US20030035798A1 - Humanized antibodies - Google Patents

Humanized antibodies Download PDF

Info

Publication number
US20030035798A1
US20030035798A1 US09/910,483 US91048301A US2003035798A1 US 20030035798 A1 US20030035798 A1 US 20030035798A1 US 91048301 A US91048301 A US 91048301A US 2003035798 A1 US2003035798 A1 US 2003035798A1
Authority
US
United States
Prior art keywords
antibody
humanized antibody
seq
ser
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/910,483
Other languages
English (en)
Inventor
Fang Fang
Lori Kohlstaedt
John Reno
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Perlan Therapeutics Inc
Original Assignee
Perlan Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Perlan Therapeutics Inc filed Critical Perlan Therapeutics Inc
Priority to US09/910,483 priority Critical patent/US20030035798A1/en
Assigned to PERLAN THERAPEUTICS, INC. reassignment PERLAN THERAPEUTICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FANG, FANG, KOHLSTAEDT, LORI, RENO, JOHN
Priority to DK02798403.8T priority patent/DK1414861T3/da
Priority to JP2003538209A priority patent/JP4516312B2/ja
Priority to CA2454361A priority patent/CA2454361C/en
Priority to AU2002363027A priority patent/AU2002363027C1/en
Priority to DE60238485T priority patent/DE60238485D1/de
Priority to PCT/US2002/023002 priority patent/WO2003035696A2/en
Priority to AT02798403T priority patent/ATE490276T1/de
Priority to EP10010857A priority patent/EP2336186A1/en
Priority to ES02798403T priority patent/ES2356896T3/es
Priority to CA2793019A priority patent/CA2793019A1/en
Priority to EP02798403A priority patent/EP1414861B1/en
Publication of US20030035798A1 publication Critical patent/US20030035798A1/en
Priority to US11/519,322 priority patent/US7696324B2/en
Priority to AU2008258214A priority patent/AU2008258214B2/en
Priority to JP2009119326A priority patent/JP2009183303A/ja
Priority to US12/748,304 priority patent/US8586712B2/en
Priority to AU2012203365A priority patent/AU2012203365A1/en
Priority to JP2013026399A priority patent/JP2013116119A/ja
Priority to US14/083,146 priority patent/US20140308269A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2821Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against ICAM molecules, e.g. CD50, CD54, CD102
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • A61P33/02Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06Antimalarials
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to humanized antibody compositions and methods of making and using humanized antibodies.
  • Monoclonal antibodies have become an important class of therapeutic proteins.
  • foreign immunoglobulins used in humans can elicit an anti-globulin response which may interfere with therapy or cause allergic or immune complex hypersensitivity.
  • a monoclonal antibody may be “humanized,” and this is typically carried out by CDR grafting.
  • CDR's also called hypervariable regions, are present in immunoglobulin light and heavy chains and are flanked by “framework” regions.
  • CDR grafting was first described in Jones et al. ((1986) Nature 321:522-525). In this and later publications, the CDRs of three mouse antibodies were grafted onto the variable domain frameworks of the human immunoglobulin NEW (V H ) and REI (V L ). The resulting humanized antibodies had the same antigen specificity and a similar affinity as the parental murine monoclonal antibody (mAb) (Jones et al. supra; Verhoeyen et al. (1988) Science 239:1534-1536; Riechmann et al. (1988) Nature 332:323-327; U.S. Pat. No. 5,225,539).
  • mAb monoclonal antibody
  • CDR grafting has been described by Queen and coworkers who reported the humanization of four murine monoclonal antibodies (Queen et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033; Co et al. (1991) Proc. Natl. Acad. Sci. USA 88:2869-2873; Co et al. (1992) J. Immunol. 148:1149-1154; and U.S. Pat. Nos. 5,585,089; 5,693,761; and 5,693,762).
  • Murine residues were inserted in the human framework in order to maintain affinity and, in each case the original antigen specificity was maintained.
  • the affinities of the humanized antibodies ranged from 1/3 to 3 times of the parental unmodified murine antibodies.
  • the invention provides humanized antibodies that bind ICAM-1.
  • the antibody is selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
  • Subsequences of antibodies that bind ICAM-1 are provided, for example, single chain, Fab, Fab′ and (Fab) 2 fragments.
  • the humanized antibody has greater affinity for ICAM-1 than the parental (non-human) antibody.
  • Varaint and modified forms of antibodies that bind ICAM-1 are also provided, for example, antibodies selected from SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI) having one or more amino acid substitutions, insertions or deletions.
  • the invention also provides humanized antibodies that bind ICAM-1 and inhibit pathogen infection of cells expressing ICAM-1.
  • Such invention antibodies include antibodies that provide greater protection from pathogen infection than parental (non-human) antibody.
  • a humanized antibody has a protective efficacy at least 2 times greater, 5 times greater, 10 times greater, 20 times greater, 30 times greater than the non-humanized antibody.
  • the pathogen is human rhinovirus (HRV), coxackie A virus, respiratory syncytial virus (RSV), or malaria.
  • the humanized antibodies of the invention include intact immunoglobulin molecules, comprising 2 full-length heavy chains and 2 full-length light chains, and subsequences that inhibit pathogen infection.
  • Particular subsequences include, for example, single chain, Fab, Fab′ or (Fab) 2 fragment.
  • the humanized antibodies of the invention include multispecific or multifunctional antibodies.
  • such an antibody is formed by linking a humanized antibody to one or more identical or different antibodies to form a multimer (e.g. using a linker).
  • Antibody multimers include a homo- or hetero-dimer, trimer, tetramer or any other higher order oligomer.
  • Antibody multimers that include different antibodies are human, humanized or non-human.
  • Multimeric forms include antibody oligomers that form via a multimerization domain (e.g. a human amino acid sequence) or a covalent bond.
  • Antibody multimers that include a multimerization domain further include forms having a linker located between the multimerization domain and the antibody.
  • the invention additionally provides nucleic acid sequences encoding humanized antibodies, subsequences and modified froms thereof (e.g., amin acid additions, deletions or substitutions). Nucleic acid sequences further include expression cassettes in which nucleic acid encoding humanized antibodies are operably linked to an expression control element. Vectors and cells (prokaryotic and eukaryotic) that include the nucleic acids also are provided.
  • the invention further provides pharmaceutical compositions including humanized antibodies, subsequences, multimers, variants and modified forms, and nucleic acids encoding them, and a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is compatible with inhalation or nasal delivery to a subject.
  • the invention further provides methods of inhibiting pathogen infection of a cell.
  • a method includes contacting a pathogen or a cell with an amount of a humanized antibody, subsequence, multimer, variant or modified form sufficient to inhibit pathogen infection of the cell.
  • the cell expresses ICAM-1.
  • the cell e.g., epithelial cell
  • the cell is present in a subject.
  • a method includes contacting HRV or a cell susceptible to HRV infection with an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to inhibit HRV infection of the cell (e.g., epithelial cell).
  • the cell is present in a subject.
  • the cell is present in a subject having or at risk of having asthma.
  • the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18.
  • the antibody, subsequence, multimer, variant or modified form binds to an antigen present on the surface of the cell (e.g., ICAM-1).
  • the humanized antibody is administered locally, via inhalation or intranasaly.
  • the invention also provides methods of inhibiting HRV infection, inhibiting HRV progression or treating HRV infection of a subject.
  • a method includes administering to a subject having or at risk of having HRV infection an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to inhibit HRV infection, inhibit HRV progression or treat HRV infection of the subject.
  • the subject has or is at risk of having asthma.
  • the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18.
  • the humanized antibody is administered locally, via inhalation or intranasaly.
  • the invention additionally provides methods of decreasing or inhibiting one or more symptoms of the common cold in a subject.
  • a method includes administering to a subject having a common cold an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to decrease or inhibit one or more symptoms of the common cold in the subject.
  • the subject has or is at risk of having asthma.
  • the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18.
  • the humanized antibody is administered locally, via inhalation or intranasaly.
  • FIG. 1 shows the amino acid sequence of murine 1A6 antibody and human consensus sequence of heavy chain subgroup III (Humiii) and light chain kappa subgroup I. Asterisks denote amino acid differences between human and mouse sequence. CDR amino acids are in bold face.
  • FIG. 2 shows a molecular model of humanized 1A6 (Hum B).
  • A Side view of humB variable domains. Yellow: V H ; green: V L ; pale blue: CDRs; red: the six high risk “Vernier zone” residues and the V H 60-64.
  • B Top view of humB variable domains. Yellow: V H ; green: V L ; pale blue: CDRs; red: the six high risk “Vernier zone” residues and the V H 60-64.
  • C V L 49 and its surrounding residues. Magenta: ICAM-1; red: V H and V L residues; blue: residues at V H -V L interphase; purple: W102 in V H .
  • FIG. 3 shows the amino acid sequence of murine 1A6 antibody, humanized 1A6 (HumB) and human consensus sequences of heavy chain subgroup III (Humiii) and light chain kappa subgroup I. Asterisks and bold face amino acids are as previously indicated.
  • FIG. 4 shows the cDNA sequence of humanized scFV3 (HumA) antibody. Restriction sites are indicated by underlining.
  • FIG. 5 shows protection from HRV15 infection with mouse 1A6 scFv antibody and humanized 1A6 scFv antibody HumA, HumB, HumC, HumD, HumF, HumH and HumI.
  • the present invention is based, at least in part, upon producing humanized antibodies. More particularly, complementarity determining region (CDR) from a non-human antibody are grafted into a human framework region. Following grafting, one or more amino acids of the antibody are mutated to human sequences. For example, mutating a murine amino acid to a human amino acid in a framework region or CDR of the grafted antibody can produce a humanized antibody having increased antigen binding affinity relative to the non-human or grafted antibody. Humanized antibodies are not immunogenic or are less immunogenic than non-human antibodies when administered to human subjects. Therefore, humanized antibodies are useful in a variety of therapeutic and diagnostic applications.
  • CDR complementarity determining region
  • a humanized antibody of the invention protects cells from HRV infection, a virus that can cause the common cold, and other associated disorders (e.g. otitis media, bronchitis, sinusitis etc.).
  • a humanized antibody binds to ICAM-1.
  • a humanized antibody that binds ICAM-1 protects against pathogen infection of cells expressing ICAM-1.
  • a humanized antibody is selected from any of SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
  • a humanized antibody has a greater or less affinity for the antigen than the donor non-human antibody.
  • affinities range from greater or less affinity for the antigen than either the donor or recombinant antibody.
  • humanized antibody has an antigen binding affinity 4-fold, 5-fold, 5- to 8-fold, 5- to 10-fold, 8- to 15-fold, 10- to 20-fold, 20- to 100-fold or greater than the parental antibody.
  • Human antibody sequence regions can be used for producing humanized antibodies of the invention.
  • a “consensus sequence,” an antibody sequence having the most frequently occurring amino acid residues at particular positions in an antibody or an antibody region, may be used.
  • human variable region domain sequences are described in Kabat ( Sequences of Proteins of Immunological Interest. 4 th Ed.US Department of Health and Human Services. Public Health Service (1987)). Sequences that are completely determined in the framework regions, 1-23, 35-49, and 57-88 in the light chains, and in the framework regions, 1-30, 36-49, and 66-94, in the heavy chains, are included in the survey.
  • For the fourth framework region, 98-107 in the light chain and 103-113 in the heavy chain, residues that can be derived from the known J-minigene segments are surveyed.
  • Consensus sequences may therefore be identified by surveying amino acid residues at each position of a plurality of antibodies; the most frequently occurring amino acid at a given position in the region of interest is a part of the consensus. In many instances, more than one residue will be found at high frequency at a given position. In such cases, if the amino acid that occurs at least one-fourth as frequently as the most frequently occurring the amino acid residue is considered a part of the consensus sequence.
  • CDR donor for producing humanized antibody.
  • Murine antibodies secreted by hybridoma cell lines can also be used.
  • Donor CDRs are selected based upon the antigen to which the antibody binds.
  • donor CDRs include sequences from antibodies that bind to pathogens, such as bacteria, viruses, protozoa and other microorganisms.
  • Donor CDRs also include antibodies that bind to molecules to which the pathogens bind, for example, cell surface proteins (e.g., adhesion proteins, receptor proteins, immune-recognition/modulation proteins such as HLA, tumor associated antigens, etc.).
  • the donor antibody is a mouse monoclonal antibody 1A6 (mAb1A6), which specifically binds to ICAM-1.
  • CDRs complementarity determining regions
  • CDRs refer to sequence regions that confer antibody specificity and affinity.
  • CDRs are also generally known as supervariable regions or hypervariable loops.
  • CDR regions of antibodies have been mapped and are defined as in Kabat ( Sequences of Proteins of Immunological Interest. 4 th Ed.US Department of Health and Human Services. Public Health Service (1987)) and Chothia and Lesk ((1987) J. Mol. Biol. 186:651-663)).
  • CDR1 is defined as H26-H35
  • CDR2 is H50-65
  • CDR3 is H95-H102
  • CDR 1 is L24-L34
  • CDR2 is L50-L56
  • CDR3 is L89-L97.
  • the amino acids are numbered according to the scheme described in Kabat ( Sequences of Proteins of Immunological Interest. 4 th Ed.US Department of Health and Human Services. Public Health Service (1987)).
  • Variable region domains typically comprise the amino-terminal approximately 105-115 amino acids a of a naturally-occurring immunoglobulin chain (e.g., amino acids 1-110). Variable domains shorter or longer than these exemplary sequence lengths may also be used.
  • a humanized antibody has increased affinity for the antigen relative to non-humanized antibody (e.g., less than 1.18 ⁇ 10 ⁇ 6 M in K D against ICAM-1, less than 1 ⁇ 10 ⁇ 7 M in K D , less than 5 ⁇ 10 ⁇ 7 M in K D , less than 1 ⁇ 10 ⁇ 8 M in K D , less than 5 ⁇ 10 ⁇ 8 M in K D ).
  • a humanized antibody comprises an amino acid sequence set forth in any of SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI); and antigen binding subsequences thereof.
  • an antibody subsequence comprises Fab, Fab′, (Fab′) 2 , Fv, and single chain antibody (SCA), e.g., scFv fragments.
  • the humanized antibodies of the invention also include antibody multimers.
  • a multimer comprises a dimer, trimer, tetramer or other higher order oligomer.
  • multimers comprise combinations of the same antibodies (homo-oligomers) and different antibodies (hetero-oligomers), the different antibodies being human, humanized or non-human.
  • polypeptide and “peptide” are used interchangeably herein to refer to two or more covalently linked amino acids, also referred to as “residues,” through an amide bond or equivalent.
  • Polypeptides are of unlimited length and may be comprised of L- or D-amino acids as well as mixtures thereof.
  • Amino acids may be linked by non-natural and non-amide chemical bonds including, for example, those formed with glutaraldehyde, N-hydoxysuccinimide esters, bifunctional maleimides, or N,N′-dicyclohexylcarbodiimide (DCC).
  • Non-amide bonds include, for example, ketomethylene, aminomethylene, olefin, ether, thioether and the like (see, e.g., Spatola (1983) in Chemistry and Biochemistry of Amino Acids, Peptides and Proteins , Vol. 7, pp 267-357, “Peptide and Backbone Modifications,” Marcel Decker, N.Y.).
  • Polypeptides may have one or more cyclic structures such as an end-to-end amide bond between the amino and carboxy-terminus of the molecule or intra- or inter-molecular disulfide bond.
  • Polypeptides may be modified in vitro or in vivo, e.g., post-translationally modified to include, for example, sugar residues, phosphate groups, ubiquitin, fatty acids or lipids.
  • Polypeptides further include amino acid structural and functional analogues, for example, peptidomimetics having synthetic or non-natural amino acids or amino acid analogues.
  • antibody refers to a protein that binds to other molecules (antigens) via heavy and light chain variable domains, V H and V L , respectively.
  • Antibodies include IgG, IgD, IgA, IgM and IgE.
  • the antibodies may be intact immunoglobulin molecules, two full length heavy chains linked by disulfide bonds to two full length light chains, as well as subsequences (i.e. fragments) of immunoglobulin molecules, with our without constant region, that bind to an epitope of an antigen, or subsequences thereof (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen.
  • Antibodies may comprise full length heavy and light chain variable domains, V H and V L , individually or in any combination.
  • V H and V L may comprise full length heavy and light chain variable domains, individually or in any combination.
  • SEQ ID NO:1 and 3 HumA
  • SEQ ID NO:5 and 7 HumB
  • SEQ ID NO:9 and 11 HumC
  • SEQ ID NO:13 and 15 HumD
  • SEQ ID NO:17 and 19 HumE
  • SEQ ID NO:21 and 23 HumF
  • SEQ ID NO:25 and 27 HumG
  • SEQ ID NO:29 and 31 HumH
  • SEQ ID NO:33 and 35 HumI
  • Polypeptide sequences can be made using recombinant DNA technology of polypeptide encoding nucleic acids via cell expression or in vitro translation, or chemical synthesis of polypeptide chains using methods known in the art.
  • Antibodies according to the invention including humanized sequences and subsequences can be expressed from recombinantly produced antibody-encoding nucleic acid (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory, 1989; Harlow and Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory, 1999; Fitzgerald et al., J. A. C. S. 117:11075 (1995); Gram et al., Proc. Natl. Acad. Sci.
  • cDNA encoding humanized antibody sequences can be expressed in bacteria in order to produce invention antibodies.
  • Antibodies may also be produced by expressing encoding nucleic acids in mammalian, insect, and plant cells.
  • Polypeptide sequences including antibodies can also be produced by a chemical synthesizer (see, e.g., Applied Biosystems, Foster City, Calif.).
  • subsequence or “fragment” means a portion of the full length molecule.
  • a subsequence of an antibody is one or more amino acid less in length than full length polypeptide (e.g. one or more internal or terminal amino acid deletions from either amino or carboxy-termini). Subsequences therefore can be any length up to the full length molecule.
  • antibody subsequences include, for example, Fab, Fab′, (Fab′) 2 , Fv, or single chain antibody (SCA) fragment (e.g., scFv).
  • Subsequences include portions which retain at least part of the function or activity of full length sequence. For example, an antibody subsequence will retain the ability to selectively bind to an antigen even though the binding affinity of the subsequence may be greater or less than the binding affinity of the full length antibody.
  • Subsequences can comprise a portion of any of the invention humanized sequences, for example, any of SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
  • HumA SEQ ID NO: 1 and 3
  • HumB SEQ ID NO:9 and 11
  • HumD SEQ ID NO:13 and 15
  • HumD SEQ ID NO:17 and 19
  • HumF SEQ ID NO:21 and 23
  • SEQ ID NO:25 and 27 HumG
  • SEQ ID NO:29 and 31 HumH
  • SEQ ID NO:33 and 35 HumI
  • an Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
  • An (Fab′) 2 fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction.
  • An Fab′ fragment of an antibody molecule can be obtained from (Fab′) 2 by reduction with a thiol reducing agent, which yields a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab′ fragments are obtained per antibody molecule treated in this manner.
  • An Fv fragment is a fragment containing the variable region of a light chain V L and the variable region of a heavy chain V H expressed as two chains.
  • the association may be non-covalent or may be covalent, such as a chemical cross-linking agent or an intermolecular disulfide bond (Inbar et al., (1972) Proc. Natl. Acad Sci. USA 69:2659; Sandhu (1992) Crit. Rev. Biotech. 12:437).
  • a single chain antibody (“SCA”) is a genetically engineered or enzymatically digested antibody containing the variable region of a light chain V L and the variable region of a heavy chain, optionally linked by a flexible linker, such as a polypeptide sequence, in either V L -linker-V H orientation or in V H -linker-V L orientation.
  • a single chain Fv fragment can be produced by linking two variable domains via a disulfide linkage between two cysteine residues.
  • Methods for producing scFv antibodies are described, for example, by Whitlow et al., (1991) In: Methods: A Companion to Methods in Enzymology 2:97; U.S. Pat. No. 4,946,778; and Pack et al., (1993) Bio/Technology 11:1271.
  • antibody subsequences such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, provided that the subsequences bind to the antigen to which the intact antibody binds.
  • binding means that the compositions referred to have affinity for each other. “Specific binding” is where the binding is selective between two molecules. A particular example of specific binding is that which occurs between an antibody and an antigen. Typically, specific binding can be distinguished from non-specific when the dissociation constant (K D ) is less than about 1 ⁇ 10 ⁇ 5 M or less than about 1 ⁇ 10 ⁇ 6 M or 1 ⁇ 10 ⁇ 7 M. Specific binding can be detected, for example, by ELISA, immunoprecipitation, coprecipitation, with or without chemical crosslinking, two-hybrid assays and the like. Appropriate controls can be used to distinguish between “specific” and “non-specific” binding.
  • K D dissociation constant
  • Invention antibodies including full length antibodies, subsequences (e.g., single chain forms) may be present as dimer, trimers, tetramers, pentamers, hexamers or any other higher order oligomer that retains at least a part of antigen binding activity of monomer.
  • Multimers can comprise heteromeric or homomeric combinations of full length antibody, subsequences, unmodified or modified as set forth herein and known in the art.
  • Antibody multimers are useful for increasing antigen avidity in comparison to monomer due to the multimer having multiple antigen binding sites.
  • Antibody multimers are also useful for producing oligomeric (e.g., dimer, trimer, tertamer, etc.) combinations of different antibodies thereby producing compositions of antibodies that are multifunctional (e.g., bifunctional, trifunctional, tetrafunctional, etc.).
  • multifunctional means that the composition referred to has two or more activities or functions (e.g., antigen binding, enzyme activity, ligand or receptor binding, toxin, etc.).
  • an antibody that binds to a particular antigen which also has an attached polypeptide with enzyme activity e.g., luciferase, acetyltransferase, galactosidase, peroxidase, etc.
  • luciferase e.g., luciferase, acetyltransferase, galactosidase, peroxidase, etc.
  • Multifunctional antibodies further include multispecific (e.g., bispecific, trispecific, tetraspecific, etc.) forms.
  • multispecific means an antibody that binds to two or more different antigenic epitopes.
  • multispecific means that the antibody contains two or more variable region sequences that bind to different epitopes.
  • the different epitopes may be present on the same antigen or different antigens.
  • a multispecific antibody oligomer comprises a mixture of two or more antibodies each having different epitope binding specificity and which form a multimer.
  • Multispecific antibodies may be comprised of individual antigen binding polypeptides each of which have distinct variable domains. For example, one of the antibodies may have two variable domains each of which recognizes a different epitope.
  • Candidate functions for multifunctional antibodies other than antigen binding and in addition to enzyme activity include, for example, detectable moieties such as radioisotopes and amino acid sequences (e.g., 35 S, 131 I, T7, immunoglobulin or polyhistidine tags, toxins (e.g., ricin, cholera, pertussis), cell surface proteins such as receptors, ligands (substrates, agonists and antagonists), adhesion proteins (e.g., streptavidin, avidin, lectins), growth factors, differentiative factors and chemotactic factors.
  • detectable moieties such as radioisotopes and amino acid sequences (e.g., 35 S, 131 I, T7, immunoglobulin or polyhistidine tags, toxins (e.g., ricin, cholera, pertussis), cell surface proteins such as receptors, ligands (substrates, agonists and antagonists), adhesion proteins (e.g.,
  • Multifunctional humanized antibodies can be produced through chemical crosslinking of the selected molecules (which have been produced by synthetic means or by expression of nucleic acid that encode the polypeptides) or through recombinant DNA technology combined with in vitro, or cellular expression of the polypeptide, and subsequent oligomerization.
  • Multispecific antibodies can be similarly produced through recombinant technology and expression, fusion of hybridomas that produce antibodies with different epitopic specificities, or expression of multiple nucleic acid encoding antibody variable chains with different epitopic specificities in a single cell.
  • Antibodies may be either joined directly or indirectly through covalent or non-covalent binding, e.g. via a multimerization domain, to produce multimers.
  • a “multimerization domain” mediates non-covalent protein-protein interactions. Specific examples include coiled-coil (e.g., leucine zipper structures) and alpha-helical protein sequences. Sequences that mediate protein-protein binding via Van der Waals' forces, hydrogen bonding or charge-charge bonds are also contemplated as multimerization domains. Additional examples include basic-helix-loop-helix domains and other protein sequences that mediate heteromeric or homomeric protein-protein interactions among nucleic acid binding proteins (e.g., DNA binding transcription factors, such as TAFs).
  • nucleic acid binding proteins e.g., DNA binding transcription factors, such as TAFs
  • multimerization domain p53 residues 319 to 360 which mediate tetramer formation.
  • human platelet factor 4 which self-assembles into tetramers.
  • extracellular protein TSP4 a member of the thrombospondin family, which can form pentamers.
  • Additional specific examples are the leucine zippers of jun, fos, and yeast protein GCN4.
  • Humanized antibodies may be directly linked to each other via a chemical cross linking agent or can be connected via a linker sequence (e.g., a peptide sequence) to form multimers.
  • linker or “spacer” refers to a molecule or group of molecules that connects two or more molecules to each other.
  • a flexible linker allows rotation of the two molecules linked to each other to the extent that the molecules do not block each others function.
  • a linker such as an amino acid sequence attached to a humanized antibody which is itself attached to a multimerization domain, allows the antibody to bind to antigen without significant steric interference from the multimers of the oligomer.
  • Non-peptide linkers include chemical cross linking agents and polyethylene glycol.
  • Linker amino acid sequences may be fully human, humanized or non-human amino acid sequences, unmodified or modified as set forth herein.
  • the invention therefore further provides humanized antibodies that include a linker sequence.
  • Linker sequences include, for example, sequences from about 2 to 10, 10 to 20, 10 to 30, 25 to 50, 30 to 60 and 50 to 75 amino acids in length.
  • Antibodies also include modified forms such as sequences having one or more amino acid substitutions, additions or deletions, provided the modification does not destroy function, e.g., does not destroy antigen binding activity; the antibody retains, at least in part, antigen binding activity.
  • a modified humanized antibody will retain, at least in part, affinity for the antigen to which unmodified antibody binds.
  • the term “modification” therefore denotes an alteration of a molecule that does not destroy an activity of the modified molecule.
  • Modifications therefore include, for example, amino acid additions, insertions, deletions and substitutions.
  • An example of an addition is where one or more amino acids are added to the N- or C-terminal end of a humanized antibody.
  • An example of an insertion is where an amino acid is inserted into the sequence.
  • An example of a deletion is where one or more amino acids are deleted from the N- or C-terminal end, or internally within the sequence.
  • a humanized antibody has one or more amino acid substitutions of a sequence set forth in SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), provided that the substituted antibody is capable of antigen binding.
  • one or more of the amino acid substitutions are conservative amino acid substitutions.
  • the substitution comprises 1-3, 3-5 or 5-10 amino acids.
  • the substitution is with a human amino acid.
  • Exemplary amino acid substitutions include conservative amino acid substitutions.
  • conservative amino acid substitution means the replacement of one amino acid by a biologically or chemically similar residue.
  • Biologically similar means that the substitution is compatible with biological activity, e.g., for a humanized antibody, antigen binding.
  • Particular examples of conservative substitutions include the substitution of one hydrophobic residue, such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, serine for threonine, and the like.
  • Modifications also include derivatized sequences, for example, amino acids in which free amino groups form amine hydrochlorides, p-toluene sulfonyl groups, cabrobenzoxy groups; the free carboxy groups from salts, methyl and ethyl esters; free hydroxl groups that form O-acyl or O-alkyl derivatives, as well as naturally occurring amino acid derivatives, for example, 4-hydroxyproline, for proline, 5-hydroxylysine for lysine, homoserine for serine, ornithine for lysine, etc. Also included are modifications that confer covalent bonding, for example, a disulfide linkage between two cysteine residues thereby producing a cyclic polypeptide. Modifications can be produced using any of a variety of methods well known in the art (e.g., PCR based sited-directed, deletion and insertion mutagenesis, chemical modification and mutagenesis, cross-linking, etc.).
  • Modifications also include addition of functional entities such as tags (e.g., polyhistidine, T7, immunoglubulin, etc.), gold particles, covalently or non-covalently attached to the humanized antibodies or subsequences or multimers.
  • tags e.g., polyhistidine, T7, immunoglubulin, etc.
  • gold particles covalently or non-covalently attached to the humanized antibodies or subsequences or multimers.
  • the invention provides modified humanized antibodies having one or more activities (e.g., retain at least part of the antigen binding activity) of unmodified parent antibody.
  • Modifications include radioactive or alternatively non-radioactive detectable labels attached to or incorporated into the molecule.
  • identity means that two or more referenced entities are the same. Thus, where two nucleic acid sequences are identical, they have the same sequence. “Areas of identity” means that a portion of two or more referenced entities are the same. Thus, where two nucleic acid sequences are identical over one or more parts of their sequence, they share identity in these areas.
  • substantially identity means that the identity is structurally or functionally significant. That is, the identity is such that the molecules are structurally identical or perform the same function (e.g., biological function) even though the molecules differ. Due to variation in the amount of sequence conservation between structurally and functionally related proteins, the amount of sequence identity for substantial identity will depend upon the type of region/domain and its function.
  • sequence homology For nucleic acid sequences, 50% sequence homology and above may constitute substantial homology. Substantial homology for proteins can be significantly less, for example, as little as 30% sequence homology, but typically is more, e.g., 50%, 60%, 75%, 85% or more.
  • BLAST e.g., BLAST 2.0
  • exemplary search parameters as follows: Mismatch -2; gap open 5; gap extension 2.
  • a BLASTP algorithm is typically used in combination with a scoring matrix, such as PAM100, PAM 250, BLOSUM 62 and the like.
  • compositions when used as a modifier of invention compositions (e.g., antibodies, subsequences, modified forms, multimers, nucleic acids encoding same, cells, vectors, etc.), means that the compositions are made by the hand of man and are separated from their naturally occurring in vivo environment. Generally, compositions so separated are substantially free of one or more materials with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cell membrane.
  • An “isolated” antibody can also be “substantially pure” when free of most or all of the materials with which they may normally associate with in nature.
  • an isolated molecule that also is substantially pure does not include polypeptides or polynucleotides present among millions of other sequences, such as antibodies of an antibody library or nucleic acids in a genomic or cDNA library, for example.
  • Purity can be at least about 60% or more by mass. The purity can also be about 70% or 80% or more, and can be greater, for example, 90% or more. Purity can be determined by any appropriate method, including, for example, UV spectroscopy, chromatography (e.g., HPLC, gas phase), gel electrophoresis (e.g., silver or coomassie staining) and sequence analysis (nucleic acid and peptide).
  • the invention also provides nucleic acids encoding invention humanized antibodies, including high affinity humanized antibodies, subsequences, modified forms and multimers thereof.
  • a nucleic acid encodes a polypeptide set forth in SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
  • nucleic acid refers to at least two or more ribo- or deoxy-ribonucleic acid base pairs that are linked through a phosphoester bond or equivalent.
  • Nucleic acids include polynucleotides and polynculeosides.
  • Nucleic acids include single, double or triplex, circular or linear, molecules.
  • a nucleic acid molecule may belong exclusively or in a mixture to any group of nucleotide-containing molecules, as exemplified by, but not limited to, the following groups of nucleic acid molecules: RNA, DNA, cDNA, genomic nucleic acids, non-genomic nucleic acids, naturally occurring and non naturally occurring nucleic acids and synthetic nucleic acids. This includes, by way of example, nucleic acids associated with any organelle, such as the mitochondria, ribosomal RNA, and nucleic acid molecules comprised chimerically of one or more components that are not naturally occurring along with naturally occurring components.
  • nucleic acid molecule may contain in part one or more non-nucleotide-based components as exemplified by, but not limited to, amino acids and sugars.
  • a ribozyme that is in part nucleotide-based and in part protein-based is considered a “nucleic acid molecule.”
  • Nucleic acids can be of any length. Nucleic acid lengths typically range from about 20 to 10 Kb, 10 to 5 Kb, 1 to 5 Kb or less, 1000 to about 500 base pairs or less in length. Nucleic acids can also be shorter, for example, 100 to about 500 base pairs, or from about 12 to 25, 25 to 50, 50 to 100, 100 to 250, or about 250 to 500 base pairs in length.
  • nucleic acids include sequences and subsequences degenerate with respect to nucleic acids that encode SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and subsequences thereof.
  • HumA SEQ ID NO:5 and 7
  • HumC SEQ ID NO:9 and 11
  • HumD SEQ ID NO:13 and 15
  • HumE SEQ ID NO:17 and 19
  • HumF SEQ ID NO:21 and 23
  • HumG SEQ ID NO:25 and 27
  • HumH SEQ ID NO:29 and 31
  • Nucleic acids also include sequences complementary to a sequence that encodes SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and subsequences thereof.
  • Nucleic acid subsequences have from about 15 to 25, 25 to 50 or 50 to 100 nucleotides. Such nucleic acids are useful for hybridization to detect the presence or an amount of humanized antibody in a sample (in vitro, cell, culture medium, tissue or organ, serum, in a subject, etc.).
  • the invention further includes nucleic acids that hybridize at high stringency to nucleic acids that encode SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), subsequences thereof and nucleic acid sequences complementary thereto.
  • Hybridizing nucleic acids are also useful for detecting the presence or an amount of humanized antibody in a sample.
  • hybridize refers to the binding between complementary nucleic acids. Sequences will generally have more than about 50% homology to a nucleic acid that encodes SEQ ID NO: 1 or 3 (HumA); SEQ ID NO:5 or 7 (HumB); SEQ ID NO:9 or 11 (HumC); SEQ ID NO:13 or 15 (HumD); SEQ ID NO:17 or 19 (HumE); SEQ ID NO:21 or 23 (HumF); SEQ ID NO:25 or 27 (HumG); SEQ ID NO:29 or 31 (HumH); and SEQ ID NO:33 or 35 (HumI).
  • the region between related sequences can extend over at least about 30 base pairs, or about 50 base pairs, or about 100 to 200 or more residues.
  • the T M (melting temperature) refers to the temperature at which binding between complementary sequences is no longer stable. For two sequences to bind, the temperature of a hybridization reaction must be less than the calculated T M for the sequences.
  • the T M is influenced by the amount of sequence complementarity, length, composition (% GC), type of nucleic acid (RNA vs. DNA), and the amount of salt, detergent and other components in the reaction (e.g., formamide). All of these factors are considered in establishing appropriate hybridization conditions (see, e.g., the hybridization techniques and formula for calculating T M described in Sambrook et al., 1989, supra).
  • hybridization stringency can be determined empirically, for example, by washing under particular conditions, e.g., at low stringency conditions or high stringency conditions.
  • Optimal conditions for selective hybridization will vary depending on the particular hybridization reaction involved.
  • An example of high stringency hybridization conditions are as follows: 2 ⁇ SSC/0.1% SDS at about 37EC or 42EC (hybridization conditions); 0.5 ⁇ SSC/0.1% SDS at about room temperature (low stringency wash); 0.5 ⁇ SSC/0.1% SDS at about 42EC (moderate stringency wash); and 0.1 ⁇ SSC/0.1% SDS at about 65EC (high stringency wash).
  • Nucleic acids of the invention can be produced using various standard cloning and chemical synthesis techniques. Such techniques include, but are not limited to: 1) nucleic acid amplification, e.g., polymerase chain reaction (PCR), with genomic DNA or cDNA targets using primers (e.g., a degenerate primer mixture) capable of annealing to antibody sequence; 2) chemical synthesis of nucleic acid sequences which can then be cloned into a plasmid, propagated amplified and purified and; 3) computer searches of databases for related sequences. Purity of nucleic acids can be determined through sequencing, gel electrophoresis and the like.
  • PCR polymerase chain reaction
  • primers e.g., a degenerate primer mixture
  • the invention further provides expression cassettes comprising a nucleic acid encoding a humanized antibody operably linked to an expression control element.
  • operably linked refers to a physical or a functional relationship between the elements referred to that permit them to operate in their intended fashion.
  • an expression control element “operably linked” to a nucleic acid means that the control element modulates transcription and as appropriate, translation of the transcript.
  • nucleic acid there need not be physical linkage to nucleic acid in order to control expression.
  • physical linkage is not required for the elements to be operably linked.
  • a minimal element can be linked to a nucleic acid encoding a humanized antibody.
  • a second element that controls expression of an operably linked nucleic acid encoding a protein that functions “in trans” to bind to the minimal element can influence expression of the humanized antibody. Because the second element regulates expression of humanized antibody, the second element is operably linked to the nucleic acid encoding the humanized antibody.
  • expression control element refers to nucleic acid that influences expression of an operably linked nucleic acid. Promoters and enhancers are particular non-limiting examples of expression control elements.
  • a “promotor sequence” is a DNA regulatory region capable of initiating transcription of a downstream (3′ direction) coding sequence. The promoter sequence includes a minimum number of bases necessary to initiate transcription. Enhancers also regulate gene expression but can function a distance from the transcription start site of the gene to which it is operably linked. Enhancers also function at either 5′ or 3′ ends of the gene, as well as within the gene (e.g., in introns or coding sequences).
  • An expression control element can confer expression in a manner that is “constitutive,” such that transcription of the operably linked nucleic acid occurs without the presence of a signal or stimuli.
  • Expression control elements can confer expression in a manner that is “regulatable,” that is, a signal or stimuli increases or decreases expression of the operably linked nucleic acid.
  • a regulatable element that increases expression of the operably linked nucleic acid in response to a signal or stimuli is also referred to as an “inducible element”
  • a regulatable element that decreases expression of the operably linked nucleic acid in response to a signal or stimuli is referred to as a “repressible element” (i.e., the signal decreases expression such that when the signal, is removed or absent, expression is increased).
  • Expression control elements include elements active in a particular tissue or cell type, referred to herein as a “tissue-specific expression control elements.” Tissue-specific expression control elements are typically active in specific cell or tissue because they are recognized by transcriptional activator proteins, or other regulators of transcription, that are unique to a specific cell or tissue type.
  • Expression control elements additionally include elements that confer expression at a particular stage of the cell cycle or differentiation. Accordingly, the invention further includes expression control elements that confer constitutive, regulatable, tissue-specific, cell cycle specific, and differentiation stage specific expression.
  • Expression control elements include full-length nucleic acid sequences, such as native promoter and enhancer elements, as well as subsequences or nucleotide variants thereof (e.g., substituted/mutated or other forms that differ from native sequences) which retain all or part of full-length or non-variant control element function (confer regulation, e.g., retain some amount of inducibility in response to a signal or stimuli).
  • constitutive promoters such as T7 and the like, as well as inducible promoters such as pL of bacteriophage ⁇ , plac, ptrp, ptac (ptrp-lac hybrid promoter) may be used.
  • inducible promoters e.g., ecdysone
  • yeast constitutive or inducible promoters may be used (see, e.g., Ausubel et al., In: Current Protocols in Molecular Biology , Vol. 2, Ch. 13, ed., Greene Publish. Assoc.
  • a constitutive yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used (R. Rothstein In: DNA Cloning, A Practical Approach , Vol. 11, Ch. 3, ed. D.M. Glover, IRL Press, Wash., D.C., 1986).
  • constitutive promoters of viral or other origins may be used.
  • SV40, or viral long terminal repeats (LTRs) and the like, or inducible promoters derived from the genome of mammalian cells (e.g., metallothionein IIA promoter; heat shock promoter, steroid/thyroid hormone/retinoic acid response elements) or from mammalian viruses (e.g., the adenovirus late promoter; the inducible mouse mammary tumor virus LTR) can be used for expression.
  • the invention also provides transformed cells and progeny thereof into which a nucleic acid molecule encoding humanized antibody has been introduced by means of recombinant DNA techniques in vitro, ex vivo or in vivo.
  • the transformed cells can be propagated and the introduced nucleic acid transcribed, or encoded protein expressed.
  • a progeny cell may not be identical to the parental cell, since there may be mutations that occur during replication.
  • Transformed cells include but are not limited to prokaryotic and eukaryotic cells such as bacteria, fingi, plant, insect, and animal (e.g., mammalian, including human) cells.
  • the cells may be present in culture, in a cell, tissue or organ ex vivo or present in a subject.
  • transformed means a genetic change in a cell following incorporation of nucleic acid (e.g., a transgene) exogenous to the cell.
  • a “transformed cell” is a cell into which, or a progeny of which a nucleic acid molecule has been introduced by means of recombinant DNA techniques.
  • Cell transformation to produce host cells may be carried out as described herein or using techniques known in the art. Accordingly, methods of producing cells containing the nucleic acids and cells expressing the humanized antibodies of the invention are also provided.
  • vector refers to, e.g., a plasmid, virus, such as a viral vector, or other vehicle known in the art that can be manipulated by insertion or incorporation of a nucleic acid, for genetic manipulation (i.e., “cloning vectors”), or can be used to transcribe or translate the inserted polynucleotide (i.e., “expression vectors”).
  • cloning vectors can be used to transcribe or translate the inserted polynucleotide
  • expression vectors are useful for introducing nucleic acids, including a nucleic acid that encodes a humanized antibody operably linked with an expression control element, and expressing the encoded protein in vitro (e.g., in solution or in solid phase), in cells or in vivo.
  • a vector generally contains at least an origin of replication for propagation in a cell.
  • Control elements including expression control elements as set forth herein, present within a vector, are included to facilitate transcription and translation.
  • expression control element is intended to include, at a minimum, one or more components whose presence can influence expression, and can include components other than or in addition to promoters or enhancers, for example, leader sequences and fusion partner sequences, internal ribosome binding sites (IRES) elements for the creation of multigene, or polycistronic, messages, splicing signal for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA, polyadenylation signal to provide proper polyadenylation of the transcript of a gene of interest, stop codons, etc.
  • IRS internal ribosome binding sites
  • Vectors can include a selection marker.
  • selection marker means a gene that allows for the selection of cells containing the gene.
  • “Positive selection” refers to a process whereby only cells that contain the selection marker will survive upon exposure to the positive selection.
  • Drug resistance is one example of a positive selection marker; cells containing the marker will survive in culture medium containing the selection drug, and cells which do not contain the marker will die.
  • markers include drug resistance genes such as neo, which confers resistance to G418, hygr, which confers resistance to hygromycin, or puro which confers resistance to puromycin, among others.
  • Other positive selection marker genes include genes that allow identification or screening of cells containing the marker. These genes include genes for fluorescent proteins (GFP), the lacZ gene, the alkaline phosphatase gene, and surface markers such as CD8, among others.
  • Vectors can contain negative selection markers.
  • Negative selection refers to a process whereby cells containing a negative selection marker are killed upon exposure to an appropriate negative selection agent.
  • HSV-tk herpes simplex virus-thymidine kinase
  • GANC drug gancyclovir
  • the gpt gene renders cells sensitive to 6-thioxanthine.
  • Additional selection systems may be used, including, but not limited to the hypoxanthine-guanine phosphoribosyltransferase gene (Szybalska et al., Proc. Natl. Acad. Sci. USA 48:2026 (1962)), and the adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes. Additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman et al., Proc. Natl. Acad. Sci.
  • Vectors included are those based on viral vectors, such as retroviral, adeno-associated virus, adenovirus, reovirus, lentivirus, rotavirus genomes, simian virus 40 (SV40) or bovine papilloma virus, etc., modified for introducing and expressing a nucleic acid in a cell (Cone et al., Proc. Natl. Acad. Sci. USA 81:6349 (1984)). (Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982; Sarver et al., Mol. Cell. Biol. 1:486 (1981)).
  • viral vectors such as retroviral, adeno-associated virus, adenovirus, reovirus, lentivirus, rotavirus genomes, simian virus 40 (SV40) or bovine papilloma virus, etc.
  • Additional viral vectors useful for expression include parvovirus, rotavirus, Norwalk virus, coronaviruses, paramyxo and rhabdoviruses, togavirus (e.g., Sindbis virus and semliki forest virus) and vesicular stomatitis virus.
  • parvovirus rotavirus
  • Norwalk virus coronaviruses
  • paramyxo and rhabdoviruses e.g., Sindbis virus and semliki forest virus
  • togavirus e.g., Sindbis virus and semliki forest virus
  • vesicular stomatitis virus e.g., Sindbis virus and semliki forest virus
  • Mammalian expression systems further include vectors specifically designed for in vivo and ex vivo expression.
  • Such systems include adeno-associated virus (AAV) vectors (U.S. Pat. No. 5,604,090).
  • AAV vectors have previously been shown to provide expression of Factor IX in humans and in mice at levels sufficient for therapeutic benefit (Kay et al., Nat. Genet. 24:257 (2000); Nakai et al., Blood 91:4600 (1998)).
  • Adenoviral vectors U.S. Pat. Nos. 5,700,470, 5,731,172 and 5,928,944
  • herpes simplex virus vectors U.S. Pat. No.
  • vectors U.S. Pat. Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516 and 5,674,703 and WIPO publications W092/05266 and W092/14829
  • papilloma virus vectors e.g., human and bovine papilloma virus
  • Vectors also include cytomegalovirus (CMV) based vectors (U.S. Pat. No. 5,561,063).
  • CMV cytomegalovirus
  • Vectors that efficiently deliver genes to cells of the intestinal tract have been developed and also may be used (see, e.g., U.S. Pat. Nos. 5,821,235, 5,786,340 and 6,110,456).
  • yeast vectors that facilitate integration of foreign nucleic acid sequences into a chromosome, via homologous recombination, for example, are known in the art and can be used.
  • Yeast artificial chromosomes YAC are typically used when the inserted nucleic acids are too large for more conventional vectors (e.g., greater than about 12 kb).
  • nucleic acid encoding humanized antibody and humanized antibody into target cells can also be carried out by conventional methods known in the art such as osmotic shock (e.g., calcium phosphate), electroporation, microinjection, cell fusion, etc. Introduction of nucleic acid and polypeptide in vitro, ex vivo and in vivo can also be accomplished using other techniques.
  • osmotic shock e.g., calcium phosphate
  • electroporation e.g., calcium phosphate
  • microinjection e.g., cell fusion
  • Introduction of nucleic acid and polypeptide in vitro, ex vivo and in vivo can also be accomplished using other techniques.
  • a polymeric substance such as polyesters, polyamine acids, hydrogel, polyvinyl pyrrolidone, ethylene-vinylacetate, methylcellulose, carboxymethylcellulose, protamine sulfate, or lactide/glycolide copolymers, polylactide/glycolide copolymers, or ethylenevinylacetate copolymers.
  • a nucleic acid can be entrapped in microcapsules prepared by coacervation techniques or by interfacial polymerization, for example, by the use of hydroxymethylcellulose or gelatin-microcapsules, or poly (methylmethacrolate) microcapsules, respectively, or in a colloid drug delivery system.
  • Colloidal dispersion systems include macromolecule complexes, nano-capsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • liposomes for introducing various compositions into cells, including nucleic acids, is known to those skilled in the art (see, e.g., U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282).
  • a carrier comprising a natural polymer, or a derivative or a hydrolysate of a natural polymer, described in WO 94/20078 and U.S. Pat. No. 6,096,291, is suitable for mucosal delivery of molecules, such as polypeptides and polynucleotides.
  • Piperazine based amphilic cationic lipids useful for gene therapy also are known (see, e.g., U.S. Pat. No.
  • Cationic lipid systems also are known (see, e.g., U.S. Pat. No. 5,459,127). Accordingly, viral and non-viral vector means of delivery into cells or tissue, in vitro, in vivo and ex vivo are included.
  • kits comprising one or more compositions of the invention, including pharmaceutical formulations, packaged into suitable packaging material.
  • a kit includes a humanized antibody or subsequence.
  • a kit includes a nucleic acid encoding humanized antibody or subsequence.
  • nucleic acids that further include an expression control element; an expression vector; a viral expression vector; an adeno-associated virus expression vector; an adenoviral expression vector; and a retroviral expression vector.
  • a kit includes a cell that expresses a humanized antibody or subsequence.
  • kits includes a label or packaging insert including instructions for expressing a humanized antibody or a nucleic acid encoding a humanized antibody in cells in vitro, in vivo, or ex vivo.
  • a kit includes a label or packaging insert including instructions for treating a subject (e.g., a subject having or at risk of having asthma) with a humanized antibody or a nucleic acid encoding a humanized antibody in vivo, or ex vivo.
  • the term “packaging material” refers to a physical structure housing the components of the kit.
  • the packaging material can maintain the components sterilely, and can be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.).
  • the label or packaging insert can include appropriate written instructions, for example, practicing a method of the invention, e.g., treating the common cold. Kits of the invention therefore can additionally include instructions for using the kit components in a method of the invention.
  • Instructions can include instructions for practicing any of the methods of the invention described herein.
  • invention pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration to a subject. Instructions may additionally include indications of a satisfactory clinical endpoint or any adverse symptoms that may occur, or additional information required by the Food and Drug Administration for use on a human subject.
  • the instructions may be on “printed matter,” e.g., on paper or cardboard within the kit, on a label affixed to the kit or packaging material, or attached to a vial or tube containing a component of the kit.
  • Instructions may comprise voice or video tape and additionally be included on a computer readable medium, such as a disk (floppy diskette or hard disk), optical CD such as CD- or DVD-ROM/RAM, magnetic tape, electrical storage media such as RAM and ROM and hybrids of these such as magnetic/optical storage media.
  • kits can additionally include a buffering agent, a preservative, or a protein/nucleic acid stabilizing agent.
  • the kit can also include control components for assaying for activity, e.g., a control sample or a standard.
  • Each component of the kit can be enclosed within an individual container or in a mixture and all of the various containers can be within single or multiple packages.
  • an invention composition can be packaged into a hand pump container or pressurized (e.g., aerosol) container for spraying the composition into the throat or nasal or sinus passages of a subject.
  • the humanized antibodies of the invention can be incorporated into pharmaceutical compositions.
  • Such pharmaceutical compositions are useful for administration to a subject in vivo or ex vivo, and for providing therapy for a physiological disorder or condition treatable with a humanized antibody.
  • compositions include “pharmaceutically acceptable” and “physiologically acceptable” carriers, diluents or excipients.
  • pharmaceutically acceptable and “physiologically acceptable” include solvents (aqueous or non-aqueous), solutions, emulsions, dispersion media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration.
  • Such formulations can be contained in a liquid; emulsion, suspension, syrup or elixir, or solid form; tablet (coated or uncoated), capsule (hard or soft), powder, granule, crystal, or microbead.
  • Supplementary active compounds e.g., preservatives, antibacterial, antiviral and antifungal agents
  • compositions can be formulated to be compatible with a particular local or systemic route of administration.
  • pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by particular routes.
  • routes of administration for compositions of the invention are inhalation or intranasal delivery. Additional routes include parenteral, e.g., intravenous, intradermal, subcutaneous, oral, transdermal (topical), transmucosal, and rectal administration.
  • parenteral e.g., intravenous, intradermal, subcutaneous, oral, transdermal (topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as as
  • compositions for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • Fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Antibacterial and antifungal agents include, for example, parabens, chlorobutanol, phenol, ascorbic acid and thimerosal.
  • Isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride can be included in the composition.
  • Including an agent which delays absorption, for example, aluminum monostearate and gelatin can prolong absorption of injectable compositions.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of above ingredients followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients as above.
  • methods of preparation include, for example, vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays, inhalation devices (e.g., aspirators) or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • Invention humanized antibodies including subsequences and modified forms and nucleic acids encoding them, can be prepared with carriers that protect against rapid elimination from the body, such as a controlled release formulation or a time delay material such as glyceryl monostearate or glyceryl stearate.
  • the compositions can also be delivered using implants and microencapsulated delivery systems to achieve local or systemic sustained delivery or controlled release.
  • Biodegradable, biocompatable polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to cells or tissues using antibodies or viral coat proteins) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • compositions for administration in the methods of the invention are known in the art (see, e.g., Remington's Pharmaceutical Sciences (1990) 18 th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12 th ed., Merck Publishing Group, Whitehouse, N.J.; and Pharmaceutical Principles of Solid Dosage Forms , Technonic Publishing Co., Inc., Lancaster, Pa., (1993)).
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the pharmaceutical carrier or excipient.
  • Humanized antibodies of the invention include antibodies that protect against virus infection of cells.
  • HumA, HumB, HumC, HumD, HumF, HumH and HumI protect against HRV infection of cells (FIG. 4).
  • the invention provides antibodies that protect against human rhinovirus (HRV) infection of cells.
  • HRV human rhinovirus
  • an antibody has a protective efficacy at least 2 to 5 times greater than the non-humanized antibody.
  • an antibody has a protective efficacy at least 5 to 10 times greater than the non-humanized antibody.
  • an antibody has a protective efficacy at least 10 to 20 times greater than the non-humanized antibody.
  • an antibody has a protective efficacy at least 20 to 30 times greater than the non-humanized antibody.
  • human rhinovirus or “HRV” means major and minor group human serotypes of rhinoviruses that have been identified (see, e.g., Hamparian et al., (1987) Virology 159:191) and those that are identified later as falling within this class of virus.
  • Major group HRV binds to ICAM-1 and minor group HRV binds low density lipoprotein (LDL) receptor.
  • LDL low density lipoprotein
  • protective efficacy is the amount of an antibody which can protect 50% of susceptible cells from infection (i.e. EC 50 ).
  • protective efficacy in EC 50 is the amount of antibody that protects 50% of hela cells from HRV infection.
  • a humanized antibody having a protective efficacy 5 times greater than another antibody e.g., non-humanized
  • Humanized antibodies of the invention include antibodies that bind to ICAM-1. Although not wishing to be bound by theory, it is believed that antibody binding to ICAM-1 inhibits viral binding or the ability to infect or penetrate the cell thereby inhibiting viral infection or proliferation. Such antibodies are therefore useful for inhibiting pathogens such as viruses (e.g., HRV and coxackie A virus, respiratory syncytial virus (RSV)), bacteria, fungi and protozoa (e.g., malaria) that bind to ICAM-1. Thus, the antibodies are useful for inhibiting HRV infection as well as for inhibiting any microorganism or other pathogens in which ICAM-1 receptor participates. Accordingly, the invention provides antibodies that inhibit pathogen infection of cells where infection is mediated, at least in part, by binding to ICAM-1, and methods for inhibiting pathogen infection of cells where infection is mediated, at least in part, by binding to ICAM-1.
  • viruses e.g., HRV and coxackie A virus, respiratory syncytial virus (RS
  • a method includes contacting a virus or cell with an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit viral infection of the cell.
  • the cell is an epithelial cell.
  • a method includes administering to a subject an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit viral infection of the subject.
  • the virus is HRV, coxackie A virus and respiratory syncytial virus.
  • a method includes administering to a subject an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit infection of the subject by a pathogen.
  • a method includes administering to a subject having or at risk of having an HRV infection an amount of humanized antibody sufficient to inhibit, inhibit progression or to treat HRV infection of the subject.
  • a method includes administering to a subject having or at risk of having an coxackie A virus or respiratory syncytial virus infection an amount of humanized antibody sufficient to inhibit infection, inhibit progression or to treat coxackie A virus or respiratory syncytial virus infection of the subject.
  • a method includes administering to a subject having or at risk of having malaria an amount of humanized antibody sufficient to inhibit, inhibit progression or to treat malaria of the subject.
  • a humanized antibody is selected from SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and antigen binding subsequences thereof.
  • the invention further provides methods of decreasing or inhibiting one or more symptoms of a pathogen infection (e.g., caused by HRV, coxackie A virus, respiratory syncytial virus or malaria).
  • a method includes administering to a subject having one or more symptoms associated with HRV, coxackie A virus, respiratory syncytial virus or malaria an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms associated with HRV, coxackie A virus, respiratory syncytial virus or malaria in the subject.
  • Symptoms decreased or inhibited include, for example, for HRV, one or more of fever, congestion, cough, nasal drip, sore throat, and the like associated with the common cold.
  • a method includes administering to a subject having otitis media an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of otitis media in the subject.
  • a method includes administering to a subject having bronchitis an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of bronchitis in the subject.
  • a method includes administering to a subject having sinusitis an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of sinusitis in the subject.
  • a method includes administering to a subject having or at risk of having asthma an amount of a humanized antibody sufficient to decrease or inhibit asthma exacerbation.
  • the humanized antibody is administered locally.
  • the humanized antibody is administered via inhalation or intranasaly.
  • invention humanized antibodies can be used to treat undesirable physiological conditions, such as disease or disorders in which ICAM-1 plays a role.
  • undesirable physiological conditions such as disease or disorders in which ICAM-1 plays a role.
  • LFA-1 interaction with ICAM-1 participates in inflammation.
  • an invention antibody may be used to inhibit this interaction thereby modulating (e.g., decrease) local or systemic inflammation.
  • ICAM-1 plays a role in other immune response pathways, cancer and metastasis.
  • an invention antibody may be used to reduce or prevent organ transplant rejection or autoimmune diseases or cancer or metastasis.
  • the invention provides antibodies that modulate immune responsiveness (e.g., inflammation) and other cellular processes in which ICAM-1 participates and methods for modulating immune response pathways.
  • the methods of the invention may be practiced prior to infection (i.e. prophylaxis) or after infection, before or after acute or chronic symptoms of the infection or physiological condition or disorder develops (e.g., before organ transplantation).
  • Administering a composition prior to or immediately following development of symptoms may lessen the severity of the symptoms in the subject.
  • Administering a composition prior to development of symptoms in the subject may decrease contagiousness of the subject thereby decreasing the likelihood of other subjects becoming infected from the infected subject.
  • subject refers to animals, typically mammalian animals, such as a non-human primate (gorillas, chimpanzees, orangutans, macaques, gibbons), a domestic animal (dogs and cats), a farm animal (horses, cows, goats, sheep, pigs), experimental animal (mouse, rat, rabbit, guinea pig) and humans.
  • Human subjects include adults, and children, for example, newborns and older children, for example, between the ages of 1 and 5, 5 and 10 and 10 and 18.
  • Human subjects may include those having or at risk of having a viral infection, such as HRV, and which develops one or more symptoms of the infection, for example, those typically associated with the common cold.
  • a viral infection such as HRV
  • Human subjects include those having or at risk of having asthma, including asthmatics suffering from chronic asthma prior to or following suffering an acute asthma attack.
  • Subjects include disease model animals (e.g., such as mice and non-human primates) for testing in vivo efficacy of humanized antibodies of the invention (e.g., an HRV animal model, an asthma animal model, an organ transplant model, an autoimmune disorder model, cancer model, etc.).
  • Mouse monoclonal antibody 1A6 (mAb1A6) was developed by Colonno et al., and has been shown to bind specifically to ICAM-1 and protect cells against infection by human rhinovirus (HRV) major group (Colonno R J, et al. (1991) European Patent Application #91201243.2; Publication number: 0 459 577 A2, which also describes the sequence of mouse mAb1A6).
  • the parental mouse monoclonal antibody 1A6 was synthesized in the form of scFv.
  • the purified protein, MsclA6 has an affinity of 1.18 ⁇ 10 ⁇ 6 M in K D against ICAM-1 (Table 4).
  • the human VH III consensus sequence and mAblA6 antibody share 56 identical amino acid residues, which amounts to 68.3% identity.
  • the human ⁇ I consensus sequence and mAb1A6 antibody have 52 amino acid residues in common, which equals to 64.2% identity. (FIG. 1).
  • This residue is at the interface between the light and heavy chains. Comparing to the parental mouse residue methionine, the human consensus residue valine intrudes less on the interface, potentially providing additional flexibility. Flexibility at the interface can enhance binding affinity by increasing conformational adaptability of the antibody. (FIG. 2C)
  • This residue is packed in the interior of the variable domain.
  • the murine residue methionine, makes a potentially destabilizing contact with the backbone of a neighboring beta strand.
  • the human residue isoleucine packs well in the interior of the protein.
  • residues at VH94 is related with the canonical structure of H1 or CDR1 (defined as VH26-VH32).
  • the CDR1 of 1A6 belongs to the canonical structure 1 and family 1 (Chothia and Lesk (1987) J. Mol. Biol. 186:651-663; Chothia et al. (1992) J. Mol. Biol. 227:799-817; Chothia et al. (1989) Nature 342:877-883).
  • human sequences showed three possible residues at VH94 position: arginine, threonine or alanine (Chothia et al. (1992) J. Mol. Biol. 227:799-817). Since arginine is not appropriate for this particular antibody, alanine, threonine and another small residue, aspartic acid were chosen.
  • molecular model building indicates that a portion of the CDR2 in the VH domain, VH60-64, does not have direct contact with the antigen. Therefore mouse residues at these positions (DPKVQ) can be replaced by human residues ADSVK.
  • the humanized scFv A (HumA) cDNA (FIG. 4) containing 750 bb was synthesized using a series of overlapping oligonucleotides. These overlapping oligonucleotides (Table 1) were designed to encode the amino acids of the variable region of the heavy (VH) and light (VL) chains linked by a linker((G 4 S) 4 ) with a Bam H1 site. The heavy chain and light chain were cloned separately in TOPO 2.1 vector. After DNA sequencing conformation, the heavy and light chain were subcloned into expression vector (pBAD/pIII A) to form full length DNA.
  • pBAD/pIII A expression vector
  • the oligonucleotides were first annealed in six groups consisting of oligo AVH1/AVH2, oligo AVH3/AVH4, oligo AVH5/AVH6 for heavy chain, and oligo AVL1/AVL2, oligo AVL3/AVL4, oligo AVL5/AVL6 for the light chain.
  • Each annealed group was extended with the Klenow fragment of DNA polymerase.
  • the annealed and extended products of group 1-3 were pooled with oligo AVH7 as overlapping templates that were amplified via polymerase chain reaction (PCR) using the high-fidelity thermostable DNA polymerase (Roche) with oligo AVH8 and AVH9 as primers.
  • the annealed and extended products of group 4-6 were pooled with oligo AVL7 as overlapping templates that were also amplified via polymerase chain reaction (PCR) using oligo AVL8 and AVL9 as primers.
  • PCR polymerase chain reaction
  • the PCR products were directly inserted into the TA cloning vector pCR2.1-TOPO (Invitrogen) and transferred into TOP10 competent cells.
  • the plasmids with inserts were isolated and sequenced.
  • the light chain and the heavy chain DNA fragments were isolated from their cloning vector by digestion with Nco I/Bam HI and Bam HI/VHpa I respectively, and cloned into expression vector pBAD/pIII A cutting with Nco I/Sal I (blunted) to be in frame with the carboxy-terminal His tag. Both strands of the expression construct pBAD-HumA was sequenced (MWG Biotech, Inc.).
  • HumB using BVH6 and BVH7 to replace AVH6 and AVH7; for HumC, using CVH5, CVH6 and CVH7 to replace AVH5, AVH6 and AVH7; for HumD, using DVH6 and DVH7 to replace AVH6 and AVH7; for HumE, using EVH4, EVH5, EVH6 and EVH7 to replace AVH4, AVH5, AVH6 and AVH7; for HumF, using FVH6 and FVH7 to replace AVH6 and AVH7; for HumG, using GVL3, GVL4, GVH5, GVH6 and GVH7 to replace AVL3, AVL4, AVH5, AVH6 and AVH7; for HumH, using HVL3, HVL4, HVH4, HVH5, HVH6 and HVH7 to replace AVL3, AVL4, AVH4, AVH5, AVH6 and AV
  • Oligonucleotides for humanized scFvs Oligonucleotides for the light (V H ) chain of HumA: AVL-1: CGAACCATGGGCGATATCCAGATGACCCAATCTCCGTCTAGCCTGAGCGCCAGTGTTGGTG AVL-2: GTGAAGATTATTACTGATAGATTGGCTGGCGCGGCAAGTAATGGTAACTCGATCACCAACAC TGGCGCTCAG AVL-3: CTATCAGTAATAATCTTCACTGGTATCAACAAAAACCGGGTAAAGCTCCGAAACTTCTTATCT ATCACGCC AVL-4: CCCGAGCCAGAGCCAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGAGGCGTGATAG ATAAGAAG AVL-5: CTCTGGCTCTGGCTCGGGCACGGACTTTACCCTTACCATCAGCTCTCTTCAGCCGGAAGAC TTTGCCACC AVL-6: CCTTGACCGAAGGTATACGGCCAGCTATT
  • HumA-HumI humanized antibodies in the form of scFv.
  • Tables 2 and 3 Four of the humanized antibodies, HumA-HumD, do not have parental mouse framework residues, and five of them, HumE-HumI, contain various number of parental mouse residues in the framework.
  • the sequence of HumB is compared against parental mouse 1A6 and human consensus framework in FIG. 3.
  • TOP10 cells transformed with disired expression construct were grown in shaker flaks in TB medium (B10 101) until they reached an OD 600 of 0.8. Protein expression was induced with 0.02% arabinose for eighteen hours at room temperature. Cells were pelleted by cenulfugation at 4,000 g for 15 minutes.
  • Cell pellets were resuspended in ⁇ fraction (1/50) ⁇ th volume of lysis buffer (20 mM sodium phosphate, 1% Triton X-100, 500 mM NaCl, 40 mM imidazole, 2 mM 2-mercaptoethanol), 0.2 mM PMSF, 1 mg/ml lysozyme and incubated on ice for 30 minutes.
  • the cell suspension was sonicated and another aliquot of PMSF was added.
  • the cell debris was pelleted by centrifugation at 12,000 ⁇ g and the clarified sonicate was filtered and fractionated by metal affinity chromatography.
  • soluble ICAM was used in an ELISA assay.
  • a 96-well EIA plate (Corning, Inc.) was coated with 100 ⁇ l/well soluble ICAM-1 (Bender MedSystems) at 1 ⁇ g/ml in 0.1 M NaHCO 3 . After washing with TBST (50 mM Tris, pH8.0, 150 mM NaCl, 0.05% Tween-20), the plate was blocked with 3% non-fat milk in TBST at 37° C. for 1 hour.
  • TBST 50 mM Tris, pH8.0, 150 mM NaCl, 0.05% Tween-20
  • This example describes data demonstrating that humanized 1A6 antibodies protect against HRV infection. This example also describes data that demonstrate that protection was significantly greater than mouse 1A6 antibody.
  • HeLa cells were plated at 1 ⁇ 10 5 cells per well of a 48-well tissue culture dish and cultured for 24 hours. Culture medium was aspirated and 100 ⁇ l of humanized 1A6 proteins was added to each well at the dilution indicated. The plates were incubated for one hour in a 37° C. incubator, the protein solution removed, 200 ⁇ l HRV15 (at MOI of 1) was added and the plates incubated for one hour at 33° C. The cells were then washed and 1 ml/well growth medium added. The infected cells were incubated at 33° C. for 48 hours. The medium was then aspirated and the remaining viable cells stained with crystal violet.
  • % ⁇ ⁇ protection ( 100 ) ⁇ ( Absorbance ⁇ ⁇ of ⁇ ⁇ sample - Absorbance ⁇ ⁇ of ⁇ ⁇ virus ⁇ ⁇ only ) ( Absorbance ⁇ ⁇ of ⁇ ⁇ uninfected ⁇ ⁇ cells - Absorbance ⁇ ⁇ of ⁇ ⁇ virus ⁇ ⁇ only )
  • the protection efficacy was quantified as EC 50 , which is the dose of an antibody protein which can protect 50% of hela cells from HRV infection.
  • EC 50 of several humanized 1A6 proteins are summarized in Table 2, and the data from this protection assay is shown in FIG. 4. This assay revealed that the EC50 of Hum19 scFv protein was more than sixty times higher than that of the parental mouse 1A6 scFv protein (FIG. 4). In vitro protection results correlate well with the antibody binding affinity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US09/910,483 1998-11-30 2001-07-19 Humanized antibodies Abandoned US20030035798A1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
US09/910,483 US20030035798A1 (en) 2000-08-16 2001-07-19 Humanized antibodies
EP02798403A EP1414861B1 (en) 2001-07-19 2002-07-19 Humanized antibodies against icam-1, their production and uses
EP10010857A EP2336186A1 (en) 2001-07-19 2002-07-19 Humanized antibodies against ICAM-1, their production and uses
CA2793019A CA2793019A1 (en) 2001-07-19 2002-07-19 Humanized antibodies
CA2454361A CA2454361C (en) 2001-07-19 2002-07-19 Humanized antibodies
AU2002363027A AU2002363027C1 (en) 2001-07-19 2002-07-19 Humanized antibodies against ICAM-1, their production and uses
DE60238485T DE60238485D1 (de) 2001-07-19 2002-07-19 Humanisierte antikörper gegen icam-1, deren herstellung und verwendungen
PCT/US2002/023002 WO2003035696A2 (en) 2001-07-19 2002-07-19 Humanized antibodies against icam-1, their production and uses
AT02798403T ATE490276T1 (de) 2001-07-19 2002-07-19 Humanisierte antikörper gegen icam-1, deren herstellung und verwendungen
DK02798403.8T DK1414861T3 (da) 2001-07-19 2002-07-19 Humaniserede antistoffer mod ICAM-1, fremstilling og anvendelse heraf
ES02798403T ES2356896T3 (es) 2001-07-19 2002-07-19 Anticuerpos humanizados contra icam-1, su producción y usos.
JP2003538209A JP4516312B2 (ja) 2001-07-19 2002-07-19 Icam−1に対するヒト化抗体、それらの生成および使用
US11/519,322 US7696324B2 (en) 1998-11-30 2006-09-11 Humanized antibodies
AU2008258214A AU2008258214B2 (en) 2001-07-19 2008-12-18 Humanized antibodies against ICAM-1, their production and uses
JP2009119326A JP2009183303A (ja) 2001-07-19 2009-05-15 Icam−1に対するヒト化抗体、それらの生成および使用
US12/748,304 US8586712B2 (en) 1998-11-30 2010-03-26 Humanized antibodies
AU2012203365A AU2012203365A1 (en) 2001-07-19 2012-06-07 Humanized antibodies against ICAM-1, their production and uses
JP2013026399A JP2013116119A (ja) 2001-07-19 2013-02-14 Icam−1に対するヒト化抗体、それらの生成および使用
US14/083,146 US20140308269A1 (en) 1998-11-30 2013-11-18 Humanized antibodies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55544600A 2000-08-16 2000-08-16
US09/910,483 US20030035798A1 (en) 2000-08-16 2001-07-19 Humanized antibodies

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US09555446 Continuation-In-Part 1998-11-30
PCT/US1998/025422 Continuation-In-Part WO1999027964A1 (en) 1997-12-01 1998-11-30 Multivalent recombinant antibodies for treating hrv infections
US55544600A Continuation-In-Part 1997-12-01 2000-08-16

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/519,322 Continuation US7696324B2 (en) 1998-11-30 2006-09-11 Humanized antibodies

Publications (1)

Publication Number Publication Date
US20030035798A1 true US20030035798A1 (en) 2003-02-20

Family

ID=25428849

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/910,483 Abandoned US20030035798A1 (en) 1998-11-30 2001-07-19 Humanized antibodies
US11/519,322 Expired - Fee Related US7696324B2 (en) 1998-11-30 2006-09-11 Humanized antibodies
US12/748,304 Expired - Fee Related US8586712B2 (en) 1998-11-30 2010-03-26 Humanized antibodies
US14/083,146 Abandoned US20140308269A1 (en) 1998-11-30 2013-11-18 Humanized antibodies

Family Applications After (3)

Application Number Title Priority Date Filing Date
US11/519,322 Expired - Fee Related US7696324B2 (en) 1998-11-30 2006-09-11 Humanized antibodies
US12/748,304 Expired - Fee Related US8586712B2 (en) 1998-11-30 2010-03-26 Humanized antibodies
US14/083,146 Abandoned US20140308269A1 (en) 1998-11-30 2013-11-18 Humanized antibodies

Country Status (10)

Country Link
US (4) US20030035798A1 (enExample)
EP (2) EP2336186A1 (enExample)
JP (3) JP4516312B2 (enExample)
AT (1) ATE490276T1 (enExample)
AU (3) AU2002363027C1 (enExample)
CA (2) CA2793019A1 (enExample)
DE (1) DE60238485D1 (enExample)
DK (1) DK1414861T3 (enExample)
ES (1) ES2356896T3 (enExample)
WO (1) WO2003035696A2 (enExample)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070071742A1 (en) * 1998-11-30 2007-03-29 Fang Fang Humanized antibodies
US20080299121A1 (en) * 1997-12-01 2008-12-04 Fang Fang Multivalent recombinant antibodies for treating HRV infections
US8394771B1 (en) 2001-07-19 2013-03-12 Perlan Therapeutics, Inc. Multimeric proteins and methods of making and using same
US11505605B2 (en) * 2014-05-13 2022-11-22 Chugai Seiyaku Kabushiki Kaisha T cell-redirected antigen-binding molecule for cells having immunosuppression function
US11660340B2 (en) 2015-11-18 2023-05-30 Chugai Seiyaku Kabushiki Kaisha Combination therapy using T cell redirection antigen binding molecule against cell having immunosuppressing function
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005086568A2 (en) * 2004-01-26 2005-09-22 Morphosys Ag Anti-icam-1 human antibodies and uses thereof
TW200616662A (en) * 2004-09-10 2006-06-01 Wyeth Corp Humanized anti-5t4 antibodies and anti-5t4 antibody/calicheamicin conjugates
US7462698B2 (en) 2005-07-22 2008-12-09 Y's Therapeutics Co., Ltd. Anti-CD26 antibodies and methods of use thereof
GB2430030B (en) * 2005-09-07 2009-04-01 Ethicon Inc Diagnostic markers of wound infection III
GB0525214D0 (en) * 2005-12-12 2006-01-18 Bioinvent Int Ab Biological materials and uses thereof
US20090162359A1 (en) 2007-12-21 2009-06-25 Christian Klein Bivalent, bispecific antibodies
US9266967B2 (en) 2007-12-21 2016-02-23 Hoffmann-La Roche, Inc. Bivalent, bispecific antibodies
BRPI1014089A2 (pt) * 2009-04-02 2016-04-19 Roche Glycart Ag anticorpos multiespecíficos que compreendem anticorpos de comprimento completo e fragmentos fab de cadeia simples
DK2417156T3 (en) 2009-04-07 2015-03-02 Roche Glycart Ag Trivalent, bispecific antibodies
US9676845B2 (en) 2009-06-16 2017-06-13 Hoffmann-La Roche, Inc. Bispecific antigen binding proteins
WO2010146550A1 (en) 2009-06-18 2010-12-23 Pfizer Inc. Anti notch-1 antibodies
CA2781519A1 (en) 2009-09-16 2011-03-24 Genentech, Inc. Coiled coil and/or tether containing protein complexes and uses thereof
TW201138821A (en) 2010-03-26 2011-11-16 Roche Glycart Ag Bispecific antibodies
GB2482536B (en) 2010-08-05 2013-07-24 Hera Pharmaceuticals Inc Expression of antibody or a fragment thereof in lactobacillus
GB2482535A (en) * 2010-08-05 2012-02-08 Hera Pharmaceuticals Inc Expression of antibody or a fragment thereof in lactobacillus
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
CA2807278A1 (en) 2010-08-24 2012-03-01 F. Hoffmann - La Roche Ag Bispecific antibodies comprising a disulfide stabilized - fv fragment
JP6016800B2 (ja) 2010-12-15 2016-10-26 ワイス・エルエルシー 抗ノッチ1抗体
WO2012085111A1 (en) 2010-12-23 2012-06-28 F. Hoffmann-La Roche Ag Polypeptide-polynucleotide-complex and its use in targeted effector moiety delivery
CN103403025B (zh) 2011-02-28 2016-10-12 弗·哈夫曼-拉罗切有限公司 单价抗原结合蛋白
JP5764677B2 (ja) 2011-02-28 2015-08-19 エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト 抗原結合タンパク質
WO2013119966A2 (en) 2012-02-10 2013-08-15 Genentech, Inc. Single-chain antibodies and other heteromultimers
RU2639287C2 (ru) 2012-06-27 2017-12-20 Ф. Хоффманн-Ля Рош Аг Способ отбора и получения высокоселективных и мультиспецифичных нацеливающих групп с заданными свойствами, включающих по меньшей мере две различные связывающие группировки, и их применения
KR20150030744A (ko) 2012-06-27 2015-03-20 에프. 호프만-라 로슈 아게 표적에 특이적으로 결합하는 하나 이상의 결합 단위를 포함하는 항체 Fc-영역 접합체의 제조 방법 및 그의 용도
RU2016115866A (ru) 2013-10-11 2017-11-16 Ф. Хоффманн-Ля Рош Аг Мультиспецифические антитела с обменянными доменами и одинаковыми вариабельными доменами легкой цепи
PL3227332T3 (pl) 2014-12-03 2020-06-15 F. Hoffmann-La Roche Ag Wielospecyficzne przeciwciała

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4698420A (en) * 1985-02-25 1987-10-06 Xoma Corporation Antibody hybrid molecules and process for their preparation
US4946778A (en) * 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5077195A (en) * 1985-03-01 1991-12-31 Board Of Reagents, The University Of Texas System Polypeptides complementary to peptides or proteins having an amino acid sequence or nucleotide coding sequence at least partially known and methods of design therefor
US5081584A (en) * 1989-03-13 1992-01-14 United States Of America Computer-assisted design of anti-peptides based on the amino acid sequence of a target peptide
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5260203A (en) * 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5491074A (en) * 1993-04-01 1996-02-13 Affymax Technologies Nv Association peptides
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5573925A (en) * 1994-11-28 1996-11-12 The Wistar Institute Of Anatomy And Biology P53 proteins with altered tetramerization domains
US5582996A (en) * 1990-12-04 1996-12-10 The Wistar Institute Of Anatomy & Biology Bifunctional antibodies and method of preparing same
US5632448A (en) * 1995-01-25 1997-05-27 Ransburg Corporation Rotary powder applicator
US5639641A (en) * 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5716805A (en) * 1991-10-25 1998-02-10 Immunex Corporation Methods of preparing soluble, oligomeric proteins
US5721340A (en) * 1994-11-28 1998-02-24 The Wistar Institute Of Anatomy & Biology p53 proteins with altered tetramerization domains
US5723386A (en) * 1995-07-04 1998-03-03 Nec Corporation Method of manufacturing a semiconductor device capable of rapidly forming minute wirings without etching of the minute wirings
US5763733A (en) * 1994-10-13 1998-06-09 Enzon, Inc. Antigen-binding fusion proteins
US5807706A (en) * 1995-03-01 1998-09-15 Genentech, Inc. Method for making heteromultimeric polypeptides
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5856456A (en) * 1992-11-20 1999-01-05 Enzon, Inc. Linker for linked fusion polypeptides
US5869620A (en) * 1986-09-02 1999-02-09 Enzon, Inc. Multivalent antigen-binding proteins
US5965712A (en) * 1998-06-19 1999-10-12 Virginia Commonwealth University LZ-CD23 chimera for inhibition of IgE-mediated allergic disease
US6025165A (en) * 1991-11-25 2000-02-15 Enzon, Inc. Methods for producing multivalent antigen-binding proteins
US6071515A (en) * 1992-08-21 2000-06-06 The Dow Chemical Company Dimer and multimer forms of single chain polypeptides
US6190886B1 (en) * 1994-05-16 2001-02-20 HOPPE HANS-JüRGEN Trimerizing polypeptides, their manufacture and use
US6800735B2 (en) * 1998-10-16 2004-10-05 Biogen, Inc. Interferon-beta fusion proteins and uses

Family Cites Families (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
CH668554A5 (de) 1984-04-09 1989-01-13 Sandoz Ag Liposomen welche polypeptide mit interleukin-2-aktivitaet enthalten sowie verfahren zu ihrer herstellung.
EP0169146A3 (en) 1984-07-20 1988-07-20 Merck & Co. Inc. Monoclonal antibodies directed against the cellular receptor of human rhinovirus
US4975282A (en) 1985-06-26 1990-12-04 The Liposome Company, Inc. Multilamellar liposomes having improved trapping efficiencies
ES2039203T3 (es) 1985-11-22 1993-09-16 Takeda Chemical Industries, Ltd. Composicion de liposomas.
GB8607679D0 (en) 1986-03-27 1986-04-30 Winter G P Recombinant dna product
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
DE3785186T2 (de) 1986-09-02 1993-07-15 Enzon Lab Inc Bindungsmolekuele mit einzelpolypeptidkette.
JP2666345B2 (ja) 1987-04-16 1997-10-22 武田薬品工業株式会社 リポソーム製剤およびその製造法
US5565550A (en) * 1987-05-04 1996-10-15 Dana Farber Cancer Institute Antibodies to ICAM-2, and fragments thereof
US5284931A (en) * 1987-05-04 1994-02-08 Dana Farber Cancer Institute Intercellular adhesion molecules, and their binding ligands
EP0289949B1 (en) 1987-05-04 1995-10-04 Dana Farber Cancer Institute Intercellular adhesion molecules, and their binding ligands
US5273876A (en) 1987-06-26 1993-12-28 Syntro Corporation Recombinant human cytomegalovirus containing foreign gene
ATE190355T1 (de) 1988-09-06 2000-03-15 Xoma Corp Genexpressions-elemente und herstellung von chimären maus-mensch-antikörpern
ES2077572T3 (es) 1988-09-28 1995-12-01 Dana Farber Cancer Inst Inc Moleculas de adhesion intercelular, y sus ligandos de fijacion.
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
IL162181A (en) 1988-12-28 2006-04-10 Pdl Biopharma Inc A method of producing humanized immunoglubulin, and polynucleotides encoding the same
EP0448650A4 (en) 1989-02-01 1992-05-13 The General Hospital Corporation Herpes simplex virus type i expression vector
US5665577A (en) 1989-02-06 1997-09-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
DE69000248T2 (de) 1989-03-09 1993-01-07 Boehringer Ingelheim Pharma Verwendung von interzellularen adhaesions-molekuelen und deren bindungsliganden bei der behandlung von asthma.
EP0404003A3 (en) 1989-06-19 1991-10-16 Xoma Corporation Chimeric mouse-human km10 antibody with specificity to a human tumor cell antigen
US5324510A (en) * 1989-09-01 1994-06-28 Boehringer Ingelheim Pharmaceuticals, Inc. Use of antibodies to intercellular adhesion molecule-1 (ICAM-1) in the treatment of asthma
KR910009285A (ko) 1989-11-13 1991-06-28 원본미기재 Hiv 항원에 특이적인 키메라형 생쥐-인간항체
EP0453554A4 (en) 1989-11-13 1993-02-17 Xoma Corporation Chimeric mouse human antibodies with specificity to hiv antigens
AU634314B2 (en) 1989-11-13 1993-02-18 Green Cross Corporation, The Chimeric mouse-human a10 antibody with specificity to a human tumor cell antigen
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
GB9009548D0 (en) 1990-04-27 1990-06-20 Celltech Ltd Chimeric antibody and method
GB9009549D0 (en) * 1990-04-27 1990-06-20 Celltech Ltd Recombinant antibody and method
EP0459577A3 (en) * 1990-06-01 1992-08-05 Merck & Co. Inc. Microbially expressed portions of a monoclonal antibody block rhinovirus attachment to cell receptors
US5723286A (en) * 1990-06-20 1998-03-03 Affymax Technologies N.V. Peptide library and screening systems
JPH06500923A (ja) 1990-09-21 1994-01-27 カイロン コーポレイション パッケージング細胞
DE69131908T3 (de) 1991-02-19 2008-04-03 Oxford Biomedica (Uk) Ltd. Viruspartikel mit veraendertem wirtspektrum
GB9105383D0 (en) 1991-03-14 1991-05-01 Immunology Ltd An immunotherapeutic for cervical cancer
US5223396A (en) * 1991-05-03 1993-06-29 Boehringer Ingelheim Pharmaceuticals, Inc. Method for detecting organ transplant rejection
EP0590058B1 (en) * 1991-06-14 2003-11-26 Genentech, Inc. HUMANIZED Heregulin ANTIBODy
JP3540315B2 (ja) 1991-09-23 2004-07-07 メディカル リサーチ カウンシル キメラ抗体の製造−組合せアプローチ
AU3178993A (en) 1991-11-25 1993-06-28 Enzon, Inc. Multivalent antigen-binding proteins
US5932448A (en) 1991-11-29 1999-08-03 Protein Design Labs., Inc. Bispecific antibody heterodimers
DE69233204T2 (de) 1991-12-13 2004-07-15 Xoma Corp., Berkeley Verfahren und materialien zur herstellung von modifizierten variablen antikörperdomänen und ihre therapeutische verwendung
WO1993015210A1 (en) 1992-01-23 1993-08-05 Merck Patent Gmbh Monomeric and dimeric antibody-fragment fusion proteins
US6129914A (en) * 1992-03-27 2000-10-10 Protein Design Labs, Inc. Bispecific antibody effective to treat B-cell lymphoma and cell line
WO1993019660A1 (en) 1992-04-03 1993-10-14 Baylor College Of Medicine Gene therapy using the intestine
US5832448A (en) * 1996-10-16 1998-11-03 Health Hero Network Multiple patient monitoring system for proactive health management
WO1994012629A1 (en) 1992-12-02 1994-06-09 Baylor College Of Medicine Episomal vectors for gene therapy
US6307026B1 (en) * 1992-12-10 2001-10-23 Celltech Limited Humanized antibodies directed against A33 antigen
FR2702160B1 (fr) 1993-03-02 1995-06-02 Biovecteurs As Vecteurs particulaires synthétiques et procédé de préparation.
DE9390311U1 (de) * 1993-05-18 1996-05-09 I.D.M. Immuno-Designed Molecules, Paris Neue Makrophagen mit Eignung als Wirkstoffe von pharmazeutischen Zusammensetzungen
AU7353494A (en) 1993-11-12 1995-05-29 Case Western Reserve University Episomal expression vector for human gene therapy
US5928944A (en) 1994-02-04 1999-07-27 The United States Of America As Represented By The Department Of Health And Human Services Method of adenoviral-medicated cell transfection
US5731172A (en) 1994-03-09 1998-03-24 Sumitomo Pharmaceuticals Company, Ltd. Recombinant adenovirus and process for producing the same
US5604090A (en) 1994-06-06 1997-02-18 Fred Hutchinson Cancer Research Center Method for increasing transduction of cells by adeno-associated virus vectors
US5693508A (en) 1994-11-08 1997-12-02 Chang; Lung-Ji Retroviral expression vectors containing MoMLV/CMV-IE/HIV-TAR chimeric long terminal repeats
JP3770333B2 (ja) 1995-03-15 2006-04-26 大日本住友製薬株式会社 組換えdnaウイルスおよびその製造方法
JPH11508126A (ja) * 1995-05-23 1999-07-21 モルフォシス ゲゼルシャフト ファー プロテインオプティマイルング エムベーハー 多量体タンパク質
US6110456A (en) 1995-06-07 2000-08-29 Yale University Oral delivery or adeno-associated viral vectors
US5942433A (en) 1995-07-31 1999-08-24 The United States Of America As Represented By The Department Of Health And Human Services Extension of a protein-protein interaction surface to inactivate the function of a cellular protein
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
AU715914B2 (en) 1995-12-22 2000-02-10 Baxter Biotech Technology S.A.R.L. Globins containing binding domains
IL126314A (en) * 1996-03-25 2003-07-31 Northwest Biotherapeutics Inc Monoclonal antibodies having an antigen binding region specific for the extracellular domain of prostate specific membrane antigen (psma)
US5861397A (en) 1996-10-03 1999-01-19 Vical Incorporated Piperazine based cytofectins
US6096291A (en) 1996-12-27 2000-08-01 Biovector Therapeutics, S.A. Mucosal administration of substances to mammals
EP2338915A3 (en) * 1997-04-07 2011-10-12 Genentech, Inc. Anti-VEGF antibodies
ATE293994T1 (de) 1997-12-01 2005-05-15 Fang Fang Multivalente rekombinante antikörper zur behandlung von hrv infektionen
JPH11228446A (ja) * 1998-02-16 1999-08-24 Mitsubishi Chemical Corp 抗マラリア剤
US20020165153A1 (en) 1998-04-06 2002-11-07 Peter Angel Transcription factors and their use
US20020102604A1 (en) * 1999-12-08 2002-08-01 Milne Edwards Jean-Baptiste Dumas Full-length human cDNAs encoding potentially secreted proteins
US20030035798A1 (en) * 2000-08-16 2003-02-20 Fang Fang Humanized antibodies
ATE477273T1 (de) * 1998-12-01 2010-08-15 Facet Biotech Corp Humanisierte antikoerper gegen gamma-interferon
CA2377513A1 (en) 1999-06-25 2001-01-04 Universitat Zurich Hetero-associating coiled-coil peptides
IL148549A0 (en) 1999-09-17 2002-09-12 Genzyme Transgenics Corp Subunit optimized fusion proteins
AUPQ425699A0 (en) * 1999-11-25 1999-12-23 University Of Newcastle Research Associates Limited, The A method of treating a malignancy in a subject and a pharmaceutical composition for use in same
ES2332872T3 (es) 2000-04-28 2010-02-15 Planet Biotechnology, Inc. Inmunoadhesina para la prevencion de la infeccion por rinovirus.
WO2003062370A2 (en) * 2001-07-19 2003-07-31 Perlan Therapeutics, Inc. Multimeric proteins and methods of making and using same
JP4236000B2 (ja) 2003-09-25 2009-03-11 元気株式会社 3次元画像処理装置、3次元画像処理方法及びプログラム

Patent Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4698420A (en) * 1985-02-25 1987-10-06 Xoma Corporation Antibody hybrid molecules and process for their preparation
US5077195A (en) * 1985-03-01 1991-12-31 Board Of Reagents, The University Of Texas System Polypeptides complementary to peptides or proteins having an amino acid sequence or nucleotide coding sequence at least partially known and methods of design therefor
US5260203A (en) * 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5455030A (en) * 1986-09-02 1995-10-03 Enzon Labs, Inc. Immunotheraphy using single chain polypeptide binding molecules
US5869620A (en) * 1986-09-02 1999-02-09 Enzon, Inc. Multivalent antigen-binding proteins
US4946778A (en) * 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5081584A (en) * 1989-03-13 1992-01-14 United States Of America Computer-assisted design of anti-peptides based on the amino acid sequence of a target peptide
US5582996A (en) * 1990-12-04 1996-12-10 The Wistar Institute Of Anatomy & Biology Bifunctional antibodies and method of preparing same
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5716805A (en) * 1991-10-25 1998-02-10 Immunex Corporation Methods of preparing soluble, oligomeric proteins
US6121424A (en) * 1991-11-25 2000-09-19 Enzon, Inc. Multivalent antigen-binding proteins
US6027725A (en) * 1991-11-25 2000-02-22 Enzon, Inc. Multivalent antigen-binding proteins
US6025165A (en) * 1991-11-25 2000-02-15 Enzon, Inc. Methods for producing multivalent antigen-binding proteins
US6071515A (en) * 1992-08-21 2000-06-06 The Dow Chemical Company Dimer and multimer forms of single chain polypeptides
US5639641A (en) * 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5856456A (en) * 1992-11-20 1999-01-05 Enzon, Inc. Linker for linked fusion polypeptides
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5491074A (en) * 1993-04-01 1996-02-13 Affymax Technologies Nv Association peptides
US6190886B1 (en) * 1994-05-16 2001-02-20 HOPPE HANS-JüRGEN Trimerizing polypeptides, their manufacture and use
US5763733A (en) * 1994-10-13 1998-06-09 Enzon, Inc. Antigen-binding fusion proteins
US5721340A (en) * 1994-11-28 1998-02-24 The Wistar Institute Of Anatomy & Biology p53 proteins with altered tetramerization domains
US5573925A (en) * 1994-11-28 1996-11-12 The Wistar Institute Of Anatomy And Biology P53 proteins with altered tetramerization domains
US5632448A (en) * 1995-01-25 1997-05-27 Ransburg Corporation Rotary powder applicator
US5821333A (en) * 1995-03-01 1998-10-13 Genetech, Inc. Method for making heteromultimeric polypeptides
US5807706A (en) * 1995-03-01 1998-09-15 Genentech, Inc. Method for making heteromultimeric polypeptides
US5723386A (en) * 1995-07-04 1998-03-03 Nec Corporation Method of manufacturing a semiconductor device capable of rapidly forming minute wirings without etching of the minute wirings
US5965712A (en) * 1998-06-19 1999-10-12 Virginia Commonwealth University LZ-CD23 chimera for inhibition of IgE-mediated allergic disease
US6800735B2 (en) * 1998-10-16 2004-10-05 Biogen, Inc. Interferon-beta fusion proteins and uses

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080299121A1 (en) * 1997-12-01 2008-12-04 Fang Fang Multivalent recombinant antibodies for treating HRV infections
US20070071742A1 (en) * 1998-11-30 2007-03-29 Fang Fang Humanized antibodies
US7696324B2 (en) 1998-11-30 2010-04-13 Perlan Therapeutics, Inc. Humanized antibodies
US20110044976A1 (en) * 1998-11-30 2011-02-24 Perlan Therapeutics Humanized antibodies
US8586712B2 (en) 1998-11-30 2013-11-19 Perlan Therapeutics, Inc. Humanized antibodies
US8394771B1 (en) 2001-07-19 2013-03-12 Perlan Therapeutics, Inc. Multimeric proteins and methods of making and using same
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US11505605B2 (en) * 2014-05-13 2022-11-22 Chugai Seiyaku Kabushiki Kaisha T cell-redirected antigen-binding molecule for cells having immunosuppression function
US11660340B2 (en) 2015-11-18 2023-05-30 Chugai Seiyaku Kabushiki Kaisha Combination therapy using T cell redirection antigen binding molecule against cell having immunosuppressing function

Also Published As

Publication number Publication date
CA2454361C (en) 2013-01-08
AU2008258214A1 (en) 2009-01-15
AU2002363027C1 (en) 2009-04-30
US20110044976A1 (en) 2011-02-24
AU2012203365A1 (en) 2012-06-28
WO2003035696A3 (en) 2003-11-27
JP2013116119A (ja) 2013-06-13
CA2793019A1 (en) 2003-05-01
AU2008258214B2 (en) 2012-03-08
US20140308269A1 (en) 2014-10-16
WO2003035696A2 (en) 2003-05-01
EP2336186A1 (en) 2011-06-22
CA2454361A1 (en) 2003-05-01
AU2002363027B2 (en) 2008-09-18
EP1414861B1 (en) 2010-12-01
EP1414861A2 (en) 2004-05-06
JP2005524385A (ja) 2005-08-18
JP4516312B2 (ja) 2010-08-04
US8586712B2 (en) 2013-11-19
US20070071742A1 (en) 2007-03-29
JP2009183303A (ja) 2009-08-20
DK1414861T3 (da) 2011-03-21
DE60238485D1 (de) 2011-01-13
US7696324B2 (en) 2010-04-13
ATE490276T1 (de) 2010-12-15
ES2356896T3 (es) 2011-04-14

Similar Documents

Publication Publication Date Title
US8586712B2 (en) Humanized antibodies
AU2002363027A1 (en) Humanized antibodies against ICAM-1, their production and uses
JP6964631B2 (ja) Cd47に対するヒト化及びキメラモノクローナル抗体
US8394771B1 (en) Multimeric proteins and methods of making and using same
CN109476736B (zh) 结合间皮素和cd3的双特异性抗体构建体
AU2002365196A1 (en) Multimeric proteins and methods of making and using same
HK1159139A (en) Humanized antibodies against icam-1, their production and uses
AU2012207040B2 (en) Multimeric proteins and methods of making and using same
CN117285628A (zh) 抗vista抗体及其应用
AU2013204969A1 (en) Humanized antibodies
CN115785269A (zh) 抗pd-l1的抗体及其应用
AU2013204068A1 (en) Multimeric proteins and methods of making and using same

Legal Events

Date Code Title Description
AS Assignment

Owner name: PERLAN THERAPEUTICS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FANG, FANG;KOHLSTAEDT, LORI;RENO, JOHN;REEL/FRAME:012344/0342

Effective date: 20011004

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION