WO2007044756A2 - Monoclonal antibodies recognizing human ccr8 - Google Patents

Abstract

The present invention generally relates to monoclonal antibodies that recognize human CCR8. More particularly, the invention relates to human CCR8 monoclonal antibodies, hybridomas producing such antibodies, and methods of using such antibodies in diagnostic and therapeutic applications.

Description

MONOCLONAL ANTIBODIES RECOGNIZING HUMAN CCR8

Field of the Invention

[0001] The present invention generally relates to monoclonal antibodies that recognize the human chemokine receptor CCR8. The present invention also relates to methods of diagnosis and treatment of patients with a disease associated with CCR8 expression or interaction with its cognate ligand, CCLl . Further, the present invention generally relates to the use of anti-CCR8 monoclonal antibodies to identify or isolate cells that express CCR8.

Background

[0002] CCR8 is selectively expressed on T helper type 2 (Th2) cells but not on T helper type 1 (ThI) cells (Zingoni et al., J. Immunol. 161:547-51 (1998)). Th2 cells play an important role in the allergic inflammatory response which occurs at sites of allergen exposure. A ligand for CCR8 is the CC chemokine CCLl, which is a chemoattractant for Th2 cells. The CCR8/CCL1 receptor/ligand pair may therefore play a role in development of allergic inflammation conditions such as asthma, atopic dermatitis and allergic rhinitis. This role includes recruitment of Th2 cells to sites of allergic inflammation, the production of Th2 cytokines at those sites, and the subsequent mobilization of eosinophils and basophils.

[0003] Additional evidence for a role of CCR8 in asthma comes from studies that examined expression of CCR8 on human airway T cells from allergen-challenged asthmatics. They found CCR8 expressed on a subset (-30%) of Th2 cells and the number of CCR8+ cells in each patient correlated with the severity of the asthmatic response to allergen challenge. This suggests that the CCR8+ sub-population of Th2 cells may be critical to asthma pathology (Panina-Bordignon et al., J. Clin. Invest. 107:1357-64 (2001)).

[0004] Further evidence for the role of CCR8 in allergic inflammation came from studies with CCR8 knockout mice. These mice showed impaired Th2 immune responses in models of allergic inflammation. For example, in both ovalbumin- and cockroach antigeninduced allergic pulmonary inflammation, the levels of Th2 cytokines (IL-4, IL-5 and IL- 13) and the number of recruited eosinophils were significantly reduced in lungs of the CCR8 knockout mice (Chensue et al., J. Exp. Med. 193:573-84 (2001)). [0005] The lack of understanding of how the immune system is regulated or differentiates has contributed to the difficulty of treating medical conditions characterized by abnormal or inappropriate regulation of the development or physiology of relevant cells, such as asthma. The discovery and characterization of specific regulatory pathways and their physiological effects will contribute to the development of therapies for a broad range of conditions which affect the immune system. The present invention provides solutions to materials and methods useful in such therapy.

[0006] Chemokine receptors have traditionally been very difficult antigens to develop antibodies against. They have low profiles on the cell surface and are not very accessible to antibody binding. Also, antibodies generated against peptides corresponding to extracellular domains of chemokine receptors often fail to recognize the intact receptor on the cell, probably because of differences in secondary structure. Due to these difficulties, researchers in this field have had a low success rate in developing antibodies to chemokine receptors. (See, e.g., Wu et al., J. Exp. Med. 185:1681-91 (1997).

Summary of the Invention

[0007] In one aspect, the invention provides CCR8-specific monoclonal antibodies such as monoclonal antibodies 414B, 414C, 414E, 433H, 459M, 464A, 464B, 433B and 455AL that bind human CCR8 protein. Hybridomas that produce antibodies 414B, 414C, 414E, 433H, 459M₅ 464A, 464B, 433B or 455AL are provided. The hybridomas are referred to by the same designation as the antibodies produced therefrom (e.g., hybridoma 414B produces antibody 414B). The hybridomas producing antibodies 414B, 414E, 433H, and 464A have been deposited with American Type Culture Collection, 10801 University Blvd., Manassas, VA, 20110-2209, and have been assigned ATCC Accession No. PTA-6941, PTA-6940, PTA-6938, and PTA-6939, respectively.

[0008] hi another embodiment, a chimerized or humanized antibody comprising a CCR8-binding region of an anti-CCR8 antibody is provided. Also provided are polypeptides comprising a CCR8-binding region of an anti-CCR8 antibody is provided, wherein the polypeptide binds to CCR8. hi a related embodiment, the CCR8-binding polypeptide comprises an F(ab')₂ fragment of the antibody, hi yet another related embodiment, the CCR8-binding polypeptide comprises a Fab fragment of the antibody, hi still another related embodiment, the CCR8-binding polypeptide comprises one or more complementarity- determining regions (CDRs) of the antibody.

[0009] In another embodiment of the invention, an isolated polynucleotide comprising a nucleotide sequence encoding an anti-CCR8 antibody or polypeptide is provided. In a related embodiment, a vector comprising the aforementioned polynucleotide is provided. In another related embodiment, a host cell transformed or transfected with the aforementioned vector is provided. In still another related embodiment, the host cell secretes an antibody or polypeptide encoded by the polynucleotide, wherein the antibody or polypeptide specifically binds to human CCR8.

[0010] In yet another embodiment of the invention, an anti-CCR8 antibody or polypeptide is provided, further comprising a detectable label.

[0011] The present invention also generally relates to the use of anti-CCR8 monoclonal antibodies to identify cells that express CCR8. In one embodiment of the invention, a method of identifying cells that express CCR8 is provided comprising the steps of: a) contacting cells with an aforementioned antibody or polypeptide; and b) identifying cells that express CCR8 by detecting the antibody or polypeptide binding to cells. In a related embodiment, the aforementioned method further comprises washing the cells between the contacting and the identifying, to remove unbound antibody or polypeptide. In yet another related embodiment, the antibody or polypeptide comprises a label. In another related embodiment, an in vivo method is provided, wherein the contacting comprises administering the antibody or polypeptide to a human subject.

[0012] In still another embodiment of the invention, a composition comprising an anti-CCR8 antibody or polypeptide and further comprising a pharmaceutically acceptable carrier, diluent, or excipient is provided.

[0013] The present invention also relates to methods of diagnosis and treatment of patients with a disease associated with CCR8 expression and interaction with its cognate ligand, CCLl. In one embodiment of the invention, a method of ameliorating symptoms of allergic inflammatory conditions in a human subject comprising administering an effective amount of the aforementioned composition to a human subject having an allergic inflammatory condition is provided. In a related embodiment, the allergic inflammatory condition is selected from the group consisting of asthma, atopic dermatitis, and allergic rhinitis. Li still another related embodiment, the allergic inflammatory condition is characterized by accumulation of Th2 cells at a site of allergen exposure.

[0014] In yet another embodiment of the invention, a method of ameliorating symptoms of human immunodeficiency virus (HIV) infection in a patient comprising administering an effective amount of the aforementioned composition to a human subject infected with HIV is provided. In yet another embodiment, a method of inhibiting HIV infection of human cells that express CCR8 is provided, comprising administering to a human subject the aforementioned composition in an amount effective to inhibit HIV infection of CCR8-expressing cells in said subject.

[0015] In another embodiment, a method of inhibiting CCLl -induced chemotaxis by contacting a cell with an anti-CCR8 antibody or polypeptide is provided. In another embodiment, a method of inhibiting CCLl -induced activation by contacting a cell with an aforementioned antibody or polypeptide is provided.

[0016] In still another embodiment of the invention, a method of diagnosing a condition characterized by accumulation of Th2 cells at a site of allergen exposure is provided comprising the steps of: a) contacting cells from a human subject with an anti- CCR8 antibody or polypeptide; and b) diagnosing the condition by measuring the antibody or polypeptide bound to cells from the human subject.

Description of the Drawings

[0017] Figure 1 shows that CCR8 monoclonal antibodies blocked chemotaxis of CCR8 transfectants toward CCLl

[0018] Figure 2 shows the results of immunohistochemistry experiments with frozen thymus and fixed/paraffin thymus samples.

Detailed Description of the Invention A. ANTIBODIES

[0019] The present invention provides monoclonal antibodies that recognize the human chemokine receptor CCR8, i.e., "anti-CCR8" monoclonal antibodies. An "antibody" as used herein is defined broadly as a protein that characteristically immunoreacts with an epitope (antigenic determinant) of an antigen. As is known in the art, the basic structural unit of an antibody is composed of two identical heavy chains and two identical light chains, in which each heavy and light chain consists of amino terminal variable regions and carboxy terminal constant regions. The anti-CCR8 antibodies of the invention include polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, CDR-grafted antibodies, humanized antibodies, human antibodies, catalytic antibodies, multispecific antibodies, , as well as fragments, regions or derivatives thereof provided by known techniques, including, for example, enzymatic cleavage, peptide synthesis or recombinant techniques.

[0020] Monoclonal antibodies (rnAb) are the preferred binding agents of the invention. "Monoclonal antibody" means an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different determinants, each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milstein, Nature 256:495-97 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567). The monoclonal antibodies may also be isolated from phage display libraries using the techniques described, for example, in Clackson et al., Nature 352:624-28 (1991) and Marks et al., J. MoI. Biol. 222(3):581-97 (1991).

[0021] The term "hybridoma" or "hybridoma cell line" refers to a cell line derived by cell fusion, or somatic cell hybridization, between a normal lymphocyte and an immortalized lymphocyte tumor line. In particular, B cell hybridomas are created by fusion of normal B cells of defined antigen specificity with a myeloma cell line, to yield immortal cell lines that produce monoclonal antibodies. In general, techniques for producing human B cell hybridomas, are well known in the art [Kozbor et al., Immunol. Today 4:72 (1983); Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. 77-96 (1985)].

[0022] The term "epitope" refers to a portion of a molecule (the antigen) that is capable of being bound by a binding agent, e.g., an antibody, at one or more of the binding agent's antigen binding regions. Epitopes usually consist of specific three-dimensional structural characteristics, as well as specific charge characteristics.

[0023] Anti-CCR8 antibodies of murine origin and their humanized and chimeric versions are suitable for use in the methods of the present invention. Anti-CCR8 antibodies as used herein encompass chimeric anti-CCR8 antibodies. "Chimeric antibodies" means antibodies that contain components of antibodies from two or more species, and they are generally derived using recombinant DNA techniques. For example, in a typical chimeric antibody, the constant region of a heavy or light chain may be derived from one species, while the variable region of the chain is derived from another species. In general, in chimeric antibodies of commercial interest, the constant regions of both the heavy and light chains are of human origin, whereas the variable regions are from a non-human species. In the present case, the constant region of a chimeric antibody of the invention maybe substantially identical to the constant region of a natural human antibody; the variable region of the chimeric antibody may be derived from a non-human source and has the desired antigenic specificity to the human CCR8 protein. The non-human source can be any vertebrate source that can be used to generate antibodies to a human cell surface antigen of interest or material comprising a human cell surface antigen of interest. Such non-human sources include, but are not limited to, rodents (e.g., rabbit, rat, mouse, etc.; see, for example, U.S. Pat. No. 4,816,567, herein incorporated by reference) and non-human primates (e.g., Old World monkeys such as baboon and macaque, chimpanzee, etc.; see, for example, U.S. Pat. Nos. 5,750,105 and 5,756,096, each herein incorporated by reference). Some chimeric antibodies may employ variable regions from a species that is immunologically "related" to humans, e.g., chimpanzee. Most commonly, the non-human component (variable region) is derived from a murine source. Techniques for making chimeric antibodies are described in U.S. Pat. Nos. 5,750,105; 5,500,362; 5,677,180; 5,721,108; and 5,843,685, each herein incorporated by reference.

[0024] Humanized anti-CCR8 antibodies are also encompassed by the term anti- CCR8 antibody as used herein. "Humanized anti-CCR8 antibodies" means anti-CCR8 antibodies that contain minimal sequence derived from non-human immunoglobulin sequences. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity. See, for example, U.S. Pat. Nos. 5,225,539; 5,585,089; 5,693,761; 5,693,762; 5,859,205, each herein incorporated by reference. In some instances, framework residues of the human immunoglobulin are replaced by corresponding non-human residues (see, for example, U.S. Pat. Nos. 5,585,089; 5,693,761; 5,693,762, each herein incorporated by reference). Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance (e.g., to obtain desired affinity). In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details see Jones et al., Nature 331:522-25 (1986); Riechmann et al., Nature 332:323-27 (1988); and Presta, Curr. Opin. Struct. Biol. 2:593-96 (1992), each herein incorporated by reference.

[0025] Also encompassed by the term anti-CCR8 antibodies are xenogeneic or modified anti-CCR8 antibodies produced in a non-human mammalian host, more particularly a transgenic mouse, characterized by inactivated endogenous immunoglobulin (Ig) loci, hi such transgenic animals, competent endogenous genes for the expression of light and heavy subunits of host immunoglobulins are rendered non-functional and substituted with the analogous human immunoglobulin loci. These transgenic animals produce human antibodies in the substantial absence of light or heavy host immunoglobulin subunits. See, for example, U.S. Pat. No. 5,939,598, herein incorporated by reference.

B. ANTIBODY VARIANTS AND FRAGMENTS

[0026] (i) Variants

The term "variant" refers to a peptide or polypeptide which comprises one or more amino acid sequence substitutions, deletions, and/or additions as compared to a native or unmodified sequence. Variant polypeptides include those wherein changes in the amino acid sequence are introduced by modification of polynucleotides encoding the polypeptides described herein. Methods for modifying a polynucleotide to encode alternative amino acid residues are well known and routinely practiced in the art. Such variants necessarily have less than 100% sequence identity or similarity with the parent antibody, hi one embodiment, an antibody variant will have an amino acid sequence from about 75% to less than 100% amino acid sequence identity or similarity with the amino acid sequence of either the heavy or light chain variable domain of the parent antibody, more preferably from about 80% to less than 100%, more preferably from about 85% to less than 100%, more preferably from about 90% to less than 100%, and most preferably from about 95% to less than 100%.

[0027] One type of variant is an insertion variant, which is an amino acid sequence supplemented with one or more amino acid residues. Insertions may be located at either or both termini of the protein, or may be positioned within internal regions of the amino acid sequence, which yield proteins such as fusion proteins and proteins attached to amino acid tags or labels.

[0028] Another type of variant is the deletion variant, wherein one or more amino acid residues in a polypeptide are removed. Deletions can be effected at one or both termini of the polypeptide, or with removal of one or more residues within the amino acid sequence. Deletion variants, therefore, include all fragments of a polypeptide described herein.

[0029] Yet another type of variant is the substitution variant which includes polypeptides wherein one or more amino acid residues are removed and replaced with alternative residues. In one aspect, the substitutions are conservative in nature, however, the invention embraces substitutions that are also non-conservative. Conservative substitutions for this purpose may be defined as set out in Tables A or B, below.

[0030J Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table A as described in Lehninger, [Biochemistry, 2nd Edition; Worth Publishers, Inc.New York (1975), pp.71-77] and set out immediately below.

Table A Conservative Substitutions I

SIDE CHAIN CHARACTERISTIC AMINO ACID

Non-polar (hydrophobic):

A. Aliphatic A L I V P

B. Aromatic F W C. Sulfur-containing M

D. Borderline G Uncharged-polar:

A. Hydroxyl S T Y

B. Amides N Q

C. Sulfhydryl C

D. Borderline G Positively charged (basic) K RH Negatively charged (acidic) D E

[0031] Alternative, exemplary conservative substitutions are set out in Table B, immediately below.

Table B Conservative Substitutions II

ORIGINAL RESIDUE EXEMPLARY SUBSTITUTION

Ala (A) VaI, Leu, He

Arg (R) Lys, GIn, Asn

Asn (N) GIn, His, Lys, Arg

Asp (D) GIu

Cys (C) Ser

GIn (Q) Asn

GIu (E) Asp

His (H) Asn, GIn, Lys, Arg

He (I) Leu, VaI, Met, Ala, Phe,

Leu (L) He, VaI, Met, Ala, Phe

Lys (K) Arg, GIn, Asn

Met (M) Leu, Phe, He

Phe (F) Leu, VaI, He, Ala

Pro (P) GIy Ser (S) Thr

Thr (T) Ser

Trp (W) Tyr

TF (Y) Trp, Phe, Thr, Ser

VaI (V) lie, Leu, Met, Phe, Ala

[0032] The term "fusion" refers to a specific type of insertion variant and comprises a polypeptide wherein amino and/or carboxy termini of the polypeptide is fused to another molecule to form a "fusion protein." Examples of such fusion proteins are proteins comprising immunoglobulin constant regions, which increase circulating half-life; markers, e.g., fluorochrome; molecules (or tags) that facilitate purification of the binding agent; and polypeptide sequences that promote formation of multimeric proteins (such as leucine zipper motifs that are useful in dimer formation/stability). One subclass of fusion proteins of particular interest is chimeric antibodies.

[0033] (ii) Derivatives

The term "derivative" includes polypeptides bearing modifications other than insertion, deletion, or substitution of amino acid residues. Preferably, the modifications are covalent in nature, and include for example, chemical bonding with polymers, lipids, other organic, and inorganic moieties. Examples of such modifications include covalent attachment of one or more water soluble polymers, N-linked, or O-linked carbohydrates, sugars, phosphates, and/or other such molecules. Derivatives further include deletion of one or more chemical groups which are naturally present on the binding agent. Derivatives of the invention may be prepared to increase circulating half-life of the polypeptide, or may be designed to improve targeting capacity for the polypeptide to desired cells, tissues, or organs.

[0034] (iii) Fragments

"Fragments" of the anti-CCR8 antibodies are suitable for use in the methods of the invention so long as they retain the desired affinity of the full-length antibody. As such, suitable fragments of an anti-CCR8 antibody will retain the ability to bind to the CCR8 receptor protein and thus contain a "CCR8-binding region of an antibody", and are herein referred to as "antigen-binding fragments." Fragments of an antibody comprise a portion of a full-length antibody, generally the antigen binding or variable region thereof. Examples of antibody fragments include, but are not limited to, Fab, Fab¹, F(ab')₂, and Fv fragments and single-chain antibody molecules. By "single-chain Fv" or "sFv" antibody fragments is intended fragments comprising the V_H and V_L domains of an antibody, wherein these domains are present in a single polypeptide chain. See, for example, U.S. Pat. Nos. 4,946,778; 5,260,203; 5,455,030; 5,856,456, each herein incorporated by reference. Generally, the Fv polypeptide further comprises a polypeptide linker between the V_H and VL domains that enables the sFv to form the desired structure for antigen binding. For a review of sFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, Vol. 113, ed. Rosenburg and Moore (Springer- Verlag, New York), pp. 269-315 (1994).

[0035] The phrase "complementarity determining region" or "CDR" refers to amino acid sequences that together define the binding affinity and specificity of the natural Fv region of a native immunoglobulin binding site (See, e.g., Chothia et at., J. MoI. Biol. 196:901-17 (1987); Kabat et al., U.S. Dept. of Health and Human Services NIH Publication No. 91 3242 (1991)). The phrase "constant region" refers to the portion of the antibody molecule that confers effector functions. Thus in a chimeric antibody, the constant region of the antibody has been replaced with a constant region of another species. In the (methods of treatment of humans according to the present invention, mouse constant regions are preferably replaced by human constant regions. The heavy chain constant region can be selected from any of the five isotypes: alpha (α), delta (δ), epsilon (ε), gamma (g), or mu (μ).

[0036] Antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature 348:552-54 (1990). Clackson et al., Nature 352:624-28 (1991) and Marks et al., J MoI. Biol. 222:581-97 (1991) describe the isolation of murine and human antibodies, respectively, usingphage libraries. Subsequent publications describe the production of high affinity (nanomolar (nM) range) human antibodies by chain shuffling (Marks et al., Bio/Technology 10:779-83 (1992)), as well as combinatorial infection and in vivo recombination as a strategy for constructing very large phage libraries (Waterhouse et al., Nucleic Acids Res. 21 -.2265-66 (1993)). Thus, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of monoclonal antibodies.

[0037] Further, any of the previously described anti-CCR8 antibodies may be conjugated prior to use in the methods of the present invention. Anti-CCR8 antibodies may be labeled using an indirect labeling or indirect labeling approach. The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody. The label may be itself be detectable (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable, as described in more detail below. By "indirect labeling" or "indirect labeling approach" is intended that a chelating agent is covalently attached to an antibody and at least one radionuclide is inserted into the chelating agent. See, for example, the chelating agents and radionuclides described in Srivastava and Mease, Int. J. Rad. Appl. Instrum. B 18: 589-603 (1991), herein incorporated by reference. Alternatively, the anti-CCR8 antibody may be labeled using "direct labeling" or a "direct labeling approach", in which a radionuclide is covalently attached directly to an antibody (typically via an amino acid residue). Suitable radionuclides are described in Srivastava and Mease (1991), supra.

C. CHEMOKINE RECEPTOR CCR8

[0038] CCR8 is expressed on monocytes and Th2 lymphocytes and in the brain, spleen and thymus. It is the receptor for the chemokine CCLl, which is chemotactic for Th2 cells. CCLl has also shown to be involved in eosinophil recruitment. The antibodies disclosed herein can be used to inhibit CCR8 activity; to inhibit CCLl activity and to inhibit or treat (therapeutically or prophylactically) conditions mediated by CCR8 and/or CCLl, including, but not limited to inflammatory disorders, allergic conditions, and T cell leukemia and lymphoma. The disclosed antibodies can also be advantageously used to inhibit conditions mediated by eosinophils and by monocytes, T lymphocytes and other immune system cells that express CCR8, including inflammatory disorders and allergic conditions mediated by these cells (e.g., asthma, atopic dermatitis, and allergic rhinitis), as well as T cell leukemia and lymphoma.

[0039] CCR8 acts as a co-receptor for HW infection, along with CD4, for some HIV-I strains when transfected into cells that did not express either of the major co-receptors CCR5 and CXCR4. (Jinno et al., Biochem. Biophys. Res. Commun., 243(2):497-502 (1998)). Lee et al. confirmed that CCR8 could act as an HIV co-receptor in primary cells, namely human thymocytes (Lee et al., J Virol., 74:6946-52 (2000)). Thus, in one embodiment of the invention, a CCR8 monoclonal antibody is used to block the interaction of CCR8 with HIV surface proteins and thereby prevent HIV infection of the CCR8-expressing cell.

[0040] The nucleotide and amino acid sequences of CCR8 are set out in SEQ ID NOs: 1 and 2, respectively. D. NUCLEIC ACIDS

[0041] An "isolated" nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the antibody nucleic acid. An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated nucleic acid molecules therefore are distinguished from the nucleic acid molecule as it exists in natural cells. However, an isolated nucleic acid molecule includes a nucleic acid molecule contained in cells that ordinarily express the antibody where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.

[0042] DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the monoclonal antibodies). The hybridoma cells serve as a preferred source of such DNA- Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells, as described further below.

E. VECTORS, HOST CELLS AND RECOMBINANT METHODS

[0043] The invention also provides isolated nucleic acid encoding an antibody as disclosed herein, vectors and host cells comprising the nucleic acid, and recombinant techniques for the production of the antibody variant.

[0044] For recombinant production of the antibody variant, the nucleic acid encoding it is isolated and inserted into a replicable vector for further cloning (amplification of the DNA) or for expression. DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody variant). Many vectors are available. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.

[0045] (i) Signal Sequence Component The antibody of this invention may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which is preferably a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. The heterologous signal sequence selected preferably is one that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell. For prokaryotic host cells that do not recognize and process the native antibody signal sequence, the signal sequence is substituted by a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders. For yeast secretion the native signal sequence may be substituted by, e.g., the yeast invertase leader, α factor leader (including Saccharomyces and Kluyveromyces α-factor leaders), or acid phosphatase leader, the C. albicans glucoamylase leader, or the signal described in WO 90/13646. hi mammalian cell expression, mammalian signal sequences as well as viral secretory leaders, for example, the herpes simplex gD signal, are available. The DNA for such precursor region is ligated in reading frame to DNA encoding the antibody variant.

[0046] (ii) Origin of Replication Component

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2mμ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not needed for mammalian expression vectors (the SV40 origin may typically be used only because it contains the early promoter).

[0047] (iii) Selection Gene Component

Expression and cloning vectors may contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase ϊoxBacillus sp. [0048] One example of a selection scheme utilizes a drag to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drag resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin, mycophenolic acid and hygromycin.

[0049] Another example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the antibody nucleic acid, such as DHFR, thymidine kinase, metallothionein-I and -II, preferably primate metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.

[0050] For example, cells transformed with the DHFR selection gene are first identified by culturing all of the transformants in a culture medium that contains methotrexate (Mtx), a competitive antagonist of DHFR. An appropriate host cell when wild-type DHFR is employed is the CHO cell line, which is deficient in DHFR activity.

[0051] (iv) Promoter Component

Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the antibody nucleic acid. Promoters suitable for use with prokaryotic hosts include the phoA promoter , beta-lactamase and lactose promoter systems, alkaline phosphatase, a tryptophan (trp) promoter system, and hybrid promoters such as the tac promoter. However, other known bacterial promoters are suitable. Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the antibody.

[0052] Promoter sequences are known for eukaryotes. Virtually all eukaryotic genes have an AT-rich region located approximately 25 bases upstream from the site where transcription is initiated. Another sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CNCAAT region, wherein N may be any nucleotide. At the 3' end of most eukaryotic genes is an AATAAA sequence that may be the signal for addition of the poly A tail to the 3' end of the coding sequence. All of these sequences maybe suitably inserted into eukaryotic expression vectors.

[0053] Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3 -phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phospho- fructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3 -phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657. Yeast enhancers also are advantageously used with yeast promoters.

[0054] Antibody transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter, Chinese hamster elongation factor promoter (CHEFl) and/or expression vector pDEF38 (ICOS) or an immunoglobulin promoter, from heat-shock promoters, provided such promoters are compatible with the host cell systems.

[0055] The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication. The immediate early promoter of the human cytomegalovirus is conveniently obtained as a Hindm E restriction fragment. A system for expressing DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed in U.S. Pat. No. 4,419,446. A modification of this system is described in U.S. Pat. No. 4,601,978. Alternatively, the Rous sarcoma virus long terminal repeat (LTR) can be used as the promoter.

[0056] (v) Enhancer Element Component

Transcription of a DNA encoding the antibody of this invention by higher eukaryotes is often increased by inserting an enhancer sequence into the vector. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha- fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100- 270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. See also Yaniv, Nature 297:17-18 (1982) on enhancing elements for activation of eukaryotic promoters. The enhancer may be spliced into the vector at a position 5' or 3' to the antibody-encoding sequence, but is preferably located at a site 5' from the promoter.

[0057] (vi) Transcription Termination Component

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally, 3' untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding the antibody. One useful transcription termination component is the bovine growth hormone polyadenylation region. See WO94/11026 and the expression vector disclosed therein.

[0058] (vii) Selection and Transformation of Host Cells

Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as Escherichiasuch as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella such as S. typhimurium, Serratia such as S. marcescens, and Shigella, as well as Bacillus such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710 published Apr. 12, 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. One preferred E. coli cloning host is E. coli 294 (ATCC 31,446), although other strains such as E. coli B, E. coli Xl 776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable. These examples are illustrative rather than limiting.

[0059] Bi addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as K. lactis, K.fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; Yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi e.g., Neurospora such as Neurospora crassa, Penicillium, Tolypocladium, and Aspergillus hosts such as A. nidulans and A. niger. These examples are illustrative rather than limiting.

[0060] Suitable host cells for the expression of glycosylated antibody are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (armyworm caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruit fly), and Bombyx mori (silkworm) have been identified. A variety of viral strains for transfection are publicly available, e.g., the L-I variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used as the virus herein according to the present invention, particularly for transfection of Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be utilized as hosts.

[0061] However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CVl line transformed by SV40 (COS-7, ATCC CPvL 1651); human embryonic kidney (HEK) line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol. 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR(CHO, Urlaub et al., Proc. Natl. Acad. Sd. USA 77:4216-20 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CVl ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL- 1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (Wl 38, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRl cells (Mather et al., Ann N. Y. Acad. Sci. 383:44-68 (1982)); MRC cells; FS4 cells; and a human hepatoma line (Hep G2).

[0062] Host cells are transformed with the above-described expression or cloning vectors for antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.

[0063] (viii) Culturing the Host Cells The host cells used to produce the antibody of this invention may be cultured in a variety of media. Commercially available media such as Ham's FlO (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing the host cells, hi addition, any of the media described in Ham et al, Methods Enzymol. 58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; or U.S. Patent Re. 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as gentamycin), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

[0064] (ix) Antibody Purification

When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration. Carter et al., Bio/Technology 510:163-67 (1992), describe a procedure for isolating antibodies which are secreted to the periplasmic space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min. Cell debris can be removed by centrifugation. When the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants.

[0065] The antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody variant. Protein A can be used to purify antibodies that are based on human gamma 1, gamma 2, or gamma 4 heavy chains (Lindmark et al., J. Immunol. Methods 62:1-13 (1983)). Protein G is recommended for all mouse isotypes and for human gamma 3 (Guss et al., EMBO J. 5:1567-75 (1986)). The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. If the antibody comprises a CH₃ domain, the Bakerbond ABX 4 resin (J.T. Baker, Phillipsburg, NJ.) is useful for purification. Other techniques for protein purification such as fractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica, chromatography on heparin Sepharose™ chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also available depending on the antibody to be recovered.

F. PHARMACEUTICAL FORMULATIONS

[0066] Therapeutic formulations of the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers {Remington 's Pharmaceutical Sciences (18^th ed.; Mack Pub. Co.: Eaton, Pa., 1990), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as Tween®, Pluronic® or polyethylene glycol (PEG). [0067] The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide an immunosuppressive agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

[0068] The active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980). The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

[0069] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody variant, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the Lupron Depot® (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37⁰C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.

G. NON-THERAPEUTIC USES FOR THE ANTI-CCR8 ANTIBODIES [0070] The anti-CCR8 antibodies of the invention may be used as affinity purification agents. In this process, the antibodies are immobilized on a solid phase such a Sephadex® resin or filter paper, using methods well known in the art. The immobilized antibody is contacted with a sample containing the antigen to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the antigen to be purified, which is bound to the immobilized antibody variant. Finally, the support is washed with another suitable solvent, such as glycine buffer, pH 5.0, that will release the antigen from the antibody.

[0071] The anti-CCR8 antibodies may also be useful in diagnostic assays, e.g., for detecting expression of an antigen of interest in specific cells, tissues, or serum.

[0072] For diagnostic applications, the antibody typically may be labeled with a detectable moiety. Numerous labels are available which can be generally grouped into the following categories:

[0073] (a) Radioisotopes, such as ³⁵S, ¹⁴C, ¹²⁵1, ³H, and ¹³¹I. The antibody can be labeled with the radioisotope using the techniques described in Current Protocols in Immunology, Volumes 1 and 2, Coligen et al., Ed. Wiley-Interscience, New York, N. Y., Pubs. (1991) for example and radioactivity can be measured using scintillation counting.

[0074] (b) Fluorescent labels such as rare earth chelates (europium chelates) or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, Lissamine, phycoerythrin and Texas Red are available. The fluorescent labels can be conjugated to the antibody using the techniques disclosed in Current Protocols in Immunology, supra, for example. Fluorescence can be quantified using a fluorimeter.

[0075] (c) Various enzyme-substrate labels are available and U.S. Pat. No. 4,275,149 provides a review of some of these. The enzyme generally catalyzes a chemical alteration of the chromogenic substrate which can be measured using various techniques. For example, the enzyme may catalyze a color change in a substrate, which can be measured spectrophotometrically. Alternatively, the enzyme may alter the fluorescence or chemiluminescence of the substrate. Techniques for quantifying a change in fluorescence are described above. The chemiluminescent substrate becomes electronically excited by a chemical reaction and may then emit light which can be measured (using a chemiluminometer, for example) or donates energy to a fluorescent acceptor. Examples of enzymatic labels include luciferases (e.g., firefly luciferase and bacterial luciferase; U.S. Pat. No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidase such as horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase, glucoamylase, lysozyme, saccharide oxidases (e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocyclic oxidases (such as uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like. Techniques for conjugating enzymes to antibodies are described in O'Sullivan et al., Methods Enzymol. (ed J. Langone & H. Van Vunakis), Academic Press, New York, 73:147-66 (1981).

[0076] Examples of enzyme-substrate combinations include, for example:

[0077] (i) HRP with hydrogen peroxide as a substrate, wherein the hydrogen peroxide oxidizes a dye precursor (e.g., orthophenylene diamine (OPD) or 3,3',5,5'- tetramethyl benzidine hydrochloride (TMB));

[0078] (ii) alkaline phosphatase (AP) with para-nitrophenyl phosphate as chromogenic substrate; and

[0079] (iii) beta-D-galactosidase (beta-D-Gal) with a chromogenic substrate (e.g., p-nitrophenyl-beta-D-galactose) or fluorogenic substrate 4-methylumbelliferyl-beta-D- galactose.

[0080] Numerous other enzyme-substrate combinations are available to those skilled in the art. For a general review of these, see U.S. Pat. Nos. 4,275,149 and 4,318,980. Sometimes, the label is indirectly conjugated with the antibody variant. The skilled artisan will be aware of various techniques for achieving this. For example, the antibody can be conjugated with biotin, and any of the three broad categories of labels mentioned above can be conjugated with avidin, or vice versa. Biotin binds selectively and extremely avidly to avidin and thus, the label can be conjugated with the antibody in this indirect manner. Alternatively, to achieve indirect conjugation of the label with the antibody variant, the antibody is conjugated with a small hapten (e.g., digoxin) and one of the different types of labels mentioned above is conjugated with an anti-hapten antibody (e.g., anti-digoxin antibody). Thus, indirect conjugation of the label with the antibody can be achieved.

[0081] In another embodiment of the invention, the antibody need not be labeled, and the presence thereof can be detected using a labeled antibody which binds to the antibody.

[0082] The antibodies of the present invention may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, at pp.147-158 (CRC Press, Inc. 1987).

[0083] Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyze for binding with a limited amount of antibody variant. The amount of antigen in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies generally are insolubilized before or after the competition, so that the standard and analyze that are bound to the antibodies may conveniently be separated from the standard and analyze which remain unbound.

[0084] Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyze is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex. See, e.g., U.S. Pat. No.4,376,110. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an antiimmunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.

[0085] For immunohistochemistry, the tumor sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.

[0086] The antibodies may also be used for in vivo diagnostic assays. Generally, the antibody is labeled with a radionuclide (such as ¹¹¹In, ⁹⁹Tc, ¹⁴C, ¹³¹1, ¹²⁵1, ³H ³²P or ³⁵S) So that the tumor can be localized using immunoscintigraphy.

H. DIAGNOSTIC KITS

[0087] As a matter of convenience, the antibodies of the present invention can be provided in a kit, i.e., a packaged combination of reagents in predetermined amounts in one or more containers with instructions for performing the diagnostic assay. Where the antibody is labeled with an enzyme, the kit will include substrates and co factors required by the enzyme (e.g., a substrate precursor which provides the detectable chromophore or fluorophore). In addition, other additives may be included such as stabilizers, buffers (e.g., a block buffer or lysis buffer) and the like. The relative amounts of the various reagents may be varied widely to provide for concentrations in solution of the reagents which substantially optimize the sensitivity of the assay. Particularly, the reagents may be provided as dry powders, usually lyophilized, including excipients which on dissolution will provide a reagent solution having the appropriate concentration.

I. IN VIVO USES FOR THE ANTI-CCR8 ANTIBODIES

[0088] For therapeutic applications, the antibodies of the invention are administered to a human or other mammal (collectively "subjects") in a pharmaceutically acceptable dosage form such as those discussed above, including those that may be administered to a subject intravenously as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intra-cerebrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. The antibodies also are suitably administered by intra-tumoral, peri-tumoral, intra-lesional, or peri-lesional routes, to exert local as well as systemic therapeutic effects. The intra-peritoneal route is expected to be particularly useful, for example, in the treatment of ovarian tumors. In addition, the antibody is suitably administered by pulse infusion, particularly with declining doses of the antibody. Preferably the dosing is given by injections, most preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.

[0089] For the prevention or treatment of disease, the appropriate dosage of antibody will depend on the type of disease to be treated, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the antibody variant, and the discretion of the attending physician or health veterinary professional. The antibody is suitably administered to the subject at one time or over a series of treatments.

[0090] When administered intravenously, the pharmaceutical composition comprising the anti-CCR8 antibody can be administered by infusion over a period of about 0.5 to about 5 hours. In some embodiments, infusion occurs over a period of about 0.5 to about 2.5 hours, over a period of about 0.5 to about 2.0 hours, over a period of about 0.5 to about 1.5 hours, or over a period of about 1.5 hours, depending upon the anti-CCR8 antibody being administered and the amount of anti-CCR8 antibody being administered. The phrase "effective amount" means an amount sufficient to modulate or ameliorate a symptom, or the time of onset of symptom, typically by at least about 10%; usually by at least about 20%, preferably at least about 30%, or more preferably at least about 50%. Typical mammalian subjects include mice, rats, cats, dogs, and primates, including humans. An effective amount for a particular subject may vary depending on factors such as the condition being treated, the overall health of the subject, the method, route, and dose of administration and the severity of side effects. When in combination, an effective amount is in ratio to a combination of components and the effect is not limited to individual components alone.

[0091] The anti-CCR8 antibodies are typically provided by standard technique within a pharmaceutically acceptable buffer, for example, sterile saline, sterile buffered water, propylene glycol, combinations of the foregoing, etc. Methods for preparing parenterally administrable agents are described in Remington 's Pharmaceutical Sciences (18 ed.; Mack Pub. Co.: Eaton, Pa., 1990), herein incorporated by reference. See also, for example, WO 98/56418, which describes stabilized antibody pharmaceutical formulations suitable for use in the methods of the present invention.

[0092] The following examples are offered by way of illustration and not of limitation. Example 1 describes the generation of anti-CCR8 monoclonal antibodies. Example 2 describes the results of epitope mapping studies. Example 3 describes the ability of anti-CCR8 monoclonal antibodies to block chemotaxis. Example 4 describes immunohistochemistry results with human thymus sections. Example 5 describes the use of anti-CCR8 monoclonal antibodies to identify CCR8-expressing cells. Example 6 provides a comparison of an anti-CCR8 monoclonal antibody of the present invention relative to a commercially available anti-CCR8 monoclonal antibody.

EXAMPLE 1

Generation of anti-CCR8 monoclonal antibodies

[0093] Anti-CCR8 monoclonal antibodies were developed by immunizing Balb/c mice with irradiated cells transfected with CCR8 which had high levels of CCR8 expressed on the cell surface. Briefly, the CCR8 coding sequence was amplified by PCR from genomic DNA using specific primers (Forward: GACAAGCTTGCCTTGATGGATTATACAC (SEQ ID NO:5); includes HindIII cloning site and covers initiating ATG; Reverse: GTCTCTAGAGATCCTCACAAAATGTAGTC (SEQ ID NO:6); includes Xbal cloning site and covers termination codon). It was then inserted into the expression vector pNEF6 behind the elongation factor promoter. Cells were transfected with the expression plasmid by electroporation, selected in media containing G418, and tested for functional expression of CCR8 by chemotaxis to CCLl . Individual clones with the greatest chemotactic response to CCLl were selected for subsequent studies.

[0094] Spleen cells from these mice were fused by standard methods to create hybridomas producing unique antibodies (Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory, 1988). Supernatants containing antibodies produced by pools of these cells were tested by fluorescence-activated cell sorting (FACS) for reactivity with CCR8-transfected cells. FACS analyses were generally carried out as follows. Approximately 10⁵-10⁶ cells per sample were spun down in polystyrene FACS tubes. Samples were then incubated with primary antibody (or isotype matched control) at 10 μg/mL in 100 μL PBS/0.1%BSA for 20-30 minutes on ice. Next, the samples were washed with PBS and the cells were pelleted. The pelleted cell samples were next incubated with FITC-anti mouse IgG secondary antibody at 1 :200 dilution in 100 μL PBS/0.1%BSA for 20- 30 minutes on ice under foil, and then washed with PBS and followed by pelleting the cells. Cell pellets were re-suspended in 1% formaldehyde for reading, and samples were analyzed on a FACScan™ (Becton Dickinson) using Cellquest™ software.

[0095] For screening large numbers of hybridoma supernatants for the presence of CCR8 antibodies by FACS, the standard FACS protocol was modified as follows. The transfected cells were put into 96-well round-bottom polystyrene plates and incubated with neat supernatants taken from hybridoma cultures. The cells were then washed, incubated with the secondary antibody and transferred to polystyrene FACS tubes for analysis on the FACScan as described. Generally the same supernatants were tested (and found to be negative) on non-transfected parental cells to confirm that the reactive antibody recognized CCR8 specifically.

[0096] Positive pools were identified and cloned by limiting dilution. After five fusions, nine clones producing unique antibodies were identified which recognized CCR8 transfected cells specifically by FACS: 414B, 414C, 414E, 433B₃ 433H, 455AL, 459M, 464 A, and 464B. The hybridomas are referred to by the same designation as the antibodies produced therefrom (e.g., hybridoma 414B produces antibody 414B).

EXAMPLE 2

Epitope mapping of the anti-CCR8 monoclonal antibodies

[0097] In order to map the epitopes of CCR8 where the monoclonal antibodies are binding, expression constructs were generated by PCR to make chimeric proteins containing portions of CCR8 fused to the related chemokine receptor CCR2. The resulting proteins contained extracellular domain 1 (amino acids 1-39 of SEQ ID NO: 2) from CCR8 with the remaining amino acids from CCR2 (amino acids 47-360 of SEQ ID NO: 4), extracellular domains 1 and 2 (amino acids 1-107 of SEQ ID NO: 2) from CCR8, or extracellular domains 1 and 2 and 3 (amino acids 1-199 of SEQ ID NO: 2) from CCR8. Similar proteins were also generated which contained the extracellular domain 1 (amino acids 1-46 of SEQ ID NO: 4) from CCR2 attached to the remaining amino acids from CCR8 (amino acids 40-355 of SEQ ID NO: 2). The constructs were made in the pcDNA3 mammalian expression vector and contained a signal sequence to maximize expression at the cell surface and a Flag tag (inserted by PCR using specific oligonucleotides) added at the amino terminus to confirm cell surface expression by FACS using the Flag epitope antibody M2 (Sigma). These constructs were expressed transiently in 293T cells and analyzed by FACS using each of the CCR8 monoclonal antibodies. When the amino terminal extracellular domain 1 of CCR8 was removed and replaced with the same domain of CCR2, all of the CCR8 monoclonal antibodies lost reactivity. When the CCR2 amino terminal extracellular domain 1 was replaced with the same CCR8 domain, reactivity with each of the CCR8 monoclonal antibodies was observed. Thus, all the antibodies react with the amino terminal extracellular domain 1 of CCR8.

EXAMPLE 3

Anti-CCR8 monoclonal antibodies block chemotaxis

[0098J In order to determine which of the antibodies described above can block chemotaxis, CCR8 transfectants were pelleted and re-suspended at 5xlO⁶/ml complete media. Chemotaxis assays were performed as follows. CCLl chemokine was diluted in complete media in a range of concentrations (generally 0.1 - 1000 ng/niL). A Costar Transwell® plate was loaded (5 μm pore size) with 600 μL diluted chemokine in the lower wells. Pore inserts (5 μm) were then transferred to the loaded wells. Next, 100 μL of cells was added to the upper chamber of the plate, and incubated for 3-4 hours at 37⁰C. After the inserts were removed, the media/cells was collected from lower wells and transferred to the FACS tubes. Cells in each sample were then counted for 30 seconds on FACScan using CellQuest software.

[0099] The inhibitor activity was tested during antibody cloning as well as with purified antibody. For testing inhibitory activity during antibody cloning, a sub-maximal level of chemokine was chosen (usually 2-5 ng/mL CCLl). 300 μL 2X chemokine in complete media was loaded into the lower wells of Transwell plate. Next, 300 μL antibody supernatant from hybridomas producing CCR8 mAb was added to the chemokine in the lower wells. The remainder of the procedure was carried out as described above (e.g., continued from the "5 μm pore inserts were then transferred to the loaded wells" step). For testing inhibitory activity of a purified antibody, antibody was diluted in a range of concentrations (generally 0.01-10 μg/mL) into media containing chemokine at sub-maximal level (2-5 ng/mL). Six hundred microliters (600 μL) of the chemokine/antibody dilution was then loaded in the lower well of the Transwell plate. The remainder of the procedure was carried out as described above (e.g., continued from the "5 μm pore inserts were then transferred to the loaded wells" step).

The chemotaxis inhibition experiments showed that CCR8 monoclonal antibodies blocked chemotaxis of CCR8 transfectants toward CCLl . The results are summarized in Figure 1.

EXAMPLE 4

Immunohistochemistry analyses with human thymus sections

[00100] Immunohistochemistry experiments were carried out on both frozen human thymus sections and fixed/paraffin sections. For frozen sections, tissue sections were incubated for 10 minutes in -2O⁰C acetone and then washed in TBS / 0.05% Tween-20. The tissue sections were next blocked with 3% H₂O₂ for 10 min and then washed. Next, the sections were blocked with Protein Block Serum-Free (DakoCytomation #X0909) for 10 min. Primary antibody 10 μg/mL was then added and incubated in TBS / 0.05% Tween-20 / 2% BSA for 60 min and then washed. Secondary anti-mouse antibody Mouse En Vision™ (DakoCytomation #K4001) was then added and incubated for 30 min and then washed. Bound antibody was visualized with DAB+ (DakoCytomation #K3468) after 5 min, and the assay was stopped with H₂O. Gill's hematoxylin was used to counterstain and then the samples was washed with H₂O. Finally, the sample was dehydrated using 70% ethanol 2x2 min / 95% ethanol 2x2 min / 100% ethanol 2x2 min / xylene 2x5 min, and the sample was prepared for microscopy.

[00101] For fixed/paraffin sections, samples were first de-paraffinized using xylene 2x5 min / 100% ethanol 2x2 min / 95% ethanol 2x2 min / 70% ethanol 2x2 min, and then washed three times in H₂O. Samples were next incubated in Target Retrieval Solution High pH 9.9 (DakoCytomation #S3307) for 20 min at 95⁰C followed by a 20 min cool down. The samples were then washed in TBS / 0.05% Tween-20, and the steps set forth above were repeated (e.g., starting with "tissue sections were next blocked with 3% H₂O₂ for 10 min and then washed").

[00102] The immunohistochemistry experiments showed that two of the CCR8 monoclonal antibodies reacted specifically with cells in the medulla region of the thymus, consistent with previous in situ hybridization results. These antibodies worked on frozen thymus samples and also on fixed/paraffin thymus samples which had been pretreated in high pH as an antigen retrieval technique as described above. The immunohistochemistry results are summarized in Figure 2.

EXAMPLE 5

Use of anti-CCR8 monoclonal antibodies to identify CCR8-expressing cells

[00103] Anti-CCR8 monoclonal antibodies were used to identify CCR8-expressing cells in lymphocytes from peripheral blood by FACS as well as in Th2 cell lines that have been derived in vitro.

[00104] Peripheral blood mononuclear cells were isolated from whole blood buffy coats of Histopaque gradients. Lymphocytes were collected from those samples after adhering monocytes to plastic for 1 hour. The lymphocytes were used directly in FACS assays or were tested after activation for 3-7 days with PHA (1 μg/ml) and ionomycin (100 U/ml). CCR8 expression was detected by incubating with 414E or other CCR8 monoclonal antibody at 10 μg/ml followed by biotinylated goat anti-mouse at 1 :150 and then streptavidin- PE at 1 :150 (all incubations in PBS/0.1% BSA for 30 minutes on ice). Marker antibodies for lymphocyte subsets labeled with FITC were used at 1 :50. The results showed that CCR8 was detected on 3-6% of freshly isolated lymphocytes. CCR8 was mainly on CD4+ cells but was also seen on CD8+ cells. CCR8 was associated with CD45RO+ cells and with CD25+ cells. CCR8 was expressed on 10-14% of PHA-activated lymphocytes.

[00105] Th2-type T cells were generated from freshly isolated CD4+ T cells by incubating with IL4 and anti-IL12 in the presence of PHA (1 μg/ml) for 10 days. Similarly ThI cells were generated with IL12 and anti-IL4. CCR8 was detected on these cells by incubating with biotinylated 414E or other CCR8 monoclonal antibody and then with streptavidin-PE. Results showed that CCR8 was expressed on Th2 cells but not on ThI cells. Re-activation of the cells with PHA increased the level of CCR8 on Th2 cells. EXAMPLE 6

Comparison of an anti-CCR8 monoclonal antibody 433H to anti-CCR8 monoclonal antibody

191704

[00106] The FACS and chemotaxis experiments described above were repeated to compare anti-CCR8 monoclonal antibody 433H to the commercially available anti-CCR8 monoclonal antibody 191704 (R&D Systems, catalog no. MAB1429). The results showed that contrary to 433H, antibody 191704 does not block chemotaxis activity nor does it recognize CCR8 transfectants when measured by FACS. CCR8 transfectants were used to test antibody 191704 in FACS and chemotaxis assays. When tested in a range of concentrations which were appropriate for activity of antibody 433H (tested in parallel), no staining by FACS of CCR8 transfectants could be detected with 191704 and no effect on chemotaxis of CCR8 transfected cells to CCLl could be measured.

Claims

ClaimsWhat is claimed is:

1. A monoclonal antibody 414B that binds human CCR8 protein.

2. A monoclonal antibody 414C that binds human CCR8 protein.

3. A monoclonal antibody 414E that binds human CCR8 protein.

4. A monoclonal antibody 433H that binds human CCR8 protein.

5. A monoclonal antibody 459M that binds human CCR8 protein.

6. A monoclonal antibody 464A that binds human CCR8 protein.

7. A monoclonal antibody 464B that binds human CCR8 protein.

8. A monoclonal antibody 433B that binds human CCR8 protein.

9. A monoclonal antibody 455AL that binds human CCR8 protein.

10. A hybridoma that produces an antibody according to claim 1 , said hybridoma having ATCC Accession No. PTA-6941.

11. A hybridoma that produces an antibody according to claim 2.

12. A hybridoma that produces an antibody according to claim 3, said hybridoma having ATCC Accession No. PTA-6940.

13. A hybridoma that produces an antibody according to claim 4, said hybridoma having ATCC Accession No. PTA-6938.

14. A hybridoma that produces an antibody according to claim 5.

15. A hybridoma that produces an antibody according to claim 6, said hybridoma having ATCC Accession No. PTA-6939.

16. A hybridoma that produces an antibody according to claim 7.

17. A hybridoma that produces an antibody according to claim 8.

18. A hybridoma that produces an antibody according to claim 9.

19. A humanized antibody comprising a CCR8-binding region of an antibody of any one of claims 1-9.

20. A chimerized antibody comprising a CCR8-binding region of an antibody of any one of claims 1-9.

21. A polypeptide comprising a CCR8-binding region of an antibody of any one of claims 1-9, wherein said polypeptide binds to CCR8.

22. The polypeptide according to claim 21 , wherein the CCR8-binding region comprises an F(ab')₂ fragment of said antibody.

23. The polypeptide according to claim 21 , wherein the CCR8-binding region comprises an Fab fragment of said antibody.

24. The polypeptide according to claim 21, wherein the CCR8-binding region comprises one or more complementarity-determining regions of said antibody.

25. An isolated polynucleotide comprising a nucleotide sequence encoding the antibody or polypeptide of any one of claims 1-9 and 10-18.

26. A vector comprising the polynucleotide of claim 25.

27. A host cell transformed or transfected with the vector according to claim 26.

28. A host cell according to claim 27 that secretes an antibody or polypeptide encoded by the polynucleotide, wherein the antibody or polypeptide specifically binds to human CCR8.

29. An antibody or polypeptide according to any one of claims 1-9 and 10-18, further comprising a detectable label.

30. A method of identifying cells that express CCR8 comprising the steps of: a) contacting cells with an antibody or polypeptide according to any one of claims 1-9 and 10-18; and b) identifying cells that express CCR8 by detecting said antibody or polypeptide binding to cells.

31. A method according to claim 30, further comprising washing the cells between the contacting and the identifying, to remove unbound antibody or polypeptide.

32. A method according to claim 31 , wherein the antibody or polypeptide comprises a label.

33. An in vivo method according to claim 32, wherein the contacting comprises administering the antibody or polypeptide to a human subject.

34. A composition comprising an antibody or polypeptide according to any one of claims 1-9 and 10-18, and further comprising a pharmaceutically acceptable carrier, diluent, or excipient.

35. A method of ameliorating symptoms of allergic inflammatory conditions in a human subject comprising administering an effective amount of a composition according to claim 34 to a human subject having an allergic inflammatory condition.

36. The method according to claim 35, wherein the allergic inflammatory condition is selected from the group consisting of asthma, atopic dermatitis, and allergic rhinitis.

37. The method according to claim 35, wherein the allergic inflammatory condition is characterized by accumulation of T helper type 2 cells at a site of allergen exposure.

38. A method of ameliorating symptoms of a condition characterized by abnormal or unwanted activity of T helper type 2 cells in a human, comprising administering an effective amount of a composition according to claim 34 to a human having symptoms of a condition characterized by abnormal or unwanted activity of T helper type 2 cells.

39. The method according to claim 38, wherein the condition is selected from the group consisting of asthma, atopic dermatitis, and allergic rhinitis.

40. A method of ameliorating symptoms of human immunodeficiency virus (HIV) infection in a patient comprising administering an effective amount of a composition according to claim 34 to a human subject infected with HIV.

41. A method of inhibiting human immunodeficiency virus (HTV) infection of human cells that express CCR8, comprising administering to a human subject a composition according to claim 34, in an amount effective to inhibit HIV infection of CCR8-expressing cells in said subject.

42. A method of inhibiting CCLl -induced chemotaxis by contacting a cell with an antibody or polypeptide according to any one of claims 1-9 and 10-18.

43. A method of inhibiting CCLl -induced activation by contacting a cell with an antibody or polypeptide according to any one of claims 1-9 and 10-18.

44. A method of diagnosing a condition characterized by accumulation of T helper type 2 cells at a site of allergen exposure comprising the steps of: a) contacting cells from a human subject with an antibody or polypeptide according to any one of claims 1-9 and 10-18; and b) diagnosing the condition by measuring the antibody or polypeptide bound to cells from said human subject.