AU2013204969A1 - Humanized antibodies - Google Patents

Abstract

The invention provides humanized antibodies, for example, those that bind ICAM-1, methods of use and methods of producing the antibodies. Antibodies include sequences having a V and VL domain selected from HumA, HumB, HumC, HumD, HumE, HumF, HumG, H-umH, HumI, Hum4Q and Hum 50.

Description

HUMANIZED ANTIBODIES The present application is a divisional application of Australian Application No. 2012203365, which is incorporated in its entirety herein by reference. 5 FIELD OF THE INVENTION The invention relates to humanized antibody compositions and methods of making and using humanized antibodies. 0 BACKGROUND Monoclonal antibodies have become an important class of therapeutic proteins. However, foreign immunoglobulins used in humans can elicit an anti--globulin response which may interfere with therapy or cause allergic or immune complex hypersensitivity. To avoid this problem, a monoclonal antibody may be "humanized," and this is typically carried out by CDR 5 grafting. CDR's, also called hypervariable regions, are present in immunoglobulin light and heavy chains and are flanked by "framework" regions. CDR grafting was first described in Jones et al. ((1986) Nature 321:522-525). In this and later publications, the CDRs of three mouse antibodies were grafted onto the variable domain framework of the human :0 immunoglobulin NEW (VH) and REI (VL). The resulting humanized antibodies had the same antigen specificity and a similar affinity as the parental murine monoclonal antibody (mAb) (Jones et al. supra; Verhoeyen et al. (1988) Science 239:1534-1536; Riechmann et al. (1988) Nature 332:323--327; U.S. Patent No. 5.225.539). CDR grafting has been described by Queen and coworkers who reported the 25 humanization of four murine monoclonal antibodies (Queen et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033; Co et al. (1991) Proc. Nati. Acad. Sci. USA 88:2869-2873; Co et al. (1992) J. Imunurol.148:1149--1154; and U.S. Patent Nos. 5,585,089; 5,693,761; and 5,693,762). Murine residues were inserted in the human framework in order to maintain affinity and, in each case the original antigen specificity was maintained. The affinities of the humanized 30 antibodies ranged from 1/3 to 3 times of the parental unmodified murine antibodies. SUMMARY The invention provides humanized antibodies that bind ICAM-1. In one embodiment, the antibody has a VHq and VL domain selected from: SEQ ID NO: 1 and 3 1 (EumA); SEQ ID NO:4 and 5 (HiumB3); SEQ ID) NOt6 and 7(HRunC); SEQ ID NO:S and 9SHumD); SEQ ID NO10 and (HumE); SEQ ID NO12 and 13 (HumF); SEQ ID NO0:14 and 15 (HumG); SEQ INO4:16 and 17 (HlumE); and SEQ ID NOdl8 and 19 (Humi); and SEQ ID) N405 and 20 (Hunv4O); and SEQ ID NO0:5 and 21 (Hum5O). S Subsequences of antibodies that bind ICAM-4 are provided, for example, single chain, Fab, Fab' and (Fab) 2 fragments In particular aspects, the humanized antibody has greater affinity for ICAM than the parental (non-hman) antibody rain and modified foms of antibodies that bind ICAMI1 me also provided,for example antibodies having a VH and'V 1 domain selected from; SEQ ID NO: and 3 (HumA) SEQ IDT NO:4 and 5 10 (HunE) SEQ ID NO:6 and7 (HunC); SEQ TMD ad 9 NROnJ M SEQ 10>40:10 and 11 (HumE); SEQ ID N412 and 13 furF); SEQ ID NO:14 and 1$ (HunG): SEQ ID N40:1 (Sand 17(HunH); and SEQ IDN0:18 and 19 (Humi); and SEQ 1DN1O:5 and 20 (Hum4O); and SEQ ID N5:5 and 21 (Hum50), having one or more arninoaid substitutions, insertions or deletions. 15 The invention also provides humanized antibodies that bind ICAM-1 and inhibit pathogen infection of cells expressing ICAM-1. Such invention antibodies include antibodies that provide equal or greater protection from pathogen infection than parental (non-human) antibody In particular aspects, a humanized antibody has a protective efficacy equal to or at least 2 times greater, 5 times greate,7 10 times greater, 20 times 20 greater, 30 timesgreater than the non-humanized antibody In other aspects, the pathogen is human rhinoviras (HRV), coxacie A virus, respiratory syncytial virus (RSmEV or malaria. The humanized antibodies of the invention include intact iraniunoglobulin molecules, comprising 2 full-angth heay chains and 2 fulllength light chainsfor 25 example, IgG, IgA, gM IgE, and IgD, and subsequences that irhbit pathogen infection, Particular subsequences include, for example, single chain, ab, Fab'or (Fab) 2 fragment. The lunnanized antibodies of the invention include multispecific or multifunctional antibodies In one aspectsuch an antibody i fomed by king a humanized antibody to one or more identical or different antibodies to form a multimer 30 (emg using a linkerj Antibody multimers include a homo- or hetero-dimnerturmer, 2 tetramer or any other higher order olgomer. Antibody multiners that include different antibodies are human, humanized or non-human. Multfimeric fonrs include antibody oligomers that form via a multimerization domain (e.g human amino acid sequence) or a covalent bond. Antibody nultimers that include a mulimerization domain further 5 include forms having a linker located between the multimedzaon domain and the antibody, The invention additionally provides methods for producing humanized antibodies. In one embodiment a method includes; selecting a human framework sequence as an acceptorg, wherein said sequence has 50% or more identity (eg 555%, 55-60%, 60 10 65% 65-70%, 70-75%, 75-80%, 885% 85-90%, 90-95%, or more identity l to a non human donor antibody framework region; grafting a CDR from the donor non--human antibody (eg, urine) onto the human framework; comparing the vernier zone residues ofthe human acceptor and the nonhuman donor frameworkregions; and maintaining one or more of the human acceptor residues in the vernierone when the donornon-hman 15 and human residues are structurlly or hemRicaiy similar or substituting one or more of the verier zone residues with a residue that is different from both the donor non-human venier zone residue and acceptor human venier zone residue if the donornon-human vernier zone residue is sMturally or chemically dissimilar to the human residue, wherein the different residue is structural or chemical similar to the donor non-human 20 verier zone residue hn additional embodimentshumanamework acceptor sequences are selected frm a consens sequence for example, fromVjdomain subgrup I and subgroup [I consensus sequences Nucleia acid sequences encoding humanized antibodiessubsequences and modified frhns thereof (e.g., amino acid additions, deletions or substitutions) are also 25 provided. Nucleic acid sequences further include expression cassettes in which nucleic acid encoding humnanized antibodies are operably linked to an expression control element. Vectors and cells prokaryoticc and eukaryotic) that include the nucleic acids also are provided, The invention further provides pharmaceutical compositions including humanized 30 antibodies, subsequences, mutmers variants and modified forms, and nucleic acids 3 encoing them, and a pharmaceutically acceptable carrier In particularaspects the phanraceuticaily acceptablecarrier is compatible with inhalation or nasal delivery to a subject. The invention further provides methods of inhibiting pathogen infection of a cel 5 In one embodiment a method includes contacting a pathogen or aell with an amount of a humanized antibody, subsequent, multinmer, variant or modified form sufficient to inhibit pathogen infection of Ihe cell, In one aspect, the cell expresses ICAM4i In another aspectthe cell (e g, epithelial cell) is present in a subject. The invention also provides methods ofinhibitingKRY infection of acell In one 10 embodiment, a method includes contacting TRY or a cell susceptible to -R infection with an amount of a humanized antibody, subsequence, multimer, vacant or modified form effective to inhibit HRV infection of the cell (ecg, epithelial cell) In one aspect, the cell is present in a subject. In another aspect, the cell is present in a subject having or at risk of having asthma. In yet another aspect, the subject is a newborn or between the 15 ages of Ito 5, 5 to 10 or 10 to 1S. In still another aspect, the antibodysubsequenc mnultimer, variant or nodified form binds to an antigen present on the surface of the cell (egICAM-1) In various additional aspects, the humanized antibody is administered locally, ia inhalation or intranasaly. The invention also provides methods of inhibiting HRV infection, inhibiting H1K 20 progression or treating HRV infection of a subject In one embodiment, a method includes adinisteing to a subject having at risk ofhaving HRV infection an amount of a humanized antibodysubsequence mutimeradant or modified font effective to inhibit HKV infection, inhibit HRT progression or treat H1V infection of theasbject. In oneaspect, the subject has or is at risk of having asthma, In another aspect, the subject is 25 a newbrn or between the ages of I to 5, 5 to 10 or 1 to 18 In various additional aspects, the humanized antibody is administered locallyia inhalation or intranasaly. The invention additionally provide methods of decreasing or inhibiting one or more symptoms of the common cold in a subject. In one embodiment, a method includes administering to a subject having a commoncold an amount of a humanized antibody, 30 subsequence, mulnimer, variant or modified form effectiveto decrease or inhibit one or 4 more symptoms of the coumon cold in the subject. In one aspect, the subject has or is at risk of having asthma. In another aspect, the subject is a newborn or between the ages of ! to 5, 5 to 10 or 10 to 18. In various additional aspects, the humanized. antibody is administered locally, via inhalation or intranassly, 5 BRIEF DESCRIPTION OF T ZE DRAWINGS Figure 1 shows the amino acid sequences of munnc l-6 antibody heavy and light chaii (SEQ ID NO77 and 79) and human consensus sequence of heavy chain subgroup Ill (HIa; SEQ ID NO:78) and light chair kappa subgroup I(Humi; SEQ ID 10 NO:S0). Asterisks denote amino acid differences between human and mouse sequence CDR. amno acids as defined by Kabat and Chothia are in bold face. Figure 2 shows the amino acid sequences of marine IA6 antibody (SEQ ID NO:77), humanized lA6 (HumB; SEQ ID NO;4) and human consensus sequences of heavy chain subgroup III (HuM3; (SEQ ID NO:78) and light chain kappa subgroup I 15 (Humid; (SEQ ID 10:8 0). Asterisks and bold face amino acids are as previously indicated. Figure 3 shows the oDNA sequences of humanized scFVA (Hurm) antibody (SEQ ID NO:2), Restriction sites are indicated by underliig; COATGG Wo I site: GGATC Baml I site; GTTAAC Hpa I site, Bold face amino acids as previously 20 indicated. Figure 4 shows protection from URVIS infection with mouse lA scFv antibody (M1 ) and humanized 1A6 scFv antibodies HumA, HumB, HumC, HumD Hum, HumIH and Huml. Figure 5 shows amino acid sequences of mudne lA6 V domain (SEQ ID 25 N0:77) and human consensus sequences of V1 domain subgroup I (Hum1; (SEQ ID NO:82) and subgroup II (1h 2; SEQ 1D NO0:81), Bold face amino acids are as previously indicated. Figure 6 shows the Adomai amno acideences ofniucnlAG antibody (SEQ ID>0:7) humanized lA6 (Ham4O; SEQ ID N020) and human consensus 5 sequences of heavy chain subgroup H (Huniu2; SEQ ID N:81) Asterisks and bold face amino acids are as previously indicated. Figure 7 shows theyVs domain amino acid sequences of marine lA6 antibody (SEQ ID NO:77),humanized lA6 (HrumO SEQ ID NOdi) and human consensus 5 sequences of lavy chain subgroup I (umi; SEQID NO:82) Astersks and bold face amno acids are as previously indicated DETAILK D DESCRIPTION The present invention is based, atleast in part, upon producing humaized I0 antibodies. More particuladycomplementarity determining region (CDR) firm a non human antibody are grafted into a human framework region. Following grafing, one or more amino acids of the antibody is mutated to a human amino acid or is mutated to a nonhuman amino acid having strctural similarity to the amino acid it replaces. For example, mutating amurine amino acid to a hmnr amino acid in a framework region or 15 COR of the grafted antibody can produce a humanized antibody having increased antigen binding affinity Jelative to the non-human or grafted antibody, Humanized antibodies are not imMunogenie or careless inuunogenic than non-human antibodies when administered to human subjects. Therefore, humanized antibodies are useful in a vadety of therapeutic and diagnostic appicationsA Fr example, as exemplified herein, a 20 humanized antibody of the invention protects cells from HR1V infection, a virus that can cause the connon cold, and other associated disorders (eg. odtis rnedia, bronchitis, sinusitis etc.) Thus, in accordance with the invention, there are provided humanized antibodies. In one embodiment, a humanized antibody binds to ICAl1 In one aspect, a humanized 25 antibody that binds ICAM-I protects against pathogen infection of cells expressing ICAM-1. In other aspects, a humanized antibody has a VH and V. domain selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:4 and 5 (HumB); SEQ ID NO:6 and? (HunC); SEQ ID NO:8 and 9 (HumnD); SEQ ID NO1 and 11 (HumE); SEQ ID NO:12 and 13 (HumF; SEQID NO:14 and 15(HunG); SEQ ID NO:16 and 17 (HumH); and 30 SEQ ID NO:18 and 19 (Hum); and SEQ 101DN:5 and 20 (Hunm40); and SEQ ID NO:5 and 21 (Hum50). In another embodiment, a humanized antibody has a greater or less 6 affinity for the antigen than the donor non-human antibody In vaIous aspects, afities range from greater or less affiity for the antigen than either the donor orrecombinant antibodyn Sparticular aspects, humanized antibody has an antigen binding affiniy 2. to 4-fold, 5-foid, 5- to 8-fold, 5- 1.0-ffold, 8- to 15-fold 100 20-fold, 20- to 40-fold, 20 5 60-fold, 20- to 10-fold or greater than the parental antibody. Human antibody sequeneregionsan n be usedfor producing humanized antibodies of the invention For example "consensus sequence, an antibody sequence having the most frequently occurring amino acid residues at particular positions in an aantibody or an antibody region, may be used. As an example, human variable region 10 domain sequences are described in Kaba, (Sequencs ofProteins qfniwwlogicai Interest 4' EdUS Depatment of Health and Human Services., Pubic Health Service (1937)). Sequences that are completely determined in the ameworkegious, 1-23, 35 4% and 5788 in the light chain, and in the fRumework begins 1300, 3649, and 6604, in teheavy chains, are included in the survey. For the fourth framework region,9840 15 in the light chain and 103-113 in the heavy chain, residues that can be derived from the known J-minigene segments are surveyed. At the end of the survey, the most 1fquentiy occurrng residue at a given position is chosen as the residue in the consensus sequence Consensus sequences may therefore be identified by saurveying amino acid residues attach positinof a plurality of 20 antibodies; the most frequently occurring amino acid at a given position in the region of interest is a part of the consensus. In many instances, more than one residue twill be found at high frequency at a given position. In such cases, if the amino acid that occurs at least one-fourth as frequently as the most frequently occurring the amino acid residue is considered a part of the consensus sequence. 25 The published consensus sequence of human '4 subgaroup III is based on a survey of 22 known hum-an '4III sequences, the consensus sequence of human V 1

-

1 subgroup I is based on 6 known human V4 I sequences, and the consensus sequence of human 7 subgroup II is based on 10 known sequences in the same group. 'Phe published consensus sequence of human '4kappa-chain subgroup I, based on a survey of 30 known hiunan 30 kappa I sequences (Padlan (1994) Mat immunoat 1 69-217; Padian (1991) Mat ns dw '7 mnaln 28489498). 7The human consensus sequences were previously used to humanize twoantibodies (Carter et a (1992) Proc. NAatLt ad S USA 89:4285-4289; Presta et at (1993) £mmunot 15126232632> These humanVsubgroup I, and M sequences and V kappa subgroup I consensus sequences are selected as frameworks, 5 respectively, to humanize imAb lA6 as descrbed in Examples 1 and 8. Thus, connsensus sequences known in the art, as exemnplite for human Vsubgroup 1, U and ITT or , kappa subgroup I, are selected as acceptor frameworks for producing humanized antibody in accordance with the invention. Any mouse, rat guinea pig, goat, non-human pimate (eg, ape chimpanzee 10 macaque, orangutan, etlor other non-human animal antibody may be used as a CDR donor for producing hunanized antibody. Murine antibodies secreted by hybridoma cell lines can also be used. Donor CDs are selected based upon the antigen to which the antibody bind Thus donor CDRs include sequences rnom antibodies that bind to pathogens, such as bacteria)viruses protozoa and other microorganisms. Donor CDRs 15 also include antibodies that bind to molecules to which the pathogens bind, for example, cel surface proteins (e.g, adhesion proteinsreceptor proteins, immune recognitiodmodulation proteinssuch as HLAtumor associated antigens, etc). In one particular example, the donor antibody is a mouse monoclonal antibody lA6 (mAblA6, which specifically binds to lCAMIt 20 "Comnplementarity determining regions" or "CDRs" are among the sequences that can be grafted into framework sequences. CDRs refer to sequence regions that confer antibody specificity and affinity. CDRs are also generally known as supervariable regions or hypervariabie loops. CDR regions of antibodies have been mapped and are defined as in Kabat (Se quences ofiProteins of hntmologi cal interest. 4 h Bd.US 25 Department of Health and Human Services. Public Health Service (1987)) and Chothia and Lesk ((1987) 1. Mob. Biol. 186:651-663)). In particular for heavy chai, CDR1 is defined as H-26-135, CDR2 is 1450-65 and CDR3 is H95-1 02; for light chain, CDR 1 is L24-L34, CDR2 is L50-L56 and CDR3 is L89-L97. The amino acids are nnbered according to the scheme described in Kabat (Sequences ofProteins ofimmunological 30 In/erest 4" EdUS Department of Health and Human Services. Public Health Service (1987)). Variable region domains typically comprise the amino-terminal approximately

S

105-115 amino acids a of a natumlly-occurring irmmmoglobulin cain (eg, amino acids 1-110). Variable domains shorter or longer than these exemplary sequence lengths may also be used. Thus, the invention provides humanized antibodies, methods of making the 5 antibodies and methods of using the antibodies, including therapeutic and diagnostic methods. In one embodiment, a humanized antibody has increased affinity for the antigen relative to non-humanized antibody (e.g., less than 1.18 x I M A in KD against ICAM-1, less than I x 10 04 1in K, less than 5 x 100 M in K, less than I x 10" 54 in Kn, less than 5 x x104 M1i K 0 or l tha I it e in Kn) In various aspects, a 10 humanized antibody includes a A and domain selected from: SEQ ID N: 1 and 3 (HumA); SEQ ID NO:4 and 5 (HuB); SEQ ID NO:6 and 7 (HmnC); SEQ ID NO:8 and 9 (HuinD); SEQ ID NO:0 and 11 (HlurE); SEQ ID NO:12 and 13 (HumF); SEQ ID NO:14 and 15 (HumG); SEQ ID N S:16 and 17 (HumH); and SEQ ID NO:18 and 19 (HunI); and SEQ ID NO:5 and 20 (Hur40); and SEQ ID NO:5 and 21 (Hum50); and 15 antigen binding subsequences thereof. In various additional aspects, an antibody subsequence comprises Fab, Fab, (Fab), Fv, and single chain antibody (SCA), e.g., scFv fragments. The humanized antibodies of the invention alsoinclude antibody rmultnmers, in various aspects muitimer comprises a dimer, trner, tetamer or otherhigher order 20 oligomer in other aspect.multiers comprise combinations of the same antibodies (homoigomers) and different antibodies (hetero-oligomers, the different antibodies being himan, humanized or nonahman, The terms "protein," polypeptidee" and "peptide" are used interchangeably herein to refer to two or more covalently linked amino acids, also referred to as "residues," 25 through an aide bond or equivalent. Polypeptides are of unlimited length and may be comprised of L- or D-amnino acids as well as mixtures thereof, Amino acids may be linked by non-natural and non-amide chemical bonds including, for example, those formed with giutaraldehyde, 1-hydoxysuccirdide esters, bifunctional maleimides, or

NN

t dicyclohexyicarbodiimide (DCC), Non-amide bonds include, for example, 30 ketomethylene, aminomethylene, olefm, ether, thioether and the like (see, e.g, Spatola 9 (1983) in CdBiochemtry of Arnino Acids, Peptides and Proteins, Vol. 7, pp 267~357, 'eptide and Backbone Modifications," Marcel Decker, NY) Polypeptides may have one or more cyclic structures such as an end-to-end amide bond between the amino and carboxy- terminus of the molecule or intra- or inter-molecular disulfide bond. 5 Polypeptides may be modified in vitro or in viva, e.g.. post-translationally modified to include, for example, sugar residues, phosphate groups, ubinqitin, fatty acids or lipids. Polypeptides further include amino acid structural and functional analogues, for example, peptidonimetics having synthetic or non-natural amino acids or amino acid analogues. The term anybodyy" refers to a protein that binds to other moleculesantigens) 10 via heavy and light chainvariable domains V and , respectively. Antibodies include IgG, IgD. IgAI1gM and Ig, The antibodiennmy be intact inuunoglobulinmolecules, two fAl length heay chains linked by disulide bonds to two fll lgth light chains, as well as subsequences (e. fragments) ofinnogobulin molecules, with our without constant region, that bind to an epitope ofan antigen, or subsequences thereof(i.e. 15 fragments) of immunogobulin mocules, with or without constantregion, that bind to an epitope of anantigen Antibodies may comprise ll length heavy and light chain variable domains, VP and VL, individually or in any combination. For example.each of a a A and A domain selected from: SEQ I) NO:1 and3 ( nuinA); SEQ ID NO:4 and 5 (HumB); SEQ IDNO6 and 7 (HumC); SEQ ID NO:8 and 9 (HurnD); SEQ ID NO:0 20 and 11 (HumE); SEQ ID NO:12 and 13 (HunF SEQI NO:4 and 15 (HuiG; SEQ ID N1016 and 17(Hum); and SEQ ID NOCi8 and 19 (Huml; and SEQ ID NO:5 and 20 (flum40); and SEQ ID NO:5 and 21 (In50 are included individually and in any combination, Polypeptide sequences can be made using recombinant DNA technology of 25 polyp apti de encoding nucleic acids via cell expression or in vitro translation, or chemical synthesis of polypeptide chains using methods known in the art Antibodies according to the invention, including humanized sequences and subsequences can be expressed from recombinantly produced antibody-encoding nucleic acid (see, eg., Harlow and Lane, Antibodies; A Labcratory Manual, Cold Spring Harbor Laboratory, 1989; Harlow and 30 Lane, Using Antibodies; A Laborcaory ana, Cold Spring Harbor Laboratory, 1999; Fitzgerald et at JA.C.S. 117:11075 (1995); Gram et at, Proc. Nat A cad. Si, USA 10 890576-80 (1992,) For example, as described in Exampl 3 ,cDNA encoding humanized antibody sequences can be expressed in bacteria in order to produceinvention antibodies. Antibodies may also be produced by expressig encoding nucleic acids in mammalian, insect, ad plan ell Polypeptide sequences including antibodies can also 5 be produced by a chemical synthesizer (see, vg. Appie liosystems Foster City, CA). As used herein, the term "snbsequence" or fagmentn means a portion of the fIl length molecule. For example a subsequence ofan antibody is one or more amino acid less in length than full length polypeptide (e.g one or more integral or terminal amino acid deletions frm either amino or earboxy-termini). Subsequences therefore canbe any 10 length up to the full length molecule, Specific examples of antibody subsequences include, for example, Fab, Fab' Fab') 2 , Fv, or single chain antibody (SCA) fragment (eag., scW) Subsequences include portions which retain at least part of the function or activity of full length sequence. For example, an antibody subsequence will retain the ability to selectively bind to an antigen 15 even though the binding affinity of the subsequence may be heater or less than the binding affiity of the full length antibody, Subsequences can comprise a portion of any of the invention humanized sequences, for example, a portion of V and V domain selected from: SEQ ID NO:I and 3 (HA); SEQ ID NO:4 and 5 (HumB); SEQ ID NO0:6 and? (HumC); SEQ ID NO:8 and 9 (HunD); SEQ ID NO:10 and II (HumE); 20 SEQ ID NO:12 and 13 (HumF); SEQ IDNO:14 an 15 (HumG); SEQ ID NO0:16 and 17 (HumEI); and SEQ ID NO:18 and 19 (Huml); and SEQ ID NO:5 and 20 (Hum40); and SEQ ID N0:5 and 2-1(Hum5) Pepsin or papain digestion of whole antibodies can be used to generate antibody fragments. In particular, an Fab fragment consists of a monovalent antigen-binding 25 fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain. An (Fab') fragment of an antibody can be obtained. by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction. An Fab' fagment of an antibody molecule can be obtained from (Tab') 2 by 30 reduction with a thiol reducing agent, which yields a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner. An Fv fragment is a fragment containing the variable region of a light chain VL and the variable region of a heavy chain VII expressed as two chains. The association 5 may be non-covalent or may be covalent, such as a chemical cross-linking agent or an intermolecular disulfide bond (Ihbar et al., (1972) Proc. NatL Acad Sci. USA 69:2659; Sandhu (1992) Crit. Rev. Biotech. 12:437). A single chain antibody ("SCA") is a genetically engineered or enzymatically digested antibody containing the variable region of a light chain VL and the variable 10 region of a heavy chain, optionally linked by a flexible linker, such as a polypeptide sequence, in either VL-linker-VH orientation or in V-linker-VL orientation. Alternatively, a single chain Fv fragment can be produced by lindng two variable domains via a disalfide linkage between two cysteine residues. Methods for producing scFv antibodies are described, for example, by Whitlow et al, (1991) in: Methods: A 15 Companion to Methods in Enzymology 2:97; U.S. Patent No. 4,946,778; and Pack et al, (1993) Bio/Technology 11:1271. Other methods of producing antibody subsequences, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, provided that the 20 subsequences bind to the antigen to which the intact antibody binds. As used herein, the term "bind" or "binding" means that the compositions referred to have affinity for each other. "Specific binding" is where the binding is selective between two molecules. A particular example of specific binding is that which occurs between an antibody and an antigen. Typically, specific binding can be distinguished 25 from non-specific when the dissociation constant (I) is less tan about I X 104 M or less than about 1 X 106 M or 1 X 107 M. Specific binding can be detected, for example, by ELISA, immunoprecipitation, coprecipitation, with or without chemical crosslinking, two-hybxid assays and the like. Appropriate controls can be used to distinguish between "specific" and "non-specific" binding. 12 Invention antibodies, including full length antibodiessbsequences (e.g single chain fon) may be present as dimer, trinerstetramerspentamershexamers or any other higher order oligomer that retains at least a part of antigen binding activity of monomer. Muliners can comprise heteromeri or homoeric cominations of full 5 length antibody, sbsequences unmodified or modified as set forth herein and known in the art Antibody rultimers are usebl for increasing antigen avidity in comparison to monomer due to the multimer having multiple antigen binding sitesAntibody mul timers are also usefl for producing oligomerie (e.g, dimer, timertertamer etc combinations of different antibodies thereby producing compositions of antibodies that are 10 rultifunctionai (e.g, bifuntional, tfunctional, tetrafunctional, etc.). The ten multifunctionala" means that the composition referred to has two or more activities or functions (e.g, antigen binding enzyme activityligand or receptor binding, toxin, etc For example, an antibody that binds to a pardcuiar antigen which also has an attached polypeptide with enzyme activity(e g luciferase, acetyltransferase, 15 gaactosidase, peroxidase,etc. is one particular example of a nlitifhnctional antibody. Multifunctional antibodies further include mudlispeciflc(e g. bispecific, trispecific tetraspecific etc.) forms. The term "nMultispecific" means an antibody that binds to two ormore different antigenic epitopes. The term "multispecific" means that the antibody contains -o or wore variable region sequences that bind to different 20 epitopes 'The different epitopes may be present on the same antigen or different antig-ns For example, a multispecificantibody oligomer comprises a mixture of two or more antibodies each having different epitope binding specificity and which form a multimer. Multispecific antibodiesmay be comprised of individual antigen binding polypeptides each of which have distinct variable domains For example, one of the 25 antbodies may have two variable domains each of whichrecognizes a different epitope. Candidate functions for multifinctional antibodies other than antigen bindig and in addition enzyme activity include, for example, detectable moieties such as radioisotopes and amino acid sequences (e0, g S, ' T7 imnunoglobulin or polyhistidiie tags, toxins (e.g.,ricin, cholera, pertussis), cell surface proteins such as 30 receptors ligands (substrates, agonists and antagonists) adhesion proteins(e g. 13 streptavidin avidin.ectins, growth factors, differentiadve factors and chemotactic factors. Multi functional humanized antibodies can be produced through chemical erosslinking of the selected molecules (which have been produced by synthetic means or 5 by expression of nucleic acid that encode the polypeptides) or through recombinant DNA technology combined with in vitro, or cellular expression of the polypeptide, and subsequent oligomerization, Multispecific antibodies can be similarly produced through recombinant technology and expression, fusion of hybridomas that produce antibodies with different epitopic specificities, or expression of multiple nucleic acid encoding 10 antibody variable chains with different epitopic specificitia in a single celL Antibodies may be either joined directly or indirectly through covalent or non covalent binding, e.g. via a multimerization domain, to produce muitirmers, A "maultimuerization domain" mediates non-covalent protein-protein interactions, Specific exam pies include coiled-coil (e.g., leucine zipper structures) and alpha-helical protein 15 sequences, Sequences that mediate protein-protein binding via Van der Waais' forces, hydrogen bonding or charge-charge bonds are also contemplated as muitimerization domains. Additional examples include basic-helix-ioop-helix domains and oth er protein sequences that mediate heteromeric or homomneric protein-protein interactions among nucleic acid binding proteins (e.g., DNA binding transcription factors, such as TAPs) 20 One specific example of a mulitinmerization domain is p 53 residues 319 to 360 which mediate tetramer formation. Another example is human platelet factor 4, which self assembles into tetramrers, Yet another example is extracellular protein TSP4, a member of the thrormbospondin family, which can forn pentamners, Additional specific examples are the leucine zippers of jun, fos, and yeast protein 0CN4. 25 Humanized antibodies may be directly liked to each other via a chemical cross linking agent or can be connected via a linker sequence (e.g., a peptide sequence) to form mnultimers. As used herein, linked" or "spacer" refers to a molecule or group of molecules that connects two or more molecules to each other. A flexible linker allows rotation of the two molecules lindced to e~ach other to tihe extent that the molecules do not 30 block each others function. For example, a linker such as an amino acid sequence attached to a humanized antibody which is itself attached to a nmultimerization domain, i4 allows the antibody to bind to antigen without significant steri Interference from the multiners of the oligorner. Non-peptide liners include chemical crosslinking agents and polyethylene glycol. One specific example of a peptide linker is an imnunoglobulin binge sequence 5 Additionalspecific examples are polylyisne ployglutamicacid and mixtures of randomized aminoacid sequences Linker amino acid sequences may be fully human, humanized or non-human amino acid sequences, unmodified or modified as set forh herein. The invention therefore fladher provides humanized antibodies that include a linker sequence. inker sequences include, for example, sequences from about 2 to 10, 10 10 to 20, 10 to 30, 25 u 50, 30 to 60 and 50 to 75 amino acids in length. Antibodies also include modified forms such as sequences having one or more amio acid substitutionsadditions or deletions,provided the modification does not destroy function e g. does not destroy antigen binding activity; the antibody retainsat least in pa antigen binding activity For example, a modified humanized antibody will 15 retain at least in part, affinity for the antigen to which unmodified antibody binds. The tenn "Naodification" therefore denotes an alteration of a molecule that doe not destroy an activity of the modified molecule, Modifications therefore include, for example, amino acid additions, insertions, deletions and substitutions; An example of an addition is where one or more amino acids 20 are added to the N- or 0-enninal end of a humanized antibody; An example of an insertion is where an amino acid inseded into the sequence. An example of a deletion is where one or more amino acids are deleted from the N- or Cterminal end,or internal within the sequence. The invention therefore also provides modified forms of the humanized 25 antibodies, including one or more amino acid additions, insertions, deletions and substitutions In one embodiment, a humanized antibody has one or more amino acid substitutions of a sequence set forth in SEQ ID NO:1 and 3 (uMA); SEQ I) 10:4 and 5 (Hum3); SEQ ID 1:6 and7 (HumC); SEQ 11 N:8 and 9 (HrD); SEQ 1D N10:10 and 11 (HumE); SEQ ID NO:12 and 13 (HumF); SEQ ID NO:14 and 15 (HumG); SEQ 30 ID NO:16 and 17 (HumH); and SEQ ID NO:18 and 19 (Humil); and SEQ ID N:5 and 15 20 (Hur4);and SEQ ID ND:5 and 21 (Hum5U, provided that the substituted antibody is capable of antigen binding. In a particular aspect or more of the amino acid substitutions arc conservative amino acid substitutions, In another aspect, the substitution comprises 13. 35 or 5-40 amino acids. In yet another aspect, the 5 substitution is vith a Inman amino acid. In Still another aspect, the substitution is with a non-human amino acid which is structurally similar to the non-human residue, for example, where a non-human vernier zone amino acid of theramework acceptor (egg miurine acceptor) is stmeturally dissimilar to the human counterpart vernier zone amino acid, 10 Exemplary amino acid substitutions include conservative amino acid substitutions. The tenn "conservative substitution" means the replacement of one amino acid by a biological or chemically or stmuturally similar residue. BiologiaRy simNilar meansthat the substitution is compatible withiological activity e g ora humanized antibody antigen binding. Stiutualy similar means that the amino acids have side [5 chains with similar length, such as alanine, glycine and serine, or having similar size. chemical similarity means that the residues have the same charge or are both hydrophili or hydrophobicParticular examples of conservative substitutions include the substitution of one hydrophobic residue, such as isoleucine; valine, leucine or methionine for another, or the substitution of one polar residue for another such as thesubstitution of 20 arginine for lysine, giutanie for aspartic acids, or glutamine for asparagine serine for threconie, and the like. Modifications also include derivatized sequences, for example, amino acids in which free amino groups form amine hydrochlorides, p-4oluene sulfonyl groups, cabrobenzoxy groups; the free carboxy groups from salts, methyl and ethyl esters; free 25 hydroxy groups that form O-acyl or O-alkyl derivatives, as wel as naturally accusing amino acid derivatives, for example, 4-hydroxyprolinie for proline, 5-hydroxylysine for lysine, homoserine for serine, Ornithine for lysine, etc. Also included are modifications that confer covalent bonding, tbr example, a disulfide linkage between two cysteine residues thereby producing a cyclic polypeptide. Modifications can be produced using 30 any of a variety of methods wellikown in the art (eg, PCR based sited-directed, 16 deletion and insertion mutagenesis, chemical modification and matagenesis, Cross linking, etc) Modifications also include addition of functional entities such as tags (e.g., polyhistidine, T7, immunogiubulin, etc.), gold particles, covalently or non-covalently 5 attached to the huxnarized antibodies or subsequences or multimers. Thus, the invention provides modified humanized antibodies having one or more activities (e.g., retain at least part of the antigen binding activity) of unmodified parent antibody. Modifications include radioactive or alternatively non-radioactive detectable labels attached to or incorporated into the molecule. 10 The term "identical"or "identity" means that two or more referenced entities are the same. Thus, where two nuclei acid sequences are identical, they have the same sequence. "Areas of identity" mans that a portion of two or more referenced entities are the sae Thuswhere two nucleic acid sequences are identical over one or more parts of their sequence,they share identity in these areasThe tenm "substantial identity" means 15 that the identity is structurally or fumtionally significant That is, the identity is suci that the molecules are stmuturally identical or perform the same function (e g., biological auction) even though the molecules differ. Due to variation in the amount ofsquence conservation between structurally and functionally related proteins, the amount of sequence identity for substantial identity will depend upon the type ofregiorddomain and 20 its function. For nucleic acid sequences, 50% sequence homology and above may constitute substantial homology. Substantial homogygy for proteins can be significantly less, for example as little as 30% sequence homolog, but typically is more, eg, 50%, 60%75%, 85% or more. The extent of identity between two sequences can be ascertained using various 25 computer programs and mathematical algorithms kmown in the art. Such algorimds that calculate percent sequence identity (homology) generally account for sequence gaps and mismatches over the comparison region. For example, a BLAST (e.g, BLAST 2.0) search algorithm (see, e.g., Altschul et a!. (1990) 1. Mo Bio, 215:403-10, publicly available through NCB at http:/wyincbi.nhmnih.gov) has exemplary search parameters 30 as follows: Mismatch -2; gap open 5; gap extension 2. For polypeptide sequence 17 comparisons, a BLASTP algorithm is typically used in combination with a scoring matrix, such as PAM10O PAM 250, BLOSUM 62 and the like, As used herein, the term "isolated"when used as a modifier of invention compositions (e.g, antibodies, subsequences modified forms, multimers nuclei acids d encoding sameells, vectors, et, means that the compositions are made by the hand of man and are separated from their naturally occurring in vivo environment Generally, compositions so separated are substantially free of one or more materials with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cel membrane. An "isolated" antibody can also be substantiallyy pure" 10 when free of most or all of the materials with which they may normally associate with in nature. Thus, an isolated moleculethat also is substantially pure does not include polypeptides or polynucleotidespresent among millions of other sequences such as antibodies of an antibody library or nuclei acids in a genomic or eNA library, or example. Purity can be at least about 60% or more by mass. The purty can also be 15 about 70% or 80% or more, and can be greater; for example, 90% or more. Puritycanbe determined by any appropriate method, including, for examples UV spectioscopy, chromatography (e.g, HPLC, gas phase) gel electrophoresis(eg silver or coomassie staining) and sequence analysis (nucleic acid and peptide) The invention additionally provides methods for producinghumanized antibodies 20 In one embodiment, a method includes:selecting a human framework sequence as an acceptor, wherein said sequence has 50% or more identity (eg, 50-55% 55-60%,60 65%, 6500%, 70-75%, 75-80%, 8085%, 8590%, 90-95%, more identity) to a now human donor antibody famework region; grafting a CDR from the donor non-human antibody (e.g. murine)onto the human framework; comparing thevernier zone residues 25 of the human acceptor and the non-huma donorfamework regions;and maintaining one or more ofthe human aeor residues in the verier zone when the donornon-human and human residues are structurally or chemically sirnilar, or substituting one o more of the vonier zone residues with a residue that is different from both the donor non-human venier zone residue and acceptor human veier zone residue if the donor non-human 30 verier zone residue is stmuturally or chemically dissimilar to the human residue, wherein the different residue is structurally or chemialy similar to the donor non-human 18 verier zone residue, In other words, if the donor non-human venier zone residue is struturally or chemically dissimiar to the acceptor human vernier zone residue, then this veraer zone residue is modified to a residue that is different from both the donor non human vernier zone residue and the acceptor human vemier zone residue, yet strmuturally 5 or chemicaHy sinnlar to the donor non-human verier zone residue. In additional embodimentshuman framework acceptor sequences are selected from consensus sequences, for example, from V domain subgroup I and subgroup I consensms sequenes. The invention also provides nucleic acids encoding intention humanized 10 antibodie; including high affinty hmanized antibodies, subsequences, modified forns and multiners thereof In varius embodiments, a nucleic acid encodes a polypeptide set forth in SEQ TI NO:! and 3 (HiunA); SEQ 1D N104 and 5 (Huru3); SEQ ID NO:6 and 7 (HumnC); SEQ ID NO:8 and 9 (HumiD); SEQ ID NO:!l0 and ii (THumE); SEQ ID NO0:2 and 13 HumF); SEQ ID NO:14 and 15 (HumG); SEQ ID NO:16 and I-(HnH); and 15 SEQ ID NO:18 and 19 (Huml); and SEQ ID NO: and 20 (iHun40); and SEQ IDNOS and 21 (HumSO) As used herein, a "nucleic acid" refers to at least two or more ribo- or deoxy ribonucleic acid base pairs that are linked through a phosphoester bond equivalent. Nucleic acids include polynucleotides and polynculeosides Nucleic acids include single, 20 double or triplex, circular or linearmolecules. A nucleic acid molecule may belong exclusively or in a mixture to any group of nucieotide-contning molecules, as exemplified by, but not limited the following groups of nucleic acid molecules: NA, DNA, cDNA, genomile nucleic acids, non-genomic nucic c acids, natural occurring and non naturally occurring nucleic acids and synthetic nuclei acids. This includes, by way 25 of examplenucleic acids associated with any organelle, such as the mitochondria, ribosonmal RNA and nuclei acid molecules comprised chimerical of one or mor components that are not naturally occurring along witnaturally occurring components Additionally a nucleic acid molecule"may contain in part one or more non nucieoide-b used components as exemplified by, but not limited to, amino acids and 19 sugars. Thus, byway ofexample, but not invitation, a ibozyme that is in part nucleotdde-based and in part proteinIbased is considered a "nuceic acid molecule? Nucleic acids can be of any length Nucleic acid lengthsypically range from about 20 to 10 Kb, 10 to 5Kb I to 5 Kb or less, 1000 to about 500 base pairs or less in 5 length Nucleic acids can also be shorterfr example, 100 to about 500 base pahis, or fronm about 12 to 25, 25 to 50, 50 to 100, 100 to 250, or about 250 to 500 base pairs in length. As a result of the degeneracy of the genetic code ucleic acids include sequences and subsequences degenerate with respect to nucleic acids that encode SEQ ID NO: and 10 3 (HumA); SEQ ID NT4 and 5 (Hu1- B) u SEQ I 0D NO:6 and 7 (HumC); SEQ ID 1N,:8 and 9 umD); SEQ ID NO 0 and 11 (HumE); SEQ .D N1;1 and 13Hum; SEQ ID NO14 and 15 HunG); SEQ ID NO:16 and 17 (HumH; and SEQ ID NO:18 and 19 (Hurib) and SEQ ID NO:5 and 20 (Hu1m40); and SEQ I N 0:5 and 21 (Hu-0), and subsequences thereof Nucleic acids also include sequences complementary to a 15 sequence thatencodes SEQ ID NO: and3(HumA); SEQ ID NW:4 and 5 (HumBoSEQ ID 10:6 and 7(HunC SEQ ID N10:8 and9 (Hui D); SEQ ID NO:1 and 11 (HuBni); SEQ ID NO:12 and 13 (Hum$) SEQ ID N0:14 and 15 (HumG) SEQ ID 1016 and 17 (HumH); and SEQID N0:18and 19 ThunI); and SEQ ID T:5 and 20 (Ua4O); and SEQ ID 11:5 and 21 (Hu5S), and subsequencesthereof Nucleic acid subsequences 20 have front about 15 to 25, 25 to 50 or 50 to 100 nucleotides Such nucleic acids are useful for hybridization to detectthe presence or an amount of humanized antibody in a sample (in vitro:,cell cure medium, tissue or organserum, in a subectetcj The invention further includes nucleic acids that hybridize at high stingency to nudei acids that encode SEQ ID NO I and 3 (1amA; SEQ ID NO:4 and 5 (Huri) 25 SEQ ID NO;6 and 7 (HumC); SEQ ID NW;8 and 9 (IunD) SEQ ID NO:10 and It (HUnH); SEQ M N 012 and 13 (HumP);SEQ N10:14 and 15 (HumG; EQ ID >10:6 and 17 (um); and SEQD NO 8 and 19 (Hum; and SEQ ID NO: and 20 (Hu4O); and SEQ ID N0:5 and 21 (Htn.50), subequencesthereof and nuclei acid sequences complementary thereto. Hybridizing nuclei acids are also useful for detecting 30 the presence or an amount of humanized antibody in a sample. 20 The term "hybridize" refers to the binding between complementary nucleic acids. Sequences will generally have more than about 50% homology to a nucleic acid that encodes SEQ ID NO:1 and 3 (HumA); SEQ ID NO:4 and 5 (HmB); SEQ ID NO0:6 and 7 (HumC); SEQ 1D NO:8 and 9 (IAnD); SEQ ID NO: 10 and I1 (HumiE); SEQ IT) 5 NO:i2 and 13 (HumF); SEQ ID NO:14 and 15 (HumG); SEQ ID NO:16 and 17 (FumH); and SEQ ID NO:18 and 19 (Hurl); and SEQ ID NO:5 and 20 (Hum40) and SEQ ID NO:5 and 21 (Hurn50). The region between related sequences can extend over at least about 30 base pairs, or about 50 base pairs, or about 100 to 200 or more residues. As is understood by those sidled in the art, the TM smeltingg temperature) refers to 10 the temperature at which binding between complementary sequences is no longer stable. For two sequences to bind, the temperature of a hybridization reaction must be less than the calculated TM for the sequences. The TMis influenced by the amount of sequence complementarity, length, composition (%GC), type of nucleic acid (RNA vs, DNA), and the amount of salt, detergent and other components in the reaction (e., formamide). All 15 of these factors are considered in establishing appropriate hybridization conditions (see, emg. the hybridization techniques and formula for calculating TM described in Sarnbrook et at, 1989 supra) Typically, wash conditions are adjusted so as to attain the desired degree of hybridization stringency. Thus, hybridiation stringency can be determined empirically, 20 for example, by washing under particular conditions, eg, at low stringency conditions or high stringency conditions. Optimal conditions for selective hybridization will vary depending on the particular hybridization reaction involved. An example of high stringency hybridization conditions are as follows: 2X SSC/T.% SDS at about 37"C or 424C (hybridization conditions); 0.5X SSC/0.1% SDS at about room temperature (low 25 stringency wash); 0.5X SSC/0% SDS at about 42*C (moderate stringency wash); and 0.1 X SSC/0,1% SDS at about 65"C (high stringency wash). Nucleic acids of the invention can be produced using various standard cloning and chemical syrhesis techniques, Such techniques include, but are not limited to: 1) nucleic acid ampliTication, e.g, polymerase chain reaction (PCR), with genomic DNA or 30 cDNA targets using primers (eg, a degenerate primer mixture) capable of annealing to 21 antibody sequence; 2) chemical synthesis of nucleic acid sequences which can then be cloned into a pasnid, propagated ampliffiedan d and computer searches of databases for related sequences, Purity of nucleic acids can be determined through sequencing, gel electrophoresis and the like. 5 The invention further provides expression cassettes comprising a nucleic acid encoding a humanized antibody operably linked to an expression control element. As used herein, the term "operably linked" refers to a physical or a fuctionalrelationship between the elements referred to that permit tem to operate in their intended fashion. Thus, an expression control element "operably linked" to a nuclei acid means that the 10 controlelement modulates transcription and as appropriate, translation of the transcript, There need notbe physical linkage to nucleic acid in order to control expression. Thus, physical linkage is not required for the elements to be operable linked. For example, a minimal element can be linked to a nucleic acid encoding a humanized antibody- A second element that controls expression of an operably linked nucleic acid 15 encoding a protein that functions "in trias" to bind to the mirdmal element can influence expression of the humanized antibody Becausethe second element regulates expression of humanized antibody, the second element is operably linked to the nucleic acid encoding the humanized antibody The term "expression control element" refers to nucleic acid that influences 20 expression of an operably linked nucleic acid., Promoters and enhances are particular non-limiting examples of expression control elements. A "promotor sequence" is a DNA regulatory region capable of initiating transcription of a downstream (3' direction) coding sequence. The promoter sequence includes a minimum number of bases necessary to initiate transcription. Enhancers also regulate gene expression but can function a distance 25 from the transcription start site of the gene to which it is operable linked. Enhancers also function at either 5' or 3' ends of the gene, as well as within the gene (eg, in introns or coding sequences> An expresion contr [ element can confer expression in a manner that is "constitutive, such that transcription of the operably linked nucic acid occurs without 30 the presence ofa signal or stimuli. expression control elements can confer expression in 22 a manner that is "regulaabie"that is, a signal or stimuli increases or decreases expression of the operably linked nucleic acid, A regulatable element that increases expression of the operably linked nucleic acid in response to a signal or stimuli is also referred to as an inducible element" A regulatable element that decreases expression of 5 the operably linked nucleic acid in response to a signal or stimuli is referred to as a "repressible elemenf e (m the signal decreases expression such that when the signal, is removed or absent, expression is increased) Expression control elements include elements active in a particular tissue or cel type, referred to herein as a "tissue-specifi expression control elements." Tissue 10 specific expression control elements are typically active in specific cell or tissue because they are recognized by transcriptional activator proteins, or other regulators of transcription, that are unique to a specific cellor tissue type. Expression control elements additionally include elements that confer expression at a particular stage of the cell cycle or differentiation Accordingly, the invention further 15 includes expression control elements that confer constitutive, regulatable, tissue-specific, cell cycle specificand differentiation stage specific expression Expression control elements include fulllength nuclei acid sequences such as native promoter and enhancer elements, as well as subsequences or nucleotide variants thereof (e.gsubstitutedlmutated or other fbrna that differ from native sequences) which 20 retain all or part of full-engthor non-ariant control element function (confer regulation, ag., retain some amount of inducibility in response to a signal or stimnulij For bacterial systems, consttutive promoters such as T7 and te like as well as inducible promoters such as piL bacterophage , pla , ptp, ptac(ptrp-ac hybrid proinoterg may be used In insect cell systems constitutive or inducible promoters (e.g 25 ecdysone) may be used In yeast, constitutive or inducible promoters may be used (see g. Ausuibel e a!, In: Current ProtocoAin Molecular Bihe Vol. 2- h , ed, Greene Publish Assoc,& Wiey lnterscience, 1988; Grant ei a (1987) In:Methods in Erh ology. 153:516-544, eds Wu & Grossman, 31987 Acad. Press, NY; Glover D2 Clnig Vol. II, Ch. 3, II Press, Wash, D 186 Bitter(1987 In: Methodin 30 Enzvnolovy 152:673-U,68 eds. Berger & Kimmel Acad.Press, and Strathern ei 23 al, fThe Molecular Biology of the Yeast Saccharomyces ( 982) eds. Cold Spring Harbor Press, Vols. I and ID). A constitutive yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used ( Rothstein in: DNA Cioing A Practical Approach, Voli i, Ch. 3, ed. DT Glover, IRL Press, Wash, D.C., 1986). S For mammalian cells, constitutive promoters of viral or other origins may be used. For example, SV40, or viral long terminal repeats (LriTRs) and the like, or inducible promoters derived from the genome of mannalian cells (e.g., inetalothionein IIA promoter; heat shock promoter, steroid/thyroid hornone/retinoic acid response elements) or from mamnalian viruses (e.g, the adenovirs late promoter; the inducible mouse 10 mammar tumor virus LTR) can be used for expression. The invention also provides transformed cells and progeny thereof into which a nuicleic acid molecule encoding humanized antibody has been introduced by means of recombinant DNA techniques in vitro, ex vivo or in viv, The transformed cells can be propagated and the introduced nucleic acid transcribed, or encoded protein expressed. It 15 is understood that a progeny cell may not be identical to the parental cell, since there may be mutations that occur during replication. Transformed cells include but are not limited to prokaryotic and eukaryotic cells such as bacteria, fiugi, plant, insect, and animal (e.g, mammalian, including human) cells. The cells may be present in culture, in a cell, tissue or organ ex viva or present in a subject. 20 The term "transformed" means a genetic change in a cell following incorporation ofnucleic acid (e.g, a transgene) exogenous to the cell Thus, a "transformed eel?" is a cell into which, or a progeny of which a nucleic acid molecule has been introduced by means ofrecombinant DNA techniques. Cell transformation to produce host cells may be carried out as described herein or using techniques known in the art. Accordingly, 25 methods of producing cells containing the nleic acids and cells expressing the humanized antibodies of the invention are also provided Typicaly cell tansfonmation employs a vector. The term "vectorrefers to eg, a plasmid, virus, such as a viralvector, or other vehicle known in the atthat can be manipulated by insertion or incorportion of a nuclei acidfor genetic manipulation (e 30 "cloning vectors"), or can be u sed to transcribe or translate the inserted polynucleotide 24 e "expression vectors") Such vectors are useful for introducing nucleic acids, including a nuclei acid That encodes a humanized antibody operably linked with an expression control clement, and Capressing the encoded protein in vifra e g in solution or in solid phase), in cells or in vivo. 5A vector generally contains at least an origin of replication for propagation in a ell Control elements, including expression control elementsas set forth herein, present within a vctor are included to facilitate transcription and translation. The tern "expression control element"is intended to include, at a minimum, one or more components whose presence can influence expression, and can include components other 10 than or in addition to promoters or enhancers, for example, ladder sequences and fuson partner sequences internalribosne binding sites IRES) elements for the creation of muligene, or polycistronic, messages, living signal for introns, maintenance of the corret reading frame of the gene to permit inifame translation of mRNA, polyadenylation signal toponde proper polyadenylation of the transcript of a gene of 15 interest, stop codons, etc. Vectors can include a selection marker. As is knovn in the art, "selection marker" mcans a gene that allows for the selection of cells containing t.e gene. "Positive selection" refers to a process whereby only cells that contain the selection marker will survive upon exposure to the positive selection. Drag resistance is one example of a 20 positive selection marker; cells containing the marker will suvive in culture medium containing the selection drug, and cells which do not contain the marker will die. Such markers include drug resistance genes such as neo, which confers resistance to 0418, hygr, which confers resistance to hygomycin, or puro which confers resistance to pmomycin, among others. Other positive selection mnaer genes include genes that 25 allow identification or screening of cells containing the marker. These genes include genes for fluorescent proteins (GFP), the laeZ gene, the alkaline phosphatase gene, and surface markers such as CD8, among others. Vectors can contain negative selection markers. "Negative selection" refers to a process whereby cells containing a negative selection marker are killed upon exposure to 30 an appropriate negative selection agent. For example, cells which contain the herpes 25 simlex virsthymidine kinase (HSY~dk) gene (Wigler et al, Coll 11223 (1977)are sensitive to the drg gancyclovir (GANC). Similarly, the gpi gene renders cells sensitive to6-tiloxanthine. Additional selection systems maybe used, including, but not limited to the 5 hypoxanthine-guanine phosphoribosyltransferase gene (Szybaiska et at, Proc. Nail Aad. ScW USA 48:2026 (1962)), and the adenine phosphoribosyitransferase (Lowy ei at, Cell 22:817 (1980)) genes. Additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hlartman ei al, Proc. NaL Acad Sci USA 10 85:8047 (1988)); and ODC (omithine decaiboxylase), which confers resistance to the omtithine decarboxylase inhibitor, 2-(difiuoromethy)-DL-omithine, DFMO (McConiogue (1987) In: Current Communications in Molecular Biology, Cold Spring Harhor Laboratory, edt). Vectors included are those based on viral vectors, such as retroviral, adeno 15 associated virs, adenovirus, reovirs lentivirus, rotavirs genomessimian virus 40 (SV40) or bovine papiliomavis, etc. modified for introducing and expressing a nucleic acid in a cell (Cone ei alt Proc ad. Aa St. USA 81:6349 (1984).(Bukaryotic Viral VectorsCold Spring HarborLaboratory, Gluzrnan ed, 1982; Sarver era Mo! Cel Bial 1:486 (1931)) Additional viral vectors useful for expression include parvovirus, 20 rotavius Norwalk virus, coronaviuses paranyxo and rhabdo:vuses, togavims (eg sindbis virus and semliki forest virus) and vesicular stonatitis virs, Manmalian expression systems further include vectors specifically designed for in vivo and ex vivo expression. Such systems include adeno-associated virus (AAV) vectors (U.S. Patent No. 5,604,090). AAV vectors have previously been shown to 25 provide expression of Factor LX in humans and in mice at levels sufficient for therapeutic benefit (Kay et ae, Na. Genei. 24:257 (2000); Nakai et a, Blood 91:4600 (1998)), Adenoviral vectors (U.S. Patent Nos. 5,700,470, 5,731,172 and 5,928,944), heroes simplex virs vectors (U.S. Patent No. 5,501,979) and retroviral (e.g, lentivirus vectors are useful for infecting dividing as well as non-dividing cells and foany virus) vectors 30 (U.S. Patent Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516 and 5,674,703 and WIPO 26 publications W092!05266 and W092/l4829) and papilloma viri vectors (e.g, human and bovine papilloma viMs have all bean employed in gene therapy (E. Patent No. 5,719.054). Vectors also inclde cytoegaloviru(CMV) based vectors (US Patent No S5615063) ectors that efficiently deliver genes to cells of the intestinal tract have been 5 developed and also may be used (see, agg, U.S. Patent Nos. 5821,2355,786,340 and 6,110,456) In yeast, vectors that faciliate integration of foreign nucleic acid sequenes into a chromosome, via homologous recombination, for example, are known in tbe art and can be used, Yeast artificial chromosomes (YAC) are typically used when the inserted 10 nucleic acids are too large for more conventional vectors (e.g., greater than about 12 kb> Introduction of nucleic acid encoding humanized antibody and huImanized antibody into target cells can also be can-led out by conventional methods known in the art such as osmotic shock (ag., calchun phosphate), electroporation, microinjection cell fusion, etc. introduction of nucleic acid and polypeptide in vitro, a viv and in vivo can 15 also be accomplished using other techniques. For example, a polymeric substance, such as polyesters, polyamnine acids, hydrogel, polyvinyl pyrrolidone, ethyiene-vinyacetate, methylcellul ose, carboxymethyicellulose, protanine sulfate, or lactide/glycolide copolymers, poiyiactide/glycolide copolymers, or ethylenevinylacetate copoiymers. A nucleic acid can be entrapped in microcapsues prepared by coacervation techniques or 20 by interfacial polymerization, for example, by the use of hydroxymethylcelldose or geiatinmicrocapsules, or poly (methylmehacroiate) microcapsules, respectively, or in a coloid drug delivery system. Colloidal dispersion systems include macromolecule complexes, nano-capsules, microspheres, beads, and lipid-based systems, including oil in-water emulsions, micelles, mixed rmicelles, and liposomes, 25 The use of liposomnes for introducing various compositions into cells, including nucleic acids, is known to those skilled in the art (see, e-g,, IS, Patent Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282). A canier comprising a natural polymer, or a derivative or a hydrolysate of a natural polymer, described in WO 94/200'8 and US Patent No. 6,096,291, is suitable for mucosal delivery of molecules, such as polypeptides 30 and polyuMcleotides. Piperazine based anphilic cationic lipids useful for gene therapy 2'7 also are known (see, e.g., US. Patent No. 5,861,397). Cationic lipid systems also are known (see, e., S. Patent No. 5,459,127), Accordingly; viral and non-viral vector means of delivery into cells or tissue, in vitr, in vivo and ex vivo are included. The invention filter provides kits comprising one or more compositions of the 5 invention, including pharnacentical formulations, packaged into suitable packaging material, In one embodiment, a kit includes a humanized antibody or subsequence. In another embodiment, a kit includes a nucleic acid encoding humanized antibody or subsequence. In additional embodiments, a Iit includes nucleic acids that further include an expression control element; an expression vector; a viral expression vector; an adeno 10 associated virus expression vector; an adenoviral expi essiun vectoa and a rtroviral expression vector, In yet an additional embodiment a kit includes a cell that expresses a humanized antibody or subsequence In additional embodiments, a kit includes a label or packaging insert including instructions for expressing a humanized antibody or a nucleic acid encoding a humanized 15 antibody in cells in vitro, in vivo, or ex viva. In vet additional embodiments, a kit includes a label or packaging insert including instructions for treating a subject (eg, a subject having or at risk of having asthma) vrith a hmnanized antibody or a nucleic acid encoding a hmanized antibody in iv r ex Amyv As used herein, the term "packaging material" refers to a physical structure 20 housing the componentsof the kit The packaging material can maintain the components sterilelyand can be made of material commonly sed for such purposes (eg, paper, cougated fiber, glass, plastic, foil, ampulestc) The label orpackaging insert can include appropriate written instructions, for example, practicing a method of the invention e.g, treating the common cold. Kits of the invention therefore can additionally 25 include instructions for using the kit components in a method of the invention. instructions can includenstructions for practicingfany of the methods of the invention described herein, Thusinvention pharmaceutica] compositions can be included in a container pack, or dispenser together with instructions administration to a subject. Instructions may additionally include indications o a satisfactory clinical 28 endpoint or any adverse symptoms that may occur or additional information required by the ood and Drug Administration for use on a human subject The instructions may be on "printed matter," e., on paper or cardboard within the kit, on a label affixed to thekit or packaging material, or attached to a vial or tube 5 containing a component ofthe kit, Instmutions may comprise voice or video tape and additionaly be included on a computer readable medium, such as a disk (floppy diskette or hard disk), optical CD such as CD- or DVD-RDM/RAI magnetic tape, electrical storage media such as RAM and ROM and hybrids of these such as magnetic/optical storage media. 10 invention kits can additionally include a suffering agent a preservadve, or a protein/nucleic acid stabilizing agent. The kit can also include control components for assaying for activitye.g, a control sampler a standard. Each component of the kit can be enclosed within an individual container or in a mixture and all ofthe various containers can be within single or multiple packages. For examplean invention 15 composition can be packaged into a hand pump ontane r pressurized (e.g. aerosol) container for spraying the composition into the throat or nasal or sinus passages of a subject. The humanized antibodies oftheinventionncluding subsequences modified fons nultiMers and nucleic acids encoding them, can be incorporated into 20 pharmaceutical compositions. Such pharmaceutical compositions are useful for administration to a suhj ect in 'vv or ar vivQand for providing therapy for a physiological disorder or conditiontreatable with a humanzed antibody Phanmaceutical compositions include "pharmaceutically acceptable" ad phy acceptable" carrersdiluents or excipients. As used herein the terms 25 pharmaceuncally acceptable" and "physiologically acceptable" include solvents (aqueous ornon-aqueous) solutions emulspons disperion media, coatings isotoni and absorption promoting or delaying agents, compatible with pharmaceutical administration. Such fornulations can be contained in a liquid; emulsionsuspension syrup or elixir or solid form tablet (coated or uncoaed>apsule (hard or soft),powder; granule, crystal or 29 microbead. Supplementary active compounds (emg. preservatives, antibacterialantiviral and antifungal agents) can also be incorporated into the compositions Pharmaceutical compositions can be formulated to be compatible with a particular local or systemic route of administration. Thus, pharmaceutical compositions include 5 carriers, diluents, or recipients suitable for administration by particular routes. Specific non-limiting examples of routes of administration for compositions of the invention are inhalation or intranasal delivery. Additional routes include parenteral, e.g. intravenous, intradernal, subcutaneous, oral, transdermal (topical), transmucosal, and rectal administration. 10 Solutions or suspensions used for parenteralintradermat or subcutaneous apphiation can include:a sterile diluent such as water for injection, saline solution fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzjl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethyienediaminetetraacetio 15 acid; buffers such as acetates citrats or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose, p1 can be adjusted with acids or bases, such as hydrochloric acid or sodiumhydoxide. Pharmaceutical compositions for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous 20 preparation of sterile injectablesolutions or dispersion For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Crernophor EUTM (BASF, Parippany NJ) or phosphate buffed saline (PBS). Tne carier canbe a solvent or dispersion medium containing fbr example, water, ethanol polyol (for example, glycerol propylene glycol, and liquid polyetheylene glycol, and the like), and suitable 25 mixtures thereof. Fluidity arn be maintained, for example, by the use of a coating such as lecithin by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Antibacterialand antifungal agents include, forexample; parabens, chlorobutano phenol, ascorbic acid and thimerosal. Isotonic agentsfor example sugars, poiyalcohols such as msnitol sorbitol sodium chloride can be included 30 in the composition. Including an agent which delays absorption, for example, aluminum monostearate and gelatin can prolong absorption of injectable compositions. Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of above 5 ingredients followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients as above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include, for example, vacuum drying and freeze-dr}ying which yields a powder of the active ingredient plus any 10 additional desired ingredient fiom a pieviously sterile4f1tered solution thereof. For transiucosal or transdermal administration, penetrants appropriate to the banner to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for tranrsmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished 15 through the use of nasal sprays, inhalation devices (e.g., aspirators) or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. Invention humanized antibodies, including subsequences and modified forms and nucleic acids encoding them, can be prepared with can-iers that protect against rapid 20 elinmination from the body, such as a controlled release fonnulation or a tirme delay material such as glyceryl monostearate or glyceryl stearate. The compositions can also be delivered using implants and microencapsulated delivery systems to achieve local or systemic sustained delivery or controlled release. Biodegradable, biocompatable polymers can be used, such as ethylene vinyl 25 acetate, polyanhydrides, polyglycolic acid, collagen, polyoihoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, ic. Liposomal suspensions (including liposormes targeted to cells or tissues using antibodies or viral coat proteins) can also be used as pharmaceutically 31 aceeptable carriers. These can be prepared according to methods known to those skilled in the art, for examples described in SPatent No 4,522,811 Additional phainaceuticaf forudlations approprie for the compositions for administration in the methods of the invention are known in the art (see eg: Remington's Pharmaceutical Sciences(990) 18* ed Mack Publishing Co, Easton, PA; The Merckldndex (1996) 12 ed. Merck Publishing Grup, Whitehouse, NJ; and Phannaceutical Principles of Solid Dosage Forrms, Technonic Publishing Co., Int, Lancaster, Pa- (993)). The pharmaceutical formulations can be packaged in dosage unit form for ease of 10 administration and unifornity of dosage,. "Dosage unit form" as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the phannaceutical carrier or excipient, Humanized antibodies of the invention include antibodies that protect against 15 virs infection of cells. For example, Hum, NumB, HumC, HunD, Hum, HunlI and Hmlprotect against RV infetion of cells (FIG. 4). Thus, in another embodiment, the invention provides antibodies that protect against human rhinovirus (HRV) infection of cells. In one embodiment, an antibody has a protective efficacy equal to or at least 2 to 5 times greater than the non-humanized antibody. hi another embodiment, an antibody has 20 a protective efficacy at least 5 to 10 times greater than the non-humanized antibody In yet another embodiment, an antibody has a protective efficacy at least 10 to 20 times greater than the non-humanized antibody. In still another embodiment, an antibody has a protective effcacy at least 20 to 30 times greater than the non-humanized antibody. As used herein, humann rhinovirus" or "HRV"means major and minor group 25 human serotypes ofrhinovimses that have been identified (see, e.g., amparian et at, (1987) Viro/ogy 159:191) and those that are identified later as falling within this class of virus. Major group HRV binds to IC AM-1 and minor group HRV binds low density lipoprotein (LDL) receptor. As used herein, the term "protective efficacy" is the amount of an antibody which 30 can protect 50% of susceptible cells from infection (Le, E3Co) under experimental 32 conditions (seeelg. Example 5)or example, for KR protective efficacy in BQ 0 is theamount of antibody thatprots 50% ofhela cells fromR infection.hus, a hiumanized antibody having a protective efficacy 5 times greater than another antibody (e, non-humanized) can be used in an amount 5 foldlesshan noniumanized antibdy 5 while still providing the same degree of protection frominfection Humanizedatibodies of the invention include antibodies that hind to ICAM?. Although not wishing to be bound by theory, it is believed that antibody binding to ICAM I inhibits viral binding or the ability to infect or penetrate the cell thereby inhibiting viral infection or proliferation Such antibodies are therefore useftfor 10 iiiti Pg pathogens such as vuuses (egg, HRYand coxackie A virs, respiratory syncytial virus (RSV)bacteria, fungi and protozoa (e g, malaria) that bind to ICAM-iL Thus, the antibodies are useful for inhibiting BKY infection as well as for inhibiting any microorganism or other pathogens inwhich lCAM4 receptor participates Accordingly, the invention provides antibodies that inhibit pathogen infection of cells where infection 15 is mediated, at least in part by binding to lCANMA and methods for inhibiting pathogen infection of cols here infection is mediated, at least in part, by binding to ICAM-l In one embodiment method includes contacting a virs or cel with an amount ofhumanized antibody that binds to ICAM- sufficient to inhibit viral infection of the cell In one aspect, the cell is an epithelial cell In another embodiment, a method 20 includes administering to a subject an amount of humanized antibody that binds to ICAM- sufficient to inhibit viral infection ofthe subject Invarious aspects, the virus is HR, coxackie A virus andrespiratory syncytial virs. In yet another embodiment a method includes administering to a subject an amount of humanized antibody that binds to ICAM4 sufficient to inhibitiufection of the subject by a pathogen. 25 The invention also provides methods for inhibiting infection, ihibiting progression or treating a Pathogenic infection of a subject one embodiment a method includes administering to a subject having or at rskofhaving an HRK infection an amount of humanized antibody suffcient to inhibit, inhibit progression or to treat HRV infection of the subject In another embodiment a method includes administering to a 30 subject having or at risk of having an coxakide A virs or respiratory syncytial vis 33 infection an amount of humanized antibody sufficient to inhibit infection, inhibit progression or to treat coxackie A virus or respiratory syncytial virus infection of the subject. In still another embodiment a method includes administering to a subject having or at risk of having malaria an amount of humanized antibody suffcient to inhibit, inhibit 5 progression or to treat malaria of the subject In various aspects, a humanized antibody has a Va and VL domain selected from: SEQ ID NO:I and 3 (HunA); SEQ ID NO:4 and 5 (HumB); SEQ ID NO and 7 (HumC); SEQ iD NO:8 and 9 (HunD; SEQ ID NO:10 and 11 (HumE); SEQ D NO:12 and 13 (HumF); SEQ ID NO:14 and 15 (HumG); SEQ ID NO:16 and 17 (HumH); and SEQ ID NO:1S and 19 (Huni); and SEQ ID NO:5 and 10 20 (Hum4O); and SEQ ID NO:5 and 21 (Hum5O), and antigen binding subsequences thereof. The invention fthiter provides methods of decreasing or inhibiting one or more symptoms of a pathogen infection (eg,, caused by HRV, coxackie A virus, respiratory syncytial virus or -a .a). In one embodient, a method includes administering to a 15 subject having one or more -symptoms associated with HRV, coxackie A virus, respiratory syncytial virus or malaria an amount of a humanized antibody sufficient to decrease or inhibit or prevent one or more symptonis associated with BRV, coxackie A virus, respiratory syncytial virus or malaria in the subject. Symptoms decreased or inhibited or prevented include, for ex, for for HRV, one or more of fever, congestion, 20 cough, nasal drip, sore throat, and the like associated with the conmuon cold. in another enbodiment, a method includes administering to a subject having otitis media an amount of a humanized antibody sufficient to decrease or inhibit or prevent one or more symptoms of otitis media in the subject, In yet another embodiment, a method includes administering to a subject having bronchitis an amount of a humanized antibody 25 sufficient to decrease or inhibit or prevent one or more symptoms of bronchitis in the subject, in still another embodiment, a method includes admiAnistering to a subject having sMusits an amount of a humanized antibody sufficient to decrease or inhibit or prevent one or more symptoms of sinusitis in the subject, In a further embodiment, a method includes administering to a subject having or at risk of having asfhma an amount of a 30 humanized antibody sufficient to decrease or inhibit or prevent asthma exacerbation. In 34 one aspect, the humanized antibody is administered locally In another aspect, the humanized antibody is administered via inhalation or intranasaly. In addition to inhibiting pathogens that function directly or indirectly through ICAMK, invention humanized antibodies an be used to treat undesirble physiological 5 conditions, such as disease or disorders in ahich lCAM-1 plays a role. For example, LA I interaction with ICAM-1 participates in narmation. Thus, an invention antibody may be used to inhibit this interaction therby modulatingeg decrease)local or systemic inflammation, Furthermnores ICAM-1 plays a role in other immune response pathways, cancer and retastasis, Thus, an invention antibody may be used to reduce or 10 prevent organ transplant rejection or autoimonne diseases or cancer or metastasis. Accordingly, the invention provides antibodies tharnodulate immune responsiveness (eginammation) and other cellular processes in which LOAMl participates and methods for modulating immune response pathways. The mehods of the invention may be practiced prior to infectiongie prophylaxis) 15 or after infection, before or after acute or chronic symptoms of the infectionor physiological condition or disorder develops (e,.g.before organ transplantation Administering a composition prior to or immediately folowing 'development of symptoms may lessen the severity of the symptoms in the subject Administering a composition prior to development of symptoms in the subject may decrease 20 contagiousness of the subject thereby decreasing the likelihood of other subjects becoming infected from the infected subject. The term "subject refers to animals, typical mammnalian animals, such as a non-human prmate(gorillachimpazees, orangutans macaques gibbons) a domestic anlia (dogs and cats), a farm animal (horses, cows, goats heep, pigs), experimental 25 animal (mouse, rat, rabbit, guinea pig) and humansiuman subjects include adults and children, for example, newborns and older children, for examplebetween the ages of I and5 5 and 10 and I0 and . Human subjects may include those having or at risk of having a viral infection, such as HL. and which develops one or oresymptoms of the infection, for example, those typically associated with the common cold. 1uran subjects 30 include those having or at uik of having asthma, including asthmatics suffering from '35 chonic asthma prior to or following suffeing an acute asthma attack. Subjects include disease model animals (e.g, such as mice and non-man. primates) for testing i viO efficacy of humanized antibodies of the invention eg, an 1V animal model an asthma animal mode], an transplant model an autoimmune disorder model, cancer model 5 ete> Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable 10 methods and materials are described herein, All publications, patents and other references cited herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. As used hereinthe singular forms " "and" and"he" include plural referents 15 unless the context clearly indicates otherwise. Thus, for example, reference to "a transformed cell" includes a plurality of such cells and reference to "a humanized antibody" can include reference to one or more such cells or antibodies, and so forth, A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the 20 spirit and scope of the invention. Accordingly, the following examples are intended to illustrate but not limit the scope of invention described in the claims. EXAMPLES Exmle 1 25 This example describes the strategy for humanizing lA6. Mouse monoclonal antibody lA6 (mAb1lA6) was developed by Colonno et aLi, and has been shown to bind specifically to ICAM-I and protect cells against infection by hiuman rhinovirus (TRV) major groups (Colonjno RJ, et al. (1991) European Patent Application #91201243.2; Publication number: 0459 ST A2, which also describes the 30 sequence of mouse mAb1A6 ). The parental mouse monoclonal antibody 1A6 was 36 synthesized in the form of scR The purified protein/Msc1AGhas an affinity of 1.18 x I0'6 M in K against CAM 1(Table 4) To humanize mAbLA6selected human VH subgroup If and Vt-kappa subgroup ioons ensus sequences were selected as the acceptor YHi and Vt frameworks. 5 respectively (Padan (1994)MoleculrJumot 31:6921 Padlan (991)tolecdar Vnmano 28:489-498), These human sequences have previously been used to hunanize two antibodies (Garter et at (992) Poc Nail. Acad. Sci USA 89:4225-4289; Presta et al (1993) 1 inmnunol 151:2623/2632), Among a cotal of82 amno acid residues in the heavy chain framework, the 10 hun VH lI conensus sequence and mAblA6 antibody share 54 identical amino acid residues, which amounts to 66% identity. A-ong 81 iight chainamewok residues the human consensus sequenceand mAblA6 antibody have 52 amino acid residues in common, which equLs to 642% identity. (FIG. Among a total of 57 framework amino acid residues that are different between 15 mAbdAG and humancosensus sequences, 49 of them are either located on the surface of the antibody molecule, or are residues with similar characteristics, therefore human consensus residues can be used to replace mouse residue The remaining six positions, V11 37, 69, 71. 73. 94 and Vt 49,belong to the "Verier" zone as described by Toote and Winter (1992, J.MVot Bio! 224:487-499). Because "Vemie' zone rescues form a lyer 20 underlying the CDRs and may impact on the simoture of CDRs and the affinity of the antibody dues at these positions were chosen based on molecular iodel building of the antibody. V1 49: Inspection reveals that this position is both at the center of the antibody 25 combining site and at the light chainiheavy chain interface. Substituting an ideal residue at this position can improve antigen binding by both providing additional direct binding contact and by improving the character of the interface. Tyrosine, found in human antibodies at this position, does both, Model building suggests that Y49 can form both Van der Waais and H bond contact with lCAM. Y49 also can interact with heavy chain 30 W102, completing a network of interacting aromatic residues that provide both binding 37 interaction and flexibility at the light chain/heavy chain interface. Therefore, human consensus residue tyrosine at this position is superior to the parental mouse residue lysine. VHI 30. This residue is at the interface between the light and heavy chains Comparing to the parental mouse residue methioninethe human consensus residue valine intrudes less on the interface, potentially providing additional flexibility Flexibility at the interface can enhance binding affinity by increasing conformational adaptability of the antibody VII 69: 10 This residue is packed in the interior of the variable domain. The urine residue) methionine, makes a potentially destabilizing contact with the backbone of a neighboring beta strand. ln contrast, the human residue isoleucine packs well in the interior of the protein. VI 73: 15 Molecular modeling indicates that ithe human consensus residue) aspartic acid (D73) can interact with K30 of heavy chain CDRI Since model building suggests that 1(30is not involved directly in antigen binding) this stabilizing change is predicted to be either neutral or beneficial 1171 and V1194: 20 Structural inspection indicated that both of these positions require a residue with a small side chain for maintenance of proper antibody conformation Thereforethe human consensus residue at this position, arginine, is not appropriate. Serine and glycine were selected for position 7L According to Chothia et at, the residue at VH94 is involved in the canonical 25 structure of H1 or CDRI (defined as VH26-VP32) The CDR1 of 1A6 belongs to the canonical structure 1 and family 1 (Chothia and Lesk (1937) J Mot Bot 186:651-663; Chothia eta (1992) J, Ma iol 227:799-817; Chothia eta! (1989)Nature 342:877 883). Corresponding to this canonical structure, human sequences showed three possible residues at V 94 position: arginine, threonine or alanine (Chothia et al (1992) J. Mt 38 Bio! 227:799<1). Since arginine is not appropriate for this particular antibody, alanne, threcoine and another all residue, asparti acid were chosen, Finally, molecular model building indicates that a portion of the CDR2 in theYHR domain H60-64, does not have direct contact with the antigen. Therefore mouse 5 residues at these positions (DPKVQ) can be replaced by human residues AD, VK. Example 2 This example describes the preparation of several humanized scFv expression consftmets, The humanized sc vA (llmA) cDNiA (FIG. 3) containing 750 hp was 10 synthesized using a series of overlapping oligonucleoties These overlapping oligonnceotides (Table 1 were designed to encode the amino acidsof the varable region fthe heavy (VR) and light (VL) chains linked by a inker((G 4 )) with a Ban HI site The heavy chain and ight chain were cloned separately in TOP 21 vecto After DNA sequencing conformation, the heavy and light chain were subcloned into expression 15 vector (BADpiIl A) to formfl length DNA The oligonuWleotides were frt annealed in six groups consisting of oligo AVIIAVH2, oligo AVH3/AVH4 oligo AVHIS/AVH6G for heavy chain, and oligo AVEI/AVL2, oligo AVL3/AVIA, oligo AVL/AVL6 for the light chain Each annealed group wasextended with the Kienow fragment of DNA polymerase. The annealed and 20 extended products of group 1-3 were pooled with oligo AVH7 as overlapping templates that were amplified via polymerase chain reaction (PCR) usingthehigh-fideliy thenostabie DNA polymerase (Roche) with oligo AYH8 and A.VH9 as primers 'The annealed and extended products of groau 4-6 were pooled with oigo AVL as overlapping templates that were also anplified via polymerase chain reaction (PCQ 25 using oligo AVLS and AVL9 as primers. The PCR products were directly inserted into the TA cloning vector pCR2.-TOPO (Invitrogen) and transferred intoTP 10 competent cells. The piasirids with inserts were isolated and seq ueed. The light chain and the heavy chain DNA fragments were isolated fomheir cloning vector by digestion with Nco i/Ban H I and Ban H ttHpa Irespectively, and 3 cloned into expression vector pBAD/pfII A cutting with Neco I/ Sal I (blunted) to be in 39 frame with the carboxy-terminal His tag. Both strands of the expression construct pBAD HumA was sequenced (MWG Biotech, Inc.). All other hunan scFv expression constructs (HumB to H1) were made with the same procedure as HumA described above except using different oligonucleotides 5 (Table ). For HumB, using BVH6 and BVH7 to replace AVH6 and AVH7; for HumC, using CVH5, CVH6 and CVH7 to replace AVHS, AVH6 and AVH7; for HumD, using DVH6 and DVH7 to replace AVH6 and AVH7; for HunE, using EVH4, EVHlS, EVH6 and EVH7 to replace AVH114, AWHS, AVH6 and AWI7; for HumF, using FVH6 and 10 FVH7 to replace AVH6 and AVH.7; for HumG, using GVL3, GVL4, GVH5, GVH6 and GVH7 to replace AVL3, AVL4, AVHS, AVH6 and AVH7; for HumH:, using HVIL3, HVL4, HVH4, HVi5, HV 6 and HVH7 to replace AVL3, AVL4, AVH4, AVHS, AVH6 and AVH7; for Huml, using IVL3, IVL4, IVH4, IVH5, IVH6 and IVH7 to replace AVL3, AVL4, AVH4, AH5, AVH6 and AVH7. 15 Table . Oligonucleotides for humanized scFvs Oligonucleoddes for the igt (VO) chain of HumA: AVL-1 (SEQ ID NO:26): CGAACCATGGGCGATATCCAGATGACCCAATCTCCGTCTAGCCTGAGCGCcAG-;TGGTG AVL-2 (SEQ ID NO:27): 20 GTGAAGATTATTACTGATAGATTGGCTGGCGCGGCAAGTAATGGTAACTCGATCACCAACAC TGGCGCTCAG AVL-3 (SEQ ID NO:28): CTATCAGTAATAATCTTCACTGGTATCAAGAAAAACCGGGTAAAGCTCCGAAACTTCTTATCT ATCACGCC 25 AVL-4 (SEQ ID NO:29): CCCGAGCCAC-AGCCAAGGGCGGCTCGGAACGCCGCTATGCTCTGAGAGGCGTGATAG ATAAGAAG AVL-5 (SEQ ID NO:30): CTCTGGCTCTGGCTCGGGCACGGACTTTACCCTTACCATCAGCTCTCTTCAGCCGGAAC 30 TTTGCCACC AVL-6 (SEQ ID NO:31): CC TTGACCGAAGGTATACGGCCAGCTATTAGANCTIGCTGACAAT,&ATAGG'TGG",CAAAGTCTTC CGGC AVL-7 (SEQ ID NO:32): 35 GTATACCTTCGGTCAAGGTACCAAGGTCOGAGATTAAGCGCGGCGGTGGCGGTTCT(GTGGC GGTGGTAGCG AVL-8 (SEQ ID NO:33): CGAACCATGGGCGATATCCAGATGACCCAATC AVL-9 (SEQ ID NO:34): CGATCCACCGCCACCGCTACCACCGCCACCAG 40 Oionucleotides for the heavSyFV chain of HumA: AVH-1l (SEQ ID NO:35): GGTGGCGGT§GATCC GGTGGCGGTGGCAGCGAGTTCAACTTTTGAGTTGGTGGCGGT CTGGTTGAGCCGG AVH-2 (SEQ 1D No:36): GTCCTTAATGTTGAAACCGCTTGCTGQCGAGACGGCGCAGAGAGCCACCGGCTGAACC AGACGOCCAC AVH-3 (SEQ ID NO:37): GGTTTCAACATTAGGACACCTACATCATGGGTGAGGCAAGCTOCGGGTAAGGGTCTGG 10 AG3TGGG AV-4 (SEQ ID NO:38): GCCCTTFCACGQTGTCAGCGTAAATGGTGTGTCGTTGCCGGTGATACGTGCCACCCA CTCCAGACCCTTACC AVH-5 (SEQ ID NO:39): 15 CGCTGACAGCGTGAAGGGCCGT!ITiACTATTTCTAGCGACGACTCTAAGAACACCGCGTAC CTTCAGATGAACTCTCTGCG AVH-6 (SEQ ID NQ:40): OCAGTAGCCAGAGTOCGTGCAGTAGTAGACGG CGGTGTCCTCGGCACGCAGAGAGTTQAT CTG3AAGG 20 AVH-7 (SEQ ID NO:41): GGACTOTGGCTACTGGTTTGCOTACTGGCGGCCAGGGCACGCT TGTCACCQGTCTCTT7CTGG3T TAAC AVH-S (SEQ ID NO:42):GGTGGCGGTGGATCCGGT AVH-9 (SEQ ID NO:43): GGGTTAA CCAGAAGAGACGG Olionclotdes for mak!,ingothecr humn cll (um34 5 CTOGG ;CCGAAT'A E~f--7 SEQID O:45): TAAC CVH-5S (SEQ ED NQ-:46)i: 20 CTCAAGG, 15 CHT (SEQIDN48 TAWC UVFPG4 (SEQ ID 104) 20 TGAAG DVH7 (SEQND raw~), 25 GGC CCACCUGGCGAT0G ATATGGrG TTTG 0:3C0(3TGGTAGG0A0C CTCOAGACCTG FVH47 (SEQ RD NQ0:53) 45 -wH-7 (SEQP) 105) 35 TAACAA FVHl-65 (S EQID105) CCA GTAGCOAGGTGTCATAT GG( GOOGT C C-TC GGGAOOCA GAGAGTTCAT CTGAAGG', FVI±7(SEQID 11:54) GVH-7 (SEQ ID NO:62): GACCTCTGGCTACTGGT1TiiGCCTA CTGGGGCCAGGGCAQGOTTGTCACCGTOTCTTCTGGT TAAC HVL-3 (SEQ 1D NO:63): 5 CTATAGTATAATCTTOACTGGTATCAAAACCGGTAAAGTCCAAACTTCTTATCA AACACGOC HVL-4 (SEQ ID N:4): CCCGAGCOAGAGCCAGAGAAG0GGCTCGGAACGCCGCTATGOTCTGAGAGGCGTGAA ATAAGAAG 10 HVH4 (SEQ ID NO:65): GGCCCTCACCTTCGGATCGTAAATGGTGTTGTCGTTTGCCGGGTCGATACTGCCACCCA CTCCAGSACCCTTACC HVH-5 (SEQ iD) NO:66): CGATCCGAAGGTGCAGGGCCGTTTTACTATTrTOGACGAOCTCTAAGAACCCGCTAC 15 OTTCAGATGMCTCTCTGOG HVHS (SEQ ID NO:67): OCAGTAGCCAGAGGT CGTGCAGTAGTAGACGGCGGTTCTGCAGCAGAGAGTTCAT OTOAAGG HVH-7 (SEQ ID NO:68): 20 GAC CTCTGGCTACTGGTTTGCCTACTGGGGCCAG GGOACGOTTGTCACOGTOTOTCTGGT TAAC' IVL- (SEQ ID NO:69): CTATCAGTATAATCTTCACTGGTATCAAAAAACCGGGTAAAGCTCCAAACTTCTTATCA AACAGCC 25 VL (SEQ ID NO:70): CCCGAGCCAGAGCCAGAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGAGGCTGAAAG ATAAGAAG IVH-4 (SEQ JD NO:71): GGCCCTGCACCTTCGGATCGTAAATGGTGTTGTCGTGCCGGGTCGATACGTGCACCCA 30 CTCCAGACCCTTACC iVH-5 (SEQ ID NO:72): CATCCGAAGGTGcAGG GCCGm 1TACTATGTTCGGACACCTCTAAGAACACCCGTAC CTT'CAGATGAACTCTCTGCG !VH~6 (SEQ ID NO:73): 35 CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGG(TGTCCTCGGCACGCAGAGAGTrTCAT CTGAAGG IVH-7 (SEQ ID NO:74): GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCT TGTCACCGTCTCTT CTGGT TAAC 40 Molecular model building enable synthesis of 9 versions of humanized antibodies in the forn of scv (umA-Humn sunnarized in Tables 2 and 3). Four of the humanized antibodies, HunmA-IumD, do not have parental mouse framework residues and five of them, HumE-iwum contain various number of parentalnouseresidues in the 45 framework. The sequence of HumB is compared against parental mouse lA6 and hann consensus framework in FIl 2 43 Table 2. Humanization Constructs Human / Mouse /K iMA ADSVK.DPKVQ W/M RIA DT R/T ___________(SEQ ID NO:75 and 76) HumA V V ADSVK D Hu V ADSV S D A HuC Y V ADSVK IG 0 T HumD Y V AOSVK I S 0 HumE T V DPKVQ I A 0 T HumF Y V ADSVK I A 0 T HumG K V ADSVK I A D T HumH K V DPKVQ I A D T Humi K M DKVQ M A T T Table 3. Amino Acid Sequences of Humanized Antibody Hum A: 5 VHt Domain (SEQ ID NO:1) Gin Val Gin Len Val. Giu Sc Gly Gly Gly Len Val Gin Pro Gly Gly Sr Leu Arg Leu Ser Cys Ala Ala Ser (Gly Phe Asn le Lys Asp Thr Tyr le His) Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Giu Trp Val Ala (Arg Te Asp Pro Ala Asn Asp A n Thi le Tyr Ala Asp Ser Val Lys Gly) Arg Phe Thr lie Sr Ser Asp Asp Se Lys Asn Thr Ala Tyr Len Gin 10 Met Asn Ser Lenu Arg Ala Gin Asp ThAla Val Tyr Tyr Cys Thr Asp (Ser Gly Tyr Trp Phe Ala Tyr) Trp Gly Gin Gly Th Leu Val Tin Val Ser Ser VL. Domain (SEQ ID NQ:3) Asp lie Gin Met Thr Gin 8cr Pro cr Ser Len Ser Ala See Val Gly As1p Avg Val Thr e Thr Cys (Arg Ala Ser Gin Ser The Ser Asn An Leu His) Tp Tyr Gin Giln Lys Pro 15 Gly Lys Ala Pro Lys Leu Leu Te Tyr (His Ala Sec Gin Ser lie Ser) Gly Val Pro Ser lag Phe Ser GIly Sec Gly 8cr Gly Thr Asp Pi Thr Leu Th Ilie 8cr Ser Len Gin Pro 44 Glu Asp Phe Ala Thi Tyr Tyr Cys (GIn Gln Ser Asna Scr Tip Pro Tyr Thr) Phe Gly Gln Gly Thr Lys Val Glu le Lys Arg HumE: VIH Domain (SEQ ID NO:4) 5 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gi Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser (Gly Phe Asn le Lys Asp Thr Tyr Ile His) Trp Val Avg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala (Arg le Asp Pro Ala Asn Asp Asn Thr Ile Tyr Ala Asp Ser Val Lys Gly) Ag Thr Ile Ser Ser Asp Asp Ser Lys Asn Tir Ala Tyr Leu GL Met Asn Ser Leu Arg Ala Glu Asp Thir Ala Val Tyr Tyr Cys Thr Ala (8&r Gly Tyr 10 Trp Phe Ala Tyr) Trp Gly Gin Gly Thr Leu Val Thr Val Ser Scr VL Domain (SEQ ID NO:5) Asp He Gn Met Thr Gin Ser Pro Ser Ser Leu Scr Ala Ser Val Gly Asp Avg Val Thr Ile Thr Cys (Arg Ala Ser Gin Ser l1e Ser Asn Asn Leu His) Tip Tyr GIn Gin Lys Pro 15 Gly Lys Ala Pro Lys Leu Leu le Tyr (His Ala Scr Gln Ser He Ser) ily Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Tir Asp Phe Thr Len Thy Ile Ser Ser Leu Gin Pro 20 Glu Asp Phe Ala Thr Tyr Tyr Cys (Gin Gin Ser Asin Ser Trp Pro Tyr Tir) Phe Gly Gin Gly Thr Lys Val Glu Ile Lys Ag Hum C: 25 V1 Domain (SEQ ID NO:6) Glu Val Gin Len Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Len Arg Leu Ser Cys Ala Ala Ser (Gly Phe Aia le Lys Asp Thr Tyr Ile His) Trp Val Arg Gn Ala Pro Gly Lys Gly Leu Glu Trp Val Ala (Avg Ile Asp Pro Ala Asn1 Asp Asn Thr le Tyr Ala Asp Ser Val Lys Gly) Arg Phe Thr le Ser Gly Asp Asp Ser Lys Asn Thr Ala Tyr Leu 30 Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tvr Tyr Cys Tir Thr (Ser Gly Tyr Tip Phe Ala Tya) Trp Gly Gln Gly Thr Len Val Thr Val Ser Ser VL Domain (SEQ 10 NO:7) Asp Ile Gin Met Tir Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly sp Arg Val Thr 35 le Thr Cys (AVg Ala Scr Gi Ser le Ser Asn Asn Leu His) Trp Tyr Clni Gln Lys Pro 45 Ciy Lys Ala Pr 1s Leu Leu JIc Tyr(lis Ala Sor Giina e SO City Vat Pro Ser Arg Ph y o ySet y Tin Asp Phe Thr Leu'lt Tre Set Ser Lou Gin Pro 5 Gu Asp Phe Ala Thr Tyr Tyr Cys (GhGin Ser Asn Set Trp Pro Tyr Thr) Phw Ciy GI GTy TIr Lys Va Gin Ho Lys Arg 10 HumD VH Domain (SEQ ID NO:8) Gin Val Gin Lan Val Glu Set Giy Cily Gly Lou Vat Gin Pro City tGly Ser Lou Ag Lou Sor CysY A Ala Ser (Cy Phe Asa Ile Lys Asp Ttr Tyr le His) Tip Vat Ag Gin Ala Pro Guy Lys Cty Leu Gin Trp Val Ala (Arg IHe Asp Pro Ala Asn Asp An Thr lie Tyr Ala 15 Asp Ser Vat Ly's Gly) Arg Phe Tir lie Set Sor Asp Asp Ser Lys Asa Ti Ala Tyr Lou Gin Met Asn Ser Lou Arg Ala Gin Asp Thr Ala Val Tyr Tyr Cys Tr Thi (Set Giy Tyr Trp Phe Ala Tyr) Trp Gly Gin Giy Tir Leu Val Thr Val Ser Sot VL Domain (SEQ ID NO:9) Asp lie Gln Met Tht Gin Ser Pro Ser Ser Leu Ser Ala Se Vat City Asp Ag Val Thn le Tht Cys (Ag Ala Ser Gin Ser Ile Ser Asn Asn Leu His) Tip Tyr GLn Gin Lys Pro GTy Lys Ala Pro Lys Len Lou le Tyr (is Ala Ser G In e Set--.) CiGy Vat Pro Sot 25 Arg Phe Ser Gly Set Cty Set Ciy Thr Asp Phe T'hr Lou 'Th Ile Ser Set Lou Gin Pro Clu Asp Phe Ala ITt Tyr Ty Cys (Gi Gin Set Asn Ser Trp Pro Tyr Thr) Phe Guy Gin tGly TIn Lys Val Glu He Lys Arg 30 Hum E: VI Domain (SEQ ID N0:10) Gin \al Gin Lou Val Glu Ser Gly Giy Ciy Lu Val Gin Pro Guy CIy Seru AL rg Leu Set CysiAl Ala Sec (Gly Phe Asa Hle Lys Asp Thr Tyrle is) Tip Vat Arg Gint Ala 35 Pro Gly Lys Cy Leu Giu Tp Val Ala (Arg Ie AspPro Ala Asn Asp Asn' le Tyr Asp Pro Lys Vat Gin Gy) lag Pie Thr Ilo Ser Ala Asp Asp Ser Lys Asn Thr Ala Tyr Lou Gin Met Asn Sor Lou Arg Ala hiAsp Thr Aia Val Tyr Tryr Cys Ti'h Thr (Ser Gly Tyr Tip PheAla Tyr) TrpCiy Gln Giy Thi Leu Vat Tin Va Se Set Domain(sEQ ID N0i I) 46 Asp le Gin Met Thr Gln Ser Pro Ser Ser Len Ser Ala SerVal Gy Asp Arg Val Thr lie Thr Cys (Arg Ala Ser Gin Ser le Sexr Asn AsnLen His) Tp Ty Gin Gin Lys Pro 5 Gly Lys Ala Pro Lys Len Leu i1e Tyr (His Ala Sex Gi Ser Le Ser) (MyVal Pro Ser Arg Phe Ser Gly Ser GIy Ser Gly Thr Asp Phe Thr Len Thr le Sex Ser Len Gin Pro 1 Gn Asp Phe Ala'in' Tyr Tyi Cys (Gin Gin Ser Asn Serm Pro Tyr Tyh) Phe Gly Gin. 10 Gy Thr Lys Val GI He Lys Arg Rum F: V11 Domain (SEQ I NO:12) 15 Gin Va GIn Len Val Giu SerI Gly Gly Gly Leu Val GJn Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser (Gly P1e Asn ie Lys Asp ThrTyr le His) Trp Val rg Gin Ala Pro Gly Lys Gly Len Gn Trp Val Ala (Arg le Asp Pro Ala Asn Asp Asn Th ie Tyr Ala Asp Ser Vai Lys Gly) Arg Phe Thr le Ser Ala Asp Asp Ser Lys Asn Thr Ala Tyr Leu Gin Met Asn Ser Leu Ag Ala Gi Asp Thy Ala Val Tyr Tyr Cys Thr Thr (Ser Gly Tyr 20 Tr Phec Ala 'yI) Tp Gly Gin Gly Thr Leu Val Thr Va Ser Ser Via Domain (SEQ I) NO:13) Asp Ie Gin Met Thr Gin 8er Pro r Ser Len Ser Ala Ser 3 Va Gly Asp Ag Va Thr He Thr Cys (Ag Ala Ser Gin Ser ie Sex Asn Asn Len is) Trp Tyr Gin Gln Lys Pro 2.5 Gly Lys Ala Pro Lys Len Len le Tyr (His Ala Se Gn Ser lIe Ser) Gly Val Pro Ser Arg Phe Sex Gly Ser Gly Ser Gly 'hr Asp P h Ti' Len Thr e Ser Ser Len Glin Pro 30 Gin Asp Phef Ala Thr Tyr Tyr Cys (Gin Gin Ser Asn Ser 'Tr Pro Tyr' Th) The Gly Gin Gy Thrt Lys V1 Gin Re Lys Arg 3 u5 in T0:4 3$ VII omain GSBQ ID NO:d4) GinuVa Gin LeA !a Glu Ser Gly Gly Gly Len Val Gin Pro Gly Gly Ser Len Ag Len Ser Cys A Ala Sex (Gly Phe Asa 6 le Lys Asp ThxTyr le His)Tp Va Arg G lda Pro Gly Lye Gly Leu Gin Trp VaI Ala (Mg Ie Asp Pro Ala Asn Asp Asn Thy le Tyr Ala Asp Ser Val Lys Gly) Arg Phe Thr e Sex Ala Asp Asp Sex Lys Asn Tri Ala Tyr Leu 47 Gin Met Asn Set Leu Ag Ala GIAsp Thr Ala Val Tr T Gys Thr Thr(Ser GlyTyr Tirp he Ala Tyri-rp ely Gin Gly T Le IVal Thr-Vl Ser Ser VL Domain (SEQ ID NOT5) Asp Ri Gin Met Th Gi Ser Pro SeSet Le SetAla Ser Val Gliy Asp Arg Val Thr 5 e Tin Cys (Arg Ala Ser Gin Ser ie Set Asn AsiLea His) Trp Tyr Gin GIn Lys Pro Gly Lys Ala Pro Lys Leu Leu lie Lys (His Ala Ser Gi Setle Ser) Gly Val Pro Ser Arg Phe Ser Gly Set Glv Ser (My Th Asp Phe ir Leu Thr le Ser Ser Len Gin Pro Gli Asp Phe Ala Tin Tyr TyT Cys Giln Gin Sev Aia Ser Tip Pro Tyr Thr) Phe (y Gin Gly Thr Lys Va Gin Re Lys Atg 15 Hum H: V11 Domain (SEQ ID40; 16) Gi Val Gin Leu Val G1u Ser Gly Gly Gly Leu Va Gin Pro Gly Gly Set Leu Arg Leu SeT Oys Ala Ala Set (Gly Phe Asan ie Lys Asp Thr I>e His) TrVal. Arg Gin Al Pro Gly Lys ly Len Gin Trp1u Al a (Ag ie Asp Pro AlaAsa Asp Asn Tin le Tyr 20 Asp Pro Lys Vat Gin Gly) rg Phe Tn Ie Set Ala Asp Asp Set Lys Asn Thr Ala Tyr Leu Gin Met Asna Set Len Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Tir Thr (Ser Gly T1 TTp Pl Ala Tyr) Trp Gly Gin Gly Thr Leu Val Thr Val Set Set VL Domain (SEQ I D :17) Asp le Gin Met Tri Gin Ser Pro Set Set Leu Set Aa Set Al Gly Asp Arg Val Thr 25 le Tin Cys (Avg Ala Set Gin Ser De Ser Asn Asm Len His)HTip TyGin Gin Lys Pro (By Lys Ala Pro Lys Leu Len le Lys is Ala Set Gin Ser h e Set) Gly Val Pro Set 30 Avg Phe Set Gly Ser Gly Ser Gy ThO Asp Phe Thr Leo Th le &3r S er Len Gin Po Giu Asp Phe Ala Thr Tyr Tyr Cys (Gn Gin Set Asn Ser Tp Pro Tlyr Tnr) Phe Gly Gin Gly Thr Lys la! Gn I1e Lys Arg 35 Hum I: VII Domain (SEQ IDNO:18) Gi VO Gin Len Val Gn Ser Gly Gly Gy Le mVl Gin Pro Gly Gly Ser Len Arg Leu Ser ys Ala Ala Ser (GyCU Phe Asn Ie Lys Asp Tin Tyr Re His )'rp Met Arg GnAla 43 Pro Gly Lys Gly Leu Glu Tip Val Ala (Arg lie Asp Pro Ala Asn Asp Asn Thr le Tyr Asp Pro Lys Val Gin Gly) Arg Phe Thr Me, Ser Ala Asp Thr Sr Lys Asn Thr Ala Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Thr Thr (Ser Gly Tyr Tip Phe Ala Tyr) Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 5 VL Domain (SEQ ID NO: 19) Asp lie GIn Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Avg Val Thr le Thr Cys (Arg Ala Ser Gln Ser Ee Ser Asn Asn Leu His) Tip Tyr Gin Gln Lys Pro 10 Gly Lys Ala Pro Lys Leu Leu le Lys (His Ala Ser Gln Ser Ile Ser) Gy Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thy Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 15 Glu Asp Phe Ala Thr Tyr Tyr Cys (Gin Gin Ser Asn Ser Tp Pro Tyr Thr) Phe Gly Gln Gly Thr Lys Val Gin Ile Lys Arg The CDR residues are included within brackets. 20 Example 3 This example describes expression and purification of humanized lA6 single chain antibody proteins. For production of the humanized tA6 scFv, TOP 10 cells transformed with desired expression construct were grown in shaker flasks in TB medium (Bio 101) until they 25 reached an OD 600 of 0.8. Protein expression was induced with 0.02% arabinose for eighteen hours at room temperature. Cels were peleted by centrifigation at 4,000 g for 15 minutes. Cell pellets were resuspended in 1

/

5 0 h volume of lysis buffer (20 mM sodium phosphate, 1% Triton X-100, 500 mM NaCi, 40 mM inidazole, 2 mM 2 mercaptoethanol), 0.2 mM PMSF, 1mg/ml lysozyrme and incubated on ice for 30 minutes, 30 The cell suspension was sonicated and another aliquot of PMSF was added. The cell debris was pelleted by centrifugation at 12,000 x g and the clarified sonicate was filtered and fractionated by metal affinity chromatography. Induced histidine-tagged proteins were bound to a Hi Traps" metal cheating colnum (Amersham/Pharnacia) equilibrated with N * according to the manufacturer's instructions, The column was then washed 35 with four column volumes of buffer consisting of 100 mM imidazole, 20 mM sodium phosphate, pH 7.4, 500 mM NaCL Fractions of proteins eluted from the column in 500 49 mM Inidazole, 20 rmM soditun phosphate, pH 7.4 were collected, pooled and dialyzed at 4* C against phosphate buffered saline (PBS)/2rmM EDTA, then dialyzed against PBS. Example 4 This example describes studies measuring binding affinity of humanized single 5 chain antibody proteins for ICAM-1. To evaluate the binding affinity of histidine-tagged human single chain (hse) proteins soluble ICAM was used in an ELISA assay. A 96-well EIA plate (Coming, Inc.) was coated with 100 p1/well soluble ICAM-1 (B ender MedSystems) at I ptgInl in 0.1 M NaICO 3 After washing with TBST (50 mM Tris, pH8.0, 150 mM NaCl, 0.05% Tween 10 20), the plate was blociod with 3% non-fat milk in TBST at 37 'C for I hour. After washing with TBST, the plate was incubated with scFv samples (100 vd /well) diluted in 1% non-fat milk / TBST solution at room temperature for 1 hour. After washing with TBST, the horse radish peroxidase-conjugated anti-His (C-term) antibody (Invitrogen) diluted 1:2000 in 1% non-fat milk/TBST was added and the plate was incubated at room 15 temperature for 1 hour. The plate was washed thoroughly with TBST and 100 1/liwe 1 l 3,3',65,5'-tetramethybenzidine substrate solution (Kirkegaard and Perry Laboratories) was added. After 5 nin incubation, the color development was stopped by adding 100 ml/well 0. 12 N HCI and the absorbance of the wells at 450 nm was measure by a plate reader (ICN). 20 Binding studies revealed that all of the humanized scFv proteins (hsc) demonstrate greater than ten times higher binding affinity for ICAM-1 than the parental mouse scFv (Table 4). Table 4. Mouse 1A6 scFv and Humanized 1A6 scFv 25 SCFv ID (M) EC 50 (pM)* MaclA6 L18 x10- 6 > 10 HumA 1.50 x 104 2.8 HumB 2.62 X 104 0.19 HumC 5.30 x 10 0.22 50 HmnD 2.33 X I0 0.05 HumE 4.60 x 1c' 0.29 HumH 2.09 x 10 4.2 HumI 1,50 x 107 >10 * 50% protection of HeLa cells against HRV15 infection at I MOL Ample 5 Tis example describes data demonstrating that humanized I A6 antibodies 10 protect against HRV infection. Ihis example also describes data that demonstrate that protection was significantly greater than nouse1A6 antibody. HeLa cells were plated at 1xio cells per well of a 48-well tissue culture dish and cultured for 24 hours. Culture medium was aspirated and 100jl of humanized 1A6 proteins was added to each well at the dilution indicated. The plates were incubated for 15 one hour in a 37tC incubator, the protein solution removed, 200pl. HRVi 5 (at MOI of 1) was added and the plates incubated for one hour at 334C. The cells were then washed and 1 mi/well growth medium added. The infected cells were incubated at 33*C for 48 hours, The medium was then aspirated and the remaining viable cells stained with crystal violet. Finally, the crystal violet was extracted with 2 ml methanol per well, and the 20 extracted stain determined by measuring the A 570 . The percentage protection was calculated for each point in triplicate using the formula: (100)(Absorbance of sample- Absorbance of virus only) % protection = ------------------------------------------------ 2(Absorbance of uninfected cells- Absorbance of virus only) 25 The protective efficacy was quantified as EC 5 o, which is the dose of an antibody protein which can protect 50% of hela cells from I-IRV infection. EC 5 of several humanized lA6 proteins are summarized in Table 4, and the data from this protection assay is shown in FIG. 4. This assay revealed that the EC50 of Hum19 scFv protein was 30 more than sixty times higher than that of the parental mouse lA6 scFv protein (FIG. 4). In vitro protection results correlate well with the antibody binding affinity. 51 Exajle This example describes additional strategies for humanizing lAG Two additional versions of humanized A6 were pmduced by grafting the CDR loops of the V domain onto two different human consensusframework sequences, 5 Hum40 and Hn0, Hum4 is a humanized lA6 resulting from CDR. grafting onto the human consensus V" subgroup iiu ( mU2) and Hum5) is a humanized 1A6 resulting from DR grafting onto the human consensus V1subgroup I (Hu1n) (Padlan (1991)Mo. f noL 28:489-498; FIG 5 10 The human'V subgroup iI (Hum2) shares 50 identical amino acid residues among 82 framework residues withthe marine JA6 VH sequence, which amounts to 61% identity (FIG. 5 and 6). Among the 32 amino acid residues that differ between the munune 1A6 and HumI, six of then belong to the "Vernier" zone (Foote and Vinter, (1992, J. MoL BL 224:487-499), and may affect the antigen-binding affinity. The 15 critical "Vernier" zone residues are Vu 67, 69, 71, 78, 93 and 94, Analysis of the arnino acids at V 1 67, 69 78 and 93 positions reveals that the human consensus residues and the mrine residues have very similar properies, Thus, human consensus residues are used to replace urine residues at these positions. Structural analysis reveals that residues at V 71 and 94 should have small side chains, 20 which rules out the human consensus residues, lysine and arginine at these two positions, Serine and alanine, both having small side chains, were therefore selected for Va71 and V494 respectively. As a result, the'V domain of Hum40 contains all human consensus residues at framework positions except for V 1 71 and Vu94. Residues that are unrelated to either marine or human residues were chosen at Va71 and VK94 because of their 25 structural features (FIG 6) Hum 50: Thre hranV subgroup I (~humnl) shares 62 identical armino acid residues among 82 framework residues wi th e marine 1A6 YA sequence, which amounts to 76% identity (FIG.G5 and 7). Among tho 20 amino acid residues that differ between the 52 murine IA6 and Huml, four of them belong to the "Vernier" zone (Foote and Vinter, (1992), J Mol. Bio 224:487-499), and may affect the antigen-.binding affinity The critical "Vernier" zone residues are Vj 48, 67, 93 and 94. Analysis of the amino acids at Vn 48, 67 and 93 positions reveals that the human consensus residues and the urine 5 residues have very similar properties. Thus, human consensus residues are used to replace muine residues at these positions, Strctunral analysis reveals that the residue at VH 94 should have a small side chain, which rules out the human consensus residue arginine. Alanine was therefore selected for V94. As a result, Hum50 contains all human consensus residues at framework positions except for VH94 (FIG. 7). 10 LxaMple7 This example describes the preparation of humanized lA6 Fab protein. Three expression constructs were made: Fab19, Fab40 and Fab50. Fab19 is composed of variable domains (VH and VL) derived from humanized 1A6, Hum (see Table 3), which is based on human consensus sequence of heavy chain VH subgroup I 15 and human light chain x subgroup L Fab40 and Fab5O contain Hum40 and Hum50 VH domains respectively and the same light chains as Fab 19. The amino acid sequence of the heavy chain variable domain of Fab 19, Fab40 and Fab50 are listed in Table 5, and the corresponding gene sequences are listed in Table 6 Gene segments of the light chain variable domain (VL) and the light chain 20 constant region (CL) that was derived from human , light chain constant region (Palm and Hilschmarn, 1975, Z. Physiol. Chem. 356:167-191) were synthesized separately by PCR amplification. After sequencing conformation, th e two gene segments were fused together to form the light chain VLCL gene. A similar appro ach was used to clone the gene segment containing the heavy chain variable domain (Vs) and the heavy chain 25 constant region (CH) that is based on the sequence of the C1 domain of human IgG1 (Ellison et al, 1982, Nuc. Acids Res. 10:4071). An expression vector was designed for production of Fab proteins. The VH- and V[ domains are precisely fused on their 5' ends to a gene segment encoding the enterotoxin 11 signal sequence. The intervening sequence in the dicistronic gene contains 30 a .ibosome entry site, while the 3' end of the gene contains the bacteriophage k t) 53 transcriptional terminator The isopropyl-1-thio-p-D-galactopvran.oside (IPTG)-inducible ptac promoter was used to drive expression of this dicistronic message. For production of the humanized TA6 Fab proteins, JM83 cells transformed with desired expression construct were grown in shaker flasks 4n TB medium (Bio 101) until 5 they reached an OD 6 00 of 1.2. Protein expression was induced with 0.2 mM IPTG for eighteen hours at room temperature. Cells were pelleted by centrifugation at 4,000 g for 15 minutes. Cell pellets were resuspended in lysis buffer (50 mM Tris, pH 8.0 , 1. M NaCl, 5 mM EDTA, 0.2 muM PMSF, 1mg/ml lysozyme) to 10-15% solution and incubated on ice for 20 minutes. The cell suspension was sonicated and another aliquot 10 of PMSF was added, The cell debris was removed by centrifugation at 12,000 x g and the clarified sonicate filtered and fractionated by affinity chromatography, using Protein A agarose for Fabl9 and Protein G agarose for FabO and Fab50. After washing the protein A or protein G colunis with 50 mM Tris, pH 8.0 , 2.0 M NaCl, 5 mM BDTA, the bound protein was eluted from the columns with 0.1 N Glycine, pH 2.5, and collected in the 15 tubes containing 1/10 volume 0.1 M Tris, pH 9.0. The protein fractions were pooled and then dialyzed against TBS. Table 5, Amino Acid Sequences of Fabl9, Fab40 and Fab50

V

1 . Domain of Fab19. Fab40 and Fab50 (SE ID NO:5): 20 Asp Ie Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys (Arg Ala Scr Gln Ser Ile Ser Asn An Leu His) Trp Tyr GIn Gin Lys Pro Gily Lys Ala Pro Lys Leu Leu le Tyr (His Ala Ser Gin Ser lie Ser) Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Tar le Ser Ser LEu Gin Pro Glu Asp Phe Ala Thr Tyr Tyr Cys (Gln Gn Ser Asn Ser Trp Pro Tyr Thr) Phe G1y Gln 25 Gly Thr Lys Val Glu le Lys Arg VtDomain of Fa bL9SEQ IDNO:4): Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gn Pro Gly Oily Ser Leu Ag LEu Ser Cys Ala Ala Ser (Gly Phe Asn lie Lys Asp Thr Tyr Ee His) Trp Val Arg Gin Ala 30 Pro Gly Lys Gly Leu Glu Tip Val Ala (Arg le Asp Pro Ala Asn Asp Asn Thr le Tyr Ala 54 Asp Ser Val Lys Gly) Arg Phe Tar Ile Ser Ser Asp Asp Ser Lys Asn Thr Ala Tyr LeU Gin Met Asn Ser Leu Arg Ala GIu Asp Tir Ala Val Tyr Tyr Cys Thr Ala (Ser Gly Tyr Trp Phe Ala Tyr) Trp Gly Gin Gly Tbr Leu Val Thr Val Ser Ser 5 M' Domain of Fab40 (SEQ IDO:20); Gin Val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Tir Leu ar Cys Thr Val Ser (Gly Phe Asn le Lys Asp Thr Tyr Ile His) Tip Ile Arg Gin Pro Pro Gly Lys Gly Leu Gin Tip Ile Gly (Arg Ile Asp Pro Ala Asn Asp Asn Thr Ile Tyr Asp Pro Lys Val Gln Gly) Arg Val Thr le Thr Ser Asp Tr Ser Lys Asn Gln Val S er Leu Asn Leu 10 Asn Ser Val Thr Ala Ala Asp Thir Ala Val Tyr Tyr Cys Ala Ala (Ser Gly Tyr Tip Phe Ala Tyr) Trp Gly Gln Gly Tir Lea Val Thr Val Ser Ser VHI Domain of Fab50 (SEQ ID) NO:21); Gin Val Gin Leu Val Gin Ser Gly Ala Giu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser 15 Cys Lys Ala Ser (Gly Phe Asn Ile Lys Asp Thr Tyr le iHis) Trp Val Ag Gin Ala Pro Gly Gin Gly Leu Glu Trp Val Gly (Arg Ile Asp Pro Ala Asn Asp Asm Thr lIe Tyr Asp Pro Lys Val Gln Gly) Arg Val Thr Met Thr Ala Asp Tr Ser Tir Asn Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Giu Asp Thr Ala Val Tyr Tyr Cys Ala Ala (Ser Gly Tyr Trp Phe Ala Tyr) Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ser 20 The CDR residues are included within brackets. Table 6. The Variable Domain Gene Sequences of FabI9, Fab40 and Fab50 25 YLggQ 9of Fab 19. Fab'40 and Fab50 (5EQID NQ:22): GXTATCCAGATGACCCAATCTCCGTCTAGCCTGACGCGCCAGTGT GTGAICG AGTTACCATTACTGCCGCGCCAGCCAATCTATCGTAAITAATCTTCACTGGT 30 ATCAACAAAAACCGGGIAAAGCTCCGAlAACTTCTTATCTATCACGCCTCTCA GAGCATTAGCGGCGTTCCGAGCCGCTTCTCTGGCTCTGGCTCGGGCACGGAC TTTACCCTTACCATCAGCTCTCTTCAGCCGGAAGACTTGCCkCCTATrATTGT CAGCAGTCTAATAGCTGGCCGTATACCTTCGGTCA-AGGTACCAAGGTCGAGA TTAAGCGG 55 GAAGTTCAACTTG TTGAGTCTGx~y GGGGT(JGGTTCAGCCCQQc-GGGCTCTCT GCGCCTGTTCTGCGCA'GCAGCGGTCJACATTAAGQACAkCCTAeCATCCAT 5 CIGGTCXAGGCAACTCCGG-'GTAAGGGTCTGGAGTGCGGTQGCACGTATCGACCC CCGAGGACACCGCCGTCT-AUPALCTGCAC(IGCCTCTGG'rACTGCYflTGCCT'AC TGGGGCCAOGGCACGCI-ITCACCGTGTCGAGC 10 CAGGTTC,K CTTCAGGAGTYICTGTCCGGGT'ICTGGUTTAACGCTCTGAG&CACJ-,frT 15 GATTAGiCAACCGCCGGGTAAGGGTCTGOj'AGTGCGATTGGCCGTATCG3ACCC ACCTCTGACACGTCTAAGAACCAGGTGTCTCCe'TCTCAATAkGCQTTACAGC 0-GTGACACGCCGTCTACTAGkTGCGCCGCATCTGGCTrIACTGIGriTT GCCVMCT GGGGCCAGGGCACGCTTGTCA.-CCGTCT-.CGAGC 20 Vugne of Fab5O (SEQ ID NTO:25) CACjTTCAACTT0-TCC-AGTCTCGTGCAGjAGGTGAA0C-A-ACCCGGCCATCTrG TOAAkGgG'TTCTCAAAoCI -kcCGoo'cpAAT-T-,A ACAc, ,Tx-CATCC.k 25 T'TGOQTTlAGGCCAAGCGC, (ICGGGTCAQQ(TCTGOA0TGQ0TQQ0CCGTYrCGAC CCGGiCA--,AGG-ACAACACCA iTTrACGAt CCCGTAAGTGCA AGTCGr3TFH7ACCA TCACCG(CGAkCACCTCJ-A(I4AAC ACCGCGTACATIGQ-A(CCTGTCIXTCJOTG CO T TCTG-AO3GACAkCCGCCOjTCTAkCTAtCTOCOGCCCCATCTC

GCTACTOGTTTGC'CTA

CTQGOGCCACGCACGCTTGTCACCOTC.TCGAGC 30' Example 8 T Ihis example describes measuring binding affinites of humanized lAG Fab proteins against their antigen, CllO-i. 546 Binding affinities of Feb proteins were evaluated using an ELISA assay. A 96 well EIA plate (Corning, Inc.) was coated with 100 p1/well soluble ICAM-I (Bender MedSystems) at I gml in 0.1 M NaHCOs 3 After washing with TBST (50 mM Tris, pH8.0, 150 mM NaCl, 0.05% Tween-20), the plate was blocked with 3% non-fat milk in 5 TBST at room temperature for 1 hour, After washing with TBST, the plate was incubated with the horseradish peroxidase-conjugated anti-human IgG Fab specific antibody (Sigma, A-0923) diluted 1:3,000 in 1% non-fat milk/TBST at room temperature for 1 hour, The plate was washed thoroughly with TBST and 100 pl/well 3,3',5,5' tetramethylbenzidine substrate solution (Kirkegaard and Perry Laboratories) was added. 10 After 10 min incubation, the color development was stopped by adding 100 mI/well 0,12 N HCL, The absorbance at 450 nm was measured by a plate reader (ICN), and then plotted against antibody concentration. The affinity constant (K), also called equilibrium dissociation constant, is equal to the concentration of a Fab protein. that gives rise to ICAM-1 binding at 50% of the saturation level. 15 Binding studies revealed that Fab19 has much higher binding affinity for ICAM I than its scFv form (HInuR, see Table 4). The binding affinities of three humanized Fab proteins are in the following order: Fabi9 > Fab40 > Fab50. Table 7. Binding affinity of Humanized 1A6 Fab 20 Sample K( (M) Fab19 9.3 x 10 9 Fab 40 5.1 X 10 4 Fab 50 1.3 x 10 25 57

Claims (54)

1. A humanized antibody that binds ICAM-1, said antibody having a VH and Vr domain selected from: SEQ ID NO: 1 and 3 (HmnA); SEQ ID NO:4 and 5 (lumB); SEQ ID NO:6 and 7 (HumC); SEQ ID NO:8 and 9 (HunD); SEQ ID NO:10 and I1 (fumE); SEQ ID NO:12 and 13 (Hm nF); SEQ ID NO:14 and 15 (HunnG); SEQ ID NO: 1 6 and 17 (HumH); and SEQ ID NO: 18 and 19 (-umn); and SEQ ID NO:5 and 20 (fHum40); and SEQ ID NO:5 and 21 (Hu5O).

2. A subsequence of the antibody of claim 1, said antibody subsequence capable of binding an ICAM-1 epitope.

3. The humanized antibody of claim 2, wherein the antibody subsequence comprises a single chain, Fab, Fab' or (Fab)2 fragment.

4. The humanized antibody of claim 1, said antibody having one or more amino acid substitutions, provided that said antibody is capable of binding an ICAM-I epitope,

5. A humanized antibody that binds ICAM-1 and inhibits pathogen infection of cells expressing ICAM-1.

6. The humanized antibody of claim 5, said antibody having a protective efficacy at least 2 times greater than the non-humanized antibody.

7. The humanized antibody of claim 5, said antibody having a protective efficacy at least 5 tines greater than the non-humanized antibody.

8. The humanized antibody of claim 5, said antibody having a protective efficacy at least 10 times greater than the non-humanized antibody.

9. The humnnized antibody of claim 5, said antibody having a protective efficacy at least 20 times greater than the non-humanized antibody.

10. The humanized antibody of claim, said antibody having a protective efficacy at least 30 times greater than the non-humanized antibody.

11. The humanized antibody of claim 5, wherein the pathogen is human rhinovirus (HRV).

12. The humanized antibody of claim 5, wherein the pathogen is coxackie A virus, respiratory syncytial virus, or malaria. 58

13. The humanized antibody of claim 5, wherein the antibody is an intact immunoglobulin molecule comprising 2 full-length heavy chains and 2 full-length light chains.

14. The humanized antibody of claim 5, wherein the antibody is an antibody subsequence that binds to ICAM- 1.

15. The humanized antibody of claim 14, wherein the antibody subsequence comprises a single 6hain, Fab, Fab' or (Fab) 2 fragment.

16. The humanized antibody of claim 5, wherein the antibody is multispecific or multifunctional.

17. The humanized antibody of claim. 5, wherein the antibody is linked to one or more identical or different antibodies to form a rniultimer. IS. The humanized antibody of claim 17, wherein the multirner comprises a homo- or hetero-dimer, turner, or tetraner or pentamer,

19. The humanized antibody of claim 17, wherein the multimer is formed via a inul timerization domain.

20. The humanized antibody of claim 19, wherein the multimerization domain comprises a human amino acid sequence,

21. The humanized antibody of claim 19, further comprising a linker located between the multimerization domain and the antibody.

22. A humanized antibody that inhibits human rhinovirus (HRV) infection of cells comprising a V. and VL domain selected from: SEQ ID NO: 1 and 3 (HumA); SEQ ID NO:4 and 5 (H-lumB); SEQ 11) NO:6 and 7 (HamCi); SEQ ID NO:8 and 9 (HrurD); SEQ ID NO:10 and 11 (HunE); SEQ 1D NO:12 and 13 (HunlF); SEQ ID NO:14 and 15 (H1umG); SEQ ID NO:16 and 17 (Huml); and SEQ ID NO: 18 and 19 (1 umI); and SEQ ID N0:5 and 20 (Hum40); and SEQ ID NO:5 and 21 (Hum50); or a subsequence thereof.

23. The humanized antibody of claim 22, wherein the antibody is an immiunoglobulin molecule comprising 2 full-length heavy chain polypeptides and 2 ful-length light chain polypeptides.

24. The humanized antibody of claim 22, wherein the subsequence comprises a single chain, Fab, Fab' or (Fab)2 fragment. 59

25. The humanized antibody of claim 22, wherein the antibody is linked with other identical or different antibodies to form a multimer.

26. The humanized antibody of claim 25, wherein the multimer comprises a homo- or hetero-dimer, timer, or tetramer.

27. The humanized antibody of claim 25, wherein the different antibodies are human, humanized or non-human.

28. A nucleic acid sequence encoding a hunmanized antibody of claim I or 22 or a subsequence thereof

29. An expression cassette comprising t he nucleic acid sequence of claim 28 operably linked to an expression control element.

30. A vector comprising the nucleic acid sequence of claim 29. 3 L The vector of claim 29, wherein the nucleic acid sequence is operably linked to an expression control element. 32, A cell comprising the nucleic acid sequence of claim 28.

33. The cell of claim 31, wherein the cell is prokaryotic or eukaryotic.

34. A pharmaceutical composition comprising a humanized antibody of claim I or 5, and a pharmaceutically acceptable carrier.

35. The phannaceutical composition of claim 34, wherein the carrier is compatible with inhalation or nasal delivery to a subject.

36. A method of inhibiting pathogen infection of a cell comprising contacting a pathogen or a cell with an amount of a humanized antibody of claim I sufficient to inhibit pathogen infection of the cell.

37. The method of claim 36, wherein the cell is present in a subject.

38. The method of claim 37, wherein the cell is an epithelial cell,

39. The method of claim 37, wherein the cell expresses ICAM-I1

40. A method of inhibiting DRV infection of a cell comprising contacting HRV or a cell susceptible to HRV infection with an amount of a humanized antibody of claim 21 effective to inhibit HRV infection of the cell.

41. The method of claim 40, wherein the cell is presen t in a subject. 42, The method of claim 41, wherein the subject has or is at risk of having asthmna. 60

43. The method of claim 40, wherein the antibody binds to an antigen present on the surface of the cell,

44. The method of claim 40, wherein the cell expresses ICAM-l.

45. The method of claim 40, wherein the cell is an epithelial cell.

46. The method of claim 40, wherein the humanized antibody is administered locally.

47. The method of claim 40, wherein tbe humanized antibody is administered via inhalation or intranasaly. 4& A method of ;nhibiting HRV infection, inhibiting HRV progression or treating -IRV infection of a subject comprising administering to a subj ect having or at risk of having HRV infection an amount of a humanized antibody of claim 22 effective to inhibit, inhibit progression or treat HRV infection of the subject.

49. The method of claim 8, wherein the humanized antibody is administered locally.

50. The method of claim 48, wherein the humanized antibody is administered via inhalation or intranasaly.

51. The method of claim 48, wherein the subject has or is at risk of having asthma.

52. The method of claim 48, wherein the subject is a newborn or between tie ages of I to 5, 5 to 10 or 10 to 18.

53. A method of decreasing or inhibiting one or more symptoms of the common cold in a subject comprising administering to a subject having a common cold an amount of a humanized antibody of claim 22 effective to decrease or inhibit one or more symptoms of the common cold in the subject.

54. The method of claim 53, wherein the humanized antibody is administered locally.

55. The method of claim 53, wherein the humanized antibody is administered via inhalation or intranasaly.

56. The method of claim 53, wherein the subject has or is at risk of having asthma,

57. The method of claim 53, wherein the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18,

58. A method for producing humanized antibody comprising: a) selecting a human franework sequence as an acceptor, wherein said sequence has 50% or more identity to a non-human donor antibody framework region; 61 b) grafting a CDR from the donor non-human antibody onto the human framework; c) comparing the vernier zone residues of the human acceptor and the non-human donor framework regions; and d) maintaining one or more of the human acceptor residues in the vernier zone when the donor non-human and acceptor human residues are structurally or chemically similar, or substituting one or more of the vernier zone residues with a residue that is different from both the donor non-human vernier zone residue and acceptor human vernier zone residue if the donor non-human vernier zone residue is structurally or chemically dissimilar to the human residue, wherein the different residue is structurally or chemically similar to the donor non-human vernier zone residue,

59. The method of claim 58, wherein the hnunan framework acceptor sequences is selcted from a Vn domain subgroup I or subgroup II consensus sequence. 62