US20100184134A1 - Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method - Google Patents

Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method Download PDF

Info

Publication number
US20100184134A1
US20100184134A1 US12/685,544 US68554410A US2010184134A1 US 20100184134 A1 US20100184134 A1 US 20100184134A1 US 68554410 A US68554410 A US 68554410A US 2010184134 A1 US2010184134 A1 US 2010184134A1
Authority
US
United States
Prior art keywords
trna
native
aminoacyl
amino acid
sense
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/685,544
Other languages
English (en)
Inventor
Alexei M. Voloshin
James F. Zawada
Daniel Gold
Christopher James Murray
James Edward Rozzelle
Nathan Uter
Gang Yin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sutro Biopharma Inc
Original Assignee
Sutro Biopharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sutro Biopharma Inc filed Critical Sutro Biopharma Inc
Priority to US12/685,544 priority Critical patent/US20100184134A1/en
Assigned to SUTRO BIOPHARMA, INC. reassignment SUTRO BIOPHARMA, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MURRAY, CHRIS, GOLD, DANIEL, VOLOSHIN, ALEXEI M., ROZZELLE, JAMES, UTER, NATHAN, YIN, GANG, ZAWADA, JAMES F.
Assigned to SUTRO BIOPHARMA, INC. reassignment SUTRO BIOPHARMA, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MURRAY, CHRISTOPHER JAMES, GOLD, DANIEL, VOLOSHIN, ALEXEI M., ROZZELLE, JAMES EDWARD, UTER, NATHAN, YIN, GANG, ZAWADA, JAMES F.
Publication of US20100184134A1 publication Critical patent/US20100184134A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/02—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length in solution
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

  • Protein synthesis is a fundamental biological process that underlies the development of polypeptide therapeutics, vaccines, diagnostics, and industrial enzymes.
  • rDNA recombinant DNA
  • a peptide that is potentially useful as a therapeutic agent may be quickly degraded or otherwise inactivated upon administration to a patient as a result of proteases present within the patient.
  • infectious agents such as bacteria or viruses are more likely to develop resistance against peptides that contain only naturally occurring amino acids. This occurs because enzymes that are produced by the bacteria or virus that can inactivate a peptide drug are more likely to inactivate a peptide containing naturally occurring amino acids as opposed to a peptide containing non-native amino acids.
  • Such limitations become even more apparent when compared with small organic molecule synthesis, in which any structural change can be made to influence functional properties of the compound.
  • proteins containing non-native amino acids are becoming more auspicious for therapeutic uses.
  • peptides containing non-native amino acids are extremely useful for non-therapeutic research purposes, such as uses relevant to the structural and functional probing of proteins, construction of peptide libraries for combinatorial chemistry, and proteomic studies.
  • Protein properties may include the size, acidity, nucleophilicity, hydrogen-bonding, or hydrophobicity of the protein.
  • aminoacyl-tRNA synthetase is an enzyme that catalyzes the bond of a specific amino acid to its cognate tRNA molecule.
  • each naturally occurring amino acid has one specific aminoacyl-tRNA synthetase that will aminoacylate that amino acid to its proper tRNA molecule, which is known as tRNA charging.
  • a major limitation of the abovementioned strategy is that all sites corresponding to a particular natural amino acid throughout the protein are replaced.
  • the extent of incorporation of the natural and non-native amino acid may also vary because it is difficult to completely deplete the cognate natural amino acid inside the cell.
  • Another limitation is that these strategies make it difficult to study the mutant protein in living cells because the multi-site incorporation of analogs often results in toxicity.
  • this method is applicable in general only to close structural analogs of the common amino acids, again because substitutions must be tolerated at all sites in the genome.
  • orthogonal tRNAs and corresponding orthogonal aminoacyl-tRNA synthetases that charge the orthogonal tRNA with the desired non-native amino acid has been used as a strategy to overcome previous limitations.
  • An orthogonal tRNA is a tRNA that base pairs with a codon that is not normally associated with an amino acid such as a stop codon or 4 base pair codon, etc.
  • orthogonal components do not cross-react with any of the endogenous tRNAs, aminoacyl-tRNA synthetases, amino acids, or codons in the host organism.
  • a commonly used orthogonal system for the incorporation of non-native amino acids is the amber suppressor orthogonal tRNA.
  • a suppressor tRNA is prepared that recognizes the stop codon UAG and is chemically aminoacylated with a non-native amino acid.
  • Conventional site-directed mutagenesis is used to introduce the stop codon TAG at the site of interest in the protein gene.
  • the aminoacylated suppressor tRNA and the mutant gene are combined in an in vitro transcription/translation system, the non-native amino acid is incorporated in response to the UAG codon which gives a protein containing the non-native amino acid at the specified position. See, e.g., Sayers et al., Nucleic Acids Res.
  • This invention discloses a method for introducing non-native amino acids into pre-selected positions of a protein using a cell-free synthesis system comprising the steps of 1) obtaining a nucleic acid template comprising degenerate sense codons, 2) lysing a cell population to yield a cell lysate, 3) aminoacylating a first and second isoaccepting sense tRNA in separate tRNA charging reactions, said first isoaccepting sense tRNA charged with an amino acid and said second isoaccepting sense tRNA charged with a non-native amino acid, 4) adding the first and second isoaccepting sense tRNAs charged with their respective amino acids and the nucleic acid template to the cell lysate and permitting the reaction to generate a protein bearing non-native amino acids in positions corresponding to the second sense codons of the template.
  • this invention is an in vitro method of introducing non-native amino acids into pre-selected positions of a protein using a cell-free synthesis system, the method comprising the steps of:
  • a) Obtaining a nucleic acid template comprising degenerate sense codons where a first sense codon and a second sense codon correspond to a same native amino acid but differ in their respective nucleotide sequence;
  • An endogenous native amino acid can be prevented from being incorporated into the desired polypeptide chain at positions corresponding to the first and second sense codons by depleting the native aminoacyl-tRNA synthetase that aminoacylates the endogenous native amino acid.
  • the endogenous native amino acid can also be prevented from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons by inactivating both a native first isoaccepting sense tRNA that recognizes the first sense codon and a native second isoaccepting sense tRNA that recognizes the second sense codon.
  • This may be accomplished by adding an inactivated aminoacyl-tRNA synthetase that selectively binds to the native first and second isoaccepting sense tRNAs, said inactivated synthetase having the ability to outcompete the native aminoacyl-tRNA synthetase.
  • This may also be accomplished by adding anti-sense DNA that selectively binds to the native first and second isoaccepting sense tRNAs.
  • the first and second isoaccepting sense tRNAs are inactivated by adding a specific tRNA ribonuclease or active fragments thereof that selectively cleave the native first and second isoaccepting sense tRNAs. In some embodiments, the first and second isoaccepting sense tRNAs are inactivated by adding colicin D or an active fragment of colicin D.
  • the above-described method can be performed wherein one or both of the catalytic aminoacylating agents are aminoacyl-tRNA synthetases.
  • the catalytic aminoacylating agents are aminoacyl-tRNA synthetases
  • said aminoacyl-tRNA synthetases are removed from the reaction vessel of the tRNA charging reaction prior to combining the tRNA:amino acid charged moiety and tRNA:non-native amino acid charged moiety with the cell lysate.
  • the catalytic aminoacylating agents can also be ribosomes.
  • the above-described method may use a cell population comprises bacterial cells, preferably E. coli cells.
  • the cell population may be depleted for arginine decarboxylase.
  • the cell population comprise rabbit reticulocytes.
  • the above-described method may also utilize a cell lysate that exhibits active oxidation phosphorylation during protein synthesis.
  • the cell lysate is depleted of the native aminoacyl-tRNA synthetase by genetically altering the cells prior to lysing where the alteration replaces the gene encoding the native aminoacyl-tRNA synthetase with a gene encoding an aminoacyl-tRNA synthetase fused to a capture moiety.
  • the native aminoacyl-tRNA synthetase tagged with a capture moiety may be heterologous to the host cell population.
  • the above-described method may comprise the step of capturing the native aminoacyl-tRNA synthetase fused to a capture moiety by affinity chromatography.
  • the affinity chromatography method may be immunoaffinity chromatography.
  • the capturing of the native aminoacyl-tRNA synthetase fused to a capture moiety may occur by immunoprecipitation using an antibody that recognizes the capture moiety.
  • this invention is a cell-free synthesis reaction system for introducing non-native amino acids into preselected positions of a protein comprising:
  • the above mentioned system may be used with cells derived from a bacterial population, preferably a bacterial population of E. coli cells.
  • the system is optionally practiced using E. coli cells depleted of arginine decarboxylase.
  • the system is further optionally practiced wherein the cell lysate has a functional oxidative phosphorylation system.
  • the system described herein can be used where one or both of the catalytic aminoacylating reagents are either aminoacyl-tRNA synthetase or ribozymes.
  • the invention further provides a kit for the in vitro synthesis of proteins having non-native amino acids introduced into preselected positions of the protein, the kit comprising:
  • the above mentioned kit may be used with cells derived from a bacterial population, preferably a bacterial population of E. coli cells.
  • the kit is optionally practiced using E. coli cells depleted of arginine decarboxylase.
  • the kit is further optionally practiced wherein the cell lysate has a functional oxidative phosphorylation system.
  • the kit described herein can be used where one or both of the catalystic aminoacylating reagents are either aminoacyl-tRNA synthetase or ribozymes.
  • FIG. 1 shows (a) the tRNA GAA Phe HDV ribozyme plasmid DNA template used for in vitro transcription, (b) a fragment of the DNA template detailing the orientation of the T7 promotor, tRNA GAA Phe coding sequence fused to the hepatitis delta virus (HDV) ribozyme sequence, and (c) the resulting E. coli isoaccepting tRNA GAA Phe transcript secondary structure with the anticodon sequence GAA in red, where the subscript denotes the corresponding anticodon sequence.
  • HDV hepatitis delta virus
  • FIG. 2 shows the process flow diagram illustrating the steps required to generate novel nnAA-tRNAs including (a) in vitro transcription of tRNA-HDV ribozyme DNA template (b) isolation of tRNA 2,3′-cyclic phosphate by size exclusion chromatography, (c) enzymatic hydrolysis of tRNA 2,3′-cyclic phosphate using T4 polynucleotide kinase (PNK) and, (d) aminoacylation of engineered isoaccepting tRNAs with nnAAs catalyzed by engineered amino acid tRNA synthetase (aaRS) enzymes.
  • PNK polynucleotide kinase
  • FIG. 3 shows TBE/UREA gels for protocols 1-4 used for optimization of in vitro transcription of two different engineered E. coli tRNA CUC Glu constructs. Both constructs are mutated at U34C to produce a C UC anticodon; the rightmost construct contains additional noted mutations that should theoretically increase transcription yield.
  • FIG. 4 shows TBE/UREA gels of in vitro transcription protocols 1-4 for two different engineered tRNA UUG Gln constructs from E. coli and H. pylori, respectively.
  • FIG. 5 shows (a) an illustration of the Hepatitis Delta Virus (HDV) consensus sequence used for generating 3′ homogeneous tRNA.
  • the autocatalytic ribozyme cleaves at the 3′ end of the tRNA leaving a 2′,3′-cyclic phosphate that is subsequently removed before aminoacylation.
  • FIG. 6 shows the effect of various additives on RNA stability.
  • FIG. 7 shows the time dependence of the dephosphorylation of tRNA 2′-3′-cyclic phosphate by PNK treatment as measured by (a) separation of reactant and product using acid/urea gel electrophoresis or (b) using a malachite green phosphate release assay.
  • FIG. 8 shows IMAC purification profiles of (a) E coli GluRS 6XHis and (b) H pylori GluRS2 (ND) enzymes used for charging tRNA with non-native amino acids (nnAA).
  • FIG. 9 shows (a) the dimeric structure of the homologous T. thermophilus PheRS illustrating the amino acid recognition site containing A294G and the anti-codon recognition site. (b) IMAC purification profile of cell-free produced PheRS(A294G) showing pull-down of the dimeric complex by the 6X His-tagged PheS(A294G) domain.
  • FIG. 10 shows the purification of several PheRS(A294G, A794X) variants produced by cell-free protein synthesis.
  • FIG. 11 shows percent Phe aminoacylation analysis of [ 30-32 Phe-tRNA Phe catalyzed by PheRS(A294G) for 30 min.
  • FIG. 12 shows percent para-acetyl Phe (pAF) aminoacylation analysis of pAF-tRNA Phe variants catalyzed by PheRS(A294G) under various conditions as measured by autoradiography using a end-labeled [ 32 P]-3′ tRNA.
  • FIG. 13 shows the time dependence of the formation of (a) pAF-tRNA CUA Phe and (b) pAF-tRNA AAA Phe as measured by autoradiography.
  • FIG. 14 shows that (a) E. coli GluRS can robustly aminoacylate tRNA CUC Glu with cognate glutamate as measured using a [ 32 P]-3′ tRNA end-labeling assay under optimized conditions. Mono-fluoroglutamate (F-Glu) AMP is not separated from [ 32 P]-AMP under these chromatographic conditions. (b) H. pylori GluRS2(ND) can aminoacylate H. pylori tRNA CUC Glu with Glu and F-Glu, although F-Glu AMP is not separated from AMP under these chromatographic conditions.
  • FIG. 15 shows (a) the separation of aminoacylated pAF-tRNA GAA Phe from tRNA GAA Phe using hydrophobic interaction chromatography, and (b) the chromatographic mobility of aminoacylated pAF-tRNA GAA Phe , tRNA GAA Phe , and tRNA GAA Phe 2′,3′ cyclic phosphate by acid-urea gel electrophoresis.
  • FIG. 16 shows (a) the separation of aminoacylated pAF-tRNA CUA Phe from tRNA CUA Phe and (b) pAF-tRNA AAA Phe from tRNA AAA Phe using hydrophobic interaction chromatography.
  • FIG. 17 shows that (a) Wild type E. coli tRNA Glu and (b) in vitro transcribed E coli tRNA CUC Glu can be robustly charged with mono-fluoroglutamate as determined by acid/urea gel electrophoresis.
  • FIG. 18 shows cell-free synthesis yields of GMCSF as function of the concentration of added lysine, phenylalanine, or glutamic acid to the extract.
  • FIG. 20 shows a response surface describing the relationship between added Phe amino acid and [Phe-SA] inhibitor on the rate of turboGFP cell-free synthesis
  • FIG. 21 shows a schematic diagram illustrating the salient features of dual-charging nnAA incorporation
  • FIG. 22 illustrates the salient features of the turboGFP Y50TAG amber suppressor protein used to establish incorporation of para-acetyl phenylalanine (pAF) at position 50.
  • pAF para-acetyl phenylalanine
  • FIG. 23 shows the conditions used to demonstrate dual-charging incorporation of para-acetyl phenylalanine (pAF) into turboGFP Y50TAG.
  • pAF para-acetyl phenylalanine
  • FIG. 24 illustrates how the removal or inhibition of PheRS from the cell-free extract, while adding exogenously synthesized pAF-tRNA CUA Phe and Phe-tRNA GAA Phe , can be used to site-specifically incorporate a nnAA into a protein by engineered ribosomal protein synthesis.
  • FIG. 25 is a schematic showing a cell-free protein synthesis system as described herein.
  • the native aminoacyl-tRNA synthetase is depleted following cell lysis.
  • Native aaRS refers to the native aminoacyl-tRNA synthetase.
  • tRNA 1 and tRNA 2 refer to the first and second isoaccepting sense tRNAs, respectively.
  • NAA depicts a native amino acid
  • nnAA depicts a non-native amino acid.
  • FIG. 26 is a schematic showing an example of the two tRNA charging reactions as described herein.
  • the aminoacylating reagent is an aminoacyl-tRNA synthetase
  • the first isoaccepting sense tRNA is charged with the native amino acid
  • the second isoaccepting sense tRNA is charged with a non-native amino acid.
  • aaRS refers to an aminoacyl-tRNA synthetase.
  • tRNA 1 and tRNA 2 refer to the first and second isoaccepting sense tRNAs, respectively.
  • NAA depicts a native amino acid
  • nnAA depicts a non-native amino acid.
  • This invention provides for a novel means of incorporating non-native amino acids into preselected positions of a protein using a cell-free synthesis system.
  • the methods involve the use of non-orthogonal, native isoaccepting sense tRNAs that are encoded by the genetic code. Such methods allow for numerous non-native amino acids to be incorporated through the use of sense codons without having to rely upon orthogonal tRNA-synthetase pairs.
  • Important to the present invention is the utilization of isoaccepting sense tRNAs to differentially incorporate either native or non-native amino acids into a protein even though such tRNAs are normally charged with the same amino acid in nature.
  • This invention exploits the degeneracy of the genetic code to incorporate non-native amino acids into a growing polypeptide chain based on an mRNA sense codon sequence without compromising the ability to incorporative the native amino acid into the protein.
  • a lysate is created that contains all the cellular components required for protein synthesis.
  • a nucleic acid template is then added that has sense codons specifying positions in which the non-native amino acid will be incorporated.
  • the endogenous native amino acid that is coded for by the sense codons must be prevented from being incorporated into the desired protein. Preventing incorporation of the endogenous native amino acid is accomplished either by depleting the native aminoacyl-tRNA synthetase, or by inactivating the isoaccepting tRNA molecules that function to position an amino acid within a growing polypeptide chain based on the mRNA template sequence.
  • the native aminoacyl-tRNA synthetase has the ability to charge both isoaccepting tRNAs.
  • the native aminoacyl-tRNA synthetase must be depleted from the lysate protein prior to the protein synthesis reaction to prevent uncharged isoaccepting sense tRNA molecules from being charged with the incorrect amino acid while in the lysate, if the invention is practiced by depleting a native aminoacyl-tRNA synthetase.
  • Each isoaccepting sense tRNA is separately aminoacylated in a tRNA charging reaction.
  • This aspect of the invention is referred to as “dual charging” because each isoaccepting sense tRNA is charged in a separate reaction vessel. Any method that will aminoacylate a tRNA molecule is sufficient regardless of whether an aminoacyl-tRNA synthetase is utilized for the separate charging reaction. For example, either a purified ribozyme or any functional aminoacyl-tRNA synthetase may be used to separately charge each respective isoaccepting sense tRNA molecule.
  • the first isoaccepting sense tRNA is charged with any amino acid, preferably the native amino acid.
  • the second isoaccepting sense tRNA is charged in yet another separate reaction with the desired non-native amino acid.
  • the first isoaccepting sense tRNA and second isoaccepting sense tRNA that have been charged with their respective amino acids are then purified from the charging reaction mixtures, which includes isolation from any aminoacyl-tRNA synthetases that was used in the reaction vessel.
  • the purified isoaccepting sense tRNA molecules are then added to the lysate in which the protein synthesis reaction will occur to generate a desired protein containing both native and non-native amino acids in positions specified by the different sequences recognized by isoaccepting sense tRNAs.
  • proteins containing non-native amino acids include desired changes in protein structure and/or function, which would include changing the size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity, or accessibility of protease target sites.
  • Proteins that include an non-native amino acid can have enhanced or even entirely new catalytic or physical properties such as modified toxicity, biodistribution, structural properties, spectroscopic properties, chemical and/or photochemical properties, catalytic ability, serum half-life, and the ability to react with other molecules, either covalently or non-covalently.
  • Proteins that include at least one non-native amino acid are useful for, but not limited to, novel therapeutics, diagnostics, catalytic enzymes, binding proteins, and the study of protein structure and function.
  • the cell-free non-native amino acid incorporation method of this invention is distinct from the non-native amino acid incorporation methods previously employed in the art. Most notably, this invention uses isoaccepting tRNAs that recognize sense codons, which circumvents the requirement of having to utilize orthogonal tRNAs and orthogonal aminoacyl-tRNA synthetases in order to incorporate non-native amino acids. Using orthogonal tRNAs relies on inherently inefficient suppressor tRNAs.
  • the protein synthesis reaction of this invention is practiced by obtaining a nucleic acid encoding the desired protein as described above, obtaining a cell lysate, preventing the endogenous native amino acid from being incorporated into the desired polypeptide, obtaining two isoaccepting sense tRNAs, one of which has been charged with an amino acid in a tRNA charging reaction in the first reaction vessel, and one of which has been charged with a non-native amino acid in a separate tRNA charging reaction that takes place in the second reaction vessel, and combining the nucleic acid and charged isoaccepting sense tRNAs with the cellular lysate to form a protein synthesis reaction mixture.
  • the amino acid used to charge the first isoaccepting tRNA in the first charging reaction may or may not be a native amino acid, but will not be the endogenous native amino acid produced by the host cell population used to generate the lysate.
  • the modified protein may also be referred to as the desired protein, selected protein, or target protein.
  • the modified protein refers generally to any peptide or protein having more than about 5 amino acids.
  • the modified protein comprises at least one non-native amino acid at a pre-determined site, and may contain multiple non-native amino acids. If present at two or more sites in the polypeptide, the non-native amino acids can be the same or different. Where the non-native amino acids are different, the tRNA codons for each non-native amino acids will also be different.
  • the modified protein may be homologous to, or may be exogenous, meaning that they are heterologous, i.e., foreign, to the cells from which the cell-free lysate is derived, such as a human protein, viral protein, yeast protein, etc. produced in a bacterial cell-free extract.
  • Modified proteins may include, but are not limited to, molecules such as, e.g., renin, a growth hormone, including human growth hormone; bovine growth hormone; growth hormone releasing factor; parathyroid hormone; thyroid stimulating hormone; lipoproteins; alpha-1-antitrypsin; insulin A-chain; insulin B-chain; proinsulin; follicle stimulating hormone; calcitonin; luteinizing hormone; glucagon; clotting factors such as factor VIIIC, factor IX, tissue factor, and von Willebrands factor; anti-clotting factors such as Protein C; atrial natriuretic factor; lung surfactant; a plasminogen activator, such as urokinase or human urine or tissue-type plasminogen activator (t-PA); bombesin; thrombin; hemopoietic growth factor; tumor necrosis factor-alpha and -beta; enkephalinase; RANTES (regulated on activation normally T-cell expressed and secreted);
  • aminoacylation or “aminoacylate” refers to the complete process in which a tRNA is “charged” with its correct amino acid that is a result of adding an aminoacyl group to a compound.
  • a tRNA that undergoes aminoacylation or has been aminoacylated is one that has been charged with an amino acid
  • an amino acid that undergoes aminoacylation or has been aminoacylated is one that has been charged to a tRNA molecule.
  • aminoacyl-tRNA synthetase or “tRNA synthetase” or “synthetase” or “aaRS” or “RS” refers to an enzyme that catalyzes a covalent linkage between an amino acid and a tRNA molecule. This results in a “charged” tRNA molecule, which is a tRNA molecule that has its respective amino acid attached via an ester bond.
  • Binding moiety refers to any substrate or ligand that is part of a molecular association responsible for eliminating a desired aminoacyl-tRNA synthetase from a reaction mixture.
  • ligand or substrate moieties may include, but are not limited to, antibodies, affinity supports, matrices, resins, columns, or coated beads.
  • Cell-free synthesis system refers to the in vitro synthesis of polypeptides in a reaction mix comprising biological extracts and/or defined reagents.
  • the reaction mix will comprise a template for production of the macromolecule, e.g. DNA, mRNA, etc.; monomers for the macromolecule to be synthesized, e.g. amino acids, nucleotides, etc.; and co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, uncharged tRNAs, tRNAs charged with unnatural amino acids, polymerases, transcriptional factors, etc.
  • Capture moiety refers to a tag that genetically engineered onto a protein. Such tags may include, but are not limited to a His-tag, GFP-tag, GST-tag, FLAG-tag, etc.
  • Catalytic aminoacylating reagent refers to any enzyme or molecule that has the capability to charge a tRNA molecule. Such aminoacylating reagents may refer to, but are not limited to, aminoacyl-tRNA synthetases or ribozyme columns.
  • Charged tRNA or “aminoacylated tRNA” refers to a tRNA molecule that has an amino acid bound at the amino acid attachment site. During protein synthesis, the amino acid to transferred to the growing polypeptide chain, releasing the tRNA, which is referred to as the “released tRNA.”
  • Charge reaction mixture refers to an in vitro reaction mixture in which an isoaccepting sense tRNA is charged with its respective amino acid.
  • the mixture contains only isoaccepting tRNAs with a specific codon sequence that is to be charged.
  • Methods for charging natural, non-native and/or arbitrary tRNA with natural, non-native and/or arbitrary amino acids are known in the art, and include, but are not limited to, chemical aminoacylation, biological misacylation, acylation by modified aminoacyl tRNA synthetases, ribozyme-based, and protein nucleic acid-mediated methods.
  • “Degenerate codon” refers to the degeneracy of the genetic code such that one amino acid or translation termination site may be coded for by more than one codon.
  • a codon is a three nucleotide sequence that specifies either an amino acid or translational stop sequence. Degeneracy is a result of all proteins being made up of only 20 amino acids even though 64 possible codons exist.
  • DNA refers to a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides.
  • Gene refers to a hereditary unit consisting of a sequence of DNA that has a specific chromosomal location. A gene is expressed to produce a protein product.
  • Heterologous refers to an aminoacyl-tRNA synthetase that originates from a species different from the host cell in which it is expressed.
  • Isoaccepting sense tRNA refers to different tRNA species that bind to alternate codons for the same amino acid.
  • Lysate is any cell derived preparation comprising the components required for protein synthesis machinery, wherein such cellular components are capable of expressing a nucleic acid encoding a desired protein where a majority of the biological components are present in concentrations resulting from the lysis of the cells rather than having been reconstituted.
  • a lysate may be further altered such that the lysate is supplemented with additional cellular components, e.g. amino acids, nucleic acids, enzymes, etc.
  • the lysate may also be altered such that additional cellular components are removed following lysis.
  • Native amino acid refers to one or more naturally occurring amino acids encoded by the genetic code.
  • An “endogenous native amino acid” refers to a native amino acid produced by the host cells used to generate the lysate.
  • Native aminoacyl-tRNA synthetase refers to a host cell aminoacyl-tRNA synthetase enzyme that is found in nature. Native aminoacyl-tRNA synthetases may be synthesized and added exogenously to a tRNA reaction vessel as defined by this invention. Native aminoacyl tRNA synthetases include, but are not limited to, a natural aminoacyl tRNA synthetases from one or more of plants, microorganisms, prokaryotes, eukaryotes, protozoa, bacteria, mammals, yeast, E. coli, or humans.
  • “Native isoaccepting sense tRNA” refers to either a first or second isoaccepting sense tRNA that is produced by the host population of cells used to create the lysate used for the cell-free protein synthesis reaction.
  • Non-native amino acids refer to amino acids that are not one of the twenty naturally occurring amino acids that are the building blocks for all proteins, but are nonetheless capable of being biologically engineered such that they are incorporated into proteins. Non-native amino acids may include D-peptide enantiomers or any post-translational modifications of one of the twenty naturally occurring amino acids. A wide variety of non-native amino acids can be used in the methods of the invention.
  • the non-native amino acid can be chosen based on desired characteristics of the non-native amino acid, e.g., function of the non-native amino acid, such as modifying protein biological properties including toxicity, biodistribution, or half life, structural properties, spectroscopic properties, chemical and/or photochemical properties, catalytic properties, ability to react with other molecules (either covalently or noncovalently), or the like.
  • Non-native amino acids that can be used in the methods of the invention may include, but are not limited to, an non-native analogue of a tyrosine amino acid; an non-native analog of a glutamine amino acid; an non-native analog of a phenylalanine amino acid; an non-native analog of a serine amino acid; an non-native analog of a threonine amino acid; an alkyl, aryl, acyl, azido, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynl, ether, thiol, sufonly, seleno, ester, thioacid, borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, hydroxylamine, keto, or amino substituted amino acid, or any combination thereof; an amino acid with a photoactivatable cross-
  • Polypeptide or “peptide” or “protein” refers to two or more naturally occurring amino acids, joined by one or more peptide bonds.
  • reaction vessel refers to the containment that is autonomous from the protein synthesis reaction in which the tRNA charging reaction occurs.
  • RNA molecule that is capable of catalyzing a chemical reaction. As it pertains to the current invention, a ribozyme has aminoacylating activity such that it will charge a tRNA molecule independent of an aminoacyl-tRNA synthetase.
  • RNA refers to a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides.
  • Sense codon refers to a set of three nucleotides in a protein coding sequence that specify an amino acid. As used in this invention, a sense codon does not include a termination signal or stop codon.
  • tRNA or “transfer RNA” refers to a small RNA molecule that transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation. tRNAs contain a three base codon that pairs to the corresponding mRNA codon. As a result of the degeneracy of the genetic code, an amino acid can associate with multiple tRNAs, while each type of tRNA molecule can only associate with one type of amino acid.
  • tRNA charging reaction refers to the reaction in which a synthesized native tRNA is charged with its respective amino acid separate from the protein synthesis reaction, whether said amino acid is natural or non-native.
  • tRNA:first amino acid charged moiety refers generally to an isoaccepting tRNA molecule that has been charged with an amino acid. As it pertains to this invention, “tRNA:first amino acid charged moiety” is used in conjunction, and relative to, a tRNA:non-native amino acid charged moiety.
  • tRNA:non-native amino acid charged moiety refers generally to a tRNA molecule that is an isoaccepting tRNA molecule to the isoaccepting first tRNA molecule, but which has been charged with a non-native amino acid in place of the native amino acid.
  • Transforming a cell or population of cells refers to the alteration of the gene expression of a host cell or cells from which the lysate is derived. As used in this invention, transforming a cell refers to the process in which is cell is altered such that an exogenous nucleic acid sequence is introduced that expresses a recombinant protein.
  • the template for cell-free protein synthesis can be either mRNA or DNA.
  • the template can encode for any particular gene of interest, and may encode a full-length polypeptide or a fragment of any length thereof.
  • Nucleic acids to serve as sequencing templates are optionally derived from a natural source or they can be synthetic or recombinant.
  • DNAs can be recombinant DNAs, e.g., plasmids, viruses or the like.
  • the nature of the invention uses sense codons for the incorporation of non-native amino acids, and circumvents the requirement of orthogonal components as is commonly found in the art. As a result, a preferred embodiment of the invention will use a template that is capable of translating a complete and functional protein regardless of whether non-native amino acids are chosen to be incorporated.
  • a DNA template that comprises the gene of interest will be operably linked to at least one promoter and to one or more other regulatory sequences including without limitation repressors, activators, transcription and translation enhancers, DNA-binding proteins, etc.
  • Suitable quantities of DNA template for use herein can be produced by amplifying the DNA in well known cloning vectors and hosts, or by polymerase chain reaction (PCR).
  • a preferred embodiment uses a bacterial lysate.
  • a DNA template be constructed for bacterial expression by operably linking a desired protein-encoding DNA to both a promoter sequence and a bacterial ribosome binding site (Shine-Delgarno sequence).
  • Promoters suitable for use with the DNA template in the cell-free transcription-translation methods of the invention include any DNA sequence capable of promoting transcription in vivo in the bacteria from which the bacterial extract is derived. Preferred are promoters that are capable of efficient initiation of transcription within the host cell.
  • DNA encoding the desired protein and DNA containing the desired promoter and Shine-Dalgarno (SD) sequences can be prepared by a variety of methods known in the art. Alternatively, the desired DNA sequences can be obtained from existing clones or, if none are available, by screening DNA libraries and constructing the desired DNA sequences from the library clones.
  • RNA templates encoding the protein of interest can be conveniently produced from a recombinant host cell transformed with a vector constructed to express a mRNA with a bacterial ribosome binding site (SD sequence) operably linked to the coding sequence of the desired gene such that the ribosomes in the reaction mixture are capable of binding to and translating such mRNA.
  • SD sequence bacterial ribosome binding site
  • the vector carries any promoter capable of promoting the transcription of DNA in the particular host cell used for RNA template synthesis.
  • RNA template can be conveniently isolated in a total cellular RNA fraction extracted from the host cell culture. Total cellular RNA can be isolated from the host cell culture by any method known in the art.
  • the desired RNA template can be isolated along with most of the cellular mRNA if the RNA template is designed to contain at its 3′ end a polyadenylation signal recognized by the eukaryotic host cell. Thus, the host cell will produce the RNA template with a polyadenylate (poly(A)) tail.
  • Polyadenylated mRNAs can be separated from the bulk of cellular RNA by affinity chromatography on oligodeoxythymidylate (oligo (dT))-cellulose columns using any methods known in the art. If the size of the mRNA encoding the desired protein is known, the mRNA preparation can be further purified for mRNA molecules of the particular size by agarose gel electrophoresis of the RNA.
  • the present invention utilizes a cell lysate for in vitro translation of a target protein.
  • the organism used as a source for the lysate may be referred to as the source organism or host cell.
  • Host cells may be bacteria, yeast, mammalian or plant cells, or any other type of cell capable of protein synthesis.
  • a lysate comprises components that are capable of translating messenger ribonucleic acid (mRNA) encoding a desired protein, and optionally comprises components that are capable of transcribing DNA encoding a desired protein.
  • mRNA messenger ribonucleic acid
  • Such components include, for example, DNA-directed RNA polymerase (RNA polymerase), any transcription activators that are required for initiation of transcription of DNA encoding the desired protein, transfer ribonucleic acids (tRNAs), aminoacyl-tRNA synthetases, 70S ribosomes, N 10 -formyltetrahydrofolate, formylmethionine-tRNAf Met synthetase, peptidyl transferase, initiation factors such as IF-1, IF-2, and IF-3, elongation factors such as EF-Tu, EF-Ts, and EF-G, release factors such as RF-1, RF-2, and RF-3, and the like.
  • RNA polymerase DNA-directed RNA polymerase
  • tRNAs transfer ribonucleic acids
  • aminoacyl-tRNA synthetases aminoacyl-tRNA synthetases
  • 70S ribosomes N 10 -formyltetra
  • An embodiment uses bacterial cells from which a lysate is derived.
  • a bacterial lysate derived from any strain of bacteria can be used in the methods of the invention.
  • the bacterial lysate can be obtained as follows.
  • the bacteria of choice are grown up overnight in any of a number of growth media and under growth conditions that are well known in the art and easily optimized by a practitioner for growth of the particular bacteria.
  • a natural environment for synthesis utilizes cell lysates derived from bacterial cells grown in medium containing glucose and phosphate, where the glucose is present at a concentration of at least about 0.25% (weight/volume), more usually at least about 1%; and usually not more than about 4%, more usually not more than about 2%.
  • 2YTPG medium An example of such media is 2YTPG medium, however one of skill in the art will appreciate that many culture media can be adapted for this purpose, as there are many published media suitable for the growth of bacteria such as E. coli, using both defined and undefined sources of nutrients.
  • Cells that have been harvested overnight can be lysed by suspending the cell pellet in a suitable cell suspension buffer, and disrupting the suspended cells by sonication, breaking the suspended cells in a French press, continuous flow high pressure homogenization, or any other method known in the art useful for efficient cell lysis. The cell lysate is then centrifuged or filtered to remove large DNA fragments. Methods of bacterial lysate preparation are well known in the art. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989).
  • Another embodiment uses rabbit reticulocyte cells from which to derive a lysate.
  • Reticulocyte lysate is prepared following the injection of rabbits with phenylhydrazine, which ensures reliable and consistent reticulocyte production in each lot.
  • the reticulocytes are purified to remove contaminating cells which could otherwise alter the translational properties of final lysate.
  • the cells can then be lysed by suspending the cell pellet in a suitable cell suspension buffer, and disrupting the suspended cells by sonication, breaking the suspended cells in a French press, or any other method known in the art useful for efficient cell lysis.
  • the lysate is treated with micrococcal nuclease and CaCl 2 in order to destroy endogenous mRNA and thus reduce background translation.
  • EGTA is further added to chelate the CaCl 2 thereby inactivating the nuclease.
  • Hemin may also be added to the reticulocyte lysate because it is a suppressor of an inhibitor of the initiation factor eIF2a. In the absence of hemin, protein synthesis in reticulocyte lysates ceases after a short period of incubation. See e.g., Jackson, R. and Hunt, T., Meth. In Enzymol. (1983).
  • Potassium acetate and magnesium acetate are added at a level recommended for the translation of most mRNA species.
  • a level recommended for the translation of most mRNA species For further detail on preparing rabbit reticulocyte lysate, one skilled in the art can refer to, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989).
  • An embodiment may use a plant lysate such as wheat germ lysate.
  • a plant lysate such as wheat germ lysate.
  • wheat germ lysate is prepared by grinding wheat germ in a lysate buffer, followed by centrifugation to remove cell debris. The supernatant is then separated by chromatography from endogenous amino acids and plant pigments that are inhibitory to translation. The lysate is also treated with micrococcalnuclease to destroy endogenous mRNA, to reduce background translation to a minimum.
  • the lysate contains the cellular components necessary for protein synthesis, such as tRNA, rRNA and initiation, elongation, and termination factors.
  • the lysate is further optimized by the addition of an energy generating system consisting of phosphocreatine kinase and phospocreatine, and magnesium acetate is added at a level recommended for the translation of most mRNA species.
  • an energy generating system consisting of phosphocreatine kinase and phospocreatine
  • magnesium acetate is added at a level recommended for the translation of most mRNA species.
  • Lysates are also commercially available from manufacturers such as Promega Corp.(Madison, Wis.), Stratagene (La Jolla, Calif.), Amersham (Arlington Heights, Ill.) and GIBCO (Grand Island, N.Y.).
  • the endogenous native amino acids recognized by the isoaccepting tRNAs used in the tRNA charging reactions that are produced by the host cell population must be prevented from being incorporated into the desired polypeptide. This allows the dual nature of the present invention to place native or non-native amino acids not produced by the host cell population into the first and second codon positions, respectively.
  • One skilled in the art can prevent incorporation of an endogenous native amino acid either by depleting native aminoacyl-tRNA synthetases that would function to aminoacylate the native amino acid, or by disrupting the function of the isoaccepting tRNAs.
  • the native aminoacyl-tRNA synthetase may be depleted from the cell lysate either before lysis of the host cell population, or directly from the lysate following lysis of the host cell population in order to prevent incorporation of an endogenous native amino acid.
  • the host cell population is altered such that the native aminoacyl-tRNA synthetase is replaced with an aminoacyl-tRNA synthetase fused to a tag referred to as a capture moiety.
  • the native aminoacyl-tRNA synthetase is replaced by transforming said cells with a gene wherein said gene expresses an aminoacyl-tRNA synthetase fused to a capture moiety that is capable of functionally replacing the native aminoacyl-tRNA synthetase.
  • the purpose of replacing the native aminoacyl-tRNA synthetase with a tagged aminoacyl-tRNA synthetase is to provide a simple manner in which the lysate will be cleared of an aminoacyl-tRNA synthetase capable of charging both isoaccepting sense tRNAs while retaining survival of the host cell population in the absence of the native aminoacyl-tRNA synthetase.
  • This may be accomplished by any method known in the art including, but not limited to, creating a host cell line that has a deletion for the entire DNA sequence that codes for the synthetase mRNA; deleting a portion of the DNA sequence that codes for the synthetase mRNA such that any resulting synthetase protein is rendered non-functional, where the deleted portion may include an exon, intron, promoter, or enhancer sequence; or introducing any type of exogenous intervening sequence into the coding or regulatory sequence of the endogenous aminoacyl-tRNA synthetase, such as a transposon, that functions to disrupt or completely inhibit the function of the synthetase.
  • aminoacyl-tRNA synthetase fused to a capture moiety When using an aminoacyl-tRNA synthetase fused to a capture moiety to functionally replace the native aminoacyl-tRNA synthetase prior to lysis, the aminoacyl-tRNA synthetase fused to a capture moiety itself must be depleted from the lysate following lysis in order to prevent any cross-reactivity that might aminoacylate both isoaccepting sense tRNAs with the same amino acid.
  • aminoacyl-tRNA synthetase fused to a capture moiety may be depleted from the lysate by any method known in the art that will allow a tagged protein to be removed from a lysate, which may include but is not limited to, affinity chromatography, immunoaffinity chromatography, or immunoprecipitation.
  • an aminoacyl-tRNA synthetase fused to a capture moiety is depleted from the cell lysate by affinity chromatography
  • tags known in the art.
  • a common tag e.g., is a Histidine-tag (His-tag), which has an affinity towards nickel or cobalt ions.
  • His-tag Histidine-tag
  • the tagged aminoacyl-tRNA synthetase to be depleted may be engineered into a recombinant protein that will express the desired synthetase having the His-tag exist as part of the expressed protein. If one immobilizes nickel or cobalt ions on a resin column, an affinity support that specifically binds to histidine-tagged proteins can be created.
  • the resin immobilized with either the nickel or cobalt ions is the binding moiety. Because the only protein in the lysate that will have a His-tag will be the aminoacyl-tRNA synthetase fused to the His-tag, that synthetase will be the only protein that will bind to the resin, letting all other proteins pass through the column.
  • His-tag vectors are commercially available from manufacturers such as Qiagen (Valencia, Calif.), Roche Applied Science (Rotnch, Switzerland), Biosciences Clontech (Palo Alto, Calif.), Promega (San Luis Obispo, Calif.) and Thermo Scientific (Rockford, Ill.).
  • Immunoaffinity chromatography may also be used to deplete from the lysate the aminoacyl-tRNA synthetase fused to a capture moiety.
  • Immunoaffinity chromatography is a method of affinity chromatography that is achieved by tagging the aminoacyl-tRNA synthetase with a capture moiety that is recognized by an antibody.
  • the capture moiety may be any tag that is commercially available and recognized by commercially available antibodies.
  • tags may include, but are not limited to, Green Fluorescent Protein (GFP) tag, Glutathione-S-transferase (GST) tag, and the FLAG-tag tag.
  • GFP Green Fluorescent Protein
  • GST Glutathione-S-transferase
  • FLAG-tag tag FLAG-tag
  • the aminoacyl-tRNA synthetase fused to a capture moiety may be depleted from the lysate by immunoprecipitation.
  • antibodies are raised against the capture moiety, but such systems often provide for the use of commercial antibodies raised against commercially available recombinant tags.
  • the antibody is then immobilized on a solid-phase substrate binding moiety that may include, but is not limited to, microscopic superparamagnetic or microscopicagarose beads. The beads bind to the substrate of choice, and when added to the cell lysate, the proteins that are targeted by the antibodies are bonded onto the substrate.
  • the antibodies may also be directly added to the lysate and allowed to associate with the targeted aminoacyl-tRNA synthetase to be depleted.
  • Beads coated in Protein A/G are then added to the antibody/aminoacyl-tRNA synthetase mixture, at which time the antibodies and bound synthetase will bind to the Protein A/G beads.
  • the substrate can then be removed from the lysate, for example, via magnetic fields for superparamagnetic substrates or centrifugation for microscopicagarose substrates. Immunoprecipitation methods are well known in the art. See, e.g. E. Harlow, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1988).
  • the native aminoacyl-tRNA synthetase is depleted prior to lysis and functionally replaced by transforming the host cell population with a recombinant aminoacyl-tRNA gene that produces an aminoacyl-tRNA synthetase that is thermally instable. Following cell lysis, heat can be used to denature the thermally instable aminoacyl-tRNA synthetase to prevent unwanted charging of the isoaccepting tRNA molecules within the lysate.
  • the host cell population can be replaced with a recombinant aminoacyl-tRNA synthetase gene that expresses an aminoacyl-tRNA synthetase that is unstable under ionic, physical, or chemical conditions.
  • the native aminoacyl-tRNA synthetase is depleted from the cell lysate following lysis, replacing the aminoacyl-tRNA synthetase with an aminoacyl-tRNA synthetase tagged with a capture moiety is unnecessary.
  • immunoaffinity chromatography or immunoprecipitation may be used to deplete the endogenous native aminoacyl-tRNA synthetase. This embodiment requires raising antibodies against the native aminoacyl-tRNA synthetase.
  • immunoaffinity chromatography or immunoprecipitation, as described above, may be used to deplete the lysate of the native aminoacyl-tRNA synthetase.
  • the native aminoacyl-tRNA synthetase may be functionally depleted using an aminoacyl-tRNA synthetase inhibitor that is specific to that synthetase desired to be depleted.
  • aminoacyl-tRNA synthetase inhibitors are amino acid analogs that inhibit a specific aminoacyl-tRNA synthetase, although a particular inhibitor may sometimes inhibit aminoacyl-tRNA synthetases associated with more than one amino acid.
  • Aminoacyl-tRNA synthetase specific inhibitors can also be searched in databanks such as BioInfoBank (http://ia.bioinfo.pl/). A person skilled in the art would also readily recognize that a specific inhibitor can be designed, screened, and tested, based on the available structural models of aminoacyl-tRNA synthetases.
  • aminoacyl-tRNA synthetase inhibitors include S-trityl-L-cysteine; L-asparaginamide; 4-aza-DL-leucine; DL-serine hydroxamate; proflavine (hemisulfate salt); L-isoleucinol; N-phenylglycine; L-leucinol; L-methioninol; phe-leu-amide; tyramine; L-isoleucinol; 3,4-dehydro-DL-proline; S-carbamyl-L-cysteine; a-methyl-DL-methionine; chloro-L-alanine; cis-hydroxy proline; L-prolinol; L-histidonol; L-tyrprophan hydroxamate; DL-4-thiaisoleucine; DL-amino-.epsilon.-caprolactam; L-aspartic acid amide; DL-
  • Endogenous native amino acids can further be prevented from incorporation into the desired polypeptide by inactivating native isoaccepting tRNAs.
  • Native isoaccepting tRNAs can be inactivated using either an inactivated aminoacyl-tRNA synthetase variant that that has been engineered to selectively bind to the native first and second isoaccepting sense tRNAs; or by using antisense DNA.
  • aminoacyl-tRNA synthetase variants are engineered to lack aminoacylating activity, but nonetheless outcompete the native aminoacyl-tRNA synthetases.
  • the aminoacyl-tRNA synthetase variants will be able to inactivate specific isoaccepting tRNAs by binding to said isoaccepting tRNAs without aminoacylating its target tRNA.
  • Engineered tRNA/aminoacyl-tRNA synthetase pairs and promiscuous aminoacyl-tRNA synthetases may be engineered using a variety of methods generally used for protein directed evolution.
  • Various types of mutagenesis may be used to produce novel synthetases.
  • Such types of mutagenesis may include, but are not limited to, site-directed, random point mutagenesis, homologous recombination (DNA shuffling), mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA or the like.
  • Additional suitable methods include point mis-match repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and the like.
  • the mutants are then screened using a functional assay for desired activity.
  • Mutagenesis e.g., involving chimeric constructs, can also be used.
  • Specific sites for increasing the affinity of the protein to its cognate tRNA can be identified by examining X-ray crystal structures.
  • Engineering aminoacyl-tRNA synthetases to recognize non-native amino acids has become well known in the art. See, e.g. Liu et al., Proc. Natl. Acad. Sci.
  • the lysate can be depleted of a specific isoaccepting tRNA by immobilizing the binding molecules on a column and passing the lysate through this column to recover the depleted isoaccepting tRNA lysate.
  • An embodiment of the present invention uses antisense DNA to inactivate isoaccepting tRNAs to prevent an endogenous native amino acid from incorporating into the desired polypeptide.
  • the antisense DNA recognizes the anticodon sequence of its target tRNA, hence preventing the native isoaccepting tRNA from associating with its mRNA codon sequence.
  • tRNAses can be used to inactive specific tRNAs by selectively cleaving specific tRNAs.
  • specific tRNAses include colicin D, colicin E5, and PrrC. See, e.g., Tomita et al., Proc. Natl. Acad. Sci. 97:8278-83 (2000); Morad et al., J. Biol. Chem. 268:26842-9 (1993); Ogawa et al., 283:2097-2100 (1999); de Zamarozy et al., Mol. Cell 8:159-168 (2001).
  • Active fragments of these specific t-RNA ribonucleases can be used for the present invention.
  • Specific t-RNA ribonucleases can be further engineered to inactivate a subset of their target t-RNAs, or can be altered to inactivate a different tRNA target.
  • the tRNAses may be inhibited by an inhibitor, e.g., ImmD protein (see, e.g., de Zamarozy et al.).
  • the isoaccepting sense tRNAs must be charged in order to incorporate the non-native amino acids into the desire protein.
  • the tRNA charging reaction refers to the in vitro tRNA aminoacylation reaction in which desired isoaccepting sense tRNAs are aminoacylated with their respective amino acid of interest.
  • the tRNA charging reaction comprises the charging reaction mixture, an isoaccepting sense tRNA, and as used in this invention, may include either natural or non-native amino acids.
  • the present invention is a dual charging system because the isoaccepting sense tRNA is charged with either a native or non-native amino acid in a separate tRNA charging reaction.
  • the present invention requires separate in vitro tRNA charging reactions for each respective isoaccepting sense tRNA, as different types of amino acids are desired to be added to a growing polypeptide chain at the first and second sense codons where only one native amino acid would normally be added.
  • the separate tRNA charging reaction can be any reaction that aminoacylates a sense tRNA molecule with a desired amino acid separate from the protein synthesis reaction. This reaction can take place in an extract, an artificial reaction mixture, or a combination of both.
  • tRNA aminoacylation reaction conditions are well known to those of ordinary skill in the art.
  • tRNA aminoacylation is carried out in a physiological buffer with a pH value ranging from 6.5 to 8.5, 0.5-10 mM high energy phosphate (such as ATP), 5-200 mM MgCl 2 , 20-200 mM KCl.
  • the reaction is conducted in the presence of a reducing agent (such as 0-10 mM dithiothreitol).
  • the concentration of the synthetase is typically 1-100 nM.
  • these conditions can be varied to optimize tRNA aminoacylation, such as high specificity for the pre-selected amino acids, high yields, and lowest cross-reactivity.
  • the reaction can be carried out in a temperature ranging from 4 to 40° C., or more preferably 20-37° C. Where the cell lysate is derived from a thermophilic bacteria, the reaction may be carried out in a higher temperature (e.g. 70° C.). Where a thermally unstable aminoacyl-tRNA synthetase is used, the reaction is preferably carried out in a lower temperature (e.g. 4° C.). The reaction temperature may also be varied to optimize tRNA aminoacylation.
  • isoaccepting tRNAs are charged by aminoacyl-tRNA synthetases.
  • a first isoaccepting sense tRNA would be charged with the native amino acid in one tRNA charging reaction.
  • a second isoaccepting tRNA that associates with a different codon sequence, but for the same amino acid as the codon for the first isoaccepting sense tRNA, would be charged with a non-native amino acid in a second tRNA charging reaction.
  • the second tRNA charging reaction would proceed in a separate reaction vessel as the first tRNA charging reaction. Because the first and second tRNA charging reaction occur in separate reactions, the first and second isoaccepting sense tRNAs are not required to be charged using the same aminoacyl-tRNA synthetase.
  • the tRNA charging reactions can thus utilize either the native aminoacyl-tRNA synthetase specific to the isoaccepting sense tRNAs to be charged, an engineered aminoacyl-tRNA synthetase, or a “promiscuous” aminoacyl tRNA synthetase capable of charging a tRNA molecule with more than one type of amino acid.
  • Promiscuous aminoacyl-tRNA synthetases may either themselves be engineered, or may include endogenously produced aminoacyl-tRNA synthetases that are sometimes found in nature.
  • the aminoacyl-tRNA synthetase utilized depends on the amino acid to be incorporated.
  • the charging reaction may use a native, engineered, or promiscuous aminoacyl-tRNA synthetase.
  • the charging reaction typically use either an engineered or promiscuous aminoacyl-tRNA synthetase.
  • the aminoacyl-tRNA synthetase can be engineered to aminoacylate the modified tRNA with a non-native amino acid under conditions similar to native reaction conditions. Engineering tRNA/aminoacyl-tRNA synthetase pairs is discussed above.
  • an engineered synthetases is Ala294 ⁇ Gly Phe-RS, with the Ala294 ⁇ Gly mutation at the active site of the synthetase.
  • an engineered synthetase allows the aminoacylation of a modified tRNA and/or a non-native amino acid under conditions similar to normal reaction conditions
  • a modified tRNA and/or a non-native amino acid can be charged under gently-denaturing reaction conditions, e.g., elevated pH, increased MgCl2 concentrations, the addition of detergents, DMSO, or spermidine.
  • An example of such reaction conditions includes:100 mM Hepes pH 8.1, 75 mM MgCl2, 5 mM ATP, 40 mM KCl, 1.4 M DMSO, 0.1% Triton X-100, 10-100 ⁇ M tRNAphe, 5-20 mM p-acetyl-phenylalanine, and 1-10 ⁇ M Ala294 ⁇ Gly Phe-RS.
  • a modified tRNA and/or a non-native amino acid can be charged under the gently-denaturing reaction conditions by a native aminoacyl-tRNA synthetase.
  • the isoaccepting codons are serviced by the same tRNA, with the first codon perfectly matched by the tRNA and the second codon mismatched by wobble base-paring.
  • engineered tRNA/aminoacyl-tRNA synthetase pairs useful for the charging reaction further include a system utilizing a modified tRNA derived from a native tRNA.
  • the native tRNA forms Watson-Crick base-pairing with a sense codon encoding a native amino acid, and forms wobble base-pairing with one or more wobble degenerate sense codon(s) encoding the same native amino acid.
  • the modified tRNA according to the present invention comprises a modified anticodon sequence that forms Watson-Crick base-pairing with one of the wobble degenerate sense codon(s).
  • an aminoacyl-tRNA synthetase aminoacylates the modified tRNA with a non-native amino acid.
  • the modified tRNA is charged with a non-native amino acid by an engineered aminoacyl-tRNA synthetase.
  • engineered tRNA is an engineered E. coli phenylalanine tRNA in which the anticodon GAA has been modified to an anticodon AAA (see Kwon et al., JACS 125:7512-7513, 2003).
  • An example of engineered aminoacyl-tRNA synthetase is a modified phenylalanine-tRNA synthetase, e.g., a Thr415Gly mutant.
  • non-native amino acids to be charged using the engineered tRNA/aminoacyl-tRNA synthetase pair is L-3-(2-naphthyl)alanine (Nal).
  • engineered tRNAs include an asparagine tRNA in which the anticodon GUU has been modified to an anticodon AUU (GUU ⁇ AUU); a GCA ⁇ ACA cysteine tRNA; a UUC ⁇ CUC glutamine tRNA; a GUG ⁇ AUG histidine tRNA; a UUU ⁇ CUU lysine tRNA; an CGU ⁇ AGU threonine tRNA.
  • non-native amino acids to be charged further include, e.g., fluro-glutamine and para-acetyl-phenylalanine
  • the charged isoaccepting sense tRNA must be purified in order to add it to the cell-free protein synthesis reaction.
  • This aspect of the invention requires the charged isoaccepting sense tRNA to be isolated from the aminoacyl-tRNA synthetase used in the tRNA charging reaction to ensure that the synthetases utilized for the charging reaction do not cross react with the tRNAs and/or amino acids in the protein synthesis reaction
  • Amino-acylated tRNA may be purified from unreacted tRNA and any aminoacyl-tRNA synthetase using elongation factor-Tu (Ef-Tu) from E. coli or T. thermophilis, immobilized on Sepharose 4B (GE Healthcare) see Derwnskus, Fischer, & SRocl, Anal. Biochem., 136, 161 (1984). Briefly, the immobilized protein is activated in the presence of GTP, pyruvate kinase, and phosphoenolpyruvate to generate immobilized Ef-Tu-GDP that specifically binds the amino-acylated tRNA. The column is washed in low ionic strength buffer (10 mM KCl; 50 mM HEPES; pH 7.4) and eluted in high salt buffer to yield purified amino-acylated tRNA.
  • Ef-Tu elongation factor-Tu
  • Another embodiment charges an isoaccepting sense tRNA with a non-native amino acid using a ribozyme column that is capable of transferring an aminoacyl group from the 5′-OH of the ribozyme (after being charged by an oligonucleotide donor) to the 3′-OH of the tRNA molecule.
  • Ribozymes currently employed in the art result in the ability to catalyze reactions between a broad spectrum of isoaccepting sense tRNAs and non-native amino acids, which is particularly useful for making isoaccepting sense tRNAs aminoacylated with non-native amino acids when using in vitro translation reactions.
  • Ribozymes currently known in the art further enable efficient affinity purification of the aminoacylated products, examples of suitable substrates including agarose, sepharose, and magnetic beads. Such methods bypass the requirement for aminoacyl-tRNA synthetases in order for proper isoaccepting sense tRNA charging.
  • Isoaccepting tRNAs that are aminoacylated using ribozymes can be accomplished in a variety of ways.
  • One suitable method is to elute the aminoacylated isoaccepting tRNAs for a column with a buffer such as EDTA. See, e.g., Bessho et al., Nature Biotechnology 20:723-28 (2002); Lee et al., Nat. Struct. Biol. 20:1797-806 (2001).
  • tRNA molecules to be used in the tRNA charging reaction can be synthesized from a synthetic DNA template for any tRNA of choice following amplification by PCR in the presence of appropriate 5′ and 3′ primers.
  • the resulting double-stranded DNA template, containing a T7-promoter sequence can then be transcribed in vitro using T7 RNA polymerase to produce the tRNA molecule, which is subsequently added to the tRNA charging reaction.
  • the reaction mixture will further comprise monomers for the macromolecule to be synthesized, e.g. amino acids, nucleotides, etc., and such co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, tRNA, polymerases, transcriptional factors, etc.
  • monomers for the macromolecule to be synthesized e.g. amino acids, nucleotides, etc.
  • co-factors, enzymes and other reagents that are necessary for the synthesis e.g. ribosomes, tRNA, polymerases, transcriptional factors, etc.
  • materials specifically required for protein synthesis may be added to the reaction.
  • the materials include salts, folinic acid, cyclic AMP, inhibitors for protein or nucleic acid degrading enzymes, inhibitors or regulators of protein synthesis, adjusters of oxidation/reduction potentials, non-denaturing surfactants, buffer components, spermine, spermidine, putrescine, etc.
  • Metabolic inhibitors to undesirable enzymatic activity may be added to the reaction mixture. Alternatively, enzymes or factors that are responsible for undesirable activity may be removed directly from the extract, or the gene encoding the undesirable enzyme may be inactivated or deleted from the chromosome.
  • the cell-free synthesis reaction may utilize a large scale reactor, small scale reactor, or may be multiplexed to perform a plurality of simultaneous syntheses.
  • Continuous reactions will use a feed mechanism to introduce a flow of reagents, and may isolate the end-product as part of the process.
  • Batch systems are also of interest, where additional reagents may be introduced to prolong the period of time for active synthesis.
  • a reactor may be run in any mode such as batch, extended batch, semi-batch, semi-continuous, fed-batch and continuous, and which will be selected in accordance with the application purpose.
  • RNA polymerase is added to the reaction mixture to provide enhanced transcription of the DNA template.
  • RNA polymerases suitable for use herein include any RNA polymerase that functions in the bacteria from which the bacterial extract is derived.
  • the components of the reaction mixture can be admixed together in any convenient order, but are preferably admixed in an order wherein the RNA template is added last.
  • the reaction mixture can be incubated at any temperature suitable for the transcription and/or translation reactions.
  • the reaction mixture can be agitated or unagitated during incubation.
  • the use of agitation enhances the speed and efficiency of protein synthesis by keeping the concentrations of reaction components uniform throughout and avoiding the formation of pockets with low rates of synthesis caused by the depletion of one or more key components.
  • the reaction can be allowed to continue while protein synthesis occurs at an acceptable specific or volumetric rate, or until cessation of protein synthesis, as desired.
  • the reaction can be conveniently stopped by incubating the reaction mixture on ice, or rapid dilution with water or an appropriate buffer.
  • the reaction can be maintained as long as desired by continuous feeding of the limiting and non-reusable transcription and translation components.
  • Cell-free protein synthesis can exploit the catalytic power of the cellular machinery. Obtaining maximum protein yields in vitro requires adequate substrate supply, e.g. nucleoside triphosphates and amino acids, a homeostatic environment, catalyst stability, and the removal or avoidance of inhibitory byproducts. The optimization of in vitro synthetic reactions benefits from recreating the in vivo state of a rapidly growing organism.
  • cell-free synthesis is therefore performed in a reaction where oxidative phosphorylation is activated, i.e. the CYTOMIMTM system.
  • the CYTOMIMTM system is defined by using a reaction condition in the absence of polyethylene glycol with optimized magnesium concentration.
  • the CYTOMIMTM system does not accumulate phosphate, which is known to inhibit protein synthesis, whereas conventional secondary energy sources result in phosphate accumulation.
  • the concentration of magnesium in the reaction mixture affects the overall synthesis. There is often magnesium present in the cell lysate, which may then be adjusted with additional magnesium to optimize the concentration.
  • the CYTOMIMTM system utilizes a preferred concentration of magnesium at least about 5 mM, usually at least about 10 mM, and preferably at least about 12 mM, and at a concentration of not more than about 20 mM, and usually not more than about 15 mM.
  • Other changes that may enhance synthesis with respect to the CYTOMIMTM system is the removal of HEPES buffer and phosphoenol pyruvate from the reaction mixture.
  • the CYTOMIMTM system is described in U.S. Pat. No. 7,338,789, herein incorporated by reference.
  • cell-free synthesis is performed in a reaction where the redox conditions in the reaction mixture is optimized.
  • This may include adding a redox buffer to the reaction mix in order to maintain the appropriate oxidizing environment for the formation of proper disulfide bonds, e.g. by the inclusion of glutathione at an appropriate ratio of oxidized to reduced forms.
  • the reaction mixture may further be modified to decrease the activity of endogenous molecules that have reducing activity.
  • such molecules can be chemically inactivated prior to cell-free protein synthesis, e.g. by treatment of the lysate with iodoacetamide (IAM), or other compounds that irreversibly inactivate free sulfhydryl groups.
  • IAM iodoacetamide
  • cell-free synthesis is performed in a reaction where the optimal amino acid concentration is maintained by inhibiting enzymes that act to undesirably metabolize specific amino acids
  • Inhibition of enzymes that catalyze the metabolism of amino acids can be achieved by addition of inhibitory compounds to the reaction mix, modification of the reaction mixture to decrease or eliminate the responsible enzyme activities, or a combination of both.
  • a preferred embodiment eliminates arginine decarboxylase.
  • Other such inhibitory compounds to be eliminated from the protein synthesis reaction mixture may include, but are not limited to, tryptophanase, alanine glutamate transaminase, or pyruvate oxidase. Eliminating enzymatic activity in order to optimize amino acid metabolism during cell-free protein synthesis is described in U.S. Pat. No. 6,994,986, herein incorporated by reference.
  • synthesized proteins containing non-native amino acids can be purified as in standard in the art.
  • Proteins of the invention can be recovered and purified by methods including, but not limited to, ammonium sulfate or ethanol precipitation, acid or base extraction, column chromatography, affinity column chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, lectin chromatography, gel electrophoresis, etc.
  • Newly synthesized proteins containing non-native amino acids must be correctly folded. Proper folding may be accomplished using high performance liquid chromatography (HPLC), affinity chromatography, or other suitable methods where high purity is desired.
  • proteins containing non-native amino acids can possess a conformation different from the desired conformations of the relevant polypeptides.
  • guanidine, urea, DTT, DTE, and/or a chaperone can be added to a translation product of interest.
  • the methods of the present invention provide for modified proteins containing non-native amino acids that have biological activity comparable to the native protein.
  • the specific activity as thus defined will be at least about 5% that of the native protein, usually at least about 10% that of the native protein, and may be about 25%, about 50%, about 90% or greater. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1989).
  • the desired protein containing the non-native amino acids may be optionally used e.g., as assay components, therapeutic reagents, or as immunogens for antibody production.
  • An embodiment of the current invention provides a cell-free synthesis reaction system.
  • the reaction system comprises a first and second catalytic aminoacylating reagent reaction vessel that comprises a charging mixture of reagents that are able to aminoacylate each respective isoaccepting sense tRNA with its respective corresponding amino acid, such that different isoaccepting sense tRNAs are differentially charged with either a native or non-native amino acid as desired.
  • the reaction system further has a reaction vessel that contains a cell lysate containing a mixture of reagents able to carry out a cell-free protein synthesis, in which the vessels described in the system have openings that permit the combining of the two charging mixtures and cell lysate into a single reaction mixture.
  • An embodiment of the current invention provides a kit for the in vitro synthesis of proteins having non-native amino acids introduced into preselected positions of the protein.
  • the kit contains the reaction vessels with the appropriate reagents required for aminoacylating the isoaccepting sense tRNAs.
  • the kit further has a reaction vessel that contains a cell lysate containing a mixture of regents able to carry out in vitro synthesis of proteins from a nucleic acids template.
  • One embodiment utilizes aminoacyl-tRNA synthetases as the catalytic aminoacylating reagent.
  • Another embodiment utilizes a ribozyme as the catalytic aminoacylating reagent.
  • One embodiment contains a cell lysate derived from a bacterial population.
  • Another embodiment contains a cell lysate derived from an E. coli population.
  • Another embodiment provides a cell lysate that has a function oxidative phophorylation system.
  • Standard methods in molecular biology are described (Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Sambrook and Russell (2001) Molecular Cloning, 3yd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Wu (1993) Recombinant DNA, Vol. 217, Academic Press, San Diego, Calif.). Standard methods also appear in Bindereif, Schön, & Westhof (2005) Handbook of RNA Biochemistry, Wiley-VCH, Weinheim, Germany which describes detailed methods for RNA manipulation and analysis.
  • Isoaccepting tRNAs aminoacylated with non-native amino acids can be produced from a designed tRNA-HDV ribozyme template DNA, illustrated by example in FIG. 1 , by in vitro transcription, followed by purification by size exclusion chromatography (SEC), enzymatic removal of the 2′,3′-cyclic phosphate, and charging of the tRNA with non-native amino acids (nnAAs) using engineered tRNA synthetase enzymes, as illustrated in FIG. 2 .
  • SEC size exclusion chromatography
  • nAAs non-native amino acids
  • Transcription optimization was generally carried out for 2-3 h at 37° C. in 50 ⁇ L reactions. Reaction conditions were as follows: (1) 40 mM HEPES (pH 7.9), 10 mM DTT, 10 mM MgCl 2 , 2.5 mM spermidine, 4 U/ml pyrophosphatase, 0.4 U/ml supeRNAse-in (Ambion), 20 mM NaCl, 4 mM NTP, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA template.
  • Reaction conditions were as follows: (1) 40 mM HEPES (pH 7.9), 10 mM DTT, 10 mM MgCl 2 , 2.5 mM spermidine, 4 U/ml pyrophosphatase, 0.4 U/ml supeRNAse-in (Ambion), 20 mM NaCl, 4 mM NTP, 0.024 mg/ml
  • tRNA AAA Phe or tRNA CUA Glu construct 1 100 mL transcriptions were set up in certified RNAse free 50 ml conical tubes.
  • large scale reactions for tRNA CUA Glu construct 1 contained 0.4 U/ ⁇ L pyrophosphatase and 0.04 U/ ⁇ L superRNAse-in were used. Transcription reactions were incubated for 2 hours at 37° C., supplemented with another 0.024 mg/ml T7 RNA polymerase and incubated for 2 more hours at 37° C., then filtered through 0.20 ⁇ m PES filters (VWR catalog #87006-062).
  • RNA-2,3′ cyclic phosphate from precursor RNA transcripts and cleaved HDV ribozyme RNA ( FIG. 5 ).
  • 25 mL fractions were collected and tRNA peak fractions were determined by TBE/UREA PAGE gel electrophoresis.
  • tRNA-2,3′ cyclic diphosphate was precipitated by adding 1/10 volume 3 M sodium acetate (pH 5.2) and an equal volume of isopropanol, followed by incubation for 30 minutes at ⁇ 80° C., and pelleting tRNA by centrifugation (20,000 ⁇ g for 30 min in a FiberLite F-13 rotor). Pellets were washed with 70% ethanol, air dried briefly, then resuspended in 1 mM sodium citrate buffer (pH 6.4).
  • H. pylori tRNA UUG Gln (2 ml) was carried out using Protocol 1. tRNA purification was performed with a 26/60 Sephacryl S-200 size exclusion column ( FIGS. 2 a and 2 b ). EDTA was omitted from the sizing column buffer. H. pylori tRNAGln was resuspended in 50 mM Tris (pH 8.5).
  • T4 polynucleotide kinase required for the removal of the 2′-3′ cyclic phosphate from tRNA cleaved by HDV ribozyme (cf. FIGS. 2 & 5 ), was produced as follows
  • the PNK gene with an N-terminal 6-Histidine tag was gene synthesized (DNA 2.0, Menlo Park., Calif.), and cloned into plasmid pYD317.
  • the plasmid T4PNK_pYD317 was used to transform BL21(DE3) cells. These cells were grown in a Braun 10 L fermenter on autoinduction media (Studier F. W. (2005) Protein Expr.
  • PNK-containing fractions were immediately diluted 4 ⁇ with Buffer A containing 20% glycerol.
  • PNK-containing fractions were pooled and buffer exchanged into PNK storage buffer (20 mM Tris (pH 7.6), 100 mM KCl, 0.2 mM EDTA, 2 mM DTT, 50% glycerol) at a final concentration of 1.2 mg/mL.
  • tRNA-2′,3′-cyclic phosphate (40 ⁇ M) was incubated at 37° C. with 50 ⁇ g/ml PNK in 50 mM MES (pH 5.5), 10 mM MgCl 2 , 300 mM NaCl, and 0.1 mM EDTA for 1 hr leaving 2′,3′-OH groups at the 3′ terminus of the tRNA, followed by phenol:chloroform:isoamylalcohol extraction and buffer exchanged using a PD10 (GE health sciences) size exclusion column pre-equilibrated in 0.3 M sodium acetate (pH 5.2) to remove inorganic phosphate and excess phenol.
  • PD10 GE health sciences
  • tRNA was precipitated by addition of an equal volume isopropanol, incubation at ⁇ 80° C. for 30 min, centrifuged for 30 min at 20,000 ⁇ g, washed with 70% ethanol, centrifuged for 10 min at 20,000 ⁇ g, air dried and resuspended in 0.1 mM sodium citrate (pH 6.4).
  • tRNA was refolded by heating to 70° C., addition of 10 mM MgCl 2 , and then slowly cooled to room temperature.
  • tRNA concentration was 8.6 ⁇ M; in PNK reactions, PNK concentration was 0.020 mg/ml, EDTA was omitted, and 1 mM ⁇ -mercaptoethanol was added.
  • the tRNA was resuspended in DEPC treated sterile water after purification.
  • FIG. 7 shows that dephosphorylated tRNA has a reduced mobility in acid/urea gel electrophoresis (Bindereif, Schon, & Westhof (2005)).
  • the separate tRNA aminoacylation (charging) reactions illustrated by the last step in FIG. 2 require the use of an engineered aminoacyl-tRNA synthetase to aminoacylate isoaccepting tRNA molecules.
  • This synthetase can be obtained by expressing a recombinant engineered synthetase as described in the examples below.
  • E. coli glutamyl-tRNA synthetase was cloned, expressed and purified by IMAC chromatography.
  • the E. coli GluRS expression construct was transformed into BL21(DE3) cells. Colonies were inoculated into 2 ml LB broth supplemented with 100 ⁇ g/ml ampicillin (LB-AMP) and grown to saturation at 37° C. This culture was diluted into 100 ml LB-AMP and grown to saturation at 37° C. This entire culture was used to inoculate 10 L of autoinduction media (Studier (2005), Protein Expr Purif.; 41,207-34) supplemented with 100 ⁇ g/mlAmpicillin in a Bioflo 3000 fermentor.
  • This culture was grown for 18 hours at 37° C. until it reached an OD of ⁇ 12.
  • Cells were harvested in Sharples centrifuge and frozen at ⁇ 80° C.
  • 30 g of cell pellet was resuspend in 500 ml of GluRS Lysis Buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole, 10% glycerol) and lysed by passage through an Avestin C55A homogenizer. Lysate was clarified by centrifugation in a JA-17 (Beckman) rotor at 40,000 ⁇ g for 30 min.
  • GluRS Lysis Buffer 50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole, 10% glycerol
  • the supernatant was passed over a 30 ml Ni 2+ Sepharose 6 Fast Flow (GE Healthcare) column equilibrated in GluRS lysis buffer.
  • the column was then washed with 15 column volumes of GluRS Wash Buffer (50 mM sodium phosphate pH 8.0; 300 mM sodium chloride; 20 mM imidazole; 10% glycerol), and eluted with 5 column volumes of GluRS Elution Buffer (50 mM sodium phosphate pH 8.0; 300 mM sodium chloride; 300 mM imidazole; 10% glycerol) as illustrated in FIG. 8 a .
  • Peak fractions were pooled, dialyzed twice into 2 L of 2 ⁇ GluRS Storage Buffer (100 mM HEPES, pH 8.0; 40 mM sodium chloride; 1 mM dithiothreitol (DTT); 0.2 mM EDTA), and diluted 2-fold with 100% glycerol. Recovery was ⁇ 945 mg GluRS from 30 g of cell pellet. Protein was stored at ⁇ 80° C. for extended periods of time and ⁇ 20° C. once thawed.
  • 2 ⁇ GluRS Storage Buffer 100 mM HEPES, pH 8.0; 40 mM sodium chloride; 1 mM dithiothreitol (DTT); 0.2 mM EDTA
  • H. pylori GluRS2 (also termed a non-discriminating (ND) synthetase) was cloned, expressed, and purified by IMAC as follows.
  • the H. pylori GluRS2 (ND) expression construct was transformed into BL21 (DE3) cells and plated on two LB-AMP plates at 37° C. The next morning 10 ml LB was added to the plates and they were then scrapped with a sterile pipet to resuspend all colonies. The resuspension was added to 2 L of LB-AMP and grown at 37° C. In keeping with previous work (Skouloubris, Ribas de Pouplana et al.
  • lysis buffer (20 mM Tris, pH 8.5; 300 mM NaCl; 10% glycerol; 10 mM imidazole) supplemented with 250 ⁇ L bacterial protease inhibitor cocktail (Sigma).
  • Cells were lysed by addition of lysozyme (to 1 mg/ml) and passage 10 ⁇ through a 22 gauge blunt needle. Total lysate was clarified by centrifugation at 35,000 ⁇ g for 30 min. Lysate was diluted 3 ⁇ in lysis buffer then bound in batch mode for 10 minutes to 1 ml of IMAC High Performance Sepharose charged with NiSO 4 and equilibrated in lysis buffer.
  • GluRS2 (ND) Storage Buffer (20 mM Tris, pH 8.5; 300 mM NaCl; 10% glycerol; 0.5 mM DTT; 0.1 mM EDTA). Protein was stored in small aliquots at ⁇ 80° C. ⁇ 0.6 mg of GluRS2(ND) was recovered from the purification.
  • E. coli phenylalanyl-tRNA synthetase is an obligate dimer consisting of two subunits, PheS and PheT, as illustrated in FIG. 9 a for the homologous enzyme from T. thermophilis.
  • the mutation A294G was introduced in the E. coli PheS in order to increase the percent charging of non-native para-substituted phenylalanine analogs (Datta, Wang et al.
  • the PheT gene was amplified from E. coli genomic DNA using primers containing NdeI and XhoI restriction sites. The PCR fragment was subcloned into pET24(b), and expressed using the identical autoinduction media as PheS(A294G). In contrast to PheS(A294G), the expressed PheT subunit was soluble.
  • Cells were lysed in Ni affinity purification load buffer: 50 mM NaPO4 buffer (pH 7.5), 300 mM NaCl, and 5 mM imidazole. The lysate was clarified, and then PheS(A294G) in 2 M guanidine-HCl was added slowly with stirring. Refolded PheRS was isolated by Ni affinity chromatography followed by size exclusion chromatography using an S100 size exclusion resin.
  • PheRS(A294G) and variants in the anticodon recognition site of the PheT domain were produced by cell-free synthesis from independent PheS and PheT genes cloned into pYD317 as summarized in Table 1:
  • the 3′ terminal adenosine nucleotide of tRNAs was exchanged with ⁇ - 32 P-AMP using E. coli CCA nucleotidyl transferase enzyme as described (Ledoux & Uhlenbeck (2008), Methods, 44, 74-80). Reaction conditions are driven toward removal of the 3′-AMP using excess PPi, and then toward addition of AMP using PPiase. Active tRNA was incubated with CCA enzyme in 50 mM Glycine pH 9.0, 10 mM MgCl 2 , 0.3 ⁇ M ⁇ - 32 P-ATP, 0.05 mM PPi for 5 min at 37° C.
  • Aminoacylation of nnAAs onto tRNA Phe was performed using optimized conditions.
  • the conditions for wild-type tRNA GAA Phe aminoacylation were 50 mM Hepes pH 7.5, 40 mM KCl, 10 mM MgCl 2 , 5 mM ATP, 8-40 ⁇ M tRNA GAA Phe , 10 mM DTT, 10-100 mM amino acid (Phe or para-acetyl Phenylalanine (pAF)), and 1-100 ⁇ M PheRS or PheRS A294G.
  • End labeled tRNA reactions are digested with P1 nuclease for 20-60 min at room temperature and 1 ⁇ l is spotted on a pre-washed (water) PEI cellulose TLC plate and allowed to air dry.
  • AMP is resolved from aa-AMP in acetic acid/1M NH 4 Cl/ddH 2 O (5:10:85) as monitored by autoradiography using a Molecular Dynamics storage phosphor screen with a Storm 840 Phosphoimager ( FIGS. 11 and 12 ).
  • Peterson and Uhlenbeck Pierson and Uhlenbeck (Peterson and Uhlenbeck (1992) Biochemistry, 31, 10380-9) have shown that under limiting [ tRNA CUA Phe ], charging by phenylalanine is very inefficient.
  • FIG. 13 shows that pAF is efficiently charged to form pAF-tRNA CUA Phe and pAF-tRNA AAA Phe under the conditions of this reaction.
  • mutant tRNA CUC Glu could be charged with cognate glutamate to 75% even with normal buffer conditions ( FIG. 14 a , lane 2).
  • pH pH 8.
  • Mg 2+ concentrations 70 mM charging
  • Tween-20 dimethyl sulfoxide
  • FIG. 14 a , lane 4 Fluoro substituted glutamate charging onto wild type tRNA Glu could not be detected under the conditions of this assay ( FIG. 14 a , lane 5), due to the poor separation of fluoro substituted glutamate-AMP and AMP in the thin layer chromatography (Hartman, Josephson et al. (2007) PLoS ONE, 2, e972).
  • Non-radiolabledtRNA GAA Phe tRNA CUA Phe , and tRNA AAA Phe were aminoacylated in 50 mM Hepes pH 7.5, 40 mM KCl, 10 mM MgCl 2 , 5 mM ATP, 8-40 ⁇ M tRNA GAA Phe , 10 mM DTT, 10-100 mM amino acid (Phe or pAF), and 1-100 ⁇ M PheRS or PheRS A294G.
  • tRNA CUA Phe and tRNA AAA Phe aminoacylation were 50 mM Hepes pH 8.1, 40 mM KCl, 75 mM MgCl 2 , 5 mM ATP, 0.1% Triton X-100,1.4 M DMSO, 8-40 ⁇ M tRNA AAA Phe or tRNA CUA Phe , 10 mM DTT, 10-100 mM pAF , and 1-100 ⁇ M PheRS or PheRS A294G. Reactions are incubated at 37° C. for 15 min and quenched with 2.5 volumes of 300 mM sodium acetate pH 5.5.
  • the quenched sample was extracted with 25:24:1 phenol:chloroform:isoamyl alcohol pH 5.2 (Ambion), vortexed for 2 min, then centrifuged at 14,000 ⁇ g for 10-30 min at 4° C. to separate the aqueous (tRNA) and organic phases (protein).
  • the aqueous phase (containing charged tRNA) was removed and added to a pre-equilibrated (300 mM NaOAc) G25 sephadex resin size exclusion column that separates based on the size of the molecule.
  • the eluant was mixed with 2.5 volumes of 100% ethanol and incubated at ⁇ 80° C. for 15-30 minutes and centrifuged at ⁇ 14,000 ⁇ g for 30-45 minutes.
  • the pelleted aminoacylated tRNA is stored at ⁇ 80° C. or resuspended in a slightly acidic buffer for injection into the HPLC and/or use in cell-free synthesis reactions.
  • tRNA CAC Gln charged using E. coli GluRS to aminoacylate with mono-fluoroglutamate or pAF-tRNA CAC Phe and tRNA GAA Phe ( FIG. 15 ) were separated using acid/urea polyacrylamide 40 cm ⁇ 34 cm gel electrophoresis.
  • tRNA CAC Glu reaction conditions were: 12.5 ⁇ L reactions, 37° C. incubation for 30 minutes in 50 mM HEPES, pH 8.1; 70 mM MgCl 2 ; 10 mM DTT; 10 mM ATP; 10 mM amino acid, pH 8.1; 16.6 U/ml pyrophosphatase.
  • Cell-free extracts or lysates were generated to maximize ribosome yield using rapid growth of high cell density fermentations of E. coli strain KGK10 (Knapp, Goerke et al. (2007) Biotechnol Bioeng, 97, 901-8), essentially as described by Liu et al.(Liu, Zawada et al. (2005) Biotechnol Prog, 21, 460-5) DL-dithiothreitol was not added to the cell lysate following homogenization. A modified “run-off procedure” was used to prepare the cell-free extract. Fermentation volume to generate sufficient cell-free extract was typically 2.5 ⁇ the desired cell-free reaction volume.
  • IAM iodoacetamide
  • the redox potential was manipulated by the addition of reduced (GSH) and oxidized (GSSG) glutathione to a total concentration of ⁇ 5 mM.
  • FIG. 18 illustrates how the concentration of added amino acids, Lys and Phe, but not Glu, may be manipulated in the cell-free reaction to affect protein synthesis.
  • the genomic copy of glutamate-tRNA synthetase (gltX) was tagged with a C-terminal FLAG-tag in order to remove the synthetase activity using FLAG-tag affinity chromatography while maintaining the enzyme activity for preparation of the cell-extract prepared from E. coli KGK10.
  • Gene insertion was carried out using Quick &Easy E.coli Gene Deletion Kit (Cat. No. K006) from GENE BRIDGES (Heidelberg, Germany) according to the protocol suggested by the manufacturer.
  • a 708-FLPecm R expression plasmid (A105, GENE BRIDGES) was used to eliminate the selection marker from E. coli chromosome.
  • DNA insertion cassette was amplified by PCR extension using AccuPrime pfx SuperMix (Invitrogen) according to the protocol suggested by the manufacturer.
  • DNA template was FTR-PGK-gb2-neo-FRT template DNA from Quick &Easy E.coli Gene Deletion Kit. Primers included:
  • PCR fragments were purified with QIAGEN DNA purification kit before transforming E. coli KGK10 by electroporation.
  • the DNA fragment including 3′ end and downstream of gltX was amplified from chromosome DNA of KGK10 ⁇ gltX::gltX-Flag using primers 5′GTTCAACACCGACAAGCTGCTGTGGCTG3′ and 5′ GCGGGAAGGGATTATCGGATTGTTACAACGC3′.
  • Flag-tag encoding sequence was confirmed by using a primer, 5′GATTACTGACTGGACCGCTG3′.
  • primers were designed for PCR amplification the DNA fragment containing the Flag-tag encoding sequence at 3′end of gltX.
  • the Flag-tag sequence DYKDDDDK was connected to the C-terminus of glutamate-tRNA synthetase through a dipeptide GG.
  • the tag peptide sequence was back translated to DNA sequence, 5′GGGTGGCGACTACAAAGATGACGATGACAAA3′.
  • a stop codon TAA was added just behind the FLAG-tag encoding sequence.
  • the forward primer included a 50 Nt homology sequence that encoded the C-terminus of glutamate—tRNA synthetase (GluRS) at 5′end, the Flag-tag sequence in the middle, and the amplifying sequence AATTAACCCTCACTAAAGGGCGG at the 3′end.
  • the backward primer was designed by connecting the amplifying sequence TAATACGACTCACTATAGGGCTCG to a 50 Nt homology sequence which is located downstream of gltX gene.
  • the linear fragment for FLAG-tag sequence insertion was amplified and transformed into KGK10 to replace a 441 by sequence downstream of gltX.
  • Flag-tag insertion mutants were selected by kanamycin resistance marker which was inserted to the genomic DNA of KGK10. Then, the kanamycin resistance marker for selection was eliminated using 708-FLPecm R expression plasmid .
  • the FLAG-tag encoding sequence was confirmed by sequencing the PCR fragment which was amplified from the mutant KGK10 ⁇ gltX::gltX-Flag.
  • FIG. 19 illustrates how the reactivity of added isoaccepting charged nnAA-tRNAs added to the cell-free reaction can be modulated using active site directed inhibitors to limit the background recharging of the added isoaccepting tRNA.
  • the 5′-O-[N-(aminoacyl)sulfamoyl] adenosine inhibitor Phe-SA ( FIG. 19 b ) was synthesized as follows: to a solution of alcohol (7 g, 17.03 mmol, 1.0 eq) in DMAC (70 mL) at 0° C. was added DIEA (10.62 mL, 59.61 mmol, 4.0 eq) and sulfamoyl chloride (4 eq) and the reaction mixture was stirred at room temperature for 15 h. The reaction mixture was diluted with ethyl acetate (300 mL) and washed with water (4 ⁇ 50 mL).
  • the reaction mixture was diluted with ethyl acetate (450 mL), washed with saturated aqueous NaHCO 3 , water, brine, dried over MgSO 4 , and evaporated.
  • the crude product was dissolved in MeOH/n-butylamine (30mL/30mL) and stirred at room temperature for 3 h. The solvents were evaporated and the crude product was purified by flash chromatography (EtOAc to 10% MeOH/EtOAc) to give the Phe-SA inhibitor (0.90 g, 1.4 mmol, 35% yield)
  • FIG. 19 c The effects of 5′-O-[N-(aminoacyl)sulfamoyl] adenosine inhibitors (Phe-SA and Glu-SA) in cell-free synthesis of a GFP reporter protein, turboGFP are illustrated in FIG. 19 c .
  • these inhibitors are competitively specific to their respective aminoacyl tRNA synthetases (PheRS and GluRS), as turboGFP fluorescence activity in the presence of 1 nM Phe-SA inhibitor ( ⁇ 50% activity) can be completely restored with the addition of >10 ⁇ M PheRS(A294G) as shown in FIG. 20 .
  • Surface response analysis of GFP activity as a function of varying both [Phe-SA] and added L-phenylalanine is consistent with the competitive and specific nature of the Phe-SA inhibition.
  • FIG. 21 illustrates the features required for efficient dual-charging of isoaccepting tRNAs that requires removal (or inhibition) of a native, endogenous tRNA synthetase, followed by the addition of specific isoaccepting engineered charged tRNAs for efficient incorporation of nnAAs into proteins.
  • the potential recharging of exogenously introduced tRNAs can be overcome if the synthetase(s) responsible for regenerating the aminoacyl-tRNA moiety are removed (cf example 8) or inhibited (cf example 9).
  • nnAAs non-native amino acids
  • FIG. 23 shows that the reference pYD317-turboGFP plasmid yields a strong fluorescent signal after 5 h of synthesis.
  • a control reaction containing turboGFP Y50TAG plasmid only yields no fluorescence, consistent with the ca. 6 kD truncated product (cf FIG. 22 ).
  • the present invention requires the use of a nucleic acid template for the cell-free protein synthesis reaction.
  • the following provides an example of generating a template having codon sequences constructed based on placement of non-native amino acids within the desired polypeptide.
  • hGMCSF human granulocyte macrophage colony stimulating factor
  • RCSB Research Collaboratory for Structural Bioinformatics
  • PDB protein data bank
  • a structural DNA gene encoding hGMCSF protein is synthesized de novo (DNA 2.0, Menlo Park, Calif.) such that all, but the second, glutamine amino-acid residues are encoded by the first codon CAA.
  • the second glutamine from the N-terminus of the protein is encoded by the codon CAG.
  • the gene is flanked by the T7 promoter and terminator and is inserted into a plasmid vector containing an E. coli origin of replication and kanamycin resistance gene.
  • the circular plasmid DNA template is prepared by transforming XL1Blue (Stratagene, La Jolla, Calif.) strain of E. coli, growing up the culture at 37° C. overnight and purifying DNA using a purification kit (Qiagen, Valencia, Calif.).
  • a lysate must be generated that will be useful for expressing proteins containing non-native amino acids.
  • This example demonstrates the generation of a lysate from E. coli that is modified such that a native aminoacyl-tRNA synthetase is expressed with a 6Xhis-tag useful for depleting said synthetase as described in subsequent examples.
  • E. coli A19 ⁇ endA ⁇ tonA ⁇ speA ⁇ tnaA ⁇ sdaA ⁇ sdaB ⁇ gshA ⁇ gorTrxBHAmet + is first modified such that a DNA fragment encoding 6Xhis-tag is appended to the native Gln-RS at the C-terminal end in the E. coli chromosome.
  • E. coli cells are then grown in a 10 L Braun Biostat C fermentor.
  • the cells are grown on 2YPTG media in batch mode with pH control at pH 7.0.
  • the cells are harvested at 3.2 OD (595) at growth rate of >0.7 per hour.
  • Cells are separated from the media by centrifugation at 6000 g, 4° C. for 25 min and the resulting cell paste is stored at ⁇ 80° C.
  • the cell paste is thawed at 4° C. in S30 buffer (10mM TRIS-acetate pH 8.2 (Sigma-Aldrich Corp. St.
  • the present invention requires inactivation of an endogenous aminoacyl-tRNA synthetase.
  • the purpose of this inactivation is to prevent uncharged isoaccepting tRNAs that would normally have been charged with a non-native amino acids from being mis-aminoacylated with native amino acids.
  • Endogenous tRNA synthetase expression can be reduced by inactivating or “knocking out” tRNA synthetase nucleic acid sequence(s) or their promoters using targeted homologous recombination of genomic DNA (e.g., see Smithies et al., Nature 317: 230-234 (1985); Thomas and Capecchi, Cell 51: 503-512 (1987); Zhang et al., Nature Biotech 18:1314-1318 (2000)).
  • a mutant, non-functional tRNA synthetase flanked by DNA homologous to the endogenous tRNA synthetase (either the coding regions or regulatory regions of seryl tRNA synthetase) can be used, with or without a selectable marker and/or a negative selectable marker, to transform cells that express the endogenous tRNA synthetase. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the tRNA synthetase.
  • Targeted homologous recombination can be used to insert a DNA construct comprising a mutant tagged tRNA synthetase in the cell, as described above.
  • targeted homologous recombination can be used to insert a DNA construct comprising a nucleic acid that encodes a tRNA synthetase polypeptide variant that differs from that present in the cell.
  • endogenous tRNA synthetase expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of a tRNA synthetase gene (i.e. promoter and/or enhancers) to form triple helical structures that prevent transcription of the tRNA synthetase in target cells.
  • deoxyribonucleotide sequences complementary to the regulatory region of a tRNA synthetase gene i.e. promoter and/or enhancers
  • the endogenous aminoacyl-tRNA synthetase in the E. coli extract above may be deactivated by addition of micromolar concentration of 5 ⁇ -O-[N-(Phenyalanylacyl)sulfamoyl] adenosine during the pretreatment with iodoacetamide, prior to addition of the template DNA as described above.
  • a volume of the appropriately engineered S30 extract is incubated with varying volumes of pre-equilibrated Ni-NTA magnetic beads (20 mM Tris-HCl, 0.1 M NaCl at pH 7.5) before use for 30 min at 4° C. After removing the beads with the help of a magnetic separator, the remaining extract is used for protein synthesis.
  • the separate tRNA charging reactions require the use of an aminoacyl-tRNA synthetase to aminoacylate isoaccepting tRNA molecules.
  • This synthetase can be obtained by expressing a recombinant synthetase as described in this example.
  • E. coli gln-tRNA synthetase The structural gene for E. coli gln-tRNA synthetase is PCR-amplified from E coli genomic DNA (ATCC #10798D-5) using the forward and reverse primers as shown in Table 2. PCR products are then cloned into pET23b vector (Novagen, Gibbstown, N.J.) after a double digestion with NdeI and HindIII to generate plasmids, pET23b-GlnRSH (histidine-tagged) and pET23b-GlnRS. The resulting plasmids contain Gln-RS sequences with or without 6xhistidine-tag under the control of a T7 promoter for over-expression.
  • GlnRS overproducer plasmid (pET23b-GlnRSH) is transformed into chemically competent BL-21 cells (Promega; Madison, Wis.) and plated on LB/carbenicillin plates. A single colony is grown overnight in TB/100 ug/mL carbenicillin and then used to inoculate a large culture at 1:50 dilution. The cells are grown in rich media to mid-log phase at 37° C. before induction with 1 mM IPTG for 5 h. All subsequent purification steps are carried out at 4° C. Crude cell extracts are prepared by centrifugation at 5000 g, followed by cell-lysis under high pressure.
  • the extracts are mixed with 5 mL of Ni-NTA resin that has been preequilibrated in lysis buffer. After a 1 h incubation of the protein on ice to allow binding to the resin, this mixture is poured into a 10 mL column. Weakly bound proteins are removed with wash buffer (50 mM potassium phosphate, pH 6.0, 300 mM NaCl, 10 mM ⁇ -mercaptoethanol, 10% glycerol) until the A 280 of the eluate drops below 0.1. The protein is eluted with a gradient of 0-0.5 M imidazole in wash buffer.
  • wash buffer 50 mM potassium phosphate, pH 6.0, 300 mM NaCl, 10 mM ⁇ -mercaptoethanol, 10% glycerol
  • Peak fractions identified by activity or SDS-PAGE are pooled together and dialyzed against buffer containing 50 mM potassium phosphate, pH 7.0, 100 mM KCl, and 10 mM ⁇ -mercaptoethanol at 4° C. overnight. Protein is then concentrated to a final concentration of 10 mg/mL in 40% glycerol and then stored at ⁇ 20° C.
  • Non-native amino acids cannot usually be charged to isoaccepting sense tRNA molecules by naturally occurring aminoacyl-tRNA synthetases.
  • “promiscuous” aminoacyl-tRNA synthetases may previously exist that have the capability to charge isoaccepting tRNAs with non-native amino acids.
  • new aminoacyl-tRNA synthetases must be engineered such that the desired non-native amino acid can be charged to a tRNA molecule in the separate tRNA charging reaction.
  • the pooled oligos are annealed to template DNA, amplified by DNA polymerase, plasmid template is degraded with Dpnl, and the library is transformed and plated. Ninety-six clones are sequenced to confirm the diversity of the library.
  • Multiscreen filtration plates (Millipore Corp.). Cells are harvested & lysed, the lysate diluted with 4 ⁇ volume of PBS buffer, and 200 ⁇ L is loaded onto Ni-chelating sepharose media in the Multiscreen plate. Enzyme elutions are optimized using increasing concentrations of imidazole. The filtrate is filtered by vacuum filtration and high yields of pure recombinant protein are produced.
  • the enzyme activity of each variant is assayed using radiolabeled non-native amino acids by a discontinuous steady state assay that monitors the formation of [ 3 H]-labeled nnAA-tRNA nnAA at 37° C. in 50 mM Tris-HCl (or Hepes) pH 7.5, 20 mM KCl 1 , 4 mM DTT, 10 mM MgCl 2 , 0.2 mg/ml bovine serum albumin, and a range of amino acid, ATP, and tRNA concentrations.
  • the activities are normalized for the enzyme concentration independently determined by fluorescence using a coupled enzyme assay that measures released pyrophosphate.
  • GalNAc L-Threonine is an example of a non-native amino acid, which is synthesized from commercially available GalNAc L-Threonine (N-Fmoc-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy- ⁇ -D-galactopyranosyl)-L-threonine (V-Labs, Inc., Covington, La.). This synthesis occurs by selective deprotection of the Fmoc group with piperidine in dichloromethane to give the free amino acid followed by selective enzymatic hydrolysis of the carbohydrate acetates using lipase WG (The sample is purified using reversed phase HPLC).
  • the present invention requires the charging of isoaccepting sense tRNAs with either native or non-native amino acids in a charging reaction separate from the protein synthesis reaction.
  • tRNA Synthetic DNA oligonucleotides (Integrated DNA Technologies, Inc., Coralville, Iowa) are designed such that the sense strand corresponding to the 5′ end of the sequence possesses a 10-bp overlap with the 3′ antisense strand.
  • the oligonucleotides used for construction of the E are designed such that the sense strand corresponding to the 5′ end of the sequence possesses a 10-bp overlap with the 3′ antisense strand.
  • coli tRNA2 Gln gene are: 5′-AAT TCCTGCAGTAATACGACTCACTATAGGGGGTATCGCCA AGCGGT AAGGCACCGG -3′ (SEQ ID NO:5); 5′-mTmGGCTGGGGTACGAGATTCGAACCTCGGAATGCCGGAATCAGAAT CCGGTG CCTT -3′ (SEQ ID NO:6), where mT and mG represent the 5′-O-methyl nucleotides and the underlined portions represent the overlapped region.
  • Bold type indicates the T7 RNA polymerase promoter.
  • Oligonucleotides are mixed to an equimolar concentration of 4 mM in a reaction solution containing 400 mM dNTPs, 10 mM Tris-HCl, pH 7.5, 10 mM MgSO4, 7.5 mM DTT, and 50 U/mL Klenow fragment polymerase (Promega).
  • the mixture is cycled between 10° C. and 37° C. at 30 s intervals for eight cycles, after which the DNA is precipitated in 65% ethanol/0.3 M sodium acetate, pelleted, and resuspended in 100 mL PMS buffer (5 mM PIPES, pH 7.5/10 mM MgSO4).
  • Transcription is performed in solutions containing 250 mM HEPES-KOH, pH 7+5, 30 mM MgCl2, 2 mM spermidine, 40 mM DTT, 0.1 mg/mL bovine serum albumin, 5 mM dNTPs, 5 mg inorganic pyrophosphatase (Boeringer Mannheim), 50 U RNasin (Amersham), 40 mg/mL T7 RNA polymerase, and 1 mM DNA template from the Klenow extension reaction .
  • the 2-mL reaction mixture is incubated at 37 deg C for 8-10 h, at which time RQ1 RNase-free DNase (Promega) is added to 10 U/mL and the incubation continued for a further 2-3 hr.
  • the reactions are then loaded on a 5-mL DE-52 (Whatman) column preequilibrated with 100 mM HEPES-KOH, pH 7.5, 12 mM MgCl 2 , and 200 mM NaCl.
  • the column is washed with 30 mL equilibration buffer and the RNA eluted with a solution of 100 mM HEPES-KOH, pH 7.5, 12 mM MgCl 2 , 600 mM NaCl.
  • Fractions containing tRNA are dialyzed into PMS buffer and refolded by heating to 70° C., followed by slow cooling to room temperature.
  • GalNAc L-Gln-tRNA2 The formation of charged GalNAc L-Gln-tRNA2 is catalyzed by a recombinant aaRS as follows.
  • a typical reaction mixture contains 50 mM Tris-HCl (or Hepes) pH 7.5, 20 mM KCl, 4 mM DTT, 10 mM MgCl 2 , 0.2 mg/ml bovine serum albumin, 1-5 nM aaRS, and a range of amino acid, ATP, and tRNA concentrations.
  • the charged tRNA may be purified by immobilized Ef-Tu chromatography as previously described.
  • the recombinant aaRS used for this charging reaction is described in Ran et al., J. Am. Chem. Soc. 126:15654-55 (2004).
  • the cell-free protein synthesis reaction contains the reagents summarized in Table 3 along with an E. coli lysate generated as described in Example 2 and subsequently depleted of a native aminoacyl-tRNA synthetase as described in Example 3.
  • the extract is pretreated with 100 ⁇ M iodoacetamide at 21° C. for 30 min.
  • the plasmid contains the structural gene encoding the target protein and is constructed as explained above.
  • GalNAc L-Gln-tRNA2 is the charged tRNA as described above.
  • Gln-Gln-tRNA1 is the glutamine tRNA recognizing a codon different from that of Gln-tRNA2 charged with native glutamine amino acid.
  • the charging reaction is carried out as described in Example 8 except that native E. coli GlnRS is used to catalyze the charging reaction of Gln-tRNA1.
  • Native GlnRS is produced according to procedure in Example 4.
  • Amino Acids are in an equimolar mixture of all 20 native amino acids except for glutamine (19 amino acids total in the mixture).
  • reaction mixture is spread on the bottom of a petri dish (Thermo Fisher Scientific, Rochester, N.Y.) and incubated at 30° C. in a sealed humidified incubator for 4 hours.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US12/685,544 2009-01-12 2010-01-11 Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method Abandoned US20100184134A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/685,544 US20100184134A1 (en) 2009-01-12 2010-01-11 Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US14409709P 2009-01-12 2009-01-12
US14408309P 2009-01-12 2009-01-12
US14403009P 2009-01-12 2009-01-12
US12/685,544 US20100184134A1 (en) 2009-01-12 2010-01-11 Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method

Publications (1)

Publication Number Publication Date
US20100184134A1 true US20100184134A1 (en) 2010-07-22

Family

ID=42316861

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/685,544 Abandoned US20100184134A1 (en) 2009-01-12 2010-01-11 Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method
US12/685,795 Expired - Fee Related US8778631B2 (en) 2009-01-12 2010-01-12 Mono charging system for selectively introducing non-native amino acids into proteins using an in vitro protein synthesis system

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/685,795 Expired - Fee Related US8778631B2 (en) 2009-01-12 2010-01-12 Mono charging system for selectively introducing non-native amino acids into proteins using an in vitro protein synthesis system

Country Status (5)

Country Link
US (2) US20100184134A1 (ja)
EP (2) EP2379578A4 (ja)
JP (1) JP5798489B2 (ja)
CN (1) CN102348807B (ja)
WO (2) WO2010081111A1 (ja)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014031566A1 (en) 2012-08-22 2014-02-27 Immunogen, Inc. Cytotoxic benzodiazepine derivatives
WO2016004024A1 (en) 2014-07-02 2016-01-07 Sutro Biopharma, Inc. High growth capacity auxotrophic escherichia coli and methods of use
KR20160025661A (ko) * 2014-08-27 2016-03-09 동국대학교 산학협력단 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
US9365625B1 (en) 2011-03-31 2016-06-14 David Gordon Bermudes Bacterial methionine analogue and methionine synthesis inhibitor anticancer, antiinfective and coronary heart disease protective microcins and methods of treatment therewith
WO2024035661A1 (en) 2022-08-08 2024-02-15 Sutro Biopharma, Inc. Spray dried extract

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012170433A1 (en) * 2011-06-08 2012-12-13 Sutro Biopharma, Inc. Multiple rna polymerase terminator cassettes for efficient transcription of discrete rna templates
AU2013270684B2 (en) 2012-06-08 2018-04-19 Sutro Biopharma, Inc. Antibodies comprising site-specific non-natural amino acid residues, methods of their preparation and methods of their use
EP2863955B1 (en) 2012-06-26 2016-11-23 Sutro Biopharma, Inc. Modified fc proteins comprising site-specific non-natural amino acid residues, conjugates of the same, methods of their preparation and methods of their use
WO2014006225A1 (en) * 2012-07-06 2014-01-09 Innovative Technologies In Biological Systems S.L. Fluorescent fusion polypeptide, biosensor comprising said polypeptide and uses thereof
SG10201702387YA (en) 2012-09-24 2017-04-27 Medimmune Ltd Cell lines
PL2906592T3 (pl) 2012-10-12 2019-07-31 Sutro Biopharma, Inc. Proteolityczna inaktywacja wybranych białek w ekstraktach bakteryjnych dla ulepszonej ekspresji
CN103933575B (zh) 2013-01-23 2017-09-29 上海新理念生物医药科技有限公司 一种三齿型连接子及其应用
HUE059565T2 (hu) 2013-04-19 2022-11-28 Sutro Biopharma Inc Biológiailag aktív fehérjék expressziója bakteriális sejtmentes szintézisrendszerben, emelkedett exogén chaperonszintû sejtextraktumok segítségével
WO2014176327A2 (en) 2013-04-25 2014-10-30 Sutro Biopharma, Inc. Selection of fab fragments using ribosomal display technology
WO2014176439A1 (en) 2013-04-25 2014-10-30 Sutro Biopharma, Inc. The use of lambda-gam protein in ribosomal display technology
US20160115487A1 (en) * 2013-05-29 2016-04-28 Bradley C. Bundy Cell-free synthetic incorporation of non-natural amino acids into proteins
EP3019522B1 (en) 2013-07-10 2017-12-13 Sutro Biopharma, Inc. Antibodies comprising multiple site-specific non-natural amino acid residues, methods of their preparation and methods of their use
WO2015019192A2 (en) 2013-08-05 2015-02-12 Medimmune Limited Amino acid derivatives
CN105723219B (zh) * 2013-09-12 2018-06-05 朗泽科技新西兰有限公司 重组微生物和其使用方法
CA2973343C (en) 2015-02-05 2023-08-08 R.P. Scherer Technologies, Llc Activated formylglycine-generating enzymes and methods of producing and using the same
WO2016154675A1 (en) * 2015-03-27 2016-10-06 The University Of Queensland Platform for non-natural amino acid incorporation into proteins
JP6759326B2 (ja) 2015-07-12 2020-09-23 ハンジョウ ディーエーシー バイオテック シーオー．，エルティディ．Ｈａｎｇｚｈｏｕ Ｄａｃ Ｂｉｏｔｅｃｈ Ｃｏ．，Ｌｔｄ． 細胞結合分子の共役のための架橋連結体
US9839687B2 (en) 2015-07-15 2017-12-12 Suzhou M-Conj Biotech Co., Ltd. Acetylenedicarboxyl linkers and their uses in specific conjugation of a cell-binding molecule
AU2016354009B2 (en) 2015-11-09 2021-05-20 R.P. Scherer Technologies, Llc Anti-CD22 antibody-maytansine conjugates and methods of use thereof
AU2016429272A1 (en) 2016-11-14 2019-05-02 Hangzhou Dac Biotech Co., Ltd. Conjugation linkers, cell binding molecule-drug conjugates containing the likers, methods of making and uses such conjugates with the linkers
AU2017375631B2 (en) 2016-12-12 2023-06-15 xCella Biosciences, Inc. Methods and systems for screening using microcapillary arrays
CN118662649A (zh) 2016-12-30 2024-09-20 Vaxcyte公司 具有非天然氨基酸的多肽-抗原缀合物
US11951165B2 (en) 2016-12-30 2024-04-09 Vaxcyte, Inc. Conjugated vaccine carrier proteins
AR114445A1 (es) 2018-02-26 2020-09-09 Synthorx Inc Conjugados de il-15, y sus usos
US20220002719A1 (en) * 2018-04-03 2022-01-06 The University Of Queensland Oligonucleotide-mediated sense codon reassignment
TW202024332A (zh) * 2018-08-31 2020-07-01 國立研究開發法人理化學研究所 吡咯賴氨酰-tRNA合成酶
EP3923974A4 (en) 2019-02-06 2023-02-08 Synthorx, Inc. IL-2 CONJUGATES AND METHODS OF USE THEREOF
IL289458A (en) 2019-06-29 2022-07-01 Hangzhou Dac Biotech Co Ltd A cell-binding conjugated derivative of the tubolisin molecule and a method for its production
BR112022002442A2 (pt) 2019-08-15 2022-07-05 Synthorx Inc Terapias de imuno-oncologia com conjugados de il-2
TW202124385A (zh) 2019-09-10 2021-07-01 美商欣爍克斯公司 治療自體免疫疾病之il-2接合物及使用方法
KR20220097445A (ko) 2019-11-04 2022-07-07 신톡스, 인크. 인터류킨 10 접합체 및 이의 용도
WO2021178597A1 (en) 2020-03-03 2021-09-10 Sutro Biopharma, Inc. Antibodies comprising site-specific glutamine tags, methods of their preparation and methods of their use
CN111996206B (zh) * 2020-06-19 2023-01-31 清华大学 光控无细胞蛋白质合成方法、该方法使用的质粒以及使用该方法的产品
JP2023531509A (ja) 2020-06-25 2023-07-24 シンソークス， インコーポレイテッド Ｉｌ－２コンジュゲートおよび抗ｅｇｆｒ抗体を用いる免疫腫瘍学併用療法
JP2023544254A (ja) 2020-09-14 2023-10-23 ストロ バイオファーマ， インコーポレイテッド 無細胞タンパク質合成系を用いた抗体の大規模産生方法
CN114250243B (zh) * 2020-09-24 2024-05-03 深圳华大生命科学研究院 一种检测极端嗜盐生物中氨酰-tRNA合成酶和tRNA活性的系统及方法
JP2023546010A (ja) 2020-10-09 2023-11-01 シンソークス， インコーポレイテッド Ｉｌ－２コンジュゲートを用いた免疫腫瘍療法
KR20230084203A (ko) 2020-10-09 2023-06-12 신톡스, 인크. Il-2 접합체 및 펨브롤리주맙을 사용한 면역 종양 병용 요법
WO2022174102A1 (en) 2021-02-12 2022-08-18 Synthorx, Inc. Lung cancer combination therapy with il-2 conjugates and an anti-pd-1 antibody or antigen-binding fragment thereof
TW202245843A (zh) 2021-02-12 2022-12-01 美商欣爍克斯公司 Ｉｌ－２接合物及西米普利單抗（ｃｅｍｉｐｌｉｍａｂ）之皮膚癌組合療法
WO2022256534A1 (en) 2021-06-03 2022-12-08 Synthorx, Inc. Head and neck cancer combination therapy comprising an il-2 conjugate and pembrolizumab
WO2023122573A1 (en) 2021-12-20 2023-06-29 Synthorx, Inc. Head and neck cancer combination therapy comprising an il-2 conjugate and pembrolizumab
WO2023122750A1 (en) 2021-12-23 2023-06-29 Synthorx, Inc. Cancer combination therapy with il-2 conjugates and cetuximab
WO2024136899A1 (en) 2022-12-21 2024-06-27 Synthorx, Inc. Cancer therapy with il-2 conjugates and chimeric antigen receptor therapies
WO2024196937A1 (en) 2023-03-20 2024-09-26 Synthorx, Inc. Cancer therapy with il-2 peg conjugates

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801013A (en) * 1995-05-26 1998-09-01 Cubist Pharmaceuticals, Inc. Helicobacter aminoacyl-tRNA synthetase proteins, nucleic acids and strains comprising same
US20050053985A1 (en) * 2003-07-02 2005-03-10 Ptc Therapeutics, Inc. RNA processing protein complexes and uses thereof
US6977150B2 (en) * 2001-01-25 2005-12-20 Anthony C. Forster Process and compositions for peptide, protein and peptidomimetic synthesis
US20050287639A1 (en) * 2004-05-17 2005-12-29 California Institute Of Technology Methods of incorporating amino acid analogs into proteins
US20060068449A1 (en) * 1999-08-25 2006-03-30 Ambergen, Inc. N-terminal and C-terminal markers in nascent proteins
US7312049B2 (en) * 2005-06-14 2007-12-25 The Board Of Trustees Of The Leland Stanford Junior University Total amino acid stabilization during cell-free protein synthesis
US20080254540A1 (en) * 2007-04-13 2008-10-16 The Salk Institute Ofr Biological Studies METHODS OF GENETICALLY ENCODING UNNATURAL AMINO ACIDS IN EUKARYOTIC CELLS USING ORTHOGONAL tRNA/SYNTHETASE PAIRS

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003070740A1 (en) * 2002-02-15 2003-08-28 The Research Foundation Of State University Of New York RIBOZYMES WITH BROAD tRNA AMINOACYLATION ACTIVITY
US20090018029A1 (en) * 2005-11-16 2009-01-15 Ambrx, Inc. Methods and Compositions Comprising Non-Natural Amino Acids
PT1999259E (pt) * 2006-03-03 2014-09-24 California Inst Of Techn Incorporação sítio-específica de aminoácidos em moléculas
DE602007005820D1 (de) * 2006-09-04 2010-05-20 Fundacio Privada Inst De Recer Screening-verfahren zur identifizierung neuer aminoacyl-trna-synthetase-inhibitoren

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801013A (en) * 1995-05-26 1998-09-01 Cubist Pharmaceuticals, Inc. Helicobacter aminoacyl-tRNA synthetase proteins, nucleic acids and strains comprising same
US20060068449A1 (en) * 1999-08-25 2006-03-30 Ambergen, Inc. N-terminal and C-terminal markers in nascent proteins
US6977150B2 (en) * 2001-01-25 2005-12-20 Anthony C. Forster Process and compositions for peptide, protein and peptidomimetic synthesis
US20050053985A1 (en) * 2003-07-02 2005-03-10 Ptc Therapeutics, Inc. RNA processing protein complexes and uses thereof
US20050287639A1 (en) * 2004-05-17 2005-12-29 California Institute Of Technology Methods of incorporating amino acid analogs into proteins
US7312049B2 (en) * 2005-06-14 2007-12-25 The Board Of Trustees Of The Leland Stanford Junior University Total amino acid stabilization during cell-free protein synthesis
US20080254540A1 (en) * 2007-04-13 2008-10-16 The Salk Institute Ofr Biological Studies METHODS OF GENETICALLY ENCODING UNNATURAL AMINO ACIDS IN EUKARYOTIC CELLS USING ORTHOGONAL tRNA/SYNTHETASE PAIRS

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9365625B1 (en) 2011-03-31 2016-06-14 David Gordon Bermudes Bacterial methionine analogue and methionine synthesis inhibitor anticancer, antiinfective and coronary heart disease protective microcins and methods of treatment therewith
WO2014031566A1 (en) 2012-08-22 2014-02-27 Immunogen, Inc. Cytotoxic benzodiazepine derivatives
WO2016004024A1 (en) 2014-07-02 2016-01-07 Sutro Biopharma, Inc. High growth capacity auxotrophic escherichia coli and methods of use
KR20160025661A (ko) * 2014-08-27 2016-03-09 동국대학교 산학협력단 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
KR101646728B1 (ko) * 2014-08-27 2016-08-09 동국대학교 산학협력단 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
WO2024035661A1 (en) 2022-08-08 2024-02-15 Sutro Biopharma, Inc. Spray dried extract

Also Published As

Publication number Publication date
JP2012514979A (ja) 2012-07-05
EP2376647A1 (en) 2011-10-19
WO2010081110A1 (en) 2010-07-15
JP5798489B2 (ja) 2015-10-21
EP2376647A4 (en) 2012-07-25
US20100184135A1 (en) 2010-07-22
US8778631B2 (en) 2014-07-15
CN102348807A (zh) 2012-02-08
WO2010081111A1 (en) 2010-07-15
EP2379578A4 (en) 2012-05-02
CN102348807B (zh) 2015-04-15
EP2376647B1 (en) 2014-03-05
EP2379578A1 (en) 2011-10-26

Similar Documents

Publication Publication Date Title
US8778631B2 (en) Mono charging system for selectively introducing non-native amino acids into proteins using an in vitro protein synthesis system
US10450353B2 (en) Proteolytic inactivation of select proteins in bacterial extracts for improved expression
Goerke et al. High‐level cell‐free synthesis yields of proteins containing site‐specific non‐natural amino acids
US6337191B1 (en) Vitro protein synthesis using glycolytic intermediates as an energy source
Quast et al. Cotranslational incorporation of non-standard amino acids using cell-free protein synthesis
Zawada et al. Microscale to manufacturing scale‐up of cell‐free cytokine production—a new approach for shortening protein production development timelines
EP1315826B1 (en) Enhanced in vitro synthesis of active proteins containing disulfide bonds
EP1177311B1 (en) In vitro macromolecule biosynthesis methods using exogenous amino acids and a novel atp regeneration system
US20170292139A1 (en) Genetically expanded cell free protein synthesis systems, methods and kits
US20020081660A1 (en) In vitro macromolecule biosynthesis methods using exogenous amino acids and a novel ATP regeneration system
US20210108213A1 (en) A method for optimizing antibody expression
Wu et al. Emerging methods for efficient and extensive incorporation of non-canonical amino acids using cell-free systems
CN111378708B (zh) 一种体外无细胞蛋白合成体系及其应用
US9550813B2 (en) Disulfide stabilized foldon polypeptides
Spirin et al. Cell-free protein synthesis systems: historical landmarks, classification, and general methods
Spirin Cell-free protein synthesis
WO2018198542A1 (ja) 無細胞タンパク質合成用反応混合物、これを用いた無細胞タンパク質合成方法、及び無細胞タンパク質合成用キット
WO2022266334A1 (en) Improved methods for producing recombinant proteins

Legal Events

Date Code Title Description
AS Assignment

Owner name: SUTRO BIOPHARMA, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VOLOSHIN, ALEXEI M.;ZAWADA, JAMES F.;GOLD, DANIEL;AND OTHERS;SIGNING DATES FROM 20100316 TO 20100322;REEL/FRAME:024136/0097

AS Assignment

Owner name: SUTRO BIOPHARMA, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VOLOSHIN, ALEXEI M.;ZAWADA, JAMES F.;GOLD, DANIEL;AND OTHERS;SIGNING DATES FROM 20100316 TO 20100322;REEL/FRAME:024162/0831

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION