US20050214849A1 - DNA sequencing method - Google Patents

DNA sequencing method Download PDF

Info

Publication number
US20050214849A1
US20050214849A1 US11/126,481 US12648105A US2005214849A1 US 20050214849 A1 US20050214849 A1 US 20050214849A1 US 12648105 A US12648105 A US 12648105A US 2005214849 A1 US2005214849 A1 US 2005214849A1
Authority
US
United States
Prior art keywords
enzyme
label
polynucleotide
sequence
carried out
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/126,481
Other languages
English (en)
Inventor
Daniel Densham
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/089,877 external-priority patent/US6908736B1/en
Application filed by Individual filed Critical Individual
Priority to US11/126,481 priority Critical patent/US20050214849A1/en
Publication of US20050214849A1 publication Critical patent/US20050214849A1/en
Priority to US12/710,059 priority patent/US7939264B1/en
Priority to US13/074,949 priority patent/US20110177520A1/en
Priority to US13/464,285 priority patent/US20120214164A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing

Definitions

  • This invention relates to polynucleotide sequence determinations.
  • the principle method in general use for large-scale DNA sequencing is the chain termination method. This method was first developed by Sanger and Coulson (Sanger et al., Proc. Natl. Acad. Sci. USA, 1977; 74: 5463-5467), and relies on the use of dideoxy derivatives of the four nucleoside triphosphates which are incorporated into a nascent polynucleotide chain in a polymerase reaction. Upon incorporation, the dideoxy derivatives terminate the polymerase reaction and the products are then separated by gel electrophoresis and analysed to reveal the position at which the particular dideoxy derivative was incorporated into the chain.
  • EP-A-0471732 uses spectroscopic means to detect the incorporation of a nucleotide into a nascent polynucleotide strand complementary to a target.
  • the method relies on an immobilised complex of template and primer, which is exposed to a flow containing only one of the different nucleotides.
  • Spectroscopic techniques are then used to measure a time-dependent signal arising from the polymerase catalysed growth of the template copy.
  • the spectroscopic techniques described are surface plasmon resonance (SPR) spectroscopy, which measures changes in an analyte within an evanescent wave field, and fluorescence measuring techniques.
  • SPR surface plasmon resonance
  • Single fragment polynucleotide sequencing approaches are outlined in WO-A-9924797 and WO-A-9833939, both of which employ fluorescent detection of single labelled nucleotide molecules.
  • These single nucleotides are cleaved from the template polynucleotide, held in a flow by an optical trap (Jett, et al., J. Biomol. Struc. Dyn, 1989; 7:301-309), by the action of an exonuclease molecule. These cleaved nucleotides then flow downstream within a quartz flow cell, are subjected to laser excitation and then detected by a sensitive detection system.
  • the present invention is based on the realisation that the sequence of a target polynucleotide can be determined by measuring conformational changes in an enzyme that binds to and processes along the target polynucleotide. The extent of the conformational change that takes place is different depending on which individual nucleotide on the target is in contact with the enzyme.
  • a method for determining the sequence of a polynucleotide comprises the steps of:
  • the enzyme is a polymerase enzyme which interacts with the target in the process of extending a complementary strand.
  • the enzyme is typically immobilised on a solid support to localise the reaction within a defined area.
  • the enzyme comprises a first bound detectable label, the characteristics of which alter as the enzyme undergoes a conformational change.
  • the enzyme may also comprise a second bound detectable label capable of interacting with the first label, wherein the degree of interaction is dependent on a conformational change in the enzyme.
  • the first label is an energy acceptor and the second label is an energy donor, and detecting the conformational change is carried out by measuring energy transfer between the two labels.
  • fluorescence resonance energy transfer is used to detect a conformational change in an enzyme that interacts with and processes along a target polymerase, thereby determining the sequence of the polynucleotide.
  • Fluorescence resonance energy transfer may be carried out between FRET donor and acceptor labels, each bound to the enzyme.
  • one of the labels may be bound to the enzyme and the other label bound to the polynucleotide.
  • a detectably-labelled enzyme capable of interacting with and precessing along a target polynucleotide, to determine the sequence of the polynucleotide, wherein the label alters its detectable characteristics as the enzyme processes along the polynucleotide.
  • a solid support comprises at least one immobilised enzyme capable of interacting with and precessing along a target polynucleotide, the enzyme being labelled with one or more detectable labels.
  • a system for determining the sequence of a polynucleotide comprises a solid support as defined above, and an apparatus for detecting the label.
  • the present invention offers several advantages over conventional sequencing technology. Once a polymerase enzyme begins its round of polynucleotide elongation, it tends to polymerase several thousand nucleotides before falling off from the strand. Additionally, certain specific polymerase systems are able to anchor or tether themselves to the template polynucleotide via a ‘sliding clamp’ (e.g. Polymerase III) which encircles the template molecule or via a molecular hook (e.g. T7:thireodoxin complex) which partially encircles the template.
  • a sliding clamp e.g. Polymerase III
  • a molecular hook e.g. T7:thireodoxin complex
  • the invention may also enable tens of kilobases (kb) or more to be sequenced in one go, at a rate of hundreds of base pairs per second. This is a result of sequencing on a single fragment of DNA.
  • An advantage of sequencing a single fragment of DNA is that sequencing rates are determined by the enzyme system utilised and not upon indirect, summated reactions, and are therefore correspondingly higher. Just as important as the high rate is the ability to sequence large fragments of DNA. This will significantly reduce the amount of subcloning and the number of overlapping sequences required to assemble megabase segments of sequencing information.
  • An additional advantage of the single fragment approach is the elimination of problems associated with the disposal of hazardous wastes, such as acrylamide, which plague current sequencing efforts.
  • FIG. 1 is a schematic illustration of a confocal microscope setup for use in the invention
  • FIG. 2 illustrates a trace taken after fluorescence resonance energy transfer, with each of the peaks representing the detection of a specific nucleotide.
  • the present method for sequencing a polynucleotide involves the analysis of conformational changes between an enzyme and a target polynucleotide.
  • polynucleotide as used herein is to be interpreted broadly, and includes DNA and RNA, including modified DNA and RNA, as well as other hybridising nucleic acid-like molecules, e.g. peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the enzyme may be a polymerase enzyme, and a conformational change is brought about when the polymerase incorporates a nucleotide into a nascent strand complementary to the target polynucleotide. It has been found that the conformational change will be different for each of the different nucleotides, A, T, G or C and therefore measuring the change will identify which nucleotide is incorporated.
  • the enzyme may be any that is involved in an interaction with a polynucleotide, e.g. a helicase enzyme, primase and holoenzyme. As the enzyme processes along the polynucleotide, its conformation will change depending on which nucleotide on the target it is brought into contact with.
  • a polynucleotide e.g. a helicase enzyme, primase and holoenzyme.
  • One way of detecting a conformational change in the enzyme is to measure resonance energy transfer between a suitable energy donor label and a suitable energy acceptor label.
  • the donor and acceptor are each bound to the enzyme and the conformational change in the enzyme brought about by its interaction with the target polynucleotide alters the relative positioning of the labels. The differences in positioning are reflected in the resulting energy transfer and are characteristic of the particular nucleotide in contact with the enzyme.
  • one label may be positioned on the enzyme and the other on a nucleotide of the target or on a nucleotide incorporated onto a strand complementary to the target.
  • FRET fluorescence resonance energy transfer
  • the present invention may also be carried out using measurement techniques that require only a single label. Any system that is capable of measuring changes in the local environment of the enzyme at the single molecule level, is an accepted embodiment of the invention.
  • Various properties of single fluorescent probes attached to a polynucleotide processive enzyme and/or its substrate(s) can be exploited in the context of the invention to provide data on variables within or in close proximity to the enzyme system/molecular environment that are specific to a nucleotide incorporation event.
  • Such variables include, but are not limited to, molecular interactions, enzymatic activity, reaction kinetics, conformational dynamics, molecular freedom of motion, and alterations in activity and in chemical and electrostatic environment.
  • the absorption and emission transition dipoles of single fluorophores can be determined by using polarized excitation light or by analysing the emission polarisation, or both.
  • the temporal variation in dipole orientation of a rigidly attached or rotationally diffusing tethered label can report on the angular motion of a macromolecule system or one of its subunits (Warshaw, et al., Proc. Natl. Acad. Sci. USA, 1998; 95:8034) and therefore may be applied in the present invention.
  • the label is a fluorescence label, such as those disclosed in Xue, et al., Nature, 1995; 373:681.
  • fluorescing enzymes such as green fluorescent protein (Lu, et al., Science, 1998; 282:1877) can be employed.
  • TMR tetramethylrhodamine
  • fluorescent labels are used in the invention, their detection may be affected by photobleaching caused by repeated exposure to excitation wavelengths.
  • One possible way to avoid this problem is to carry out many sequential reactions, but detecting fluorescence signals on only a few at a time.
  • the correct sequence of signals can be determined and the polynucleotide sequence determined. For example, by immobilising a plurality of enzymes on a solid support and contacting them with the target polynucleotide, the sequencing reactions should start at approximately the same time. Excitation and detection of fluorescence can be localised to a proportion of the total reactions, for a time until photobleaching becomes evident. At this time, excitation and detection can be transferred to a different proportion of the reactions to continue the sequencing. As all the reactions are relatively in phase, the correct sequence should be obtained with minimal sequence re-assembly.
  • the labels may be attached to the enzymes by covalent or other linkages.
  • a number of strategies may be used to attach the labels to the enzyme. Strategies include the use of site-directed mutagenesis and unnatural amino acid mutagenesis (Anthony-Cahil, et al., Trends Biochem. Sci., 1989; 14:400) to introduce cysteine and ketone handles for specific and orthogonal dye labelling proteins (Cornish, et al., Proc. Natl. Acad. Sci. USA, 1994; 91:2910).
  • GFP green fluorescent protein
  • processive enzyme e.g. polymerase
  • molecular cloning techniques known in the art (Pierce, D. W. et al., Nature, 1997; 388:338). This technique has been demonstrated to be applicable to the measurement of conformational changes (Miyawaki, et al., Nature, 1997; 388:882) and local pH changes (Llopis, et al., Proc. Natl. Acad. Sci. USA, 1998; 95:6803).
  • Enzyme immobilisation may be carried out by covalent or other means.
  • covalent linker molecules may be used to attach to a suitably prepared enzyme. Attachment methods are known to the skilled person.
  • Resonance energy transfer may be measured by the techniques of surface plasmon resonance (SPR) or fluorescent surface plasmon resonance.
  • spectroscopy by total internal reflectance fluorescence (TIRF), attenuated total reflection (ATR), frustrated total reflection (FTR), Brewster angle reflectometry, scattered total internal reflection (STIR), fluorescence lifetime imaging microscopy and spectroscopy (FLIMS), fluorescence polarisation anisotrophy (FPA), fluorescence spectroscopy, or evanescent wave ellipsometry.
  • TIRF total internal reflectance fluorescence
  • ATR attenuated total reflection
  • FTR frustrated total reflection
  • HIR scattered total internal reflection
  • FLIMS fluorescence lifetime imaging microscopy and spectroscopy
  • FPA fluorescence polarisation anisotrophy
  • fluorescence spectroscopy or evanescent wave ellipsometry.
  • This Example used a confocal fluorescence setup, as shown in FIG. 1 .
  • the setup consists of a scan table ( 1 ) able to scan at high resolution in X, Y and Z dimensions, a class coverslip ( 2 ) which is part of a microfluidic flow cell system with an inlet ( 8 ) for introducing the primer-template polynucleotide complex ( 4 ) and nucleotides over the immobilised ( 9 ) polymerase molecule ( 3 ) within a buffer, and an outlet ( 7 ) for waste.
  • Incident light from a laser light source ( 6 ) for donor excitation is delivered via an oil-immersion objective ( 5 ).
  • TMR Tetramethylrhodamine
  • Cy5 acceptor
  • T7 DNA Polymerase from New England Biolabs (supplied at 10 000 U/ml) was used. 50 ⁇ l of T7 was buffer-exchanged in a Vivaspin 500 (Vivaspin) against 4 ⁇ 500 ⁇ l of 200 mM Sodium Acetate buffer at pH 4 in order to remove the DTT from the storage buffer that the T7 DNA Polymerase is supplied in. Then, 50 ⁇ l of the buffer-exchanged T7 DNA polymerase was added to 100 ⁇ l of Sodium Acetate buffer at pH 4 and 50 ⁇ l saturated 2-2-DiPyridyl-DiSulphide in aqueous solution. This reaction was then left for 110 minutes and the absorption at 343 nm noted. Finally, the sample was then buffer-exchanged into 200 mM Tris at pH 8 as before (4 times 500 ⁇ l).
  • Glass coverslips were derivatized with N-[(3-trimethoxysilyl)propyl]ethylenediamine triacetic acid. The coverslip was then glued into a flow-cell arrangement that allowed buffer to be flowed continuously over the derivatized glass surface. The labelled polymerase was then added to the buffer and allowed to flow over the coverslip so that protein was immobilised on the glass surface.
  • Proteins were then immobilised on the glass-water interface with low density so that only one molecule was under the laser excitation volume at any one time.
  • Laser light (514 nm Ar ion laser, 15 ⁇ W, circularly polarized) was focused onto a 0.4 ⁇ m spot using an oil immersion objective in an epi-illumination setup of a scanning-stage confocal microscope.
  • the fluorescence emission was collected by the same objective and divided into two by a dichroic beam splitter (long pass at 630 nm) and detected by two Avalanche Photo Diode (APD) counting units, simultaneously.
  • APD Avalanche Photo Diode
  • a 585 nm band pass filter was placed in front of the donor detector; a 650 nm long pass filter was placed in front of the acceptor detector. Since the spectral ranges during fluorescence detection are sufficiently removed from the cutoff wavelength of the dichroic beam splitter, the polarization dependence of the detection efficiency of both donor and acceptor signal is negligible. It has been shown that the polarization mixing due to the high near field aperture (NA) objective can be overlooked (Ha et al, Supra).
  • NA near field aperture
  • oligonucleotides were synthesised using standard phosphoramidite chemistry.
  • the oligonucleotide defined as SEQ ID NO.1 was used as the target polynucleotide, and the oligonucleotide defined as SEQ ID No.2 was used as the primer.
  • the two oligonucleotides were reacted under hybridizing conditions to form the target-primer complex.
  • SEQ ID NO.1 CAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGGA GAG SEQ ID NO.2 CTCTCCCTTCTCTCGTC
  • the reaction was then initiated by injecting the primed DNA into the flow cell with all four nucleotides (dGTP, dCTP, DATP and dTTP) present at a concentration of 0.4 mM.
  • the flow cell was maintained at 25 degrees Celsius by a modified peltier device.
  • An oxygen-scavenging system was also employed [50 ⁇ g/ml glucose oxidase, 10 ⁇ g/ml catalase, 18% (wt/wt) glucose, 1% (wt/vol) ⁇ -mercaptoethanol] to prolong fluorescent lifetimes (Funatsu, et al., Nature, 1995; 374:555-559).
  • the amount of donor signal recovery upon acceptor photobleaching is related to the quantum yields of the molecules and their overall detection efficiencies.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Saccharide Compounds (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
US11/126,481 1999-10-06 2005-05-11 DNA sequencing method Abandoned US20050214849A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US11/126,481 US20050214849A1 (en) 1999-10-06 2005-05-11 DNA sequencing method
US12/710,059 US7939264B1 (en) 1999-10-06 2010-02-22 DNA sequencing method
US13/074,949 US20110177520A1 (en) 1999-10-06 2011-03-29 Dna sequencing method
US13/464,285 US20120214164A1 (en) 1999-10-06 2012-05-04 Dna sequencing method

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GBGB9923644.0A GB9923644D0 (en) 1999-10-06 1999-10-06 DNA sequencing
GB9923644.0 1999-10-06
PCT/GB2000/003860 WO2001025480A2 (fr) 1999-10-06 2000-10-06 Procede de sequençage de l'adn
US10/089,877 US6908736B1 (en) 1999-10-06 2000-10-06 DNA sequencing method
US11/126,481 US20050214849A1 (en) 1999-10-06 2005-05-11 DNA sequencing method

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US10/089,877 Continuation US6908736B1 (en) 1999-10-06 2000-10-06 DNA sequencing method
US10089877 Continuation 2000-10-06
PCT/GB2000/003860 Continuation WO2001025480A2 (fr) 1999-10-06 2000-10-06 Procede de sequençage de l'adn

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/710,059 Continuation US7939264B1 (en) 1999-10-06 2010-02-22 DNA sequencing method

Publications (1)

Publication Number Publication Date
US20050214849A1 true US20050214849A1 (en) 2005-09-29

Family

ID=10862234

Family Applications (4)

Application Number Title Priority Date Filing Date
US11/126,481 Abandoned US20050214849A1 (en) 1999-10-06 2005-05-11 DNA sequencing method
US12/710,059 Expired - Fee Related US7939264B1 (en) 1999-10-06 2010-02-22 DNA sequencing method
US13/074,949 Abandoned US20110177520A1 (en) 1999-10-06 2011-03-29 Dna sequencing method
US13/464,285 Abandoned US20120214164A1 (en) 1999-10-06 2012-05-04 Dna sequencing method

Family Applications After (3)

Application Number Title Priority Date Filing Date
US12/710,059 Expired - Fee Related US7939264B1 (en) 1999-10-06 2010-02-22 DNA sequencing method
US13/074,949 Abandoned US20110177520A1 (en) 1999-10-06 2011-03-29 Dna sequencing method
US13/464,285 Abandoned US20120214164A1 (en) 1999-10-06 2012-05-04 Dna sequencing method

Country Status (21)

Country Link
US (4) US20050214849A1 (fr)
EP (1) EP1226271B1 (fr)
JP (2) JP5030249B2 (fr)
KR (1) KR100809171B1 (fr)
CN (1) CN1159457C (fr)
AT (1) ATE388242T1 (fr)
AU (1) AU769102B2 (fr)
BR (1) BR0014468A (fr)
CA (1) CA2386115C (fr)
DE (1) DE60038244T2 (fr)
DK (1) DK1226271T3 (fr)
EA (1) EA006702B1 (fr)
ES (1) ES2302497T3 (fr)
GB (1) GB9923644D0 (fr)
HK (1) HK1045857A1 (fr)
IL (2) IL148678A0 (fr)
IS (1) IS6333A (fr)
MX (1) MXPA02003534A (fr)
NZ (1) NZ517775A (fr)
PT (1) PT1226271E (fr)
WO (1) WO2001025480A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040241678A1 (en) * 2001-05-18 2004-12-02 Densham Daniel Henry Polynucleotide sequencing method
WO2009056831A1 (fr) * 2007-10-30 2009-05-07 Isis Innovation Limited Séquençage de molécules individuelles au moyen de polymérases
US20100279288A1 (en) * 2003-07-24 2010-11-04 Daniel Densham Method for Sequencing Nucleic Acid Molecules
US20100316999A1 (en) * 1997-07-28 2010-12-16 Daniel Henry Densham Nucleic Acid Sequence Analysis
US7939264B1 (en) 1999-10-06 2011-05-10 Gen-Probe Incorporated DNA sequencing method

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7875440B2 (en) 1998-05-01 2011-01-25 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
GB9907812D0 (en) * 1999-04-06 1999-06-02 Medical Biosystems Ltd Sequencing
US7056661B2 (en) 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
EP1681356B1 (fr) 1999-05-19 2011-10-19 Cornell Research Foundation, Inc. Procédé de séquenage d'acides nucléiques
CN101525660A (zh) 2000-07-07 2009-09-09 维西根生物技术公司 实时序列测定
EP1354064A2 (fr) 2000-12-01 2003-10-22 Visigen Biotechnologies, Inc. Synthese d'acides nucleiques d'enzymes, et compositions et methodes modifiant la fidelite d'incorporation de monomeres
US6902921B2 (en) 2001-10-30 2005-06-07 454 Corporation Sulfurylase-luciferase fusion proteins and thermostable sulfurylase
US6956114B2 (en) 2001-10-30 2005-10-18 '454 Corporation Sulfurylase-luciferase fusion proteins and thermostable sulfurylase
SE0201655D0 (sv) * 2002-05-31 2002-05-31 Amersham Biosciences Ab A method of electrophoresis
WO2005007887A1 (fr) * 2003-07-15 2005-01-27 Daniel Henry Densham Mesure d'une reaction d'amplification de polynucleotide
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
DE602005020421D1 (de) 2004-02-19 2010-05-20 Helicos Biosciences Corp Verfahren zur analyse von polynukleotidsequenzen
US7170050B2 (en) 2004-09-17 2007-01-30 Pacific Biosciences Of California, Inc. Apparatus and methods for optical analysis of molecules
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
CA2648149A1 (fr) * 2006-03-31 2007-11-01 Solexa, Inc. Systemes et procedes pour analyse de sequencage par synthese
AU2009229157B2 (en) 2008-03-28 2015-01-29 Pacific Biosciences Of California, Inc. Compositions and methods for nucleic acid sequencing
US9182406B2 (en) 2008-08-04 2015-11-10 Biodesy, Inc. Nonlinear optical detection of molecules comprising an unnatural amino acid possessing a hyperpolarizability
WO2010068884A2 (fr) * 2008-12-11 2010-06-17 The Regents Of The University Of California Procédés et systèmes pour le séquençage direct de molécules d'adn individuelles
US8911972B2 (en) 2009-12-16 2014-12-16 Pacific Biosciences Of California, Inc. Sequencing methods using enzyme conformation
WO2011159942A1 (fr) 2010-06-18 2011-12-22 Illumina, Inc. Sondes conformationnelles et procédés de séquençage d'acides nucléiques
WO2012129347A1 (fr) 2011-03-21 2012-09-27 Biodesy, Llc Classification d'inhibiteurs de kinase à l'aide de techniques optiques non linéaires
DE102013202721A1 (de) * 2013-02-20 2014-08-21 Siemens Aktiengesellschaft Sequenziervorrichtung zum Sequenzieren mindestens eines Nukleinsäureeinzelstrangs und Verfahren zum Sequenzieren mindestens eines Nukleinsäureeinzelstrangs
GB201306444D0 (en) * 2013-04-09 2013-05-22 Base4 Innovation Ltd Single nucleotide detection method
DK3460075T3 (da) 2014-07-15 2021-02-01 Illumina Inc Biokemisk aktiveret elektronisk anordning
WO2016106286A1 (fr) 2014-12-23 2016-06-30 Biodesy, Inc. Fixation de protéines à des interfaces destinées à être utilisées en détection optique non linéaire
US10077470B2 (en) 2015-07-21 2018-09-18 Omniome, Inc. Nucleic acid sequencing methods and systems
CA3021769C (fr) 2016-04-29 2021-11-23 Omniome, Inc. Procede de sequencage faisant appel a la destabilisation d'un complexe ternaire pour identifier des nucleotides apparentes
JP6828140B2 (ja) 2016-08-15 2021-02-10 オムニオム インコーポレイテッドＯｍｎｉｏｍｅ， Ｉｎｃ． 核酸をシーケンシングするための方法及びシステム
US10428378B2 (en) 2016-08-15 2019-10-01 Omniome, Inc. Sequencing method for rapid identification and processing of cognate nucleotide pairs
EP3562962B1 (fr) 2016-12-30 2022-01-05 Omniome, Inc. Procédé et système utilisant des polymérases pouvant être distinguées pour détecter des complexes ternaires et identifier des nucléotides parents
US10975427B2 (en) 2017-01-20 2021-04-13 Omniome, Inc. Process for cognate nucleotide detection in a nucleic acid sequencing workflow
US9951385B1 (en) 2017-04-25 2018-04-24 Omniome, Inc. Methods and apparatus that increase sequencing-by-binding efficiency
US10161003B2 (en) 2017-04-25 2018-12-25 Omniome, Inc. Methods and apparatus that increase sequencing-by-binding efficiency
JP2020530257A (ja) * 2017-09-15 2020-10-22 イルミナ インコーポレイテッド 配列検出システム
EP3697932A1 (fr) 2017-10-19 2020-08-26 Omniome, Inc. Réduction du bruit de fond et stabilisation de complexes simultanées dans des flux de travaux de dosage par liaison
US10344328B2 (en) 2017-11-17 2019-07-09 Ultima Genomics, Inc. Methods for biological sample processing and analysis
US11499962B2 (en) 2017-11-17 2022-11-15 Ultima Genomics, Inc. Methods and systems for analyte detection and analysis
US10512911B1 (en) * 2018-12-07 2019-12-24 Ultima Genomics, Inc. Implementing barriers for controlled environments during sample processing and detection
US11118223B2 (en) 2019-03-14 2021-09-14 Ultima Genomics, Inc. Methods, devices, and systems for analyte detection and analysis
US12060148B2 (en) 2022-08-16 2024-08-13 Honeywell International Inc. Ground resonance detection and warning system and method

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5360714A (en) * 1992-08-28 1994-11-01 Fox Chase Cancer Center Hepadnavirus polymerase gene product having RNA-dependent DNA priming and reverse transcriptase activities and methods of measuring the activities thereof
US5620854A (en) * 1993-08-25 1997-04-15 Regents Of The University Of California Method for identifying biochemical and chemical reactions and micromechanical processes using nanomechanical and electronic signal identification
US5747247A (en) * 1994-07-25 1998-05-05 The Regents Of The University Of California Spectroscopic helicase assay
US5753439A (en) * 1995-05-19 1998-05-19 Trustees Of Boston University Nucleic acid detection methods
US5801042A (en) * 1994-08-18 1998-09-01 The Trustees Of Columbia University In The City Of New York Unique associated Kaposi's sarcoma virus sequences and uses thereof
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6210896B1 (en) * 1998-08-13 2001-04-03 Us Genomics Molecular motors
US6221642B1 (en) * 1994-08-31 2001-04-24 Cornell Research Foundation, Inc. Process for reconstituting the polymerase III* and other subassemblies of E. coli DNA polymerase III holoenzyme from peptide subunits
US6263286B1 (en) * 1998-08-13 2001-07-17 U.S. Genomics, Inc. Methods of analyzing polymers using a spatial network of fluorophores and fluorescence resonance energy transfer
US6331392B1 (en) * 1997-03-05 2001-12-18 Anadys Pharmaceutical, Inc. Screen employing fluorescence anisotropy to identify compounds with affinity for nucleic acids
US6355420B1 (en) * 1997-02-12 2002-03-12 Us Genomics Methods and products for analyzing polymers
US20030044781A1 (en) * 1999-05-19 2003-03-06 Jonas Korlach Method for sequencing nucleic acid molecules

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE462454B (sv) 1988-11-10 1990-06-25 Pharmacia Ab Maetyta foer anvaendning i biosensorer
GB8910880D0 (en) * 1989-05-11 1989-06-28 Amersham Int Plc Sequencing method
CA2044616A1 (fr) 1989-10-26 1991-04-27 Roger Y. Tsien Sequencage de l'adn
GB9208733D0 (en) 1992-04-22 1992-06-10 Medical Res Council Dna sequencing method
JPH08507926A (ja) 1993-03-19 1996-08-27 シーケノム・インコーポレーテツド エキソヌクレアーゼ分解を介した質量分析法によるｄｎａ配列決定
DK1017848T3 (da) 1997-07-28 2003-02-10 Medical Biosystems Ltd Nucleinsyresekvensanalyse
US7875440B2 (en) * 1998-05-01 2011-01-25 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
EP1105535A1 (fr) 1998-08-13 2001-06-13 U.S. Genomics Polymeres caracterises optiquement
US7270951B1 (en) * 1999-03-10 2007-09-18 Asm Scientific, Inc. Method for direct nucleic acid sequencing
GB9907812D0 (en) * 1999-04-06 1999-06-02 Medical Biosystems Ltd Sequencing
US6335420B1 (en) 1999-11-22 2002-01-01 Ibc Advanced Technologies, Inc. Polyamide ligand-containing polymeric resins and methods of using the same for removing, separating and/or concentrating desired metal ions from solutions
US6908736B1 (en) * 1999-10-06 2005-06-21 Medical Biosystems, Ltd. DNA sequencing method
GB9923644D0 (en) * 1999-10-06 1999-12-08 Medical Biosystems Ltd DNA sequencing
GB0112238D0 (en) 2001-05-18 2001-07-11 Medical Biosystems Ltd Sequencing method
GB0317343D0 (en) 2003-07-24 2003-08-27 Medical Biosystems Ltd Polynucleotide sequencing
GB0413082D0 (en) 2004-06-11 2004-07-14 Medical Biosystems Ltd Method
US8262900B2 (en) * 2006-12-14 2012-09-11 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
US20100301398A1 (en) * 2009-05-29 2010-12-02 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US20100137143A1 (en) * 2008-10-22 2010-06-03 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US8574835B2 (en) * 2009-05-29 2013-11-05 Life Technologies Corporation Scaffolded nucleic acid polymer particles and methods of making and using
US8673627B2 (en) * 2009-05-29 2014-03-18 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5360714A (en) * 1992-08-28 1994-11-01 Fox Chase Cancer Center Hepadnavirus polymerase gene product having RNA-dependent DNA priming and reverse transcriptase activities and methods of measuring the activities thereof
US5620854A (en) * 1993-08-25 1997-04-15 Regents Of The University Of California Method for identifying biochemical and chemical reactions and micromechanical processes using nanomechanical and electronic signal identification
US5747247A (en) * 1994-07-25 1998-05-05 The Regents Of The University Of California Spectroscopic helicase assay
US5801042A (en) * 1994-08-18 1998-09-01 The Trustees Of Columbia University In The City Of New York Unique associated Kaposi's sarcoma virus sequences and uses thereof
US6221642B1 (en) * 1994-08-31 2001-04-24 Cornell Research Foundation, Inc. Process for reconstituting the polymerase III* and other subassemblies of E. coli DNA polymerase III holoenzyme from peptide subunits
US5753439A (en) * 1995-05-19 1998-05-19 Trustees Of Boston University Nucleic acid detection methods
US6355420B1 (en) * 1997-02-12 2002-03-12 Us Genomics Methods and products for analyzing polymers
US6331392B1 (en) * 1997-03-05 2001-12-18 Anadys Pharmaceutical, Inc. Screen employing fluorescence anisotropy to identify compounds with affinity for nucleic acids
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6210896B1 (en) * 1998-08-13 2001-04-03 Us Genomics Molecular motors
US6263286B1 (en) * 1998-08-13 2001-07-17 U.S. Genomics, Inc. Methods of analyzing polymers using a spatial network of fluorophores and fluorescence resonance energy transfer
US20030044781A1 (en) * 1999-05-19 2003-03-06 Jonas Korlach Method for sequencing nucleic acid molecules

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100316999A1 (en) * 1997-07-28 2010-12-16 Daniel Henry Densham Nucleic Acid Sequence Analysis
US7939264B1 (en) 1999-10-06 2011-05-10 Gen-Probe Incorporated DNA sequencing method
US20110177520A1 (en) * 1999-10-06 2011-07-21 Daniel Henry Densham Dna sequencing method
US20040241678A1 (en) * 2001-05-18 2004-12-02 Densham Daniel Henry Polynucleotide sequencing method
US20090029383A1 (en) * 2001-05-18 2009-01-29 Daniel Henry Densham Polynucleotide Sequencing Method
US9476094B2 (en) * 2001-05-18 2016-10-25 Gen-Probe Incorporated Polynucleotide sequencing method
US20100279288A1 (en) * 2003-07-24 2010-11-04 Daniel Densham Method for Sequencing Nucleic Acid Molecules
US7888073B2 (en) 2003-07-24 2011-02-15 Gen-Probe Incorporated Method for sequencing nucleic acid molecules
US20110097729A1 (en) * 2003-07-24 2011-04-28 Daniel Densham Apparatus and method for sequencing nucleic acid molecules
US8592183B2 (en) 2003-07-24 2013-11-26 Gen-Probe Incorporated Apparatus and method for sequencing nucleic acid molecules
WO2009056831A1 (fr) * 2007-10-30 2009-05-07 Isis Innovation Limited Séquençage de molécules individuelles au moyen de polymérases

Also Published As

Publication number Publication date
KR100809171B1 (ko) 2008-02-29
US20110177520A1 (en) 2011-07-21
JP2012196201A (ja) 2012-10-18
CN1391615A (zh) 2003-01-15
EP1226271A2 (fr) 2002-07-31
CA2386115A1 (fr) 2001-04-12
WO2001025480A3 (fr) 2002-05-16
EA200200428A1 (ru) 2002-10-31
AU7546700A (en) 2001-05-10
IS6333A (is) 2002-04-05
WO2001025480A2 (fr) 2001-04-12
DE60038244D1 (de) 2008-04-17
JP2003511043A (ja) 2003-03-25
DE60038244T2 (de) 2009-04-23
NZ517775A (en) 2004-01-30
IL148678A (en) 2008-12-29
MXPA02003534A (es) 2004-09-10
ATE388242T1 (de) 2008-03-15
ES2302497T3 (es) 2008-07-16
US20120214164A1 (en) 2012-08-23
DK1226271T3 (da) 2008-07-07
AU769102B2 (en) 2004-01-15
CA2386115C (fr) 2010-06-15
PT1226271E (pt) 2008-05-23
US7939264B1 (en) 2011-05-10
GB9923644D0 (en) 1999-12-08
CN1159457C (zh) 2004-07-28
KR20020059444A (ko) 2002-07-12
IL148678A0 (en) 2002-09-12
HK1045857A1 (en) 2002-12-13
BR0014468A (pt) 2002-08-20
EP1226271B1 (fr) 2008-03-05
JP5030249B2 (ja) 2012-09-19
EA006702B1 (ru) 2006-02-24

Similar Documents

Publication Publication Date Title
US7939264B1 (en) DNA sequencing method
US6908736B1 (en) DNA sequencing method
EP2267164B1 (fr) Analyse de séquences d'acides nucléiques
US6524829B1 (en) Method for DNA- or RNA-sequencing
US9382584B2 (en) Methods and systems for direct sequencing of single DNA molecules
RU2291197C2 (ru) Способ секвенирования полинуклеотидов
US6982146B1 (en) High speed parallel molecular nucleic acid sequencing
JP2006528485A (ja) ポリヌクレオチドの配列の決定
MXPA00000715A (es) Analisis de secuencia de acido nucleico

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION