US20020106729A1 - Expression vectors - Google Patents

Expression vectors Download PDF

Info

Publication number
US20020106729A1
US20020106729A1 US09/897,006 US89700601A US2002106729A1 US 20020106729 A1 US20020106729 A1 US 20020106729A1 US 89700601 A US89700601 A US 89700601A US 2002106729 A1 US2002106729 A1 US 2002106729A1
Authority
US
United States
Prior art keywords
vector
protein
sequence
cells
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/897,006
Other languages
English (en)
Inventor
Gregory Bleck
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GALA DESIGN LLC
Original Assignee
GALA DESIGN LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GALA DESIGN LLC filed Critical GALA DESIGN LLC
Priority to AU2001270252A priority Critical patent/AU2001270252B2/en
Priority to US09/897,006 priority patent/US20020106729A1/en
Assigned to GALA DESIGN, LLC reassignment GALA DESIGN, LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BLECK, GREGORY T.
Publication of US20020106729A1 publication Critical patent/US20020106729A1/en
Priority to US10/947,881 priority patent/US7378273B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1267Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
    • C07K16/1282Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria from Clostridium (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3007Carcino-embryonic Antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3061Blood cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/80Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85Vector systems having a special element relevant for transcription from vertebrates mammalian
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the present invention relates to novel regulatory elements and vectors for the expression of one or more proteins in a host cell.
  • proteins produced recombinantly in mammalian cells include erythropoietin, factor VIII, factor IX, and insulin.
  • recombinant antibodies are often used as therapeutic agents.
  • Clinical applications of recombinantly produced proteins, in particular antibodies, often require large amounts of highly purified proteins. Proteins are generally produced in either mammalian cell culture or in transgenic animals.
  • Retroviral vectors are widely used as vehicles for delivery of genes into mammalian cells (See e.g., Vile and Russell, British Medical Bulletin, 51:12 [1995]).
  • current methods for creating mammalian cell lines for expression of recombinant proteins suffer from several drawbacks. (See, e.g., Mielke et al., Biochem. 35:2239-52 [1996]).
  • Episomal systems allow for high expression levels of the recombinant protein, but are frequently only stable for a short time period (See, e.g., Klehr and Bode, Mol. Genet. (Life Sci. Adv.) 7:47-52 [1988]).
  • Mammalian cell lines containing integrated exogenous genes are somewhat more stable, but there is increasing evidence that stability depends on the presence of only a few copies or even a single copy of the exogenous gene. Vectors are often unstable, resulting in a decrease in the level of protein expression over time.
  • the present invention relates to novel regulatory elements and vectors for the expression of one or more proteins in a host cell.
  • the present invention provides a hybrid ⁇ -lactalbumin promoter comprising at least one portion derived from a first mammalian ⁇ -lactalbumin promoter and at least one portion derived from a second mammalian ⁇ -lactalbumin promoter.
  • the present invention is not limited to portions derived from any particular ⁇ -lactalbumin promoter. Indeed, portions from a variety of ⁇ -lactalbumin promoters are contemplated, including, but not limited to bovine, human, ovine, caprine, and murine ⁇ -lactalbumin promoters.
  • the present invention provides a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 and sequences hybridizable to SEQ ID NO:1 under low stringency conditions, wherein the nucleic acid contains sequences derived from at least two mammalian sources and causes mammary specific gene expression.
  • the present invention provides a nucleic acid sequence encoding a hybrid bovine/human alpha lactalbumin ( ⁇ LA) promoter/enhancer (i.e., SEQ ID NO:1) and sequences that are hybridizable to a hybrid bovine/human ⁇ -LA promoter under low to high stringency conditions.
  • ⁇ LA hybrid bovine/human alpha lactalbumin
  • these sequences drive the expression of an exogenous gene in the mammary gland of a transgenic animal.
  • the hybridizable sequence comprises human and bovine elements.
  • the present invention provides a vector containing the nucleic acid sequence of hybrid bovine/human ⁇ -LA promoter.
  • the vector is a retroviral vector.
  • the present invention provides a host cell containing a vector containing a hybrid bovine/human ⁇ -LA promoter.
  • the present invention also provides a nucleic acid encoding a mutant RNA export element (PPE element; SEQ ID NO:2) and sequences that are hybridizable to a mutant PPE element.
  • PPE element RNA export element
  • the sequences hybridizable to a mutant PPE element contain ATG sequences that have been mutated at at least one of the positions corresponding to nucleic acid residues 4, 112, 131, and 238 of the wild-type PPE element. In preferred embodiments, these sequences enhance the export from the nucleus of the RNA to which they are operably linked.
  • the present invention provides a vector containing the nucleic acid sequence of the mutant PPE element.
  • the vector is a retroviral vector.
  • the present invention provides a host cell containing a vector that contains a mutant PPE element.
  • the present invention also provides a nucleic acid encoding an IRES coding sequence and a signal peptide coding sequence, wherein said IRES and signal peptide coding sequences are adjacent to one another.
  • the IRES/signal peptide sequence comprises SEQ ID NO:3 or SEQ ID NO:12 and sequences that are hybridizable to these sequences under low stringency conditions.
  • these sequences interact with a ribosome and provide for the secretion of proteins to which they are operably linked.
  • the present invention is not limited to any particular signal sequence peptide. Indeed, it is contemplated that a variety of signal peptides find use in the present invention.
  • the signal peptide sequence is selected from alpha-casein, human growth hormone, or ⁇ -lactalbumin signal peptide sequences.
  • the present invention provides a vector containing the nucleic acid sequence of the IRES/signal peptide sequence.
  • the vector is a retroviral vector.
  • the present invention provides a host cell containing a vector that contains a IRES/signal peptide sequence.
  • the present invention also provides methods for producing a protein of interest.
  • the methods comprise providing a host cell and a vector containing at least one exogenous gene operably linked to a bovine/human hybrid ⁇ -lactalbumin promoter and introducing the vector to the host cell under conditions such that expression of the protein encoded by the exogenous gene is expressed.
  • the vector further contains a mutant RNA export element.
  • the vector contains at least two exogenous genes.
  • the two or more exogenous genes are arranged in a polycistronic sequence separated by an internal ribosome entry site/bovine ⁇ -lactalbumin signal peptide.
  • the present invention also provides methods for expressing at least two proteins in a polycistronic sequence.
  • the proteins are unrelated, while in other embodiments, the proteins are subunits of a multisubunit protein.
  • the present invention provides methods for producing an immunoglobulin including providing a host cell and a vector comprising a first exogenous gene and a second exogenous gene, wherein the first exogenous gene encodes a first immunoglobulin chain and wherein the second exogenous gene encodes a second immunoglobulin chain, and wherein the first and the second genes are separated by an internal ribosome entry site, and introducing the vector to the host cell under conditions such the first immunoglobulin chain and the second immunoglobulin chain encoded by the first and second exogenous genes are expressed.
  • the first immunoglobulin chain is an immunoglobulin light chain (e.g., ⁇ or ⁇ ) and the second immunoglobulin chain is an immunoglobulin heavy chain (e.g., ⁇ , ⁇ , ⁇ , or ⁇ ).
  • the first immunoglobulin chain is an immunoglobulin heavy chain (e.g., ⁇ , ⁇ , ⁇ , ⁇ , or ⁇ ) and the second immunoglobulin chain is an immunoglobulin light chain (e.g., ⁇ or ⁇ ).
  • the vector is a retroviral vector. In other embodiments, the vector further contains a bovine ⁇ -lactalbumin signal peptide.
  • the vector further contains a bovine/human hybrid ⁇ -lactalbumin promoter.
  • the first immunoglobulin chain and the second immunoglobulin chain are expressed at a ratio of about 0.9:1.1 to 1:1.
  • the present invention also provides immunoglobulins produced by the methods described herein. The present invention is not limited to the use of any particular vector. Indeed, it is contemplated that a variety of vectors find use in the present invention, including, but not limited to plasmid and retroviral vectors. In some preferred embodiments, the retroviral vector is pseudotyped.
  • the present invention provides methods of indirectly detecting the expression of a protein of interest comprising providing a host cell transduced or transfected with a vector encoding a polycistronic sequence, wherein the polycistronic sequence comprises a signal protein and a protein of interest operably linked by an IRES, and culturing the host cells under conditions such that the signal protein and protein of interest are produced, wherein the presence of the signal protein indicates the presence of the protein of interest.
  • the methods of the present invention are not limited to the expression of any particular protein of interest. Indeed, the expression of a variety of proteins of interest is contemplated, including, but not limited to, G-protein coupled receptors. The present invention is not limited to the use of any particular signal protein.
  • signal proteins including, but not limited to, immunoglobulin heavy and light chains, beta-galactosidase, beta-lactamase, green fluorescent protein, and luciferase.
  • expression of the signal protein and protein of interest is driven by the same promoter and the signal protein and protein of interest are transcribed as a single transcriptional unit.
  • FIG. 1 is a Western blot of a 15% SDS-PAGE gel run under denaturing conditions and probed with anti-human IgG (Fc) and anti-human IgG (kappa).
  • FIG. 2 is a graph of MN14 expression over time.
  • FIG. 3 is a Western blot of a 15% PAGE run under non-denaturing conditions and probed with anti-human IgG (Fc) and anti-human IgG (Kappa).
  • FIG. 4 provides the sequence for the hybrid human-bovine alpha-lactalbumin promoter (SEQ ID NO:1).
  • FIG. 5 provides the sequence for the mutated PPE sequence (SEQ ID NO:2).
  • FIG. 6 provides the sequence for the IRES-Signal peptide sequence (SEQ ID NO:3).
  • FIGS. 7 a and 7 b provide the sequence for CMV MN14 vector (SEQ ID NO:4).
  • FIGS. 8 a and 8 b provide the sequence for the CMV LL2 vector (SEQ ID NO:5).
  • FIGS. 9 a - c provide the sequence for the MMTV MN14 vector (SEQ ID NO:6).
  • FIGS. 10 a - d provide the sequence for the alpha-lactalbumin MM14 Vector (SEQ ID NO:7).
  • FIGS. 11 a - c provide the sequence for the alpha-lactalbumin Bot vector (SEQ ID NO:8).
  • FIGS. 12 a - b provide the sequence for the LSRNL vector (SEQ ID NO:9).
  • FIGS. 13 a - b provide the sequence for the alpha-lactalbumin cc49IL2 vector (SEQ ID NO:10).
  • FIGS. 14 a - c provides the sequence for the alpha-lactalbumin YP vector (SEQ ID NO:11).
  • FIG. 15 provides the sequence for the IRES-Casein signal peptide sequence (SEQ ID NO:12).
  • FIGS. 16 a - c provide the sequence for the LNBOTDC vector (SEQ ID NO:13).
  • FIGS. 17 a - d provide the sequence of a retroviral vector that expresses a G-Protein coupled receptor and antibody light chain.
  • the term “host cell” refers to any eukaryotic cell (e.g., mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
  • eukaryotic cell e.g., mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells
  • cell culture refers to any in vitro culture of cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro, including oocytes and embryos.
  • vector refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells.
  • vector includes cloning and expression vehicles, as well as viral vectors.
  • integrating vector refers to a vector whose integration or insertion into a nucleic acid (e.g., a chromosome) is accomplished via an integrase.
  • integrating vectors include, but are not limited to, retroviral vectors, transposons, and adeno associated virus vectors.
  • the term “integrated” refers to a vector that is stably inserted into the genome (i.e., into a chromosome) of a host cell.
  • the term “multiplicity of infection” or “MOI” refers to the ratio of integrating vectors:host cells used during transfection or transduction of host cells. For example, if 1,000,000 vectors are used to transduce 100,000 host cells, the multiplicity of infection is 10. The use of this term is not limited to events involving transduction, but instead encompasses introduction of a vector into a host by methods such as lipofection, microinjection, calcium phosphate precipitation, and electroporation.
  • the term “genome” refers to the genetic material (e.g., chromosomes) of an organism.
  • nucleotide sequence of interest refers to any nucleotide sequence (e.g., RNA or DNA), the manipulation of which may be deemed desirable for any reason (e.g., treat disease, confer improved qualities, expression of a protein of interest in a host cell, etc.), by one of ordinary skill in the art.
  • nucleotide sequences include, but are not limited to, coding sequences of structural genes (e.g., reporter genes, selection marker genes, oncogenes, drug resistance genes, growth factors, etc.), and non-coding regulatory sequences which do not encode an mRNA or protein product (e.g., promoter sequence, polyadenylation sequence, termination sequence, enhancer sequence, etc.).
  • protein of interest refers to a protein encoded by a nucleic acid of interest.
  • signal protein refers to a protein that is co-expressed with a protein of interest and which, when detected by a suitable assay, provides indirect evidence of expression of the protein of interest.
  • signal protein useful in the present invention include, but are not limited to, immunoglobulin heavy and light chains, beta-galactosidase, beta-lactamase, green fluorescent protein, and luciferase.
  • exogenous gene refers to a gene that is not naturally present in a host organism or cell, or is artificially introduced into a host organism or cell.
  • the term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of a polypeptide or precursor (e.g., proinsulin).
  • the polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the full-length or fragment are retained.
  • the term also encompasses the coding region of a structural gene and includes sequences located adjacent to the coding region on both the 5 40 and 3′ ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA.
  • the sequences that are located 5′ of the coding region and which are present on the mRNA are referred to as 5′ untranslated sequences.
  • the sequences that are located 3′ or downstream of the coding region and which are present on the mRNA are referred to as 3′ untranslated sequences.
  • gene encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences.”
  • Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • mRNA messenger RNA
  • RNA expression refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through “transcription” of the gene (i.e., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through “translation” of mRNA.
  • Gene expression can be regulated at many stages in the process. “Up-regulation” or “activation” refers to regulation that increases the production of gene expression products (i.e., RNA or protein), while “down-regulation” or “repression” refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up-regulation or down-regulation are often called “activators” and “repressors,” respectively.
  • amino acid sequence is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule
  • amino acid sequence and like terms, such as “polypeptide” or “protein” are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
  • nucleic acid molecule encoding refers to the order or sequence of deoxyribonucleotides or ribonucleotides along a strand of deoxyribonucleic acid or ribonucleic acid. The order of these deoxyribonucleotides or ribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA or RNA sequence thus codes for the amino acid sequence.
  • variant when used in reference to a protein, refers to proteins encoded by partially homologous nucleic acids so that the amino acid sequence of the proteins varies.
  • variant encompasses proteins encoded by homologous genes having both conservative and nonconservative amino acid substitutions that do not result in a change in protein function, as well as proteins encoded by homologous genes having amino acid substitutions that cause decreased (e.g., null mutations) protein function or increased protein function.
  • the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence “A-G-T,” is complementary to the sequence “T-C-A.”Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
  • the terms “homology” and “percent identity” when used in relation to nucleic acids refers to a degree of complementarity. There may be partial homology (i.e., partial identity) or complete homology (i.e., complete identity).
  • a partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid sequence and is referred to using the functional term “substantially homologous.” The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency.
  • a substantially homologous sequence or probe i.e., an oligonucleotide which is capable of hybridizing to another oligonucleotide of interest
  • conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
  • the absence of non-specific binding may be tested by the use of a second target which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
  • a partial degree of complementarity e.g., less than about 30% identity
  • the art knows conditions that promote hybridization under conditions of high stringency e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.).
  • substantially homologous refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
  • substantially homologous refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be “self-hybridized.”
  • T m is used in reference to the “melting temperature” of a nucleic acid.
  • the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. With “high stringency” conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of “weak” or “low” stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.
  • “High stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5 ⁇ SSPE (43.8 g/l NaCl, 6.9 g/l NaH 2 PO 4 .H 2 O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5 ⁇ Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1 ⁇ SSPE, 1.0% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
  • “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5 ⁇ SSPE (43.8 g/l NaCl, 6.9 g/l NaH 2 PO 4 .H 2 O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5 ⁇ Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0 ⁇ SSPE, 1.0% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
  • “Low stringency conditions” comprise conditions equivalent to binding or hybridization at 42° C. in a solution consisting of 5 ⁇ SSPE (43.8 g/l NaCl, 6.9 g/l NaH 2 PO 4 .H 2 O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5 ⁇ Denhardt's reagent [50 ⁇ Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5 ⁇ SSPE, 0.1% SDS at 42° C. when a probe of about 500 nucleotides in length is employed.
  • 5 ⁇ SSPE 43.8 g/l NaCl, 6.9 g/l NaH 2 PO 4 .H 2 O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH
  • a gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript.
  • cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon “A” on cDNA 1 wherein cDNA 2 contains exon “B” instead). Because the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
  • operable combination refers to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced.
  • operable order refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced.
  • selectable marker refers to a gene that encodes an enzymatic activity that confers the ability to grow in medium lacking what would otherwise be an essential nutrient (e.g. the HIS3 gene in yeast cells); in addition, a selectable marker may confer resistance to an antibiotic or drug upon the cell in which the selectable marker is expressed. Selectable markers may be “dominant”; a dominant selectable marker encodes an enzymatic activity that can be detected in any eukaryotic cell line.
  • dominant selectable markers examples include the bacterial aminoglycoside 3′ phosphotransferase gene (also referred to as the neo gene) that confers resistance to the drug G418 in mammalian cells, the bacterial hygromycin G phosphotransferase (hyg) gene that confers resistance to the antibiotic hygromycin and the bacterial xanthine-guanine phosphoribosyl transferase gene (also referred to as the gpt gene) that confers the ability to grow in the presence of mycophenolic acid.
  • Other selectable markers are not dominant in that their use must be in conjunction with a cell line that lacks the relevant enzyme activity.
  • non-dominant selectable markers include the thymidine kinase (tk) gene that is used in conjunction with tk ⁇ cell lines, the CAD gene which is used in conjunction with CAD-deficient cells and the mammalian hypoxanthine-guanine phosphoribosyl transferase (hprt) gene which is used in conjunction with hprt ⁇ cell lines.
  • tk thymidine kinase
  • CAD CAD-deficient cells
  • hprt mammalian hypoxanthine-guanine phosphoribosyl transferase
  • regulatory element refers to a genetic element which controls some aspect of the expression of nucleic acid sequences.
  • a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region.
  • Other regulatory elements are splicing signals, polyadenylation signals, termination signals, RNA export elements, internal ribosome entry sites, etc. (defined infra).
  • Transcriptional control signals in eukaryotes comprise “promoter” and “enhancer” elements. Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis et al., Science 236:1237 [1987]). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells, and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest.
  • eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review see, Voss et al., Trends Biochem. Sci., 11:287 [1986]; and Maniatis et al., supra).
  • the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been widely used for the expression of proteins in mammalian cells (Dijkema et al., EMBO J. 4:761 [1985]).
  • promoter/enhancer elements active in a broad range of mammalian cell types are those from the human elongation factor 1 ⁇ gene (Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; Kim et al., Gene 91:217 [1990]; and Mizushima and Nagata, Nuc. Acids. Res., 18:5322 [1990]) and the long terminal repeats of the Rous sarcoma virus (Gorman et al, Proc. Natl. Acad. Sci. USA 79:6777 [1982]) and the human cytomegalovirus (Boshart et al., Cell 41:521 [1985]).
  • promoter/enhancer denotes a segment of DNA which contains sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element, see above for a discussion of these functions).
  • promoter/promoter may be “endogenous” or “exogenous” or “heterologous.”
  • An “endogenous” enhancer/promoter is one which is naturally linked with a given gene in the genome.
  • an “exogenous” or “heterologous” enhancer/promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques such as cloning and recombination) such that transcription of that gene is directed by the linked enhancer/promoter.
  • Regulatory elements may be tissue specific or cell specific.
  • tissue specific refers to a regulatory element that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., liver) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue (e.g., lung).
  • Tissue specificity of a regulatory element may be evaluated by, for example, operably linking a reporter gene to a promoter sequence (which is not tissue-specific) and to the regulatory element to generate a reporter construct, introducing the reporter construct into the genome of an animal such that the reporter construct is integrated into every tissue of the resulting transgenic animal, and detecting the expression of the reporter gene (e.g., detecting mRNA, protein, or the activity of a protein encoded by the reporter gene) in different tissues of the transgenic animal.
  • the detection of a greater level of expression of the reporter gene in one or more tissues relative to the level of expression of the reporter gene in other tissues shows that the regulatory element is “specific” for the tissues in which greater levels of expression are detected.
  • tissue-specific e.g., liver-specific
  • tissue-specific does not require that one tissue have extremely high levels of expression and another tissue have no expression. It is sufficient that expression is greater in one tissue than another.
  • tissue-specific expression is meant to indicate expression in a single tissue type (e.g., liver) with no detectable expression in other tissues.
  • cell type specific refers to a regulatory element which is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue.
  • cell type specific when applied to a regulatory element also means a regulatory element capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue.
  • Cell type specificity of a regulatory element may be assessed using methods well known in the art (e.g., immunohistochemical staining and/or Northern blot analysis). Briefly, for immunohistochemical staining, tissue sections are embedded in paraffin, and paraffin sections are reacted with a primary antibody specific for the polypeptide product encoded by the nucleotide sequence of interest whose expression is regulated by the regulatory element. A labeled (e.g., peroxidase conjugated) secondary antibody specific for the primary antibody is allowed to bind to the sectioned tissue and specific binding detected (e.g., with avidin/biotin) by microscopy.
  • a labeled (e.g., peroxidase conjugated) secondary antibody specific for the primary antibody is allowed to bind to the sectioned tissue and specific binding detected (e.g., with avidin/biotin) by microscopy.
  • RNA is isolated from cells and electrophoresed on agarose gels to fractionate the RNA according to size followed by transfer of the RNA from the gel to a solid support (e.g., nitrocellulose or a nylon membrane).
  • a solid support e.g., nitrocellulose or a nylon membrane.
  • the immobilized RNA is then probed with a labeled oligo-deoxyribonucleotide probe or DNA probe to detect RNA species complementary to the probe used.
  • Northern blots are a standard tool of molecular biologists.
  • promoter refers to a DNA sequence which when ligated to a nucleotide sequence of interest is capable of controlling the transcription of the nucleotide sequence of interest into mRNA.
  • a promoter is typically, though not necessarily, located 5′ (i.e., upstream) of a nucleotide sequence of interest whose transcription into mRNA it controls, and provides a site for specific binding by RNA polymerase and other transcription factors for initiation of transcription.
  • Promoters may be constitutive or regulatable.
  • the term “constitutive” when made in reference to a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a stimulus (e.g., heat shock, chemicals, etc.).
  • a “regulatable” promoter is one which is capable of directing a level of transcription of an operably linked nucleic acid sequence in the presence of a stimulus (e.g., heat shock, chemicals, etc.) which is different from the level of transcription of the operably linked nucleic acid sequence in the absence of the stimulus.
  • Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York [1989], pp. 16.7-16.8).
  • a commonly used splice donor and acceptor site is the splice junction from the 16S RNA of SV40.
  • Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.
  • the term “poly A site” or “poly A sequence” as used herein denotes a DNA sequence that directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded.
  • the poly A signal utilized in an expression vector may be “heterologous” or “endogenous.”
  • An endogenous poly A signal is one that is found naturally at the 3′ end of the coding region of a given gene in the genome.
  • a heterologous poly A signal is one that is isolated from one gene and placed 3′ of another gene.
  • a commonly used heterologous poly A signal is the SV40 poly A signal.
  • the SV40 poly A signal is contained on a 237 bp BamHI/BclI restriction fragment and directs both termination and polyadenylation (Sambrook, supra, at 16.6-16.7).
  • Eukaryotic expression vectors may also contain “viral replicons” or “viral origins of replication.”
  • Viral replicons are viral DNA sequences that allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors.
  • Vectors that contain either the SV40 or polyoma virus origin of replication replicate to high “copy number” (up to 10 4 copies/cell) in cells that express the appropriate viral T antigen.
  • Vectors that contain the replicons from bovine papillomavirus or Epstein-Barr virus replicate extrachromosomally at “low copy number” ( ⁇ 100 copies/cell).
  • long terminal repeat of “LTR” refers to transcriptional control elements located in or isolated from the U3 region 5′ and 3′ of a retroviral genome. As is known in the art, long terminal repeats may be used as control elements in retroviral vectors, or isolated from the retroviral genome and used to control expression from other types of vectors.
  • secretion signal refers to any DNA sequence which when operably linked to a recombinant DNA sequence encodes a signal peptide which is capable of causing the secretion of the recombinant polypeptide.
  • the signal peptides comprise a series of about 15 to 30 hydrophobic amino acid residues (See, e.g., Zwizinski et al., J. Biol. Chem. 255(16): 7973-77 [1980], Gray et al., Gene 39(2): 247-54 [1985], and Martial et al., Science 205: 602-607 [1979]).
  • secretion signal sequences are preferably derived from genes encoding polypeptides secreted from the cell type targeted for tissue-specific expression (e.g., secreted milk proteins for expression in and secretion from mammary secretory cells).
  • Secretory DNA sequences are not limited to such sequences.
  • Secretory DNA sequences from proteins secreted from many cell types and organisms may also be used (e.g., the secretion signals for t-PA, serum albumin, lactoferrin, and growth hormone, and secretion signals from microbial genes encoding secreted polypeptides such as from yeast, filamentous fungi, and bacteria).
  • RNA export element or “Pre-mRNA Processing Enhancer (PPE)” refer to 3′ and 5′ cis-acting post-transcriptional regulatory elements that enhance export of RNA from the nucleus.
  • PPE elements include, but are not limited to Mertz sequences (described in U.S. Pat. Nos. 5,914,267 and 5,686,120, all of which are incorporated herein by reference) and woodchuck mRNA processing enhancer (WPRE; WO99/14310 and U.S. Pat. No. 6,136,597, each of which is incorporated herein by reference).
  • polycistronic refers to an mRNA encoding more than polypeptide chain (See, e.g., WO 93/03143, WO 88/05486, and European Pat. No. 117058, all of which are incorporated herein by reference).
  • arranged in polycistronic sequence refers to the arrangement of genes encoding two different polypeptide chains in a single mRNA.
  • internal ribosome entry site refers to a sequence located between polycistronic genes that permits the production of the expression product originating from the second gene by internal initiation of the translation of the dicistronic mRNA.
  • Examples of internal ribosome entry sites include, but are not limited to, those derived from foot and mouth disease virus (FDV), encephalomyocarditis virus, poliovirus and RDV (Scheper et al, Biochem. 76: 801-809 [1994]; Meyer et al., J. Virol. 69: 2819-2824 [1995]; Jang et al., 1988, J. Virol.
  • FDV foot and mouth disease virus
  • poliovirus poliovirus
  • Vectors incorporating IRES's may be assembled as is known in the art.
  • a retroviral vector containing a polycistronic sequence may contain the following elements in operable association: nucleotide polylinker, gene of interest, an internal ribosome entry site and a mammalian selectable marker or another gene of interest.
  • the polycistronic cassette is situated within the retroviral vector between the 5′ LTR and the 3′ LTR at a position such that transcription from the 5′ LTR promoter transcribes the polycistronic message cassette.
  • the transcription of the polycistronic message cassette may also be driven by an internal promoter (e.g., cytomegalovirus promoter) or an inducible promoter, which may be preferable depending on the use.
  • the polycistronic message cassette can further comprise a cDNA or genomic DNA (gDNA) sequence operatively associated within the polylinker.
  • Any mammalian selectable marker can be utilized as the polycistronic message cassette mammalian selectable marker.
  • Such mammalian selectable markers are well known to those of skill in the art and can include, but are not limited to, kanamycin/G418, hygromycin B or mycophenolic acid resistance markers.
  • the term “retrovirus” refers to a retroviral particle which is capable of entering a cell (i.e., the particle contains a membrane-associated protein such as an envelope protein or a viral G glycoprotein which can bind to the host cell surface and facilitate entry of the viral particle into the cytoplasm of the host cell) and integrating the retroviral genome (as a double-stranded provirus) into the genome of the host cell.
  • a membrane-associated protein such as an envelope protein or a viral G glycoprotein which can bind to the host cell surface and facilitate entry of the viral particle into the cytoplasm of the host cell
  • retroviral genome as a double-stranded provirus
  • the term “retrovirus” encompasses Oncovirinae (e.g., Moloney murine leukemia virus (MoMOLV), Moloney murine sarcoma virus (MoMSV), and Mouse mammary tumor virus (MMTV), Spumavirinae, amd Lentivirinae (e.g., Human immunodeficiency virus, Simian immunodeficiency virus, Equine infection anemia virus, and Caprine arthritis-encephalitis virus; See, e.g., U.S. Pat. Nos. 5,994,136 and 6,013,516, both of which are incorporated herein by reference).
  • Oncovirinae e.g., Moloney murine leukemia virus (MoMOLV), Moloney murine sarcoma virus (MoMSV), and Mouse mammary tumor virus (MMTV)
  • Spumavirinae e.g., Amd Lentivirinae (e.g., Human immunodeficiency
  • retroviral vector refers to a retrovirus that has been modified to express a gene of interest. Retroviral vectors can be used to transfer genes efficiently into host cells by exploiting the viral infectious process. Foreign or heterologous genes cloned (i.e., inserted using molecular biological techniques) into the retroviral genome can be delivered efficiently to host cells which are susceptible to infection by the retrovirus. Through well known genetic manipulations, the replicative capacity of the retroviral genome can be destroyed. The resulting replication-defective vectors can be used to introduce new genetic material to a cell but they are unable to replicate. A helper virus or packaging cell line can be used to permit vector particle assembly and egress from the cell.
  • retroviral vectors comprise a replication-deficient retroviral genome containing a nucleic acid sequence encoding at least one gene of interest (i.e., a polycistronic nucleic acid sequence can encode more than one gene of interest), a 5′ retroviral long terminal repeat (5′ LTR); and a 3′ retroviral long terminal repeat (3′ LTR).
  • a nucleic acid sequence encoding at least one gene of interest (i.e., a polycistronic nucleic acid sequence can encode more than one gene of interest)
  • 5′ LTR 5′ retroviral long terminal repeat
  • 3′ retroviral long terminal repeat 3′ retroviral long terminal repeat
  • the term “pseudotyped retroviral vector” refers to a retroviral vector containing a heterologous membrane protein.
  • membrane-associated protein refers to a protein (e.g., a viral envelope glycoprotein or the G proteins of viruses in the Rhabdoviridae family such as VSV, Piry, Chandipura and Mokola) which are associated with the membrane surrounding a viral particle; these membrane-associated proteins mediate the entry of the viral particle into the host cell.
  • the membrane associated protein may bind to specific cell surface protein receptors, as is the case for retroviral envelope proteins or the membrane-associated protein may interact with a phospholipid component of the plasma membrane of the host cell, as is the case for the G proteins derived from members of the Rhabdoviridae family.
  • heterologous membrane-associated protein refers to a membrane-associated protein which is derived from a virus which is not a member of the same viral class or family as that from which the nucleocapsid protein of the vector particle is derived.
  • Virtual class or family refers to the taxonomic rank of class or family, as assigned by the International Committee on Taxonomy of Viruses.
  • the term “Rhabdoviridae” refers to a family of enveloped RNA viruses that infect animals, including humans, and plants.
  • the Rhabdoviridae family encompasses the genus Vesiculovirus which includes vesicular stomatitis virus (VSV), Cocal virus, Piry virus, Chandipura virus, and Spring viremia of carp virus (sequences encoding the Spring viremia of carp virus are available under GenBank accession number U18101).
  • the G proteins of viruses in the Vesiculovirus genera are virally-encoded integral membrane proteins that form externally projecting homotrimeric spike glycoproteins complexes that are required for receptor binding and membrane fusion.
  • the G proteins of viruses in the Vesiculovirus genera have a covalently bound palmititic acid (C 16 ) moiety.
  • the amino acid sequences of the G proteins from the Vesiculoviruses are fairly well conserved.
  • the Piry virus G protein share about 38% identity and about 55% similarity with the VSV G proteins (several strains of VSV are known, e.g., Indiana, New Jersey, Orsay, San Juan, etc., and their G proteins are highly homologous).
  • the Chandipura virus G protein and the VSV G proteins share about 37% identity and 52% similarity.
  • the G proteins from non-VSV Vesiculoviruses may be used in place of the VSV G protein for the pseudotyping of viral particles.
  • the G proteins of the Lyssa viruses also share a fair degree of conservation with the VSV G proteins and function in a similar manner (e.g., mediate fusion of membranes) and therefore may be used in place of the VSV G protein for the pseudotyping of viral particles.
  • the Lyssa viruses include the Mokola virus and the Rabies viruses (several strains of Rabies virus are known and their G proteins have been cloned and sequenced).
  • the Mokola virus G protein shares stretches of homology (particularly over the extracellular and transmembrane domains) with the VSV G proteins which show about 31% identity and 48% similarity with the VSV G proteins.
  • Preferred G proteins share at least 25% identity, preferably at least 30% identity and most preferably at least 35% identity with the VSV G proteins.
  • the VSV G protein from which New Jersey strain (the sequence of this G protein is provided in GenBank accession numbers M27165 and M21557) is employed as the reference VSV G protein.
  • lentivirus vector refers to retroviral vectors derived from the Lentiviridae family (e.g., human immunodeficiency virus, simian immunodeficiency virus, equine infectious anemia virus, and caprine arthritis-encephalitis virus) that are capable of integrating into non-dividing cells (See, e.g., U.S. Pat. Nos. 5,994,136 and 6,013,516, both of which are incorporated herein by reference).
  • Lentiviridae family e.g., human immunodeficiency virus, simian immunodeficiency virus, equine infectious anemia virus, and caprine arthritis-encephalitis virus
  • lentivirus vector refers to lentivirus vector containing a heterologous membrane protein (e.g., a viral envelope glycoprotein or the G proteins of viruses in the Rhabdoviridae family such as VSV, Piry, Chandipura and Mokola).
  • a heterologous membrane protein e.g., a viral envelope glycoprotein or the G proteins of viruses in the Rhabdoviridae family such as VSV, Piry, Chandipura and Mokola.
  • transposon refers to transposable elements (e.g., Tn5, Tn7, and Tn10) that can move or transpose from one position to another in a genome. In general, the transposition is controlled by a transposase.
  • transposon vector refers to a vector encoding a nucleic acid of interest flanked by the terminal ends of transposon. Examples of transposon vectors include, but are not limited to, those described in U.S. Pat. Nos. 6,027,722; 5,958,775; 5,968,785; 5,965,443; and 5,719,055, all of which are incorporated herein by reference.
  • AAV vector refers to a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
  • AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes, but retain functional flanking ITR sequences.
  • AAV vectors can be constructed using recombinant techniques that are known in the art to include one or more heterologous nucleotide sequences flanked on both ends (5′ and 3′) with functional AAV ITRs.
  • an AAV vector can include at least one AAV ITR and a suitable promoter sequence positioned upstream of the heterologous nucleotide sequence and at least one AAV ITR positioned downstream of the heterologous sequence.
  • a “recombinant AAV vector plasmid” refers to one type of recombinant AAV vector wherein the vector comprises a plasmid.
  • 5′ and 3′ ITRs flank the selected heterologous nucleotide sequence.
  • AAV vectors can also include transcription sequences such as polyadenylation sites, as well as selectable markers or reporter genes, enhancer sequences, and other control elements which allow for the induction of transcription. Such control elements are described above.
  • AAV virion refers to a complete virus particle.
  • An AAV virion may be a wild type AAV virus particle (comprising a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid, i.e., a protein coat), or a recombinant AAV virus particle (described below).
  • single-stranded AAV nucleic acid molecules can be packaged into an AAV virion; both the sense and the antisense strands are equally infectious.
  • recombinant AAV virion or “rAAV” is defined as an infectious, replication-defective virus composed of an AAV protein shell encapsulating (i.e., surrounding with a protein coat) a heterologous nucleotide sequence, which in turn is flanked 5′ and 3′ by AV. ITRs.
  • a number of techniques for constructing recombinant AV. virions are known in the art (See, e.g., U.S. Pat. No. 5,173,414; WO 92/01070; WO 93/03769; Lebkowski et al., Molec. Cell. Biol.
  • Suitable nucleotide sequences for use in AAV vectors include any functionally relevant nucleotide sequence.
  • the AAV vectors of the present invention can comprise any desired gene that encodes a protein that is defective or missing from a target cell genome or that encodes a non-native protein having a desired biological or therapeutic effect (e.g., an antiviral function), or the sequence can correspond to a molecule having an antisense or ribozyme function.
  • Suitable genes include those used for the treatment of inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholestemia; various blood disorders including various anemias, thalasemias and hemophilia; genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc.
  • a number of antisense oligonucleotides e.g., short oligonucleotides complementary to sequences around the translational initiation site (AUG codon) of an mRNA
  • AAV ITRs adeno-associated virus inverted terminal repeats
  • flanking AAV ITRs are positioned 5′ and 3′ of one or more selected heterologous nucleotide sequences and, together with the rep coding region or the Rep expression product, provide for the integration of the selected sequences into the genome of a target cell.
  • AAV ITR regions The nucleotide sequences of AAV ITR regions are known (See, e.g., Kotin, Human Gene Therapy 5:793-801 [1994]; Bems, K. I. “Parvoviridae and their Replication” in Fundamental Virology, 2nd Edition, (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 sequence.
  • an “AAV ITR” need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides.
  • the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
  • the 5′ and 3′ ITRs which flank a selected heterologous nucleotide sequence need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for the integration of the associated heterologous sequence into the target cell genome when the rep gene is present (either on the same or on a different vector), or when the Rep expression product is present in the target cell.
  • in vitro refers to an artificial environment and to processes or reactions that occur within an artificial environment.
  • In vitro environments can consist of, but are not limited to, test tubes and cell cultures.
  • in vivo refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
  • clonally derived refers to a cell line that it derived from a single cell.
  • non-clonally derived refers to a cell line that is derived from more than one cell.
  • the term “passage” refers to the process of diluting a culture of cells that has grown to a particular density or confluency (e.g., 70% or 80% confluent), and then allowing the diluted cells to regrow to the particular density or confluency desired (e.g., by replating the cells or establishing a new roller bottle culture with the cells.
  • a particular density or confluency e.g. 70% or 80% confluent
  • stable when used in reference to genome, refers to the stable maintenance of the information content of the genome from one generation to the next, or, in the particular case of a cell line, from one passage to the next. Accordingly, a genome is considered to be stable if no gross changes occur in the genome (e.g., a gene is deleted or a chromosomal translocation occurs). The term “stable” does not exclude subtle changes that may occur to the genome such as point mutations.
  • response when used in reference to an assay, refers to the generation of a detectable signal (e.g., accumulation of reporter protein, increase in ion concentration, accumulation of a detectable chemical product).
  • a detectable signal e.g., accumulation of reporter protein, increase in ion concentration, accumulation of a detectable chemical product.
  • membrane receptor protein refers to membrane spanning proteins that bind a ligand (e.g., a hormone or neurotransmitter).
  • protein phosphorylation is a common regulatory mechanism used by cells to selectively modify proteins carrying regulatory signals from outside the cell to the nucleus.
  • the proteins that execute these biochemical modifications are a group of enzymes known as protein kinases. They may further be defined by the substrate residue that they target for phosphorylation.
  • protein kinases are the tyrosine kinases (TKs) which selectively phosphorylate a target protein on its tyrosine residues.
  • tyrosine kinases are membrane-bound receptors (RTKs), and, upon activation by a ligand, can autophosphorylate as well as modify substrates.
  • RTKs membrane-bound receptors
  • the initiation of sequential phosphorylation by ligand stimulation is a paradigm that underlies the action of such effectors as, for example, epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), and fibroblast growth factor (FGF).
  • EGF epidermal growth factor
  • PDGF platelet-derived growth factor
  • FGF fibroblast growth factor
  • the receptors for these ligands are tyrosine kinases and provide the interface between the binding of a ligand (hormone, growth factor) to a target cell and the transmission of a signal into the cell by the activation of one or more biochemical pathways.
  • Tyrosine kinases can also be cytoplasmic, non-receptor-type enzymes and act as a downstream component of a signal transduction pathway.
  • signal transduction protein refers to a proteins that are activated or otherwise effected by ligand binding to a membrane receptor protein or some other stimulus.
  • Examples of signal transduction protein include adenyl cyclase, phospholipase C, and G-proteins.
  • Many membrane receptor proteins are coupled to G-proteins (i.e., G-protein coupled receptors (GPCRs); for a review, see Neer, 1995, Cell 80:249-257 [1995]).
  • GPCRs G-protein coupled receptors
  • GPCRs G-protein coupled receptors
  • Putative GPCRs can be identified on the basis of sequence homology to known GPCRs.
  • GPCRs mediate signal transduction across a cell membrane upon the binding of a ligand to an extracellular portion of a GPCR.
  • the intracellular portion of a GPCR interacts with a G-protein to modulate signal transduction from outside to inside a cell.
  • a GPCR is therefore said to be “coupled” to a G-protein.
  • G-proteins are composed of three polypeptide subunits: an ⁇ subunit, which binds and hydrolyses GTP, and a dimeric ⁇ subunit. In the basal, inactive state, the G-protein exists as a heterotrimer of the ⁇ and ⁇ subunits.
  • GDP guanosine diphosphate
  • GTP guanine triphosphate
  • active G ⁇ subunit disassociates from both the receptor and the dimeric ⁇ subunit.
  • the disassociated, active G ⁇ subunit transduces signals to effectors that are “downstream” in the G-protein signalling pathway within the cell.
  • the G-protein's endogenous GTPase activity returns active G subunit to its inactive state, in which it is associated with GDP and the dimeric ⁇ subunit.
  • G ⁇ s Numerous members of the heterotrimeric G-protein family have been cloned, including more than 20 genes encoding various G ⁇ subunits.
  • the various G subunits have been categorized into four families, on the basis of amino acid sequences and functional homology. These four families are termed G ⁇ s , G ⁇ i , G ⁇ q , and G ⁇ 12 . Functionally, these four families differ with respect to the intracellular signaling pathways that they activate and the GPCR to which they couple.
  • GPCRs normally couple with G ⁇ s and, through G ⁇ s , these GPCRs stimulate adenylyl cyclase activity.
  • Other GPCRs normally couple with GG ⁇ q , and through GG ⁇ q , these GPCRs can activate phospholipase C (PLC), such as the ⁇ isoform of phospholipase C (i.e., PLC ⁇ , Stermweis and Smrcka, Trends in Biochem. Sci. 17:502-506 [1992]).
  • PLC phospholipase C
  • Immunoglobulin refers to proteins which bind a specific antigen. Immunoglobulins include, but are not limited to, polyclonal, monoclonal, chimeric, and humanized antibodies, Fab fragments, F(ab′)2 fragments, and includes immunoglobulins of the following classes: IgG, IgA, IgM, IgD, IbE, and secreted immunoglobulins (sIg). Immunoglobulins generally comprise two identical heavy chains ( ⁇ , ⁇ , ⁇ , ⁇ , or ⁇ ) and two light chains ( ⁇ or ⁇ ).
  • antigen binding protein refers to proteins which bind to a specific antigen.
  • Antigen binding proteins include, but are not limited to, immunoglobulins, including polyclonal, monoclonal, chimeric, and humanized antibodies; Fab fragments, F(ab′)2 fragments, and Fab expression libraries; and single chain antibodies.
  • immunoglobulins including polyclonal, monoclonal, chimeric, and humanized antibodies; Fab fragments, F(ab′)2 fragments, and Fab expression libraries; and single chain antibodies.
  • Fab fragments fragments, F(ab′)2 fragments, and Fab expression libraries
  • single chain antibodies single chain antibodies.
  • Various procedures known in the art are used for the production of polyclonal antibodies.
  • various host animals can be immunized by injection with the peptide corresponding to the desired epitope including but not limited to rabbits, mice, rats, sheep, goats, etc.
  • the peptide is conjugated to an immunogenic carrier (e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH)).
  • an immunogenic carrier e.g., diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin (KLH)
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • Various adjuvants are used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG
  • any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used (See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). These include, but are not limited to, the hybridoma technique originally developed by Köhler and Milstein (Köhler and Milstein, Nature 256:495-497 [1975]), as well as the trioma technique, the human B-cell hybridoma technique (See e.g., Kozbor et al. Immunol.
  • Antibody fragments that contain the idiotype (antigen binding region) of the antibody molecule can be generated by known techniques.
  • fragments include but are not limited to: the F(ab′)2 fragment that can be produced by pepsin digestion of an antibody molecule; the Fab′ fragments that can be generated by reducing the disulfide bridges of an F(ab′)2 fragment, and the Fab fragments that can be generated by treating an antibody molecule with papain and a reducing agent.
  • Genes encoding antigen binding proteins can be isolated by methods known in the art. In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art (e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), Western Blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays, etc.), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.) etc.
  • radioimmunoassay e.g., ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoas
  • reporter gene refers to a gene encoding a protein that may be assayed.
  • reporter genes include, but are not limited to, luciferase (See, e.g., deWet et al., Mol. Cell. Biol. 7:725 [1987] and U.S.
  • purified refers to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated.
  • An “isolated nucleic acid sequence” is therefore a purified nucleic acid sequence.
  • substantially purified molecules are at least 60% free, preferably at least 75% free, and more preferably at least 90% free from other components with which they are naturally associated.
  • the present invention provides novel regulatory sequences for use in expression vectors.
  • the present invention provides retroviral expression vectors containing novel regulatory elements.
  • the present invention provides methods for expressing proteins of interest in host cells.
  • the present invention provides methods for expressing two chains of a multisubunit protein (e.g., a heavy chain and a light chain of an immunoglobulin or the subunits of follicle stimulating hormone) in a nearly equal ratio. These methods take advantage of the novel regulatory sequences and vectors of the present invention to solve problems in the prior art.
  • the retroviral vectors of the present invention include the following elements in operable association: a) a 5′ LTR; b) a packaging signal; c) a 3′ LTR, and d) a nucleic acid encoding a protein of interest located between the 5′ and 3′ LTRs.
  • novel compositions including, but not limited to those described below are included in expression vectors in order to aid in the expression, secretion and purification of proteins of interest.
  • novel elements are described in more detail below: bovine/human hybrid alpha-lactalbumin ( ⁇ -LA) promoter (A); mutant RNA export element (B); and internal ribosome entry site (C).
  • the present invention provides a hybrid ⁇ -lactalbumin ( ⁇ -LA) promoter.
  • ⁇ -LA ⁇ -lactalbumin
  • the hybrid promoter may be constructed from portions of any two or more mammalian ⁇ -lactalbumin promoters (e.g., human, bovine, goat, sheep, rabbit, or mouse ⁇ -lactalbumin promoters among others; see, e.g., GenBank Accession numbers AF124257; AF123893; AX067504; Soulier et al., Transgenic Res. 8(1):23-31 (1999); McKee et al., Nat. Biotech. 16(7):647-51 (1998); Lubon et al., Biochem. J.
  • the portion of at least one of the promoters contributing to the hybrid is at least 50 nucleotides in length, while in preferred embodiments, the portion of at least one of the promoters contributing to the hybrid is at least 100 nucleotides in length, while in particularly preferred embodiments, the portion of at least one of the promoters contributing to the hybrid is at least 500 nucleotides length, with the portion of the at least one other promoter contributing to the hybrid being of similar or longer length.
  • the hybrid promoters can be assayed for functionality by operably linking the promoter to a reporter gene such as beta-galactosidase, green fluorescent protein, or luciferase, creating a transgenic animal such as transgenic mouse or bovine that comprises the resulting construct, and assaying various tissues of the resulting transgenic animal to determine the specificity of expression from the hybrid promoter.
  • a reporter gene such as beta-galactosidase, green fluorescent protein, or luciferase
  • expression from the hybrid promoter is substantially specific to the mammary gland, and in particular to mammary epithelial cells, with no or only trace levels of expression of in other tissues.
  • the hybrid promoter is a bovine/human hybrid ⁇ -lactalbumin ( ⁇ -LA) promoter (SEQ ID NO: 1).
  • the human portion of the promoter was derived from human genomic DNA and contains bases from +15 relative to the transcription start point to ⁇ 600 relative to the transcription start point.
  • the bovine portion is attached to the end of the human portion and corresponds to bases ⁇ 550 to ⁇ 2000 relative to the transcription start point.
  • the hybrid promoter preferably used in the present invention utilizes a region of the human promoter that contained an internal poly-adenylation signal.
  • the internal poly-adenylation signal was removed by mutation.
  • the mutation was at base 2012 and involved a change from A to T.
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is contemplated the removal of poly-adenylation signals improves retroviral RNA production by eliminating premature mRNA termination problems.
  • additional enhancer regions exist in the human, but not the bovine sequence.
  • the hybrid promoter was constructed to take advantage of these additional sequences. Likewise, the hybrid promoter contains bovine elements that may or may not be found in the human promoter.
  • the present invention comprises a mutant RNA export element (pre-mRNA processing element (PPE), Mertz sequence, or WPRE; See, e.g., U.S. Pat. Nos. 5,914,267 and 5,686,120 and PCT Publication WO99/14310, all of which are incorporated herein by reference).
  • PPE pre-mRNA processing element
  • WPRE Wideband RNA processing element
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is contemplated that the use of RNA export elements allows or facilitates high levels of expression of the protein of interest without incorporating splice signals or introns in the nucleic acid sequence encoding the protein of interest.
  • a mutated PPE element is utilized.
  • the PPE sequence is mutated to remove internal ATG sequences.
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is contemplated that the removal of internal start sequences prevents potential unwanted translation initiation.
  • bases 4, 112, 131, and 238 of SEQ ID NO: 2 were changed from a G to a T. In all cases, these changes resulted in and ATG start codon being mutated to an ATT codon.
  • the mutated PPE sequence is placed in the 5′ untranslated region (UTR) of the mRNA encoding the gene of interest. In other embodiments, the mutated PPE sequence is placed in the 3′ UTR of the mRNA encoding the gene of interest. In some preferred embodiments, two mutated PPE sequences separated by a linker are placed in a head to tail array (See e.g., SEQ ID NO:2). It has been shown that two copies of the sequence cause a more dramatic effect on mRNA export. In other embodiments, 2-20 copies of the mutated PPE sequence are placed in the mRNA encoding the gene of interest.
  • the present invention comprises an internal ribosome entry site (IRES)/signal peptide sequence (e.g., SEQ ID NOs:3 and 12).
  • IRES internal ribosome entry site
  • signal sequences include those from ⁇ -lactalbumin, casein, tissue plasminogen activator, serum albumin, lactoferrin, and lactoferrin (See, e.g., Zwizinski et al., J. Biol. Chem.
  • Such secretion signal sequences are preferably derived from genes encoding polypeptides secreted from the cell type targeted for tissue-specific expression (e.g., secreted milk proteins for expression in and secretion from mammary secretory cells).
  • Suitable IRES sequences include, but are not limited, to those derived from foot and mouth disease virus (FDV), encephalomyocarditis virus, poliovirus and RDV (Scheper et al., Biochem.
  • Functional IRES/signal peptide sequences may be identified by operably linking two genes with the sequence and an appropriate promoter, transfecting a host cell with the construct, and assaying the host cell for production the proteins encoding by the two genes. Suitable genes, vector constructs, and host cells for such screening are provided in the examples.
  • the coding sequences for the IRES and signal peptide are adjacent to one another, with no intervening coding sequences (i.e., that may be separated by noncoding sequences in some instances).
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention.
  • the IRES allows translation of the gene to start at the IRES sequence, thereby resulting in the expression of two genes of interest in the same construct.
  • the bovine ⁇ -lactalbumin signal peptide or casein signal peptide causes extracellular secretion of expressed protein products.
  • the initial ATG of the signal peptide is attached to the IRES in order to allow the most efficient translation initiation from the IRES.
  • the second codon of the signal peptide is mutated from an ATG to a GCC, changing the second amino acid of the ⁇ -lactalbumin signal peptide from a methionine to an alanine.
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is contemplated that this mutation facilitates more efficient translation initiation by the IRES.
  • the (IRES)/signal peptide is inserted into a vector between two genes of interest.
  • the (IRES)/signal peptide creates a second translation initiation site, allowing for the expression of two polypeptides from the same expression vector.
  • a single transcript is produced that encodes two different polypeptides (e.g., the heavy and light chains of an immunoglobulin).
  • the signal peptide is derived from ⁇ -lactalbumin.
  • the present invention comprises an internal ribosome entry site (IRES)/modified bovine ⁇ -S1 Casein signal peptide fusion protein (SEQ ID NO:12).
  • IRES internal ribosome entry site
  • SEQ ID NO:12 modified bovine ⁇ -S1 Casein signal peptide fusion protein
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention.
  • the IRES allows translation of the gene to start at the IRES sequence, allowing the expression of two genes of interest in the same construct.
  • the bovine ⁇ S1 casein signal peptide causes secretion of expressed protein products.
  • the second codon of the bovine ⁇ -S1 casein signal peptide is mutated from a AAA to a GCC.
  • the mutation results in the second codon of the signal peptide being changed from an alanine to a lysine.
  • the third codon of the signal peptide is mutated from a CTT to a TTG, a change which does not result and an amino acid substitution.
  • the present invention is not limited to any particular mechanism of action. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is contemplated that this mutation allows more efficient translation initiation by the IRES.
  • the present invention comprises retroviral expression vectors.
  • Retroviruses family Retroviridae
  • retroviruses are generally divided into three groups: the spumaviruses (e.g., human foamy virus); the lentiviruses (e.g., human immunodeficiency virus and sheep visna virus), and the oncoviruses (e.g., MLV and Rous sarcoma virus).
  • Retroviruses are enveloped (i.e., surrounded by a host cell-derived lipid bilayer membrane) single-stranded RNA viruses which infect animal cells.
  • a retrovirus infects a cell, its RNA genome is converted into a double-stranded linear DNA form (i.e., it is reverse transcribed).
  • the DNA form of the virus is then integrated into the host cell genome as a provirus.
  • the provirus serves as a template for the production of additional viral genomes and viral mRNAs. Mature viral particles containing two copies of genomic RNA bud from the surface of the infected cell.
  • the viral particle comprises the genomic RNA, reverse transcriptase and other pol gene products inside the viral capsid (containing the viral gag gene products) which is surrounded by a lipid bilayer membrane derived from the host cell containing the viral envelope glycoproteins (also referred to as membrane-associated proteins).
  • the gene of interest is inserted into a retroviral vector which contains the sequences necessary for the efficient expression of the gene of interest (including promoter and/or enhancer elements which may be provided by the viral long terminal repeats (LTRs) or by an internal promoter/enhancer and relevant splicing signals), sequences required for the efficient packaging of the viral RNA into infectious virions (e.g., the packaging signal (Psi), the tRNA primer binding site ( ⁇ PBS), the 3′ regulatory sequences required for reverse transcription (+PBS)) and the viral LTRs.
  • LTRs viral long terminal repeats
  • Psi packaging signal
  • ⁇ PBS tRNA primer binding site
  • (+PBS reverse transcription
  • the LTRs contain sequences required for the association of viral genomic RNA, reverse transcriptase and integrase functions, and sequences involved in directing the expression of the genomic RNA to be packaged in viral particles.
  • many recombinant retroviral vectors lack functional copies of the genes which are essential for viral replication (these essential genes are either deleted or disabled); therefore, the resulting virus is said to be “replication defective”.
  • the vector DNA is introduced into a packaging cell line.
  • Packaging cell lines provide viral proteins required in trans for the packaging of the viral genomic RNA into viral particles having the desired host range (i.e., the viral-encoded gag, pol and env proteins). The host range is controlled, in part, by the type of envelope gene product expressed on the surface of the viral particle.
  • Packaging cell lines may express ecotrophic, amphotropic or xenotropic envelope gene products.
  • the packaging cell line may lack sequences encoding a viral envelope (env) protein. In this case the packaging cell line will package the viral genome into particles lacking a membrane-associated protein (e.g., an env protein).
  • the packaging cell line containing the retroviral sequences is commonly transfected with sequences encoding a membrane-associated protein (e.g., the G protein of vesicular stomatitis virus (VSV)).
  • VSV vesicular stomatitis virus
  • the transfected packaging cell will then produce viral particles which contain the membrane-associated protein expressed by the transfected packaging cell line; these viral particles which contain viral genomic RNA derived from one virus encapsidated by the envelope proteins of another virus are said to be “pseudotyped virus particles”.
  • the retroviral vectors of the present invention can be further modified to include additional regulatory sequences.
  • the retroviral vectors of the present invention include the following elements in operable association: a) a 5′ LTR; b) a packaging signal; c) a 3′ LTR; and d) a nucleic acid encoding a protein of interest located between the 5′ and 3′ LTRs.
  • the nucleic acid of interest may be arranged in opposite orientation to the 5′ LTR when transcription from an internal promoter is desired.
  • Suitable internal promoters include, but are not limited to, the alpha-lactalbumin promoter, the CMV promoter, and the thymidine kinase promoter.
  • the vectors are modified by including a signal peptide sequence in operable association with the protein of interest.
  • the sequences of several suitable signal peptides are known in the art, including, but not limited to, those derived from tissue plasminogen activator, human growth hormone, lactoferrin, alpha S1-casein, and alpha-lactalbumin.
  • the vectors are modified by incorporating one or more of the elements described above, including, but not limited to, an RNA export element, a PPE element, and an IRES/bovine ⁇ -lactalbumin signal sequence.
  • the retroviral vectors of the present invention may further comprise a selectable marker which facilitates selection of transformed cells.
  • selectable markers known in the art find use in the present invention, including, but not limited to the bacterial aminoglycoside 3′ phosphotransferase gene (also referred to as the “neo gene”) that confers resistance to the drug G418 in mammalian cells, the bacterial hygromycin G phosphotransferase (hyg) gene that confers resistance to the antibiotic hygromycin, and the bacterial xanthine-guanine phosphoribosyl transferase gene (also referred to as the “gpt gene”) that confers the ability to grow in the presence of mycophenolic acid.
  • the selectable marker gene is provided as part of a polycistronic sequence also encoding the protein of interest.
  • the retroviral vectors may comprise recombination elements recognized by a recombination system (e.g., the cre/loxP or flp recombinase systems: See, e.g., Hoess et al., Nucleic Acids Res., 14:2287 [1986], O'Gorman et al., Science 251:1351 [1991], van Deursen et al., Proc. Natl. Acad. Sci. USA 92:7376 [1995], and U.S. Pat. No. 6,025,192, incorporated herein by reference).
  • a recombination system e.g., the cre/loxP or flp recombinase systems: See, e.g., Hoess et al., Nucleic Acids Res., 14:2287 [1986], O'Gorman et al., Science 251:1351 [1991], van Deursen et
  • the host cell can be transiently transfected (e.g., by electroporation, lipofection, or microinjection) with either a recombinase enzyme (e.g., Cre recombinase) or a nucleic acid sequence encoding the recombinase enzyme and one or more nucleic acid sequences encoding a protein of interest flanked by sequences recognized by the recombination enzyme so that the nucleic acid sequence of interest is inserted into the integrated vector.
  • a recombinase enzyme e.g., Cre recombinase
  • a nucleic acid sequence encoding the recombinase enzyme e.g., Cre recombinase
  • nucleic acid sequence encoding a protein of interest flanked by sequences recognized by the recombination enzyme
  • Viral vectors including recombinant retroviral vectors, provide a more efficient means of transferring genes into cells, as compared to other techniques such as calcium phosphate-DNA co-precipitation or DEAE-dextran-mediated transfection, electroporation or microinjection of nucleic acids. Nonetheless, the present invention is not limited to any particular mechanism. Indeed, an understanding of the mechanism is not required to practice the present invention. Nevertheless, it is believed that the efficiency of viral transfer is due in part to the fact that the transfer of nucleic acid is a receptor-mediated process (i.e., the virus binds to a specific receptor protein on the surface of the target cell). In addition, once inside a cell, the virally transferred nucleic acid integrates in controlled manner. This is in contrast to nucleic acids transferred by other means (e.g., calcium phosphate-DNA co-precipitation), which are typically subject to rearrangement and degradation.
  • other means e.g., calcium phosphate-DNA co-precipitation
  • Example 1 describes several illustrative examples of retroviral vectors of the current invention. However, it is not intended that the present invention be limited to the vectors described in Example 1. Indeed, any suitable retroviral vectors containing the novel elements of the present invention are contemplated. Furthermore, the elements described above find use in other vectors such as AAV vectors, transposon vectors, plasmids, bacterial artificial chromosomes, and yeast artificial chromosomes.
  • the vectors and regulatory elements described above find use in the expression of one or more proteins.
  • the present invention is not limited to the production of any particular protein. Indeed, the production of a wide variety of proteins is contemplated, including, but not limited to, erythropoietin, alpha-interferon, alpha-1 proteinase inhibitor, angiogenin, antithrombin III, beta-acid decarboxylase, human growth hormone, bovine growth hormone, porcine growth hormone, human serum albumin, beta-interferon, calf intestine alkaline phosphatase, cystic fibrosis transmembrane regulator, Factor VIII, Factor IX, Factor X, insulin, lactoferrin, tissue plasminogen activator, myelin basic protein, insulin, proinsulin, prolactin, hepatitis B antigen, immunoglobulins, monoclonal antibody CTLA4 Ig, Tag 72 monoclonal antibody, Tag 72 single chain
  • the vectors of the present invention are used to express more than one exogenous protein.
  • host cells may be transfected with vectors encoding different proteins of interest (e.g., cotransfection with one vector encoding a first protein of interest and a second vector encoding a second protein of interest).
  • more than one protein is expressed by arranging the nucleic acids encoding the different proteins of interest in a polycistronic sequence (e.g., bicistronic or tricistronic sequences). This arrangement is especially useful when expression of the different proteins of interest in a 1:1 molar ratio is desired (e.g., expression of the light and heavy chains of an immunoglobulin molecule).
  • proteins are expressed in cell culture.
  • retroviral vectors are used to express protein in mammalian tissue culture host cells, including, but not limited to, rat fibroblast cells, bovine kidney cells, and human kidney cells, while in some preferred embodiments, protein is expressed in bovine mammary cells.
  • the host cells are cultured according to methods known in the art; suitable culture conditions for mammalian cells are well known in the art (See e.g., J. Immunol. Methods 56:221 [1983], Animal Cell Culture: A Practical Approach 2 nd Ed., Rickwood, D. and Hames, B. D., eds. Oxford University Press, New York [1992]).
  • the present invention contemplates the transfection of a variety of host cells with integrating vectors.
  • a number of mammalian host cell lines are known in the art. In general, these host cells are capable of growth and survival when placed in either monolayer culture or in suspension culture in a medium containing the appropriate nutrients and growth factors, as is described in more detail below. Typically, the cells are capable of expressing and secreting large quantities of a particular protein of interest into the culture medium.
  • suitable mammalian host cells include, but are not limited to Chinese hamster ovary cells (CHO-K1, ATCC CC1-61); bovine mammary epithelial cells (ATCC CRL 10274; bovine mammary epithelial cells); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture; see, e.g., Graham et al., J. Gen Virol., 36:59 [1977]); baby hamster kidney cells (BHK, ATCC CCL 10); mouse sertoli cells (TM4, Mather, Biol. Reprod.
  • CHO-K1, ATCC CC1-61 Chinese hamster ovary cells
  • ATCC CRL 10274 bovine mammary epithelial cells
  • monkey kidney CV1 line transformed by SV40 COS-7, ATCC CRL 1651
  • human embryonic kidney line (293 or 293 cells subcloned for growth in
  • monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., 383:44-68 [1982]); MRC 5 cells; FS4 cells; rat fibroblasts (208F cells); MDBK cells (bovine kidney cells); and a human hepatoma line (Hep G2).
  • the present invention also contemplates the transfection of plant protoplasts with integrating vectors at a low or high multiplicity of infection.
  • the present invention contemplates a plant cell or whole plant comprising at least one integrated integrating vector, preferably a retroviral vector, and most preferably a pseudotyped retroviral vector.
  • All plants that can be produced by regeneration from protoplasts can also be transfected using the process according to the invention (e.g., cultivated plants of the genera Solanum, Nicotiana, Brassica, Beta, Pisum, Phaseolus, Glycine, Helianthus, Allium, Avena, Hordeum, Oryzae, Setaria, Secale, Sorghum, Triticum, Zea, Musa, Cocos, Cydonia, Pyrus, Malus, Phoenix, Elaeis, Rubus, Fragaria, Prunus, Arachis, Panicum, Saccharum, Coffea, Camellia, Ananas, Vitis or Citrus).
  • protoplasts are produced in accordance with conventional methods (See, e.g., U.S.
  • Plant tissue may be dispersed in an appropriate medium having an appropriate osmotic potential (e.g., 3 to 8 wt. % of a sugar polyol) and one or more polysaccharide hydrolases (e.g., pectinase, cellulase, etc.), and the cell wall degradation allowed to proceed for a sufficient time to provide protoplasts. After filtration the protoplasts may be isolated by centrifugation and may then be resuspended for subsequent treatment or use.
  • an appropriate osmotic potential e.g., 3 to 8 wt. % of a sugar polyol
  • polysaccharide hydrolases e.g., pectinase, cellulase, etc.
  • the present invention also contemplates the use of amphibian and insect host cell lines.
  • suitable insect host cell lines include, but are not limited to, mosquito cell lines (e.g., ATCC CRL-1660).
  • suitable amphibian host cell lines include, but are not limited to, toad cell lines (e.g., ATCC CCL-102).
  • the host cell cultures are prepared in a medium suitable for the particular cell being cultured.
  • Commercially available media such as Ham's F10 (Sigma, St. Louis, Mo.), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are exemplary nutrient solutions. Suitable media are also described in U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 5,122,469 and 4,560,655; and PCT Publications WO 90/03430; and WO 87/00195 (each of which are incorporated herein by reference).
  • any of these media may be supplemented as necessary, with hormones and/or other growth factors (e.g., insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium, magnesium, and phosphate), buffers (e.g., HEPES), nucleosides (e.g., adenosine and thymidine), antibiotics (e.g., gentamycin (gentamicin)), trace elements (i.e., inorganic compounds usually present at final concentrations in the micromolar range) lipids (e.g., linoleic or other fatty acids) and their suitable carriers, and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations known to those skilled in the art.
  • the osmolality of the culture medium is generally about 290-330 mOsm.
  • the present invention also contemplates the use of a variety of culture systems (e.g., petri dishes, 96 well plates, roller bottles, and bioreactors) for the growth and expression of host cells.
  • the host cells can be cultured in a perfusion system.
  • Perfusion culture refers to providing a continuous flow of culture medium through a culture maintained at high cell density. The cells are suspended and do not require a solid support upon which to grow. Generally, fresh nutrients must be supplied continuously with concomitant removal of toxic metabolites and, ideally, selective removal of dead cells. Filtering, entrapment and micro-capsulation methods are all suitable for refreshing the culture environment at sufficient rates.
  • a fed batch culture procedure is employed.
  • the mammalian host cells and culture medium are supplied to a culturing vessel initially and additional culture nutrients are fed, continuously or in discrete increments, to the culture during culturing, with or without periodic cell and/or roduct harvest before termination of culture.
  • the fed batch culture is a semi-continuous fed batch culture in which the whole culture (including cells and medium) is removed from the growth vessel and replaced by fresh medium.
  • Fed batch culture is distinguished from simple batch culture in which all components for cell culturing (including the cells and all culture nutrients) are supplied to the culturing vessel at the start of the culturing process.
  • Fed batch culture can be further distinguished from perfusion culturing insofar as the supernate is not removed from the culturing vessel during the process (in perfusion culturing, the cells are restrained in the culture ( e.g., by filtration, encapsulation, anchoring to microcarriers etc.) and the culture medium is continuously or intermittently introduced and removed from the culturing vessel).
  • the cells of the culture may be propagated according to any scheme or routine suitable for the particular host cell and the particular production plan contemplated.
  • the present invention contemplates single step, as well as multiple step culture procedures.
  • a single step culture the host cells are inoculated into a culture environment and the processes of the instant invention are employed during a single production phase of the cell culture.
  • cells are cultivated in a number of steps or phases. For instance, cells may be grown in a first step or growth phase culture wherein cells, possibly removed from storage, are inoculated into a medium suitable for promoting growth and high viability. The cells may be maintained in the growth phase for a suitable period of time by the addition of fresh medium to the host cell culture.
  • Fed batch or continuous cell culture conditions are contemplated in order to enhance growth of the mammalian cells in the growth phase of the cell culture.
  • cells are grown under conditions and for a period of time that is optimized for growth.
  • Culture conditions such as temperature, pH, dissolved oxygen (dO 2 ) and the like, are those used with the particular host and are apparent to the ordinarily skilled artisan.
  • the pH is adjusted to a level between about 6.5 and 7.5 using either an acid (e.g., CO 2 ) or a base (e.g., Na 2 CO 3 or NaOH).
  • a suitable temperature range for culturing mammalian cells e.g., CHO cells
  • a suitable dO 2 is between 5-90% of air saturation.
  • the polypeptide of interest is recovered from the culture medium using well-established techniques.
  • the protein of interest is recovered from the culture medium as a secreted polypeptide (e.g., the secretion of the protein of interest is directed by a signal peptide sequence), although it also may be recovered from host cell lysates.
  • the culture medium or lysate is centrifuged to remove particulate cell debris.
  • the polypeptide is then purified from contaminant soluble proteins and polypeptides using any suitable method.
  • Suitable purificaiton methods include, but are not limited to fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using (e.g., Sephadex G-75); and protein A Sepharose columns to remove contaminants such as IgG.
  • a protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification.
  • the protein of interest can be fused in frame to a marker sequence which allows for purification of the protein of interest.
  • Non-limiting examples of marker sequences include a hexahistidine tag which may be supplied by a vector, preferably a pQE-9 vector, and a hemagglutinin (HA) tag.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (See e.g., Wilson et al., Cell, 37:767 [1984]).
  • purification methods suitable for the polypeptide of interest may require modification to account for changes in the character of the polypeptide upon expression in recombinant cell culture.
  • the host cell utilized for expression of the protein of interest is part of a mammal.
  • the mammal is a transgenic bovine.
  • the transgenic bovine may be produced by any suitable method (See e.g., Chan et al., PNAS, 95:14028 [1998]; U.S. Pat. No. 5,741,957 (incorporated herein by reference); and Pursel et al., Science, 244:1281 [1989]).
  • the protein is expressed in the mammary gland of a bovine and secreted in the milk of the bovine.
  • proteins and signal sequences for tissue specific expression and secretion are utilized, including, but not limited to, bovine/human ⁇ -lactalbumin promoter and bovine ⁇ -lactalbumin signal sequence.
  • the protein of interest may be recovered from bovine milk using any suitable method, including but not limited to, those described above for the recovery of protein from cell cultures.
  • vectors of the present invention will find use in the production of other transgenic animals as well, including, but not limited to, mice, goats, pigs, birds and rabbits (See e.g., U.S Pat. Nos. 5,523,226; 5,453,457; 4,873,191; 4,736,866; each of which is herein incorporated by reference).
  • single vectors are utilized for the expression of two or more proteins, including individual subunits of multisubunit proteins.
  • two or more chains of an immunoglobulin e.g., one heavy chain (( ⁇ , ⁇ , ⁇ , ⁇ , or 68 ) and one light chain ( ⁇ or ⁇ )
  • IRES sequence e.g., one heavy chain (( ⁇ , ⁇ , ⁇ , ⁇ , or 68 ) and one light chain ( ⁇ or ⁇ )
  • the present invention is not limited to any particular vector. Indeed, the use of a variety of vectors is contemplated, including, but not limited to plasmids, cosmids, bacterial artificial chomosomes, yeast artificial chromosomes, adeno-associated virus vectors, and adenovirus vectors.
  • vectors include, but are not limited to, the following vectors: 1) Bacterial—pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); and 2) Eukaryotic—pWLNEO, pSV2CAT, pOG44, PXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
  • mammalian expression vectors comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5′ flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • Promoters useful in the present invention include, but are not limited to, the LTR or SV40 promoter, the E. coli lac or trp, the phage lambda P L and P R , T3 and T7 promoters, and the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionein-I promoters and other promoters known to control expression of gene in prokaryotic or eukaryotic cells or their viruses.
  • CMV cytomegalovirus
  • HSV herpes simplex virus
  • thymidine kinase thymidine kinase
  • recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance in E. coli ).
  • transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
  • Enhancers useful in the present invention include, but are not limited to, the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • retroviral vectors are used to express immunoglobulins.
  • retroviral vectors for expression of immunoglobulins contain regulatory elements.
  • two immunoglobulins chains are expressed in the same retrovirus vector construct separated by an IRES sequence.
  • the two chains are separated by an IRES/ ⁇ -LA signal sequence.
  • the vector further contains RNA export elements.
  • the RNA export element is a WPRE.
  • the PPE element is at least one Mertz sequence.
  • the PPE element is mutated to remove start signals.
  • two PPE elements are placed in a head to tail array separated by a linker.
  • expression of immunoglobulins by the vectors of the current invention is controlled by a promoter.
  • expression is controlled by a CMV promoter, while in other embodiments, expression is controlled by a MMTV promoter.
  • expression is controlled by a hybrid bovine/human ⁇ -LA promoter.
  • heavy and light chains are expressed by the vectors of the current invention of a ratio of about 0.7:1.3. In preferred embodiments, heavy and light chains are expressed and a ratio of about 0.8:1.2. In particularly preferred embodiments, heavy and light chains are expressed at a ratio of about 0.9:1.1. In still more preferred embodiments, heavy and light chains are expressed at a ratio of about 1:1. In particularly preferred embodiments, the majority (e.g., greater that 90%, preferably greater than 95%, and most preferably greater than about 99%) of the heavy and light chains are correctly assembled in a ratio of 1:1 to form a functional (e.g., able to bind an antigen) antibody.
  • a functional e.g., able to bind an antigen
  • immunoglobulins are expressed in a host cell comprising the vectors and elements described above.
  • the vectors described in Example 1 are used to express a variety of immunoglobulins in a variety of cell lines. In general, this expression led to the formation of finctional, tetrameric immunoglobulins.
  • the vectors of the present invention are also useful for expressing G-protein coupled receptors (GPCRs) and other transmembrane proteins. It is contemplated that when these proteins are expressed, they are correctly inserted into the membrane in their native conformation. Thus, GPCRs and other transmembrane proteins may be purified as part of a membrane fraction or purified from the membranes by methods known in the art.
  • GPCRs G-protein coupled receptors
  • the vectors of the present invention are useful for co-expressing a protein of interest for which there is no assay or for which assays are difficult.
  • a protein of interest and a signal protein are arranged in a polycistronic sequence.
  • an IRES sequence separates the signal protein and protein of interest (e.g., a GPCR) and the genes encoding the signal protein and protein of interest are expressed as a single transcriptional unit.
  • the present invention is not limited to any particular signal protein. Indeed, the use of a variety of signal proteins for which easy assays exist is contemplated. These signal proteins include, but are not limited to, green fluorescent protein, luciferase, beta-galactosidase, and antibody heavy or light chains.
  • the present invention provides methods for indirectly detecting the expression of protein of interest comprising providing a host cell transfected with a vector encoding a polycistronic sequence, wherein the polycistronic sequence comprises a signal protein and a protein of interest operably linked by an IRES, and culturing the host cells under conditions such that the signal protein and protein of interest are produced, wherein the presence of the signal protein indicates the presence of the protein of interest.
  • M molar
  • mM millimolar
  • ⁇ M micromolar
  • nM nanomolar
  • mol molecular weight
  • mmol millimoles
  • ⁇ mol micromoles
  • nmol nanomoles
  • gm grams
  • mg milligrams
  • ⁇ g micrograms
  • pg picograms
  • L liters
  • ml milliliters
  • ⁇ l microliters
  • cm centimeters
  • mm millimeters
  • nm nanometers
  • RNA ribonucleic acid
  • PBS phosphate buffered saline
  • g gravity
  • OD optical density
  • HEPES N-[2- ⁇ Hydroxyethyl]piperazine-N-[2-ethanesulfonic acid]
  • HBS HBS buffered saline
  • PBS phosphate buffered saline
  • SDS sodium dodecylsulfate
  • the CMV MN14 vector (SEQ ID NO:4; MN14 antibody is described in U.S. Pat. No. 5,874,540, incorporated herein by reference) comprises the following elements, arranged in 5′ to 3′ order: CMV promoter; MN14 heavy chain signal peptide, MN14 antibody heavy chain; IRES from encephalomyocarditis virus; bovine ⁇ -lactalbumin signal peptide; MN 14 antibody light chain; and 3′ MoMuLV LTR.
  • the CMV MN14 vector further comprises a 5′ MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO:7; the 5′ LTR is derived from Moloney Murine Sarcoma Virus in each of the constructs described herein, but is converted to the MoMuLV 5′ LTR when integrated).
  • This construct uses the 5′ MoMuLV LTR to control production of the neomycin phosphotransferase gene.
  • the expression of MN14 antibody is controlled by the CMV promoter.
  • the MN14 heavy chain gene and light chain gene are attached together by an IRES sequence.
  • the CMV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES.
  • Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA.
  • the mRNA expression from the LTR as well as from the CMV promoter is terminated and poly adenylated in the 3′ LTR.
  • the construct was cloned by similar methods as described in section B below.
  • the IRES sequence (SEQ ID NO:3) comprises a fusion of the IRES from the plasmid pLXIN (Clontech) and the bovine ⁇ -lactalbumin signal peptide.
  • the initial ATG of the signal peptide was attached to the IRES to allow the most efficient translation initiation from the IRES.
  • the 3′ end of the signal peptide provides a multiple cloning site allowing easy attachment of any protein of interest to create a fusion protein with the signal peptide.
  • the IRES sequence can serve as a translational enhancer as well as creating a second translation initiation site that allows two proteins to be produced from a single mRNA.
  • the IRES-bovine ⁇ -lactalbumin signal peptide was constructed as follows. The portion of the plasmid pLXIN (Clontech, Palo Alto, Calif.) containing the ECMV IRES was PCR amplified using the following primers.
  • Primer 1 (SEQ ID NO: 35):
  • Primer 2 attaches a tail corresponding to the start of the bovine ⁇ -lactalbumin signal peptide coding region to the IRES sequence.
  • the second triplet codon of the ⁇ -lactalbumin signal peptide was mutated from ATG to GCC to allow efficient translation from the IRES sequence. This mutation results in a methionine to alanine change in the protein sequence. This mutation was performed because the IRES prefers an alanine as the second amino acid in the protein chain.
  • the resulting IRES PCR product contains an EcoRI site on the 5′ end of the fragment (just downstream of Primer 1 above).
  • the ⁇ -lactalbumin signal peptide containing sequence was PCR amplified from the ⁇ -LA Signal Peptide vector construct using the following primers.
  • Primer 3 attaches a tail corresponding to the 3′ end of the IRES sequence to the ⁇ -lactalbumin signal peptide coding region.
  • the second triplet codon of the bovine ⁇ -lactalbumin signal peptide was mutated to allow efficient translation from the IRES sequence.
  • the resulting signal peptide PCR fragment contains NaeI, NcoI, EcoRV, XbaI, BglII and XhoI sites on the 3′ end.
  • the resultant product of this reaction is a spliced fragment that contains the IRES attached to the full length ⁇ -lactalbumin signal peptide.
  • the ATG encoding the start of the signal peptide is placed at the same location as the ATG encoding the start of the neomycin phosphotransferase gene found in the vector pLXIN.
  • the fragment also contains the EcoRI site on the 5′ end and Nael, NcoI, EcoRV, XbaI, BglII and XhoI sites on the 3′ end.
  • the spliced IRES/ ⁇ -lactalbumin signal peptide PCR fragment was digested with EcoRI and XhoI.
  • the ⁇ -LA Signal Peptide vector construct was also digested with EcoRI and XhoI. These two fragments were ligated together to give the pIRES construct.
  • the IRES/ ⁇ -lactalbumin signal peptide portion of the pIRES vector was sequenced and found to contain mutations in the 5′ end of the IRES. These mutations occur in a long stretch of C's and were found in all clones that were isolated.
  • pLXIN DNA was digested with EcoRI and BsmFI.
  • the 500 bp band corresponding to a portion of the IRES sequence was isolated.
  • the mutated IRES/ ⁇ -lactalbumin signal peptide construct was also digested with EcoRI and BsmFI and the mutated IRES fragment was removed.
  • the IRES fragment from pLXIN was then substituted for the IRES fragment of the mutated IRES/ ⁇ -lactalbumin signal peptide construct.
  • the IRES/ ⁇ -LA signal peptide portion of resulting plasmid was then verified by DNA sequencing.
  • the CMV LL2 (SEQ ID NO:5; LL2 antibody is described in U.S. Pat. No. 6,187,287, incorporated herein by reference) construct comprises the following elements, arranged in 5′ to 3′ order: 5° CMV promoter (Clontech), LL2 heavy chain signal peptide, LL2 antibody heavy chain; IRES from encephalomyocarditis virus; bovine ⁇ -LA signal peptide; LL2 antibody light chain; and 3′ MoMuLV LTR.
  • the CMV LL2 vector further comprises a 5′ MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO:7).
  • This construct uses the 5′ MoMuLV LTR to control production of the neomycin phosphotransferase gene.
  • the expression of LL2 antibody is controlled by the CMV promoter (Clontech).
  • the LL2 heavy chain gene and light chain gene are attached together by an IRES sequence.
  • the CMV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES.
  • Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA.
  • the mRNA expression from the LTR as well as from the CMV promoter is terminated and poly adenylated in the 3′ LTR.
  • the IRES sequence (SEQ ID NO:3) comprises a fusion of the IRES from the plasmid pLXIN (Clontech) and the bovine alpha-lactalbumin signal peptide.
  • the initial ATG of the signal peptide was attached to the IRES to allow the most efficient translation initiation from the IRES.
  • the 3′ end of the signal peptide provides a multiple cloning site allowing easy attachment of any protein of interest to create a fusion protein with the signal peptide.
  • the IRES sequence can serve as a translational enhancer as well as creating a second translation initiation site that allows two proteins to be produced from a single mRNA.
  • the LL2 light chain gene was attached to the IRES ⁇ -lactalbumin signal peptide as follows.
  • the LL2 light chain was PCR amplified from the vector pCRLL2 using the following primers.
  • the Kozak sequence of the LL2 heavy chain gene was then modified.
  • the vector pCRMN14HC was digested with XhoI and AvrII to remove about a 400 bp fragment.
  • PCR was then used to amplify the same portion of the LL2 heavy chain construct that was removed by the XhoI-AvrII digestion. This amplification also mutated the 5′ end of the gene to add a better Kozak sequence to the clone.
  • the Kozak sequence was modified to resemble the typical IgG Kozak sequence.
  • the PCR primers are shown below.
  • the PCR product was digested with XhoI and AvrII and inserted back into the previously digested plasmid backbone.
  • the “good” Kozak sequence was then added to the light chain gene.
  • the “good” Kozak LL2 heavy chain gene construct was digested with EcoRI and the heavy chain gene containing fragment was isolated.
  • the IRES ⁇ -Lactalbumin Signal Peptide LL2 light chain gene construct was also digested with EcoRI.
  • the heavy chain gene was then cloned into the EcoRI site of IRES light chain construct. This resulted in the heavy chain gene being placed at the 5′ end of the IRES sequence.
  • LNCX retroviral backbone plasmid was digested with HindIII and ClaI. Two oligonucleotide primers were produced and annealed together to create an double stranded DNA multiple cloning site. The following primers were annealed together.
  • the double chain gene fragment was ligated into the retroviral backbone gene construct.
  • the double chain gene construct created above was digested with SalI and BglII and the double chain containing fragment was isolated.
  • the retroviral expression plasmid LNC-MCS was digested with XhoI and BglII. The double chain fragment was then cloned into the LNC-MCS retroviral expression backbone.
  • RNA splicing problem in the construct was corrected.
  • the construct was digested with NsiI.
  • the resulting fragment was then partially digested with EcoRI.
  • the fragments resulting from the partial digest that were approximately 9300 base pairs in size were gel purified.
  • a linker was created to mutate the splice donor site at the 3′ end of the LL2 heavy chain gene.
  • the linker was again created by annealing two oligonucleotide primers together to form the double stranded DNA linker. The two primers used to create the linker are shown below.
  • the MMTV MN14 (SEQ ID NO:6) construct comprises the following elements, arranged in 5′ to 3′ order: 5′ MMTV promoter; double mutated PPE sequence; MN 14 antibody heavy chain; IRES from encephalomyocarditis virus; bovine ⁇ LA signal peptide MN 14 antibody light chain; WPRE sequence; and 3′ MoMuLV LTR.
  • the MMTV MN14 vector further comprises a MoMuLV LTR, MoMuLV extended viral packaging signal; neomycin phosphotransferase gene located 5′ of the MMTV promoter (these additional elements are provided in SEQ ID NO: 7).
  • This construct uses the 5′ MoMuLV LTR to control production of the neomycin phosphotransferase gene.
  • the expression of MN14 antibody is controlled by the MMTV promoter (Pharmacia).
  • the MN14 heavy chain gene and light chain gene are attached together by an IRES/bovine ⁇ -LA signal peptide sequence (SEQ ID NO: 3).
  • the MMTV promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES/bovine ⁇ -LA signal peptide sequence.
  • Ribosomes attach to the mRNA at the CAP site and at the IRES/bovine ⁇ -LA signal peptide sequence.
  • the PPE sequence is contained between the RNA CAP site and the start of the MN14 protein coding region
  • the WPRE is contained between the end of MN14 protein coding and the poly-adenylation site.
  • ATG sequences within the PPE element were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence is placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region.
  • the WPRE is isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3′ untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold.
  • the ⁇ -LA MN14 (SEQ ID NO:7) construct comprises the following elements, arranged in 5′ to 3′ order: 5′ MoMuLV LTR, MoMuLV extended viral packaging signal, neomycin phosphotransferase gene, bovine/human alpha-lactalbumin hybrid promoter, double mutated PPE element, MN14 heavy chain signal peptide, MN14 antibody heavy chain, IRES from encephalomyocarditis virus/bovine ⁇ LA signal peptide, MN14 antibody light chain, WPRE sequence; and 3′ MoMuLV LTR.
  • This construct uses the 5′ MoMuLV LTR to control production of the neomycin phosphotransferase gene.
  • the expression of MN14 antibody is controlled by the hybrid ⁇ -LA promoter (SEQ ID NO:1).
  • the MN14 heavy chain gene and light chain gene are attached 30 together by an IRES sequence/bovine ⁇ -LA signal peptide (SEQ ID NO:3).
  • the ⁇ -LA promoter drives production of a mRNA containing the heavy chain gene and the light chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both heavy and light chain protein to be produced from a single mRNA.
  • the mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region. ATG sequences within the PPE element (SEQ ID NO:2) were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence is placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region.
  • the WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3′ untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold.
  • the WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3′ LTR.
  • the bovine/human alpha-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences.
  • the human portion of the promoter is from +15 relative to transcription start point (tsp) to ⁇ 600 relative to the tsp.
  • the bovine portion is then attached to the end of the human portion and corresponds to ⁇ 550 to ⁇ 2000 relative to the tsp.
  • the hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine.
  • bovine/human ⁇ -lactalbumin promoter human genomic DNA was isolated and purified. A portion of the human ⁇ -lactalbumin promoter was PCR amplified using the following two primers:
  • Primer 1 (SEQ ID NO: 24):
  • This two primers created a NdeI site on the 5′ end of the PCR fragment and a EcoRI site on the 3′ end of the PCR fragment.
  • the human PCR fragment created using the above primers was double digested with the restriction enzymes NdeI and EcoRI.
  • the plasmid pKBaP-1 was also double digested with NdeI and EcoRI.
  • the plasmid pKBaP-1 contains the bovine ⁇ -lactalbumin 5′ flanking region attached to a multiple cloning site. This plasmid allows attachment of various genes to the bovine ⁇ -lactalbumin promoter.
  • the human fragment was ligated/substituted for the bovine fragment of the promoter that was removed from the pKBaP-1 plasmid during the double digestion.
  • the resulting plasmid was confirmed by DNA sequencing to be a hybrid of the Bovine and Human a-lactalbumin promoter/regulatory regions.
  • Attachment of the MN14 light chain gene to the IRES ⁇ -lactalbumin signal peptide was accomplished as follows.
  • the MN14 light chain was PCR amplified from the vector pCRMN14LC using the following primers.
  • Primer 1 (SEQ ID NO: 26): 5′CTACAGGTGTCCACGTCGACATCCAGCTGACCCAG 3′
  • Primer 2 (SEQ ID NO: 27): 5′ CTGCAGAATAGATCTCTAACACTCTCCCCTGTTG 3′
  • the vector pCRMN14HC was digested with XhoI and NruI to remove about a 500 bp fragment.
  • PCR was then used to amplify the same portion of the MN14 heavy chain construct that was removed by the XhoI-NruI digestion. This amplification also mutated the 5′ end of the gene to add a better Kozak sequence to the clone.
  • the Kozak sequence was modified to resemble the typical IgG Kozak sequence.
  • the PCR primers are shown below.
  • Primer 1 (SEQ ID NO: 28):
  • the PCR product was digested with XhoI and NruI and inserted back into the previously digested plasmid backbone.
  • the “good” Kozak MN14 heavy chain gene construct was digested with EcoRI and the heavy chain gene containing fragment was isolated.
  • the IRES ⁇ -Lactalbumin Signal Peptide MN14 light chain gene construct was also digested with EcoRI.
  • the heavy chain gene was then cloned into the EcoRI site of IRES light chain construct. This resulted in the heavy chain gene being placed at the 5′ end of the IRES sequence.
  • a multiple cloning site was then added to the LNCX retroviral backbone plasmid.
  • the LNCX plasmid was digested with HindIII and ClaI.
  • Two oligonucleotide primers were produced and annealed together to create an double stranded DNA multiple cloning site. The following primers were annealed together.
  • Primer 1 (SEQ ID NO: 30):
  • the double chain gene fragment was then inserted into a retroviral backbone gene construct.
  • the double chain gene construct created in step 3 was digested with SailI and BglII and the double chain containing fragment was isolated.
  • the retroviral expression plasmid LNC-MCS was digested with XhoI and BglII. The double chain fragment was then cloned into the LNC-MCS retroviral expression backbone.
  • RNA splicing problem in the construct was repaired.
  • the construct was digested with NsiI.
  • the resulting fragment was then partially digested with EcoRI.
  • the fragments resulting from the partial digest that were approximately 9300 base pairs in size, were gel purified.
  • a linker was created to mutate the splice donor site at the 3′ end of the MN14 heavy chain gene.
  • the linker was again created by annealing two oligonucleotide primers together to form the double stranded DNA linker. The two primers used to create the linker are shown below.
  • Primer 1 (SEQ ID NO: 32):
  • the mutated double chain fragment was inserted into the ⁇ -Lactalbumin expression retroviral backbone LN ⁇ -LA-Mertz-MCS.
  • the gene construct produced above was digested with BamHI and BglII and the mutated double chain gene containing fragment was isolated.
  • the LN ⁇ -LA-Mertz-MCS retroviral backbone plasmid was digested with BglII.
  • the BamHI/BglII fragment was then inserted into the retroviral backbone plasmid.
  • a WPRE element was then inserted into the gene construct.
  • the plasmid BluescriptII SK+WPRE-B11 was digested with BamHI and HincII to remove the WPRE element and the element was isolated.
  • the vector created above was digested with BglII and HpaI.
  • the WPRE fragment was ligated into the BglII and HpaI sites to create the final gene construct.
  • the ⁇ -LA Bot (SEQ ID NO:8, botulinum toxin antibody) construct comprises the following elements, arranged in 5′ to 3′ order: bovine/human alpha-lactalbumin hybrid promoter, mutated PPE element, cc49 signal peptide, botulinum toxin antibody light chain, IRES from encephalomyocarditis virus/bovine ⁇ -LA signal peptide, botulinum toxin antibody heavy chain, WPRE sequence, and 3′ MoMuLV LTR.
  • the ⁇ -LA botulinum toxin antibody vector further comprises a 5′ MoMuLV LTR, a MoMuLV extended viral packaging signal, and a neomycin phosphotransferase gene (these additional elements are provided in SEQ ID NO: 7).
  • This construct uses the 5′ MoMuLV LTR to control production of the neomycin phosphotransferase gene.
  • the expression of botulinum toxin antibody is controlled by the hybrid a-LA promoter.
  • the botulinum toxin antibody light chain gene and heavy chain gene are attached together by an IRES/bovine ⁇ -LA signal peptide sequence.
  • the bovine/human alpha-lactalbumin hybrid promoter drives production of a mRNA containing the light chain gene and the heavy chain gene attached by the IRES. Ribosomes attach to the mRNA at the CAP site and at the IRES sequence. This allows both light and heavy chain protein to be produced from a single mRNA.
  • the mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region. ATG sequences within the PPE element (SEQ ID NO:2) were mutated to prevent potential unwanted translation initiation. Two copies of this mutated sequence were used in a head to tail array. This sequence was placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region.
  • the WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the niRNA. If this sequence is included in the 3′ untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold.
  • the WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3′ LTR.
  • the bovine/human ⁇ -lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine ⁇ -lactalbumin promoter sequences.
  • the human portion of the promoter is from +15 relative to transcription start point to ⁇ 600 relative to the tsp.
  • the bovine portion is then attached to the end of the human portion and corresponds to ⁇ 550 to ⁇ 2000 relative to the tsp.
  • the hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human.
  • the LSRNL (SEQ ID NO:9) construct comprises the following elements, arranged in 5′ to 3′ order: 5′ MoMuLV LTR, MoMuLV viral packaging signal; hepatitis B surface antigen; RSV promoter; neomycin phosphotransferase gene; and 3′ MoMuLV LTR.
  • This construct uses the 5′ MoMuLV LTR to control production of the Hepatitis B surface antigen gene.
  • the expression of the neomycin phosphotransferase gene is controlled by the RSV promoter.
  • the mRNA expression from the LTR as well as from the RSV promoter is terminated and poly adenylated in the 3′ LTR.
  • the ⁇ -LA cc49IL2 (SEQ ID NO:10; the cc49 antibody is described in U.S. Pat. Nos. 5,512,443; 5,993,813; and 5,892,019; each of which is herein incorporated by reference) construct comprises the following elements, arranged in 5′ to 3′ order: 5′ bovine/human ⁇ -lactalbumin hybrid promoter; cc49-IL2 coding region; and 3′ MoMuLV LTR.
  • This gene construct expresses a fusion protein of the single chain antibody cc49 attached to Interleukin-2. Expression of the fusion protein is controlled by the bovine/human ⁇ -lactalbumin hybrid promoter.
  • the bovine/human ⁇ -lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences.
  • the human portion of the promoter is from +15 relative to transcription start point to ⁇ 600 relative to the tsp.
  • the bovine portion is then attached to the end of the human portion and corresponds to ⁇ 550 to ⁇ 2000 relative to the tsp.
  • the hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human.
  • the 3′ viral LTR provide the poly-adenylation sequence for the mRNA.
  • the ⁇ -LA YP (SEQ ID NO: 11) construct comprises the following elements, arranged in 5′ to 3′ order: 5′ bovine/human alpha-lactalbumin hybrid promoter; double mutated PPE sequence; bovine ⁇ LA signal peptide; Yersenia pestis antibody heavy chain Fab coding region; EMCV IRES/bovine ⁇ -LA signal peptide; Yersenia pestis antibody light chain Fab coding region; WPRE sequence; 3′ MoMuLV LTR.
  • This gene construct will cause the expression of Yersenia pestis mouse Fab antibody.
  • the expression of the gene construct is controlled by the bovine/human ⁇ -lactalbumin hybrid promoter.
  • the PPE sequence and the WPRE sequence aid in moving the mRNA from the nucleus to the cytoplasm.
  • the IRES sequence allows both the heavy and the light chain genes to be translated from the same mRNA.
  • the 3′ viral LTR provides the poly-adenylation sequence for the mRNA.
  • the mutated PPE sequence (SEQ ID NO:2) is contained between the RNA CAP site and the start of the MN14 protein coding region.
  • ATG sequences within the PPE element (SEQ ID NO:2) were mutated (bases 4, 112, 131, and 238 of SEQ ID NO: 2 were changed from a G to a T) to prevent potential unwanted translation initiation.
  • Two copies of this mutated sequence were used in a head to tail array. This sequence was placed just downstream of the promoter and upstream of the Kozak sequence and signal peptide-coding region.
  • the WPRE was isolated from woodchuck hepatitis virus and also aids in the export of mRNA from the nucleus and creating stability in the mRNA. If this sequence is included in the 3′ untranslated region of the RNA, level of protein expression from this RNA increases up to 10-fold.
  • the WPRE is contained between the end of MN14 protein coding and the poly-adenylation site. The mRNA expression from the LTR as well as from the bovine/human alpha-lactalbumin hybrid promoter is terminated and poly adenylated in the 3′ LTR.
  • the bovine/human alpha-lactalbumin hybrid promoter (SEQ ID NO:1) is a modular promoter/enhancer element derived from human and bovine alpha-lactalbumin promoter sequences.
  • the human portion of the promoter is from +15 relative to transcription start point to ⁇ 600 relative to the tsp.
  • the bovine portion is then attached to the end of the human portion and corresponds to ⁇ 550 to ⁇ 2000 relative to the tsp.
  • the hybrid was developed to remove poly-adenylation signals that were present in the bovine promoter and hinder retroviral RNA production. It was also developed to contain genetic control elements that are present in the human gene, but not the bovine. Likewise, the construct contains control elements present in the bovine but not in the human.
  • Examples 2-5 describe the production of pseudotyped retroviral vectors. These methods are generally applicable to the production of the vectors described above.
  • the expression of the fusogenic VSV G protein on the surface of cells results in syncytium formation and cell death. Therefore, in order to produce retroviral particles containing the VSV G protein as the membrane-associated protein a two-step approach was taken. First, stable cell lines expressing the gag and pol proteins from MoMLV at high levels were generated (e.g., 293GP SD cells). The stable cell line which expresses the gag and pol proteins produces noninfectious viral particles lacking a membrane-associated protein (e.g., an envelope protein).
  • a membrane-associated protein e.g., an envelope protein
  • the stable cell line was then co-transfected, using the calcium phosphate precipitation, with VSV-G and gene of interest plasmid DNAs.
  • the pseudotyped vector generated was used to infect 293GP SD cells to produce stably transformed cell lines.
  • Stable cell lines can be transiently transfected with a plasmid capable of directing the high level expression of the VSV G protein (see below).
  • the transiently transfected cells produce VSV G-pseudotyped retroviral vectors which can be collected from the cells over a period of 3 to 4 days before the producing cells die as a result of syncytium formation.
  • the first step in the production of VSV G-pseudotyped retroviral vectors, the generation of stable cell lines expressing the MoMLV gag and pol proteins is described below.
  • the human adenovirus Ad-5-transformed embryonal kidney cell line 293 (ATCC CRL 1573) was cotransfected with the pCMVgag-pol and the gene encoding for phleomycin.
  • pCMV gag-pol contains the MoMLV gag and pol genes under the control of the CMV promoter (pCMV gag-pol is available from the ATCC).
  • the plasmid DNA was introduced into the 293 cells using calcium phosphate co-precipitation (Graham and Van der Eb, Virol. 52:456 [1973]). Approximately 5 ⁇ 10 5 293 cells were plated into a 100 mm tissue culture plate the day before the DNA co-precipitate was added. Stable transformants were selected by growth in DMEM-high glucose medium containing 10% FCS and 10 ⁇ g/ml phleomycin (selective medium). Colonies which grew in the selective medium were screened for extracellular reverse transcriptase activity (Goff et al., J. Virol. 38:239 [1981]) and intracellular p30gag expression.
  • the presence of p30gag expression was determined by Western blotting using a goat-anti p30 antibody (NCI antiserum 77S000087).
  • a clone which exhibited stable expression of the retroviral genes was selected. This clone was named 293GP SD (293 gag-pol-San Diego).
  • VSV G protein pseudotyped retrovirus In order to produce VSV G protein pseudotyped retrovirus the following steps were taken.
  • the 293GP SD cell line was co-transfected with VSV-G plasmid and DNA plasmid of interest. This co-transfection generates the infectious particles used to infect 293 GP SD cells to generate the packaging cell lines.
  • This Example describes the production of pseudotyped LNBOTDC virus. This general method may be used to produce any of the vectors described in Example 1.
  • the packaging cell line, 293GP SD was grown in alpha-MEM-high glucose medium containing 10% FCS
  • the titer of the pseudo-typed virus may be determined using either 208F cells (Quade, Virol. 98:461 [1979]) or NIH/3T3 cells (ATCC CRL 1658); 208F and NIH/3T3 cells are grown in DMEM-high glucose medium containing 10% CS.
  • the plasmid LNBOTDC contains the gene encoding BOTD under the transcriptional control of cytomegalovirus intermediate-early promoter followed by the gene encoding neomycin phosphotransferase (Neo) under the transcriptional control of the LTR promoter.
  • the plasmid pHCMV-G contains the VSV G gene under the transcriptional control of the human cytomegalovirus intermediate-early promoter (Yee et al., Meth. Cell Biol. 43:99 [1994]).
  • LNBOTDC DNA (SEQ ID NO: 13) was co-transfected with pHCMV-G DNA into the packaging line 293GP SD to produce LNBOTDC virus. The resulting LNBOTDC virus was then used to infect 293GP SD cells to transform the cells. The procedure for producing pseudotyped LNBOTDC virus was carried out as described (Yee et al., Meth. Cell Biol. 43:99 [1994].
  • the CMV regulatory sequences control the expression of the botulinum toxin antibody heavy and light chain genes.
  • the IRES sequence allows both the heavy and the light chain genes to be translated from the same mRNA.
  • the 3′ viral LTR provides the poly-adenylation sequence for the mRNA.
  • Both heavy and light chain protein for botulinum toxin antibody are produced from this signal mRNA.
  • the heavy and light chain proteins also appear to be formed in an equal molar ratio to each other.
  • Polybrene was added to the medium following addition to cells.
  • the virus containing medium was allowed to remain on the 293GP SD cells for 24 hours. Following the 16 hour infection period (on day 5), the medium was removed from the 293GP SD cells and was replaced with fresh medium containing 400 ⁇ g/ml G418 (GIBCO/BRL). The medium was changed approximately every 3 days until G418-resistant colonies appeared approximately two weeks later.
  • the G418-resistant 293 colonies were plated as single cells in 96 wells. Sixty to one hundred G418-resistant colonies were screened for the expression of the BOTDC antibody in order to identify high producing clones. The top 10 clones in 96-well plates were transferred 6-well plates and allowed to grow to confluency.
  • the top 10 clones were then expanded to screen for high titer production. Based on protein expression and titer production, 5 clonal cell lines were selected. One line was designated the master cell bank and the other 4 as backup cell lines. Pseudotyped vector was generated as follows. Approximately 1 ⁇ 10 6 293GP SD /LNBOTDC cells were placed into a 75 cm 2 tissue culture flask. Twenty-four hours later, the cells were transfected with 25 ⁇ g of pHCMV-G plasmid DNA using calcium phosphate co-precipitation. Six to eight hours after the calcium-DNA precipitate was applied to the cells, the DNA solution was replaced with fresh culture medium (lacking G41 8).
  • the pseudotyped LNBOTDC virus generated from the transfected 293GP SD /LNBOTDC cells can be collected at least once a day between 24 and 96 hr after transfection.
  • the highest virus titer was generated approximately 48 to 72 hr after initial pHCMV-G transfection. While syncytium formation became visible about 48 hr after transfection in the majority of the transfected cells, the cells continued to generate pseudotyped virus for at least an additional 48 hr as long as the cells remained attached to the tissue culture plate.
  • the collected culture medium containing the VSV G-pseudotyped LNBOTDC virus was pooled, filtered through a 0.45 ⁇ m filter and stored at ⁇ 80° C. or concentrated immediately and then stored at ⁇ 80° C.
  • the titer of the VSV G-pseudotyped LNBOTDC virus was then determined as follows. Approximately 5 ⁇ 10 4 rat 208F fibroblasts cells were plated into 6 well plates. Twenty-fours hours after plating, the cells were infected with serial dilutions of the LNBOTDC virus-containing culture medium in the presence of 8 ⁇ g/ml polybrene. Twenty four hours after infection with virus, the medium was replaced with fresh medium containing 400 ⁇ g/ml G418 and selection was continued for 14 days until G418-resistant colonies became visible. Viral titers were typically about 0.5 to 5.0 ⁇ 10 6 colony forming units (cfu)/ml. The titer of the virus stock could be concentrated to a titer of greater than 10 9 cfu/ml as described below.
  • VSV G-pseudotyped LNBOTDC viruses were concentrated to a high titer by one cycle of ultracentrifugation. However, two cycles can be performed for further concentration.
  • the frozen culture medium collected as described in Example 2 which contained pseudotyped LNBOTDC virus was thawed in a 37° C. water bath and was then transferred to Oakridge centrifuge tubes (50 ml Oakridge tubes with sealing caps, Nalge Nunc International) previously sterilized by autoclaving. The virus was sedimented in a JA20 rotor (Beckman) at 48,000 ⁇ g (20,000 rpm) at 4° C. for 120 min.
  • the culture medium was then removed from the tubes in a biosafety hood and the media remaining in the tubes was aspirated to remove the supernatent.
  • the virus pellet was resuspended to 0.5 to 1% of the original volume of culture medium DMEM.
  • the resuspended virus pellet was incubated overnight at 4° C. without swirling.
  • the virus pellet could be dispersed with gentle pipetting after the overnight incubation without significant loss of infectious virus.
  • the titer of the virus stock was routinely increased 100- to 300-fold after one round of ultracentrifugation. The efficiency of recovery of infectious virus varied between 30 and 100%.
  • the virus stock was then subjected to low speed centrifugation in a microfuge for 5 min at 4° C. to remove any visible cell debris or aggregated virions that were not resuspended under the above conditions. It was noted that if the virus stock is not to be used for injection into oocytes or embryos, this centrifugation step may be omitted.
  • the virus stock can be subjected to another round of ultracentrifugation to further concentrate the virus stock.
  • the resuspended virus from the first round of centrifugation is pooled and pelleted by a second round of ultracentrifugation which is performed as described above.
  • Viral titers are increased approximately 2000-fold after the second round of ultracentrifugation (titers of the pseudotyped LNBOTDC virus are typically greater than or equal to 1 ⁇ 10 9 cfu/ml after the second round of ultracentrifugation).
  • the titers of the pre- and post-centrifugation fluids were determined by infection of 208F cells (NIH 3T3 or bovine mammary epithelial cells can also be employed) followed by selection of G418-resistant colonies as described above in Example 2.
  • the concentrated pseudotyped retroviruses were resuspended in 0.1 ⁇ HBS (2.5 mM HEPES, pH 7.12, 14 mM NaCl, 75 ⁇ M Na 2 HPO 4 -H 2 O) and 18 pl aliquots were placed in 0.5 ml vials (Eppendorf) and stored at ⁇ 80° C. until used.
  • the titer of the concentrated vector was determined by diluting 1 ⁇ l of the concentrated virus 10 ⁇ 7 - or 10 ⁇ 8 -fold with 0.1 ⁇ HBS.
  • the diluted virus solution was then used to infect 208F and bovine mammary epithelial cells and viral titers were determined as described in Example 2.
  • This Example describes the production of antibody MN14 from cells transfected with a high number of integrating vectors.
  • Pseudotyped vector were made from the packaging cell lines for the following vectors: CMV MN14, ⁇ -LA MN14, and MMTV MN14.
  • Rat fibroblasts 208F cells
  • MDBK cells bovine kidney cells
  • bovine mammary epithelial cells were transfected at a multiplicity of infection of 1000.
  • One thousand cells were plated in a T25 flask and 10 6 colony forming units (CFU's) of vector in 3 ml media was incubated with the cells. The duration of the infection was 24 hr, followed by a media change. Following transfection, the cells were allowed to grow and become confluent.
  • the cell lines were grown to confluency in T25 flasks and 5 ml of media was changed daily. The media was assayed daily for the presence of MN14. All of the MN14 produced is active (an ELISA to detect human IgG gave the exact same values as the CEA binding ELISA) and Western blotting has shown that the heavy and light chains are produced at a ratio that appears to be a 1:1 ratio. In addition, a non-denaturing Western blot indicated that what appeared to be 100% of the antibody complexes were correctly formed (See FIG.
  • Lane 1 Lane 1, 85 ng control Mn14; Lane 2, bovine mammary cell line, ⁇ -LA promoter; Lane 3, bovine mammary cell line, CMV promoter; Lane 4, bovine kidney cell line, ⁇ -LA promoter; Lane 5, bovine kidney cell line, CMV promoter; Lane 6, 208 cell line, ⁇ -LA promoter; Lane 7, 208 cell line, CMV promoter)).
  • FIG. 2 is a graph showing the production of MN14 over time for four cell lines.
  • the Y axis shows MN14 production in ng/ml of media.
  • the X-axis shows the day of media collection for the experiment.
  • Four sets of data are shown on the graph.
  • the comparisons are between the CMV and ⁇ -LA promoter and between the 208 cells and the bovine mammary cells.
  • the bovine mammary cell line exhibited the highest expression, followed by the 208F cells and MDBK cells.
  • the CMV driven construct demonstrated the highest level of expression, followed by the ⁇ -LA driven gene construct and the MMTV construct.
  • the level of daily production of the CMV construct was 4.5 ⁇ g/ml of media (22.5 mg/day in a T25 flask). The level of expression subsequently increased slowly to 40 ⁇ g/day as the cells became very densely confluent over the subsequent week.
  • 2.7 L of media from an ⁇ -lac-MN14 packaging cell line was processed by affinity chromatography to produce a purified stock of MN14.
  • FIG. 3 is a western blot of a 15% SDS-PAGE gel run under denaturing conditions in order to separate the heavy and light chains of the MN14 antibody.
  • Lane 1 shows MN14 from bovine mammary cell line, hybrid ⁇ -LA promoter;
  • lane 2 shows MN14 from bovine mammary cell line, CMV promoter;
  • lane 3 shows MN14 from bovine kidney cell line, hybrid ⁇ LA promoter;
  • lane 4 shows MN14 from bovine kidney cell line, CMV promoter;
  • lane 5 shows MN14 from rat fibroblast cell line, hybrid ⁇ -LA promoter;
  • lane 6 shows MN14 from rat fibroblast, CMV promoter.
  • the results show that the heavy and light chains are produced in a ratio of approximately 1:1.
  • This Example describes the quantitation of the amount of protein produced per cell in cell cultures produced according to the invention.
  • Various cells 208F cells, MDBK cells, and bovine mammary cells
  • Various cells 208F cells, MDBK cells, and bovine mammary cells
  • Three different vectors were used to infect the three cells types (CMV-MN14, MMTV-MN14, and ⁇ -LA-MN14) at an MOI of 1000 (titers: 2.8 ⁇ 10 6 , 4.9 ⁇ 10 6 , and 4.3 ⁇ 10 6 , respectively).
  • Media was collected approximately every 24 hours from all cells. Following one month of media collection, the 208F and MDBK cells were discarded due to poor health and low MN14 expression.
  • the cells were passaged to T25 flasks and collection of media from the bovine mammary cells was continued for approximately 2 months with continued expression of MN14. After two months in T25 flasks, the cells with CMV promoters were producing 22.5 pg/cell/day and the cells with ⁇ LA promoters were producing 2.5 pg MN14/cell/day.
  • roller bottles (850 cm 2 ) were seeded to scale-up production and to determine if MN14 expression was stable following multiple passages.
  • Two roller bottles were seeded with bovine mammary cells expressing MN14 from a CMV promoter and two roller bottles were seeded with bovine mammary cells expressing MN14 from the ⁇ -LA promoter.
  • the cultures reached confluency after approximately two weeks and continue to express MN14.
  • Roller bottle expression is shown in Table 1 below.
  • This Example demonstrates the expression of antibody LL2 by bovine mammary cells and 293 human kidney fibroblast cells.
  • Bovine mammary cells were infected with vector CMV LL2 (7.85 ⁇ 10 7 CFU/ml) at MOI's of 1000 and 10,000 and plated in 25cm 2 culture dishes. None of the cells survived transfection at the MOI of 10,000. At 20% confluency, 250 ng/ml of LL2 was present in the media. Active LL2 antibody was produced by both cell types. Non-denaturing and denaturing western analysis demonstrated that all the antibody produced is active and correctly assembled in approximately a 1:1 ratio of heavy:light chain.
  • This Example demonstrates the expression of botulinum toxin antibody in bovine mammary cells.
  • Bovine mammary cells were infected with vector ⁇ -LA Bot (2.2 ⁇ 10 2 CFU/ml) and plated in 25 cm 2 culture dishes. At 100% confluency, 6 ng/ml of botulinum toxin antibody was present in the media.
  • This Example demonstrates the expression of Hepatitis B Surface Antigen antibody in bovine mammary cells.
  • Bovine mammary cells were infected with vector LSRNL (350 CFU/ml) and plated in 25 cm 2 culture dishes. At 100% confluency, 20 ng/ml of Hepatitis B Surface Antigen was present in the media.
  • This Example demonstrates the expression of cc49IL2 in bovine mammary cells and human kidney fibroblast cells.
  • Bovine mammary cells were infected with vector LSRNL (3.1 ⁇ 10 5 CFU/ml) at a MOI of 1000 and plated in 25 cm 2 culture dishes. At 100% confluency, 10 ⁇ g/ml of cc49IL2 was present in the media.
  • Human kidney fibroblast (293) cells were infected with the ⁇ -LA cc49IL2 vector. Active cc49-IL2 fusion protein was produced by the cells.
  • This Example demonstrates the production of Yersinea pestis antibody by bovine mammary epithelial cells and human kidney fibroblast cells (293 cells). Cells lines were infected with the ⁇ -LA YP vector. Both of the cell lines produced YP antibody. All of the antibody is active and the heavy and light chains are produced in a ratio approximating 1:1.
  • This Example demonstrates the expression of multiple proteins in bovine mammary cells.
  • Mammary cells producing MN14 infected with CMV-MN14 vector
  • cc49IL2 vector 3.1 ⁇ 10 5 CFU/ml
  • 1000 cells were plated in 25 cm 2 culture plates.
  • the cells expressed MN14 at 2.5 ⁇ g/ml and cc49IL2 at 5 ⁇ g/ml.
  • This Example demonstrates the expression of multiple proteins in bovine mammary cells.
  • Mammary cells producing MN14 infected with CMV-MN14 vector
  • LSNRL vector 100 CFU/ml
  • 1000 cells were plated in 25 cm 2 culture plates.
  • the cells expressed MN14 at 2.5 ⁇ g/ml and hepatitis surface antigen at 150 ng/ml.
  • This Example demonstrates the expression of multiple proteins in bovine mammary cells.
  • Mammary cells producing hepatitis B surface antigen (infected with LSRNL vector) were infected with cc49IL2 vector at an MOI of 1000, and 1000 cells were plated in 25 cm 2 culture plates. At 100% confluency, the cells expressed MN14 at 2.4 and hepatitis B surface antigen at 13.
  • This Example demonstrates the culture of transfected cells in roller bottle cultures.
  • 208F cells and bovine mammary cells were plated in 25 cm 2 culture dishes at 1000 cells/25 cm 2 .
  • LSRNL or ⁇ -LA Bot vectors were used to infect each cell line at a MOI of 1000. Following one month of culture and media collection, the 208F cells were discarded due to poor growth and plating.
  • the bovine mammary cells infected with ⁇ -LA Bot were discarded due to low protein expression.
  • the bovine mammary cells infected with LSRNL were passaged to seed roller bottles (850 cm 2 ). Approximately 20 ng/ml hepatitis type B surface antigen was produced in the roller bottle cultures.
  • This example describes the expression of a G-Protein Coupled Receptor protein (GPCR) from a retroviral vector.
  • GPCR G-Protein Coupled Receptor protein
  • This example also describes the expression of a signal protein from an IRES as a marker for expression of a difficult to assay protein or a protein that has no assay such as a GPCR.
  • the gene construct (SEQ ID NO: 34; FIG. 17) comprises a G-protein-coupled receptor followed by the IRES-signal peptide-antibody light chain cloned into the MCS of pLBCX retroviral backbone.
  • pLBCX contains the EM7 (T7) promoter, Blasticidin gene and SV40 polyA in place of the Neomycin resistance gene from pLNCX.
  • the gene construct was used to produce a replication defective retroviral packaging cell line and this cell line was used to produce replication defective retroviral vector.
  • the vector produced from this cell line was then used to infect 293GP cells (human embryonic kidney cells). After infection, the cells were placed under Blasticidin selection and single cell Blasticidin resistant clones were isolated. The clones were screened for expression of antibody light chain. The top 12 light chain expressing clones were selected. These 12 light chain expressing clones were then screened for expression of the GPCR using a ligand binding assay. All twelve of the samples also expressed the receptor protein.
  • the clonal cell lines and there expression are shown in Table 2. TABLE 2 Cell Clone Antibody Light GPCR Number Chain Expression Expression 4 + + 8 + + 13 + + 19 + + + 20 + + 22 + + 24 + + + 27 + + 30 + + + 45 + + + 46 + + 50 + + + +

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
US09/897,006 2000-07-03 2001-06-29 Expression vectors Abandoned US20020106729A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU2001270252A AU2001270252B2 (en) 2000-07-03 2001-06-29 Expression vectors
US09/897,006 US20020106729A1 (en) 2000-07-03 2001-06-29 Expression vectors
US10/947,881 US7378273B2 (en) 2000-07-03 2004-09-23 Expression vectors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US21585100P 2000-07-03 2000-07-03
US09/897,006 US20020106729A1 (en) 2000-07-03 2001-06-29 Expression vectors

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/947,881 Continuation US7378273B2 (en) 2000-07-03 2004-09-23 Expression vectors

Publications (1)

Publication Number Publication Date
US20020106729A1 true US20020106729A1 (en) 2002-08-08

Family

ID=22804662

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/897,006 Abandoned US20020106729A1 (en) 2000-07-03 2001-06-29 Expression vectors
US10/947,881 Expired - Lifetime US7378273B2 (en) 2000-07-03 2004-09-23 Expression vectors

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/947,881 Expired - Lifetime US7378273B2 (en) 2000-07-03 2004-09-23 Expression vectors

Country Status (7)

Country Link
US (2) US20020106729A1 (ja)
EP (1) EP1297168A2 (ja)
JP (1) JP4762478B2 (ja)
KR (1) KR100545945B1 (ja)
AU (2) AU2001270252B2 (ja)
CA (1) CA2413156C (ja)
WO (1) WO2002002783A2 (ja)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030224408A1 (en) * 2002-03-07 2003-12-04 Dyax Corporation Ligand screening and discovery
US7384738B2 (en) 2002-03-28 2008-06-10 Bremel Robert D Retrovirus-based genomic screening
WO2019079772A1 (en) * 2017-10-20 2019-04-25 Fred Hutchinson Cancer Research Center SYSTEMS AND METHODS FOR GENETICALLY MODIFIED B-LYMPHOCYTES FOR EXPRESSING SELECTED ANTIBODIES
US20200190524A1 (en) * 2014-04-09 2020-06-18 Dna2.0, Inc. Dna vectors, transposons and transposases for eukaryotic genome modification
US11466258B2 (en) * 2013-10-11 2022-10-11 The Schepens Eye Research Institute, Inc. Methods of predicting ancestral virus sequences and uses thereof

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100450266B1 (ko) * 2002-01-16 2004-09-30 주식회사 엘지생명과학 유전자 발현 동물세포 제조용 바이시스트로닉 벡터 및이를 포함하는 세포주 그리고 이를 이용한 항체단백질의생산방법
US20040038304A1 (en) * 2002-03-28 2004-02-26 Gala Design, Inc. Antibody libraries
CA2526120A1 (en) * 2003-06-03 2005-02-24 Cell Genesys, Inc. Compositions and methods for enhanced expression of recombinant polypeptides from a single vector using a peptide cleavage site
KR100533794B1 (ko) * 2003-10-02 2005-12-07 주식회사 프로젠 인간 난포자극 호르몬을 대량으로 생산하는 방법
JP4994241B2 (ja) * 2004-11-22 2012-08-08 ニューヨーク・ユニバーシティ 遺伝子操作されたクロストリジウム遺伝子、操作された遺伝子によりコードされるタンパク質、およびその使用
MX2007010008A (es) * 2005-02-16 2008-01-18 Lentigen Corp Vectores lentivirales y su uso.
US7632509B2 (en) * 2005-07-19 2009-12-15 Biosante Pharmaceuticals, Inc. Methods to express recombinant proteins from lentiviral vectors
EP2427577A4 (en) * 2009-05-04 2013-10-23 Hutchinson Fred Cancer Res PSEUDOTYPED RETROVIRAL VECTORS WITH COCAL VESICULOVIRUS SHELL
BR112012017243A2 (pt) * 2010-01-13 2017-09-19 Apt Therapeutics Inc constructos terapêuticos de apirase, agentes de apirase, e métodos de produção
JP6092782B2 (ja) 2010-11-16 2017-03-08 エクセリミューン, インコーポレイテッド 組換えタンパク質の製造方法
CN105288589A (zh) 2011-02-07 2016-02-03 塞勒尼斯医疗控股公司 脂蛋白复合物及其制备和用途
WO2012115980A1 (en) * 2011-02-22 2012-08-30 California Institute Of Technology Delivery of proteins using adeno-associated virus (aav) vectors
US20120220648A1 (en) * 2011-02-24 2012-08-30 National Taiwan University Hospital Method of Treating Aromatic L-Amino Acid Decarboxylase (AADC) Deficiency Using Adeno-Associated Virus (AAV)-AADC Vector
US9763999B2 (en) 2011-11-09 2017-09-19 Cedars-Sinai Medical Center Transcription factor-based generation of pacemaker cells and methods of using same
EP2914731B1 (en) 2012-11-01 2019-09-11 California Institute of Technology Reversible gene expression
JP2016513082A (ja) 2013-01-28 2016-05-12 ニューヨーク・ユニバーシティ 無毒性神経毒誘導体を用いる治療方法
CN104419685B (zh) * 2013-09-03 2017-01-11 中国检验检疫科学研究院 人α-乳清白蛋白单克隆抗体及其制备方法与应用
US10233454B2 (en) 2014-04-09 2019-03-19 Dna2.0, Inc. DNA vectors, transposons and transposases for eukaryotic genome modification
US9428767B2 (en) 2014-04-09 2016-08-30 Dna2.0, Inc. Enhanced nucleic acid constructs for eukaryotic gene expression
JP6788573B6 (ja) 2014-04-10 2020-12-16 シアトル チルドレンズ ホスピタル, ディービーエー シアトル チルドレンズ リサーチ インスティテュート メトトレキサートによる選択と組み合わせたSleeping Beautyトランスポゾンによる遺伝子改変T細胞の製造
EP3230457B1 (en) 2014-12-09 2021-06-30 New York University Clostridial neurotoxin fusion proteins, propeptide fusions, their expression, and use
AU2016306209B2 (en) 2015-08-07 2023-07-06 Seattle Children's Hospital (dba Seattle Children's Research Institute) Bispecific CAR T-cells for solid tumor targeting
EP3551197B1 (en) 2016-12-12 2023-11-22 Seattle Children's Hospital (DBA Seattle Children's Research Institute) Chimeric transcription factor variants with augmented sensitivity to drug ligand induction of transgene expression in mammalian cells
US10898585B2 (en) 2017-04-14 2021-01-26 Ptc Therapeutics .Inc. Gene therapy for AADC deficiency
CN110202840B (zh) * 2019-07-04 2024-02-02 中碳实业(珠海)有限公司 空气源智慧湿巾机

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5512421A (en) * 1991-02-19 1996-04-30 The Regents Of The University Of California Generation, concentration and efficient transfer of VSV-G pseudotyped retroviral vectors
US5665567A (en) * 1992-08-27 1997-09-09 Beiersdorf Ag Preparation of heterodimeric PDGF-AB using a bicistronic vector system in mammalian cells
US6479284B1 (en) * 1998-03-13 2002-11-12 Dana-Farber Cancer Institute, Inc. Humanized antibody and uses thereof

Family Cites Families (85)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4560655A (en) * 1982-12-16 1985-12-24 Immunex Corporation Serum-free cell culture medium and process for making same
US4657866A (en) * 1982-12-21 1987-04-14 Sudhir Kumar Serum-free, synthetic, completely chemically defined tissue culture media
CA1220733A (en) * 1982-12-27 1987-04-21 Shigeru Takahashi Method for promoting fusion of plant protoplast
US4713339A (en) 1983-01-19 1987-12-15 Genentech, Inc. Polycistronic expression vector construction
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4767704A (en) * 1983-10-07 1988-08-30 Columbia University In The City Of New York Protein-free culture medium
US5149645A (en) * 1984-06-04 1992-09-22 Rijksuniversiteit Leiden Process for introducing foreign DNA into the genome of plants
US5168062A (en) * 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
GB8516415D0 (en) 1985-06-28 1985-07-31 Celltech Ltd Culture of animal cells
US5139941A (en) * 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5583024A (en) * 1985-12-02 1996-12-10 The Regents Of The University Of California Recombinant expression of Coleoptera luciferase
US4927762A (en) * 1986-04-01 1990-05-22 Cell Enterprises, Inc. Cell culture medium with antioxidant
US4946778A (en) * 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
EP0270496B1 (de) * 1986-12-05 1993-03-17 Ciba-Geigy Ag Verbessertes Verfahren zur Transformation von pflanzlichen Protoplasten
ATE162308T1 (de) * 1987-07-15 1998-01-15 Us Health Monoklonale antikörper der zweiten generation mit bindungsspezifität für tag-72 und menschliche karzinome sowie methoden zu ihrer anwendung
US5892019A (en) * 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
US4937190A (en) * 1987-10-15 1990-06-26 Wisconsin Alumni Research Foundation Translation enhancer
US5591624A (en) * 1988-03-21 1997-01-07 Chiron Viagene, Inc. Retroviral packaging cell lines
ATE135397T1 (de) 1988-09-23 1996-03-15 Cetus Oncology Corp Zellenzuchtmedium für erhöhtes zellenwachstum, zur erhöhung der langlebigkeit und expression der produkte
US5993813A (en) * 1988-10-19 1999-11-30 The Dow Chemical Company Family of high affinity, modified antibodies for cancer treatment
US5215904A (en) * 1989-01-27 1993-06-01 Wisconsin Alumni Research Foundation Method for producing a recombinant mammal in vivo
US5225347A (en) * 1989-09-25 1993-07-06 Innovir Laboratories, Inc. Therapeutic ribozyme compositions and expression vectors
EP0497894A4 (en) * 1989-10-25 1993-03-31 The Salk Institute For Biological Studies Receptor infection assay
US5364783A (en) * 1990-05-14 1994-11-15 Massachusetts Institute Of Technology Retrovirus promoter-trap vectors
AU8200191A (en) 1990-07-09 1992-02-04 United States of America, as represented by the Secretary, U.S. Department of Commerce, The High efficiency packaging of mutant adeno-associated virus using amber suppressions
US5817491A (en) * 1990-09-21 1998-10-06 The Regents Of The University Of California VSV G pseusdotyped retroviral vectors
US5122469A (en) * 1990-10-03 1992-06-16 Genentech, Inc. Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins
US6027722A (en) * 1990-10-25 2000-02-22 Nature Technology Corporation Vectors for gene transfer
US5173414A (en) * 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
CA2111006C (en) * 1991-06-21 2008-04-08 Andrew D. Boyd A novel receptor-type tyrosine kinase and use thereof
EP1266965B1 (en) * 1991-07-25 2006-05-24 Biogen Idec Inc. Recombinant antibodies for human therapy
WO1993003143A1 (en) 1991-08-07 1993-02-18 Anderson W French Retroviral vectors containing internal ribosome entry sites
US6368862B1 (en) * 1991-08-12 2002-04-09 Fred Hutchinson Cancer Research Center Polymerase I promoter plasmid and vector constructs
US6319707B1 (en) * 1991-08-12 2001-11-20 Fred Hutchinson Cancer Research Center Board Regents Of The University Of Washington Cap-independent multicistronic retroviral vectors
CA2093659C (en) * 1991-08-13 2001-01-16 Gregory T. Bleck Dna sequence encoding bovine .alpha.-lactalbumin and methods of use
JP3534749B2 (ja) 1991-08-20 2004-06-07 アメリカ合衆国 アデノウイルスが介在する胃腸管への遺伝子の輸送
US5994074A (en) * 1991-11-18 1999-11-30 Cold Spring Harbor Laboratories Human cdc25 genes, encoded products and uses thereof
US5670113A (en) * 1991-12-20 1997-09-23 Sibia Neurosciences, Inc. Automated analysis equipment and assay method for detecting cell surface protein and/or cytoplasmic receptor function using same
GB9211539D0 (en) * 1992-06-01 1992-07-15 Ducost Eng Ltd Control of paint spraying machines and the like
MX9304769A (es) * 1992-08-05 1994-05-31 Max Planck Gesellschaft Subfamilia ptp-d de fosfatasas de la proteina tirosina.
US5589375A (en) * 1992-10-06 1996-12-31 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E. V. PTP 1D: a novel protein tyrosine phosphatase
JPH08510636A (ja) * 1993-01-20 1996-11-12 バイオトランスプラント,インコーポレイテッド 多重翻訳開始部位から多量体タンパク質を発現出来るレトロウイルスベクター
AT401526B (de) * 1993-02-10 1996-09-25 Scheirer Winfried Reagenzlösung zur stabilisierung der lumineszenz bei der luciferasemessung
US5459036A (en) * 1993-03-19 1995-10-17 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Extracellular signal-regulated kinase, sequences, and methods of production and use
US5585233A (en) * 1993-03-23 1996-12-17 Max-Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. PTP-S31: A novel protein tyrosine phosphatase
US6001581A (en) * 1993-06-04 1999-12-14 Sibia Neurosciences, Inc. Cation-based bioassay using human metabotropic glutamate receptors
US6051427A (en) * 1993-06-11 2000-04-18 Cell Genesys, Inc. Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells
US5834256A (en) * 1993-06-11 1998-11-10 Cell Genesys, Inc. Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells
AU7321294A (en) * 1993-06-30 1995-01-24 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College, The Transformed eukaryotic cells, and transposon-based transformation vectors
US5534423A (en) * 1993-10-08 1996-07-09 Regents Of The University Of Michigan Methods of increasing rates of infection by directing motion of vectors
FR2716459B1 (fr) * 1994-02-22 1996-05-10 Univ Paris Curie Système hôte-vecteur utilisable en thérapie génique.
US5677170A (en) * 1994-03-02 1997-10-14 The Johns Hopkins University In vitro transposition of artificial transposons
US6013517A (en) * 1994-05-09 2000-01-11 Chiron Corporation Crossless retroviral vectors
CA2195557C (en) * 1994-08-12 2006-10-17 Shui-On Leung Immunoconjugates and humanized antibodies specific for b-cell lymphoma and leukemia cells
US5874540A (en) * 1994-10-05 1999-02-23 Immunomedics, Inc. CDR-grafted type III anti-CEA humanized mouse monoclonal antibodies
DE4439662C2 (de) * 1994-11-07 1997-10-02 Max Planck Gesellschaft Verfahren zur Aktivitätsbestimmung von Phosphotyrosinphosphatasen und zur Identifizierung von Effektoren davon
US5843742A (en) * 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
US5518911A (en) * 1995-01-06 1996-05-21 Onyx Pharmaceuticals, Inc. Human PAK65
US5922601A (en) * 1995-01-19 1999-07-13 Biotransplant, Inc. High efficiency gene trap selection of regulated genetic loci
US5686120A (en) * 1995-05-22 1997-11-11 Wisconsin Alumni Research Foundation Pre-mRNA processing enhancer and method for intron-independent gene expression
US5721121A (en) * 1995-06-06 1998-02-24 Genentech, Inc. Mammalian cell culture process for producing a tumor necrosis factor receptor immunoglobulin chimeric protein
US6013516A (en) * 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
HU226821B1 (en) * 1995-11-20 2009-11-30 Lilly Co Eli The mesylate salt of a macrocyclic bis-indolyl-maleimide derivative, process for its preparation, use thereof and pharmaceutical compositions containing the same
US5976853A (en) * 1996-03-21 1999-11-02 New York University Medical Center Growth factor inducible serine/threonine phosphatase FIN13
US5814507A (en) * 1996-05-24 1998-09-29 Genentech, Inc. κ/μ-like protein tyrosine phosphatase, PTP λ
US5965443A (en) * 1996-09-09 1999-10-12 Wisconsin Alumni Research Foundation System for in vitro transposition
US6025192A (en) * 1996-09-20 2000-02-15 Cold Spring Harbor Laboratory Modified retroviral vectors
US6255071B1 (en) * 1996-09-20 2001-07-03 Cold Spring Harbor Laboratory Mammalian viral vectors and their uses
US5976796A (en) * 1996-10-04 1999-11-02 Loma Linda University Construction and expression of renilla luciferase and green fluorescent protein fusion genes
US6004791A (en) * 1996-11-13 1999-12-21 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Protein tyrosine phosphatase PTP20 and related products and methods
EP1484409B1 (en) * 1996-12-16 2009-04-08 Eisai R&D Management Co., Ltd. DNA-construction comprising a drug-resistance gene and a foreign gene
US5968800A (en) * 1997-02-07 1999-10-19 Merck & Co., Inc. Cyclin-dependent protein kinase
US6080912A (en) * 1997-03-20 2000-06-27 Wisconsin Alumni Research Foundation Methods for creating transgenic animals
US5876946A (en) * 1997-06-03 1999-03-02 Pharmacopeia, Inc. High-throughput assay
US6074859A (en) * 1997-07-08 2000-06-13 Kikkoman Corporation Mutant-type bioluminescent protein, and process for producing the mutant-type bioluminescent protein
WO1999005295A1 (en) * 1997-07-25 1999-02-04 Thomas Jefferson University Composition and method for targeted integration into cells
KR100228493B1 (ko) * 1997-08-30 1999-11-01 윤종용 비대칭 디지털 가입자 라인 시스템에서 송출 전력제어방법
US6136597A (en) * 1997-09-18 2000-10-24 The Salk Institute For Biological Studies RNA export element
US5994136A (en) * 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6034228A (en) * 1998-12-15 2000-03-07 Zeneca Limited Human signal transduction serine/threonine kinase
WO1999043795A1 (en) 1998-02-24 1999-09-02 Her Majesty In Right Of Canada As Represented By The Minister Of Agriculture And Agri-Food Canada Trans-somatics with gene transfer into mammary epithelial cells
JP2002519069A (ja) * 1998-07-01 2002-07-02 オーストリアン・ノルディック・バイオセラピューティクス・アーゲー レトロウイルスベクターを用いた染色体へのターゲッティングされた組込み
US6013455A (en) * 1998-10-15 2000-01-11 Incyte Pharmaceuticals, Inc. Protein kinase homologs
GB9825524D0 (en) * 1998-11-20 1999-01-13 Oxford Biomedica Ltd Vector
CA2365655A1 (en) * 1999-03-15 2000-09-21 Chiron Corporation Retrovirus producting cells utilizing a high multiplicity of transduction

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5512421A (en) * 1991-02-19 1996-04-30 The Regents Of The University Of California Generation, concentration and efficient transfer of VSV-G pseudotyped retroviral vectors
US5665567A (en) * 1992-08-27 1997-09-09 Beiersdorf Ag Preparation of heterodimeric PDGF-AB using a bicistronic vector system in mammalian cells
US6479284B1 (en) * 1998-03-13 2002-11-12 Dana-Farber Cancer Institute, Inc. Humanized antibody and uses thereof

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030224408A1 (en) * 2002-03-07 2003-12-04 Dyax Corporation Ligand screening and discovery
US7244592B2 (en) * 2002-03-07 2007-07-17 Dyax Corp. Ligand screening and discovery
US20090105083A1 (en) * 2002-03-07 2009-04-23 Dyax Corp., A Delaware Corporation Ligand Screening and Discovery
US8445410B2 (en) 2002-03-07 2013-05-21 Dyax Corp. Ligand screening and discovery
US8846579B2 (en) 2002-03-07 2014-09-30 Dyax Corp. Ligand screening and discovery
US9562902B2 (en) 2002-03-07 2017-02-07 Dyax Corp. Ligand screening and discovery
US7384738B2 (en) 2002-03-28 2008-06-10 Bremel Robert D Retrovirus-based genomic screening
US11466258B2 (en) * 2013-10-11 2022-10-11 The Schepens Eye Research Institute, Inc. Methods of predicting ancestral virus sequences and uses thereof
US20200190524A1 (en) * 2014-04-09 2020-06-18 Dna2.0, Inc. Dna vectors, transposons and transposases for eukaryotic genome modification
WO2019079772A1 (en) * 2017-10-20 2019-04-25 Fred Hutchinson Cancer Research Center SYSTEMS AND METHODS FOR GENETICALLY MODIFIED B-LYMPHOCYTES FOR EXPRESSING SELECTED ANTIBODIES
CN111479916A (zh) * 2017-10-20 2020-07-31 弗莱德哈钦森癌症研究中心 用以产生被遗传修饰来表达所选抗体的b细胞的系统和方法
US11578118B2 (en) 2017-10-20 2023-02-14 Fred Hutchinson Cancer Center Systems and methods to produce B cells genetically modified to express selected antibodies

Also Published As

Publication number Publication date
WO2002002783A3 (en) 2003-01-16
KR100545945B1 (ko) 2006-01-25
KR20030074584A (ko) 2003-09-19
AU7025201A (en) 2002-01-14
AU2001270252B2 (en) 2007-02-08
EP1297168A2 (en) 2003-04-02
CA2413156C (en) 2009-08-18
US7378273B2 (en) 2008-05-27
JP2004524807A (ja) 2004-08-19
JP4762478B2 (ja) 2011-08-31
US20050060762A1 (en) 2005-03-17
CA2413156A1 (en) 2002-01-10
WO2002002783A2 (en) 2002-01-10

Similar Documents

Publication Publication Date Title
CA2413156C (en) Expression vectors
US20030092882A1 (en) Host cells containing multiple integrating vectors
US20040235173A1 (en) Production of host cells containing multiple integrating vectors by serial transduction
CA2413151C (en) Host cells containing multiple integrating vectors
US5770428A (en) Chimeric retrovial expression vectors and particles containing a simple retroviral long terminal repeat, BLV or HIV coding regions and cis-acting regulatory sequences, and an RNA translational enhancer with internal ribsome entry site
US6808922B1 (en) Retroviral vectors comprising a functional splice donor site and a functional splice acceptor site
AU2001270252A1 (en) Expression vectors
CA2066053C (en) Recombinant retroviruses delivering vector constructs to target cells
CN106520832B (zh) 双顺反子表达载体、表达系统、制备方法及应用
JP2014110789A (ja) ウシ免疫不全ウイルス由来ベクター
US20060160220A1 (en) Retroviral vectors with introns
EP1572912B1 (en) Selection free growth of host cells containing multiple integrating vectors
CN107058387A (zh) 一种适合hek293细胞的双顺反子表达载体及其制备方法、表达系统、应用
US20050221429A1 (en) Host cells containing multiple integrating vectors comprising an amplifiable marker
US20040033604A1 (en) Recombinant lentiviral vectors pseudotyped in envelopes containing filovirus binding domains
WO2001083730A2 (en) Recombinant lentiviral vectors pseudotyped in envelopes containing filovirus binding domains
KR20230058081A (ko) 인간 IgG1의 변형된 FC 영역과 적어도 하나의 이종 항원을 포함하는 폴리펩티드를 암호화하는 핵산
AU2007214314A1 (en) Host cells containing multiple integrating vectors

Legal Events

Date Code Title Description
AS Assignment

Owner name: GALA DESIGN, LLC, WISCONSIN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BLECK, GREGORY T.;REEL/FRAME:012556/0952

Effective date: 20011016

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION