EP2968220B1 - Procédés et compositions pour améliorer la fonction cognitive - Google Patents

Procédés et compositions pour améliorer la fonction cognitive Download PDF

Info

Publication number
EP2968220B1
EP2968220B1 EP14764293.8A EP14764293A EP2968220B1 EP 2968220 B1 EP2968220 B1 EP 2968220B1 EP 14764293 A EP14764293 A EP 14764293A EP 2968220 B1 EP2968220 B1 EP 2968220B1
Authority
EP
European Patent Office
Prior art keywords
instances
pharmaceutically acceptable
cognitive impairment
acceptable salt
cognitive
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP14764293.8A
Other languages
German (de)
English (en)
Other versions
EP2968220A4 (fr
EP2968220A1 (fr
Inventor
Gardiner SMITH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agenebio Inc
Original Assignee
Agenebio Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agenebio Inc filed Critical Agenebio Inc
Publication of EP2968220A1 publication Critical patent/EP2968220A1/fr
Publication of EP2968220A4 publication Critical patent/EP2968220A4/fr
Application granted granted Critical
Publication of EP2968220B1 publication Critical patent/EP2968220B1/fr
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/4015—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having oxo groups directly attached to the heterocyclic ring, e.g. piracetam, ethosuximide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/27—Esters, e.g. nitroglycerine, selenocyanates of carbamic or thiocarbamic acids, meprobamate, carbachol, neostigmine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/662—Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the CNS disorder may be an age-related condition.
  • This disclosure relates to methods and compositions for improving cognitive function by using a combination of a synaptic vesicle protein 2A (SV2A) inhibitor and an acetylcholinesterase inhibitor (AChEI).
  • SV2A synaptic vesicle protein 2A
  • AChEI acetylcholinesterase inhibitor
  • compositions comprising SV2A inhibitors in an extended release form in combination with AChEI and their use in treating cognitive impairment associated with central nervous system (CNS) disorders in a subject in need or at risk thereof, including, without limitation, subjects having or at risk for age-related cognitive impairment, Mild Cognitive Impairment (MCI), amnestic MCI (aMCI), Age-Associated Memory Impairment (AAMI), Age Related Cognitive Decline (ARCD), dementia, Alzheimer's Disease (AD), prodromal AD, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder, amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson'
  • Cognitive ability may decline as a normal consequence of aging or as a consequence of a central nervous disorder.
  • MCI Mild Cognitive Impairment
  • AAMI Age-Associated Memory Impairment
  • ARCD Age-Related Cognitive Decline
  • Cognitive impairment is also associated with other central nervous system (CNS) disorders, such as dementia, Alzheimer's Disease(AD), prodromal AD, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder (e.g., mania), amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, and substance addiction.
  • CNS central nervous system
  • Tacrine hydrochloride (“COGNEXTM”), the first FDA approved drug for Alzheimer's disease (“AD”) is an AChEI (Cutler et al, 1993).
  • Other examples of clinically used AChEIs include galantamine (“REMINYLTM”) or rivastigmine (“EXELONTM”). These drugs, however, have shown limited success in cognitive improvement in Alzheimer's disease patients and display a use-limiting side effect profile.
  • Another AChEI, donepezil also known as “ARICEPTTM”
  • ARICEPTTM appears more effective than tacrine.
  • WO 2011/100373 A1 , WO 2011/143721 A1 , WO 2013/007698 A1 and EP 2 486 918 A2 describe combinations of active ingredients which can include SV2A inhibitors and AChE inhibitors. These combinations are described as useful for improving e.g. cognitive function, treating neurodegenerative diseases or treating neurological disorders.
  • levetiracetam in treating mild cognitive impairment is mentioned by Karakaya et al. (Current Neuropharmacology, 2013, 11: 102-108 ).
  • the use of donepezil in treating memory decline in mild cognitive impairment is described by Koide et al. (Alzheimer & Dementia, 2012, 8(4 Suppl):P370 ). None of these documents teaches a pharmaceutical composition comprising levetiracetam and donepezil for use in accordance with the present invention.
  • the present invention provides pharmaceutical compositions comprising the SV2A inhibitor levetiracetam and the AChE inhibitor donepezil, for use as set out in the appended claims. Specifically, the invention provides a pharmaceutical composition comprising:
  • a pharmaceutical composition for treating cognitive impairment or improving cognitive function in, a subject suffering from cognitive impairment associated with a CNS disorder, or at risk thereof comprising a synaptic vesicle protein 2A (SV2A) inhibitor or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof and an acetylcholinesterase inhibitor (AChEI) or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph or prodrug thereof, wherein the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is in an extended release form.
  • SV2A synaptic vesicle protein 2A
  • AChEI acetylcholinesterase inhibitor
  • the AChEI or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof are not in an extended release form. In some instances, the AChEI or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof are in an immediate release form. In some instances, the composition is in a solid form (e.g., capsule or tablet). In some instances, the composition is in a liquid form. In some instances, the composition is in a suspension form. In some instances, the composition is in an aqueous solution. In some instances, the composition is for oral administration. In some instances, the composition is in a unit dosage form. In some instances, the composition is administered once daily.
  • the extended release SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the composition does not affect the pharmacokinetics or the half-life clearance of the AChEI or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the same composition.
  • the extended release form SV2A inhibitor includes without limitation a controlled release form, a prolonged release form, a sustained release form, a delayed release form, or a slow release form.
  • the composition comprises levetiracetam or brivaracetam or seletracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an extended release form and donepezil (or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate) or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof.
  • the composition comprises levetiracetam or brivaracetam or seletracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an extended release form and donepezil (or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate) or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in a form that is not extended release.
  • the composition comprises extended release levetiracetam and immediate release donepezil.
  • the extended release levetiracetam or brivaracetam or seletracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof present in the composition does not affect the pharmacokinetics or the half-life clearance of donepezil (or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate) or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof that are present in the same composition, or in the same unit dosage form, or in the same single formulation.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in the composition is present in an amount of 0.07 - 350 mg, or 50 - 250 mg, or 3 - 50 mg.
  • the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is present in an amount less than 500 mg, less than 350 mg, less than 300 mg, less than 250 mg, less than 200 mg, less than 150 mg, less than 110 mg, less than 100 mg, less than 70 mg, less than 50 mg, less than 35 mg, less than 10 mg, less than 7 mg, less than 5 mg, less than 3 mg, less than 1 mg, less than 0.7 mg, less than 0.5 mg, less than 0.1 mg, less than 0.07 mg, or less than 0.05 mg.
  • the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, or polymorph or prodrug thereof in the composition is present in an amount of about 0.1 - 500 mg, 0.1 - 350 mg, 0.7 - 350 mg, 3 - 300 mg, 3 - 150 mg, 3 - 110 mg, 7 - 70 mg, 70 - 350 mg, 100 - 300 mg, or 125 - 250 mg.
  • the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is present in an amount of 0.1 - 10 mg, 1 - 10 mg, 2 - 10 mg, 2 - 8 mg, or 2 - 5 mg. In some instances, the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is present in an amount of less than 10 mg, less than 9 mg, less than 8 mg, less than 7 mg, less than 6 mg, less than 5 mg, less than 2 mg, less than 1 mg, or less than 0.5 mg.
  • a method for treating cognitive impairment or improving cognitive function, delaying or slowing the progression of cognitive impairment, or reducing the rate of decline of cognitive function, in a subject suffering from cognitive impairment associated with a central nervous system (CNS) disorder, or at risk thereof comprising the step of administering to said subject a composition comprising a therapeutically effective amount of an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph, or prodrug thereof in combination with a therapeutically effective amount of an AChEI or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph, or prodrug thereof, wherein the SV2A inhibitor is in extended release form.
  • the AChEI is in a form that is not extended release. In some instances, the AChEI is in an immediate release form. In some instances, the methods of this disclosure prevent or slow the progression of said cognitive impairment associated with the CNS disorder in said subject. In other instances, the methods of this disclosure alleviate, ameliorate, or slow the progression, of one or more symptoms associated with said cognitive impairment associated with the CNS disorder in said subject.
  • the SV2A inhibitor and/or the AChEI are administered at doses that are subtherapeutic as compared to the doses at which they are therapeutically effective when administered in the absence of the other.
  • the cognitive impairment associated with a CNS disorder is age-related cognitive impairment, such as Mild Cognitive Impairment (MCI), Age-Associated Memory Impairment (AAMI), Age Related Cognitive Decline (ARCD).
  • MCI Mild Cognitive Impairment
  • AAMI Age-Associated Memory Impairment
  • ARCD Age Related Cognitive Decline
  • the MCI is amnestic MCI.
  • the CNS disorder is dementia, Alzheimer's Disease(AD), prodromal AD, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder, amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, or substance addiction.
  • the subject that suffers such CNS disorder or such cognitive impairment is a human patient.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof that is useful in the methods and compositions of this disclosure include those disclosed in, for example, United States (U.S.) Patent Application 12/580,464 (Pub. No. US-2010-0099735 ), U.S. Patent Application 13/287,531 (Pub. No. US-2012-0046336 ), U.S. Patent Application 13/370,253 (Pub. No. US-2012-0214859 ), International Patent Application PCT/US2009/005647 (Pub. No. WO2010/044878 ), International Patent Application PCT/US12/24556 (Pub. No.
  • any SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof may be used in the methods and compositions of the disclosure.
  • the SV2A inhibitor is selected from the group of SV2A inhibitors referred to in International Patent Application PCT/US2009/005647 ; International Patent Application Publications WO2010/144712 ; WO2010/002869 ; WO2008/132139 ; WO2007/065595 ; WO2006/128693 ; WO2006/128692 ; WO2005/054188 ; WO2004/087658 ; WO2002/094787 ; WO2001/062726 ; U.S. Patents 7,465,549 ; 7,244,747 ; 5,334,720 ; 4,696,943 ; 4,696,942 ; U.S.
  • the SV2A inhibitor is selected from the group consisting of levetiracetam, brivaracetam, and seletracetam or derivatives or analogs or pharmaceutically acceptable salts, hydrates, solvates, or polymorphs thereof.
  • the SV2A inhibitor is levetiracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph, or prodrug thereof.
  • AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof that is useful in the methods and compositions of this disclosure include those disclosed in, for example, International Patent Applications WO2010/057088 ; WO2009/008769 ; WO2008/097546 ; WO2008/074896 ; WO2008/073452 ; WO2007/127474 ; WO2007/107846 ; WO2006/097588 ; WO2006/071274 ; WO2006/070394 ; WO2006/060082 ; WO2006/040688 ; WO2005/092009 ; WO2005/079789 ; WO2005/074535 ; WO2005/072713 ; WO 2005/042475 ; WO2005/039580 ; WO2005/027975 ; WO2004/084884 ; WO2004/080393 ; WO2004/052348 ; WO2004/037234 ; WO
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof can be administered at doses as disclosed, for example, in United States ( U.S.) Patent Application 12/580,464 (Pub. No. US-2010-0099735 ), U.S. Patent Application 13/287,531 (Pub. No. US-2012-0046336 ), U.S. Patent Application 13/370,253 (Pub. No. US-2012-0214859 ), International Patent Application PCT/US2009/005647 (Pub. No. WO2010/044878 ), International Patent Application PCT/US12/24556 (Pub. No.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is administered at a daily dose of about 0.001 mg/kg to 5 mg/kg.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is administered at a daily dose of about 0.1 to 5 mg/kg, or about 1 to 2 mg/kg, or about 0.1 to 0.2 mg/kg, or about 0.01 to 2.5 mg/kg, or about 0.1 to 2.5 mg/kg, or about 0.4 to 2.5 mg/kg, or about 0.6 to 1.8 mg/kg, or about 0.04 to 2.5 mg/kg, or about 0.06 to 1.8 mg/kg, or about 0.01 to 1 mg/kg, or about 0.001 to 1 mg/kg, or about 0.5 mg/kg to 5 mg/kg, or about 0.05 mg/kg to 0.5 mg/kg; or at a daily dose of 0.0015 - 7 mg/kg, 0.0015 - 5 mg/kg, 0.01 - 5 mg/kg, 0.05 - 4.0 mg/kg, 0.05 - 2 mg/kg, 0.05 - 1.5 mg/kg, 0.1 - 1 mg/kg, 1
  • a subtherapeutic amount of the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is used.
  • Such subtherapeutic amount may be, for example, a daily dose of less than 7 mg/kg, less than 5 mg/kg, less than 2.5 mg/kg, less than 2 mg/kg, less than 1.5 mg/kg, less than 1 mg/kg, less than 0.5 mg/kg, less than 0.1 mg/kg, less than 0.05 mg/kg, less than 0.01 mg/kg, less than 0.005 mg/kg, or less than 0.001 mg/kg, or less than 7 mg/kg, less than 6 mg/kg, less than 5 mg/kg, less than 4 mg/kg, less than 3.6 mg/kg, less than 3 mg/kg, less than 2 mg/kg, less than 1.5 mg/kg, less than 1.5 mg/kg, less than 1 mg/kg, less than 0.1 mg/kg, less than 0.05 mg/kg, less than 0.01 mg/kg, or less than 0.0015
  • the SV2A inhibitor present in the composition of this disclosure is administered at a daily dose of 0.0015 to 7 mg/kg/day (which, given a typical human subject of 70 kg, is about 0.1 - 500 mg/day).
  • Daily doses that may be used include, but are not limited to 0.0015 mg/kg, 0.002 mg/kg, 0.0025 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1 mg/kg, 1.2 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.8 mg/kg, 2.0 mg/kg, 2.2 mg/kg, 0.5
  • the levetiracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is present in the composition of this disclosure in an amount of 0.7 - 50 mg, 0.7 - 75 mg, 0.7 - 100 mg, 0.7 - 150 mg, 0.7 - 180 mg, 0.7 - 225 mg, 0.7 - 250 mg, 0.7 - 280 mg, 1.8 - 50 mg, 1.8 - 75 mg, 1.8 - 100 mg, 1.8 - 150 mg, 1.8 - 180 mg, 1.8 - 225 mg, 1.8 - 250 mg, 1.8 - 280 mg, 3.5 - 50 mg, 3.5 - 75 mg, 3.5 - 100 mg, 3.5 - 150 mg, 3.5 - 180 mg, 3.5 - 225 mg, 3.5 - 250 mg, 3.5 - 280 mg, 5 - 50 mg, 5 - 75 mg, 5 - 100 mg, 5 - 150 mg, 5 - 180 mg, 5 - 225 mg, 5
  • the SV2A inhibitor present in the composition is levetiracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof and is administered at according to one of the daily dose ranges indicated as "+" listed in Table 1 or Table 2.
  • the levetiracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is present in the composition in an amount of about 70 to 140 mg, or about 7 to 180 mg, or about 25 to 180 mg, or about 40 to 130 mg, or about 140 to 300 mg, or about 200 to 300 mg, or about 140 to 200 mg, or about 7 to 350 mg, about 70 - 350 mg, about 100 - 300 mg, or about 125 -250 mg.
  • a subtherapeutic amount of levetiracetam or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is used.
  • the SV2A inhibitor present in the composition is brivaracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof and is administered at according to one of the daily dose ranges indicated as "+" listed in Tables 3-6.
  • the brivaracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is present in the composition in an amount of about 7 to 15 mg, or about 0.7 to 180 mg, or about 2.5 to 180 mg, or about 4.0 to 130 mg, or about 14 to 30 mg, or about 0.1 - 35 mg, 0.5 - 35 mg, 0.75 - 35 mg, 1.0 - 35 mg, 1.5 - 35 mg, 2.0 - 35 mg, 0.1 - 30 mg, 0.1 - 25 mg, 0.1 - 20 mg, 0.1 - 15 mg, 0.1 - 10 mg, 0.1 - 5 mg, 0.1 - 2.5 mg, or 0.7 - 50 mg, 0.7 - 75 mg, 0.7 - 100 mg, 0.7 - 150 mg, 0.7 - 180 mg, 0.7 - 225 mg, 0.7 - 250 mg, 0.7 - 280 mg, 1.8 - 50 mg, 1.8 - 75 mg, 1.8 - 100 mg, 1.8 - 150 - 150
  • the SV2A inhibitor present in the composition is seletracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof and is administered at according to one of the daily dose ranges indicated as "+" listed in Tables 7-10.
  • the seletracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is present in the composition in an amount of about 7 to 15 mg, or about 0.7 to 180 mg, or about 2.5 to 180 mg, or about 4.0 to 130 mg, or about 14 to 30 mg, or about 0.1 - 35 mg, 0.5 - 35 mg, 0.75 - 35 mg, 1.0 - 35 mg, 1.5 - 35 mg, 2.0 - 35 mg, 0.1 - 30 mg, 0.1 - 25 mg, 0.1 - 20 mg, 0.1 - 15 mg, 0.1 - 10 mg, 0.1 - 5 mg, 0.1 - 2.5 mg, or 0.7 - 50 mg, 0.7 - 75 mg, 0.7 - 100 mg, 0.7 - 150 mg, 0.7 - 180 mg, 0.7 - 225 mg, 0.7 - 250 mg, 0.7 - 280 mg, 1.8 - 50 mg, 1.8 - 75 mg, 1.8 - 100 mg, 1.8 - 150 mg, 1.8
  • the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is administered at a daily dose of 0.1 - 10 mg, 1 - 10 mg, 2 - 10 mg, 2 - 8 mg, or 2 - 5 mg.
  • a subtherapeutic amount of the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is administered.
  • the subtherapeutic amount of the AChEI administered is a daily dose of less than 10 mg, less than 9 mg, less than 8 mg, less than 7 mg, less than 6 mg, less than 5 mg, less than 2 mg, less than 1 mg, or less than 0.5 mg.
  • the AChEI inhibitor is donepezil.
  • the combined treatment has a longer or improved therapeutic effect in the subject than is attained by administering the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in the absence of the SV2A inhibitor or a pharmaceutically acceptable salt, solvate, hydrate, or polymorph, or prodrug thereof by at least about 1.5x, or 2.0x, or 2.5x, or 3.0x, or 3.5x, or 4.0x, or 4.5x, or 5.0x, or 5.5x, or 6.0x, or 6.5x, or 7.0x, or 7.5x, or 8.0x, or 8.5x, or 9.0x, or 9.5x, or 10x, or greater than about 10x.
  • the combined treatment has a longer or improved therapeutic effect in the subject than is attained by administering the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in the absence of the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof by at least about 1.5x, or 2.0x, or 2.5x, or 3.0x, or 3.5x, or 4.0x, or 4.5x, or 5.0x, or 5.5x, or 6.0x, or 6.5x, or 7.0x, or 7.5x, or 8.0x, or 8.5x, or 9.0x, or 9.5x, or 10x, or greater than about 10x.
  • a method of increasing the therapeutic index of an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in a method of treating cognitive impairment associated with a CNS disorder in a subject in need or at risk thereof comprising administering a composition comprising an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof to said subject.
  • the AChEI or the pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is not in an extended release form. In other instances, the AChEI or the pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is in an immediate release form.
  • the increase in the therapeutic index of the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is greater than the therapeutic index of the AChEI when administered in the absence of the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof or a pharmaceutically acceptable salt, hydrate, solvate or polymorph of the AChEI when administered in the absence of the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof by at least about 1.5x, or 2.0x, or 2.5x, or 3.0x, or 3.5x, or 4.0x, or 4.5x, or 5.0x, or 5.5x, or 6.0x, or 6.5x, or 7.0x, or 7.5x, or 8.0x, or 8.5x, or 9.0x, or 9.5x, or 10x, or greater than about 10x.
  • a method of increasing the therapeutic index of an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in a method of treating cognitive impairment associated with a CNS disorder in a subject in need or at risk thereof comprising administering a composition comprising an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof to said subject.
  • the AChEI or the pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is not in an extended release form. In other instances, the AChEI or the pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is in an immediate release form.
  • the increase in the therapeutic index of the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof is greater than the therapeutic index of the SV2A inhibitor , hydrate, solvate or polymorph when administered in the absence of the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof or a pharmaceutically acceptable salt, hydrate, solvate or polymorph of the SV2A inhibitor when administered in the absence of the AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof by at least about 1.5x, or 2.0x, or 2.5x, or 3.0x, or 3.5x, or 4.0x, or 4.5x, or 5.0x, or 5.5x, or 6.0x, or 6.5x, or 7.0x, or 7.5x, or 8.0x, or 8.5x, or 9.0x, or 9.5x, or 10x, or greater than about 10x.
  • the methods of the disclosure improve or treat cognitive function in said subject. In some instances, the methods delay or slow the progression of cognitive impairment in said subject. In some instances, the methods reduce the rate of decline of cognitive function in said subject. In some instances, the methods prevent or slow the progression of the cognitive impairment associated with said CNS disorder in said subject. In other instances, the methods alleviate, ameliorate, or slow the progression, of one or more symptoms associated with the cognitive impairment aspects of said CNS disorder in said subject.
  • the cognitive impairment is associated with age-related cognitive impairment, such as Mild Cognitive Impairment (MCI), Age-Associated Memory Impairment (AAMI), Age Related Cognitive Decline (ARCD).
  • MCI Mild Cognitive Impairment
  • AAMI Age-Associated Memory Impairment
  • ARCD Age Related Cognitive Decline
  • the MCI is amnestic MCI.
  • the cognitive impairment is associated with dementia, Alzheimer's Disease(AD), prodromal AD, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder, amyotrophic lateral sclerosis, cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease, autism, compulsive behavior, or substance addiction.
  • the subject that suffers such cognitive impairment is a human patient.
  • the effect of the treatment, the progression of cognitive impairment, or the rate of decline of cognitive function is measured by detecting the difference between the levels of reelin in the subject prior to and after the administration step.
  • the effect of the treatment, the progression of cognitive impairment, or the rate of decline of cognitive function is measured by detecting the difference between the levels of somatostatin in the subject prior to and after the administration step.
  • a pharmaceutical composition for treating, or improving cognitive function in, a subject suffering from cognitive impairment associated with a CNS disorder, or at risk thereof comprising levetiracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof and donepezil or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph or prodrug thereof, wherein the levetiracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is in an extended release form.
  • the donepezil or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is not in an extended release form.
  • the donepezil or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof are in an immediate release form.
  • the composition is in a solid form (e.g., capsule or tablet).
  • the composition is in a liquid form.
  • the composition is in an aqueous solution.
  • the composition is for oral administration.
  • the composition is administered once daily.
  • the composition is in a suspension form.
  • the composition is in a unit dosage form.
  • the composition is in a tablet or capsule.
  • the extended release levetiracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the composition does not affect the pharmacokinetics or the half-life clearance of the donepezil or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the same composition or in the same formulation or in the same unit.
  • the extended release form may be a controlled release form, a prolonged release form, a sustained release form, a delayed release form, or a slow release form.
  • the levetiracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is present in the composition in an amount of 7 - 350 mg, 70 - 350 mg, 100 - 300 mg, or 125 - 250 mg and the donepezil is present in the composition in an amount of 2 - 10 mg or 2 - 4 mg.
  • the SV2A inhibitor and/or the AChEI are administered at doses that are subtherapeutic as compared to the doses at which they are therapeutically effective when administered in the absence of the other.
  • the cognitive impairment associated with a CNS disorder is age-related cognitive impairment, such as Mild Cognitive Impairment (MCI), Age-Associated Memory Impairment (AAMI), Age Related Cognitive Decline (ARCD).
  • MCI Mild Cognitive Impairment
  • AAMI Age-Associated Memory Impairment
  • ARCD Age Related Cognitive Decline
  • the MCI is amnestic MCI.
  • the CNS disorder is dementia, Alzheimer's Disease(AD), prodromal AD, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, or substance addiction.
  • the subject that suffers such CNS disorder or such cognitive impairment is a human patient.
  • agent is used herein to denote a chemical compound (such as an organic or inorganic compound, a mixture of chemical compounds), a biological macromolecule (such as a nucleic acid, an antibody, including parts thereof as well as humanized, chimeric and human antibodies and monoclonal antibodies, a protein or portion thereof, e.g., a peptide, a lipid, a carbohydrate), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues.
  • Agents include, for example, agents which are known with respect to structure, and those which are not known with respect to structure.
  • the SV2A inhibitory activity or the AChEI activity of such agents may render them suitable as "therapeutic agents" in the methods and compositions of this disclosure.
  • a “patient”, “subject”, or “individual” are used interchangeably and refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats).
  • “Cognitive function” or “cognitive status” refers to any higher order intellectual brain process or brain state, respectively, involved in learning and/or memory including, but not limited to, attention, information acquisition, information processing, working memory, short-term memory, long-term memory, anterograde memory, retrograde memory, memory retrieval, discrimination learning, decision-making, inhibitory response control, attentional set-shifting, delayed reinforcement learning, reversal learning, the temporal integration of voluntary behavior, and expressing an interest in one's surroundings and self-care, speed of processing, reasoning and problem solving and social cognition.
  • cognitive function may be measured, for example and without limitation, by the clinical global impression of change scale (CIBIC-plus scale); the Mini Mental State Exam (MMSE); the Neuropsychiatric Inventory (NPI); the Clinical Dementia Rating Scale (CDR); the Cambridge Neuropsychological Test Automated Battery (CANTAB); the Sandoz Clinical Assessment-Geriatric (SCAG), the Buschke Selective Reminding Test (Buschke and Fuld, 1974); the Verbal Paired Associates subtest; the Logical Memory subtest; the Visual Reproduction subtest of the Wechsler Memory Scale-Revised (WMS-R) (Wechsler, 1997); the Benton Visual Retention Test, or the explicit 3-alternative forced choice task, or MATRICS consensus neuropsychological test battery.
  • CBIIC-plus scale the Mini Mental State Exam
  • NPI Neuropsychiatric Inventory
  • CDR Clinical Dementia Rating Scale
  • CDR Clinical Dementia Rating Scale
  • CANTAB Cambridge Neuropsychological Test Automated Battery
  • cognitive function may be measured in various conventional ways known in the art, including using a Morris Water Maze (MWM), Barnes circular maze, elevated radial arm maze, T maze or any other mazes in which the animals use spatial information.
  • MMM Morris Water Maze
  • Cognitive function can be assessed by reversal learning, extradimensional set shifting, conditional discrimination learning and assessments of reward expectancy.
  • Other tests known in the art may also be used to assess cognitive function, such as novel object recognition and odor recognition tasks.
  • Cognitive function may also be measured using imaging techniques such as Positron Emission Tomography (PET), functional magnetic resonance imaging (fMRI), Single Photon Emission Computed Tomography (SPECT), or any other imaging technique that allows one to measure brain function.
  • PET Positron Emission Tomography
  • fMRI functional magnetic resonance imaging
  • SPECT Single Photon Emission Computed Tomography
  • electrophysiological techniques any other imaging technique that allows one to measure brain function.
  • “Promoting” cognitive function refers to affecting impaired cognitive function so that it more closely resembles the function of a normal, unimpaired subject.
  • Cognitive function may be promoted to any detectable degree, but in humans preferably is promoted sufficiently to allow an impaired subject to carry out daily activities of normal life a level of proficiency as close as possible to a normal, unimpaired subject or an age-matched normal, unimpaired subject.
  • "promoting" cognitive function in a subject affected by age-related cognitive refers to affecting impaired cognitive function so that it more closely resembles the function of an aged-matched normal, unimpaired subject, or the function of a young adult subj ect.
  • Cognitive function of that subject may be promoted to any detectable degree, but in humans preferably is promoted sufficiently to allow an impaired subject to carry out daily activities of normal life at a level of proficiency as close as possible to a normal, unimpaired subject or a young adult subject or an age-matched normal, unimpaired subject.
  • Preserving cognitive function refers to affecting normal or impaired cognitive function such that it does not decline or does not fall below that observed in the subject upon first presentation or diagnosis, or delays such decline.
  • “Improving” cognitive function includes promoting cognitive function and/or preserving cognitive function in a subject.
  • Cognitive impairment refers to cognitive function in subjects that is not as robust as that expected in a normal, unimpaired subject. In some cases, cognitive function is reduced by about 5%, about 10%, about 30%, or more, compared to cognitive function expected in a normal, unimpaired subject. In some cases, “cognitive impairment” in subjects affected by aged-related cognitive impairment refers to cognitive function in subjects that is not as robust as that expected in an aged-matched normal, unimpaired subject, or the function of a young adult subject (i.e. subjects with mean scores for a given age in a cognitive test).
  • Age-related cognitive impairment refers to cognitive impairment in aged subjects, wherein their cognitive function is not as robust as that expected in an age-matched normal subject or as that expected in young adult subjects. In some cases, cognitive function is reduced by about 5%, about 10%, about 30%, or more, compared to cognitive function expected in an age-matched normal subject. In some cases, cognitive function is as expected in an age-matched normal subject, but reduced by about 5%, about 10%, about 30%, about 50% or more, compared to cognitive function expected in a young adult subject. Age-related impaired cognitive function may be associated with Mild Cognitive Impairment (MCI) (including amnestic MCI and non-amnestic MCI), Age-Associated Memory Impairment (AAMI), and Age-related Cognitive Decline (ARCD).
  • MCI Mild Cognitive Impairment
  • AAMI Age-Associated Memory Impairment
  • ARCD Age-related Cognitive Decline
  • Cognitive impairment associated with AD or related to AD or in AD refers to cognitive function in subjects that is not as robust as that expected in subjects who have not been diagnosed AD using conventional methodologies and standards.
  • MCI Mild Cognitive Impairment
  • memory complaint as reported by patient, informant, or physician
  • ADLs normal activities of daily living
  • normal global cognitive function (4) abnormal memory for age (defined as scoring more than 1.5 standard deviations below the mean for a given age), and (5) absence of indicators of dementia (as defined by DSM-IV guidelines).
  • MCI MCI
  • MMSE Mini Mental State Examination
  • CANTAB Cambridge Neuropsychological Test Automated Battery
  • AVLT Rey Auditory Verbal Learning Test
  • WMS-R Logical Memory Subtest of the revised Wechsler Memory Scale
  • NYU New York University
  • AAMI Alzheimer's disease Impairment
  • a patient may be considered to have AAMI if he or she is at least 50 years old and meets all of the following criteria: a) The patient has noticed a decline in memory performance, b) The patient performs worse on a standard test of memory compared to young adults, c) All other obvious causes of memory decline, except normal aging, have been ruled out (in other words, the memory decline cannot be attributed to other causes such as a recent heart attack or head injury, depression, adverse reactions to medication, Alzheimer's disease, etc.).
  • Age-Related Cognitive Decline refers to declines in memory and cognitive abilities that are a normal consequence of aging in humans (e.g., Craik & Salthouse, 1992). This is also true in virtually all mammalian species. Age-Associated Memory Impairment refers to older persons with objective memory declines relative to their younger years, but cognitive functioning that is normal relative to their age peers (Crook et al., 1986). Age-Consistent Memory Decline is a less pejorative label which emphasizes that these are normal developmental changes (Crook, 1993; Larrabee, 1996), are not pathophysiological (Smith et al., 1991), and rarely progress to overt dementia (Youngjohn & Crook, 1993). The DSM-IV (1994) has codified the diagnostic classification of ARCD.
  • AD Alzheimer's disease
  • memory deficits in its early phase Later symptoms include impaired judgment, disorientation, confusion, behavior changes, trouble speaking, and motor deficits.
  • Histologically, AD is characterized by beta-amyloid plaques and tangles of protein tau.
  • Vascular dementia is caused by strokes. Symptoms overlap with those of AD, but without the focus on memory impairment.
  • Dementia with Lewy bodies is characterized by abnormal deposits of alpha-synuclein that form inside neurons in the brain.
  • Cognitive impairment may be similar to AD, including impairments in memory and judgment and behavior changes.
  • Frontotemporal dementia is characterized by gliosis, neuronal loss, superficial spongiform degeneration in the frontal cortex and/or anterior temporal lobes, and Picks' bodies. Symptoms include changes in personality and behavior, including a decline in social skills and language expression/comprehension.
  • Post traumatic stress disorder refers to an anxiety disorder characterized by an immediate or delayed response to a catastrophic event, characterized by re-experiencing the trauma, psychic numbing or avoidance of stimuli associated with the trauma, and increased arousal.
  • Re-experiencing phenomena include intrusive memories, flashbacks, nightmares, and psychological or physiological distress in response to trauma reminders.
  • Such responses produce anxiety and can have significant impact, both chronic and acute, on a patient's quality of life and physical and emotional health.
  • PTSD is also associated with impaired cognitive performance, and older individuals with PTSD have greater decline in cognitive performance relative to control patients.
  • “Schizophrenia” refers to a chronic debilitating disorder, characterized by a spectrum of psychopathology, including positive symptoms such as aberrant or distorted mental representations (e.g., hallucinations, delusions), negative symptoms characterized by diminution of motivation and adaptive goal-directed action (e . g ., anhedonia, affective flattening, avolition), and cognitive impairment. While abnormalities in the brain are proposed to underlie the full spectrum of psychopathology in schizophrenia, currently available antipsychotics are largely ineffective in treating cognitive impairments in patients.
  • BP Bipolar disorder
  • manic depressive disorder or “manic depressive illness” refers to a chronic psychological/mood disorder which can be characterized by significant mood changes including periods of depression and euphoric manic periods.
  • BP may be diagnosed by a skilled physician based on personal and medical history, interview consultation and physical examinations.
  • mania or “manic periods” or other variants refers to periods where an individual exhibits some or all of the following characteristics: racing thoughts, rapid speech, elevated levels of activity and agitation as well as an inflated sense of self-esteem, euphoria, poor judgment, insomnia, impaired concentration and aggression.
  • ALS Amyotrophic lateral sclerosis
  • ALS refers to a progressive, fatal, neurodegenerative disease characterized by a degeneration of motor neurons, the nerve cells in the central nervous system that control voluntary muscle movement.
  • ALS is also characterized by neuronal degeneration in the entorhinal cortex and hippocampus, memory deficits, and neuronal hyperexcitability in different brain areas such as the cortex.
  • Cancer-therapy-related cognitive impairment refers to cognitive impairment that develops in subjects that are treated with cancer therapies such as chemotherapy and radiation. Cytotoxicity and other adverse side-effects on the brain of cancer therapies result in cognitive impairment in such functions as memory, learning and attention.
  • Parkinson's disease is a neurological disorder characterized by a decrease of voluntary movements.
  • the afflicted patient has reduction of motor activity and slower voluntary movements compared to the normal individual.
  • the patient has characteristic "mask” face, a tendency to hurry while walking, bent over posture and generalized weakness of the muscles.
  • Another important feature of the disease is the tremor of the extremities occurring at rest and decreasing during movements.
  • autism refers to an autism spectrum disorder characterized by a neural development disorder leading to impaired social interaction and communication by restricted and repetitive behavior.
  • Autism Spectrum Disorder refers to a group of developmental disabilities that includes: autism; Asperger syndrome; pervasive developmental disorder not otherwise specified (PDD-NOS or atypical autism); Rett syndrome; and childhood disintegrative disorder.
  • Mental retardation is a generalized disorder characterized by significantly impaired cognitive function and deficits in adaptive behaviors. Mental retardation is often defined as an Intelligence Quotient (IQ) score of less than 70. Inborn causes are among many underlying causes for mental retardation. The dysfunction in neuronal communication is also considered one of the underlying causes for mental retardation ( Myrrhe van Spronsen and Casper C. Hoogenraad, Curr. Neurol. Neurosci. Rep. 2010, 10, 207-214 ).
  • IQ Intelligence Quotient
  • mental retardation includes, but are not limited to, Down syndrome, velocariofacial syndrome, fetal alcohol syndrome, Fragile X syndrome, Klinefelter's syndrome, neurofibromatosis, congenital hypothyroidism, Williams syndrome, phenylketonuria (PKU), Smith-Lemli-Opitz syndrome, Prader-Willi syndrome, Phelan-McDermid syndrome, Mowat-Wilson syndrome, ciliopathy, Lowe syndrome and siderium type X-linked mental retardation.
  • Down syndrome is a disorder that includes a combination of birth defects, including some degree of mental retardation, characteristic facial features and, often, heart defects, increased infections, problems with vision and hearing, and other health problems.
  • Fragile X syndrome is a prevalent form of inherited mental retardation, occurring with a frequency of 1 in 4,000 males and 1 in 8,000 females. The syndrome is also characterized by developmental delay, hyperactivity, attention deficit disorder, and autistic-like behavior. There is no effective treatment for fragile X syndrome.
  • Obsessive compulsive disorder is a mental condition that is most commonly characterized by intrusive, repetitive unwanted thoughts (obsessions) resulting in compulsive behaviors and mental acts that an individual feels driven to perform (compulsion).
  • OCD Obsessive compulsive disorder
  • Current epidemiological data indicates that OCD is the fourth most common mental disorder in the United States. Some studies suggest the prevalence of OCD is between one and three percent, although the prevalence of clinically recognized OCD is much lower, suggesting that many individuals with the disorder may not be diagnosed. Patients with OCD are often diagnosed by a psychologist, psychiatrist, or psychoanalyst according to the Diagnostic and Statistical Manual of Mental Disorders, 4th edition text revision (DSM-IV-TR) (2000) diagnostic criteria that include characteristics of obsessions and compulsions.
  • Substance addiction e.g., drug addiction, alcohol addiction
  • the addiction is not triggered instantaneously upon exposure to substance of abuse. Rather, it involves multiple, complex neural adaptations that develop with different time courses ranging from hours to days to months ( Kauer J. A. Nat. Rev. Neurosci. 2007, 8, 844-858 ).
  • the path to addiction generally begins with the voluntary use of one or more controlled substances, such as narcotics, barbiturates, methamphetamines, alcohol, nicotine, and any of a variety of other such controlled substances. Over time, with extended use of the controlled substance(s), the voluntary ability to abstain from the controlled substance(s) is compromised due to the effects of prolonged use on brain function, and thus on behavior.
  • substance addiction generally is characterized by compulsive substance craving, seeking and use that persist even in the face of negative consequences.
  • the cravings may represent changes in the underlying neurobiology of the patient which likely must be addressed in a meaningful way if recovery is to be obtained.
  • Substance addiction is also characterized in many cases by withdrawal symptoms, which for some substances are life threatening (e.g., alcohol, barbiturates) and in others can result in substantial morbidity (which may include nausea, vomiting, fever, dizziness, and profuse sweating), distress, and decreased ability to obtain recovery.
  • alcoholism also known as alcohol dependence
  • Alcoholism is primarily characterized by four symptoms, which include cravings, loss of control, physical dependence and tolerance. These symptoms also may characterize addictions to other controlled substances.
  • the craving for alcohol, as well as other controlled substances often is as strong as the need for food or water. Thus, an alcoholic may continue to drink despite serious family, health and/or legal ramifications.
  • Treating age-related cognitive impairment further comprises slowing the conversion of age-related cognitive impairment (including, but not limited to MCI, ARCD and AAMI) into dementia ( e . g ., AD).
  • Treating cognitive impairment refers to taking steps to improve cognitive function in a subject with cognitive impairment so that the subject's performance in one or more cognitive tests is improved to any detectable degree, or is prevented from further decline.
  • that subject's cognitive function after treatment of cognitive impairment, more closely resembles the function of a normal, unimpaired subject.
  • Treatment of cognitive impairment in humans may improve cognitive function to any detectable degree, but is preferably improved sufficiently to allow the impaired subject to carry out daily activities of normal life at the same level of proficiency as a normal, unimpaired subject.
  • “treating cognitive impairment” refers to taking steps to improve cognitive function in a subject with cognitive impairment so that the subject's performance in one or more cognitive tests is improved to any detectable degree, or is prevented from further decline.
  • that subject's cognitive function, after treatment of cognitive impairment more closely resembles the function of a normal, unimpaired subject.
  • “treating cognitive impairment” in a subject affecting by age-related cognitive impairment refers to takings steps to improve cognitive function in the subject so that the subject's cognitive function, after treatment of cognitive impairment, more closely resembles the function of an age-matched normal, unimpaired subject, or the function of a young adult subject.
  • “treating cognitive impairment” in a subject refers to taking steps to delay or slow the progression of cognitive impairment in a subject with cognitive impairment.
  • “treating cognitive impairment” in a subject refers to taking steps to reduce the rate of decline of cognitive function in a subject with cognitive impairment.
  • administering or “administration of' a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art.
  • a compound or an agent can be administered, intravenously, arterially, intradermally, intramuscularly, intraperitonealy, intravenously, subcutaneously, ocularly, sublingually, orally (by ingestion), intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct).
  • a compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow, or controlled release of the compound or agent.
  • Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • the administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug.
  • a physician who instructs a patient to self-administer a drug, or to have the drug administered by another and/or who provides a patient with a prescription for a drug is administering the drug to the patient.
  • Appropriate methods of administering a substance, a compound or an agent to a subject will also depend, for example, on the age of the subject, whether the subject is active or inactive at the time of administering, whether the subject is cognitively impaired at the time of administering, the extent of the impairment, and the chemical and biological properties of the compound or agent (e.g. solubility, digestibility, bioavailability, stability and toxicity).
  • a compound or an agent is administered orally, e.g., to a subject by ingestion, or intravenously, e.g., to a subject by injection.
  • the orally administered compound or agent is in an extended release or slow release formulation, or administered using a device for such slow or extended release.
  • a "therapeutically effective amount" of a drug or agent is an amount of a drug or an agent that, when administered to a subject will have the intended therapeutic effect, e.g. improving cognitive function, or delaying or slowing the progression of cognitive impairment, or reducing the rate of decline of cognitive function in a subject, e.g., a patient having cognitive impairment associated with a CNS disorder.
  • the full therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
  • a therapeutically effective amount may be administered in one or more administrations.
  • the precise effective amount needed for a subject will depend upon, for example, the subject's size, health and age, the nature and extent of the cognitive impairment, and the therapeutics or combination of therapeutics selected for administration, and the mode of administration. The skilled worker can readily determine the effective amount for a given situation by routine experimentation.
  • Subject therapeutic amount refers to an amount administered of an agent or compound of the disclosure that is less than the therapeutic amount, that is, less than the amount normally used when said agent or compound is administered alone (i.e., individually and in the absence of other therapeutic agents or compounds) to treat disorders involving cognitive dysfunction.
  • Analog is used herein to refer to a compound which functionally resembles another chemical entity, but does not share the identical chemical structure.
  • an analog is sufficiently similar to a base or parent compound such that it can substitute for the base compound in therapeutic applications, despite minor structural differences.
  • “Derivative” is used herein to refer to the chemical modification of a compound. Chemical modifications of a compound can include, for example, replacement of hydrogen by an alkyl, acyl, or amino group. Many other modifications are also possible.
  • prodrug is art-recognized and is intended to encompass compounds or agents which, under physiological conditions, are converted into an SV2A inhibitor or an AChEI.
  • a common method for making a prodrug is to select moieties which are hydrolyzed or metabolized under physiological conditions to provide the desired compound or agent.
  • the prodrug is converted by an enzymatic activity of the host animal to an inhibitor of SV2A or an AChEI.
  • “Pharmaceutically acceptable salts” is used herein to refer to an agent or a compound according to the disclosure that is a therapeutically active, non-toxic base and acid salt form of the agents and compounds of the disclosure.
  • the acid addition salt form of a compound that occurs in its free form as a base can be obtained by treating said free base form with an appropriate acid such as an inorganic acid, for example, a hydrohalic such as hydrochloric or hydrobromic, sulfuric, nitric, phosphoric and the like; or an organic acid, such as, for example, acetic, hydroxyacetic, propanoic, lactic, pyruvic, malonic, succinic, maleic, fumaric, malic, tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclic, salicylic, p- aminosalicylic, pamoic and the like. See, e.g
  • the methods of this disclosure comprise administration of an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate, polymorph or prodrug thereof in combination with administration of an AChEI or a pharmaceutically acceptable salt, hydrate, solvate, polymorph or prodrug thereof.
  • the agents or compounds of the SV2A inhibitor or the AChEI and their pharmaceutically acceptable salts also include hydrates, solvates, polymorphs, and prodrugs of those agents, compounds, and salts.
  • Animal models serve as an important resource for developing and evaluating treatments for cognitive impairment associated with CNS disorders.
  • Features that characterize cognitive impairment in animal models typically extend to cognitive impairment in humans. Efficacy in such animal models is, thus, expected to be predictive of efficacy in humans.
  • the extent of cognitive impairment in an animal model for a CNS disorder, and the efficacy of a method of treatment for said CNS disorder may be tested and confirmed with the use of a variety of cognitive tests.
  • a Radial Arm Maze (RAM) behavioral task is one example of a cognitive test, specifically testing spacial memory ( Chappell et al. Neuropharmacology 37: 481-487, 1998 ).
  • the RAM apparatus consists of, e.g., eight equidistantly spaced arms. A maze arm projects from each facet of a center platform. A food well is located at the distal end of each arm. Food is used as a reward. Blocks can be positioned to prevent entry to any arm. Numerous extra maze cues surrounding the apparatus may also be provided. After habituation and training phases, spatial memory of the subjects may be tested in the RAM under control or test compound-treated conditions.
  • subjects are pretreated before trials with a vehicle control or one of a range of dosages of the test compound.
  • a subset of the arms of the eight-arm maze is blocked.
  • Subjects are allowed to obtain food on the unblocked arms to which access is permitted during this initial "information phase" of the trial.
  • Subjects are then removed from the maze for a delay period, e.g., a 60 second delay, a 15 minute delay, a one-hour delay, a two-hour delay, a six hour delay, a 24 hour delay, or longer) between the information phase and the subsequent "retention test," during which the barriers on the maze are removed, thus allowing access to all eight arms.
  • a cognitive test that may be used to assess the effects of a test compound on the cognitive impairment of a CNS disorder model animal is the Morris water maze.
  • a water maze is a pool surrounded with a novel set of patterns relative to the maze.
  • the training protocol for the water maze may be based on a modified water maze task that has been shown to be hippocampal-dependent ( de Hoz et al., Eur. J. Neurosci., 22:745-54, 2005 ; Steele and Morris, Hippocampus 9:118-36, 1999 ).
  • the subject is trained to locate a submerged escape platform hidden underneath the surface of the pool.
  • a subject is released in the maze (pool) from random starting positions around the perimeter of the pool.
  • the starting position varies from trial to trial. If the subject does not locate the escape platform within a set time, the experimenter guides and places the subject on the platform to "teach" the location of the platform. After a delay period following the last training trial, a retention test in the absence of the escape platform is given to assess spatial memory.
  • the subject's level of preference for the location of the (now absent) escape platform as measured by, e.g., the time spent in that location or the number of crossings of that location made by the mouse, indicates better spatial memory, i.e., treatment of cognitive impairment.
  • the preference for the location of the escape platform under different treatment conditions can then be compared for efficacy of the test compound in treating cognitive impairment associated with CNS disorders.
  • the progression of age-related cognitive impairment and dementia may be monitored by assessing surrogate changes in the brain of the subject.
  • Surrogate changes include, without limitation, changes in regional brain volumes, perforant path degradation, and changes seen in brain function through resting state fMRI (R-fMRI) and fluorodeoxyglucose positron emission tomography (FDG-PET).
  • R-fMRI resting state fMRI
  • FDG-PET fluorodeoxyglucose positron emission tomography
  • regional brain volumes useful in monitoring the progression of age-related cognitive impairment and dementia include reduction of hippocampal volume and reduction in volume or thickness of entorhinal cortex. These volumes may be measured in a subject by, for example, MRI.
  • Perforant path degradation has been shown to be linked to age, as well as reduced cognitive function. For example, older adults with more perforant path degradation tend to perform worse in hippocampus-dependent memory tests. Perforant path degradation may be monitored in subjects through ultrahigh-resolution diffusion tensor imaging (DTI). Yassa et al., PNAS 107:12687-12691 (2010 ). Resting-state fMRI (R-fMRI) involves imaging the brain during rest, and recording large-amplitude spontaneous low-frequency ( ⁇ 0.1 Hz) fluctuations in the fMRI signal that are temporally correlated across functionally related areas.
  • DTI ultrahigh-resolution diffusion tensor imaging
  • Seed-based functional connectivity, independent component analyses, and/or frequency-domain analyses of the signals are used to reveal functional connectivity between brain areas, particularly those areas whose connectivity increase or decrease with age, as well as the extent of cognitive impairment and/or dementia.
  • FDG-PET uses the uptake of FDG as a measure of regional metabolic activity in the brain. Decline of FDG uptake in regions such as the posterior cingulated cortex, temporoparietal cortex, and prefrontal association cortex has been shown to relate to the extent of cognitive decline and dementia. Aisen et al., Alzheimer's & Dementia 6:239-246 (2010 ), Herholz et al., Neurolmage 17:302-316 (2002 ).
  • This disclosure provides methods and compositions for treating age-related cognitive impairment or the risk thereof using an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof in an extended release form in combination with an AChEI or a , hydrate, solvate, polymorph, or prodrug pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises improving cognitive function in patients with age-related cognitive impairment.
  • treatment comprises slowing or delaying the progression of age-related cognitive impairment.
  • treatment comprises reducing the rate of decline of cognitive function associated with dementia.
  • treatment comprises preventing or slowing the progression, of age-related cognitive impairment.
  • treatment comprises alleviation, amelioration or slowing the progression, of one or more symptoms associated with age-related cognitive impairment.
  • treatment of age-related cognitive impairment comprises slowing the conversion of age-related cognitive impairment (including, but not limited to MCI, ARCD and AAMI) into dementia (e.g., AD).
  • the methods and compositions may be used for human patients in clinical applications in the treating age-related cognitive impairment in conditions such as MCI, ARCD and AAMI or for the risk thereof.
  • the dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • a subject to be treated by the methods and compositions of this disclosure exhibits age-related cognitive impairment or is at risk of such impairment.
  • the age-related cognitive impairment includes, without limitation, Age-Associated Memory Impairment (AAMI), Mild Cognitive Impairment (MCI) and Age-related Cognitive Decline (ARCD).
  • Animal models serve as an important resource for developing and evaluating treatments for such age-related cognitive impairments.
  • Features that characterize age-related cognitive impairment in animal models typically extend to age-related cognitive impairment in humans. Efficacy in such animal models is, thus, expected to be predictive of efficacy in humans.
  • Aged rats in the study population have no difficulty swimming to a visible platform, but an age-dependent impairment is detected when the platform is camouflaged, requiring the use of spatial information. Performance for individual aged rats in the outbred Long-Evans strain varies greatly. For example, a proportion of those rats perform on a par with young adults. However, approximately 40-50% fall outside the range of young performance. This variability among aged rats reflects reliable individual differences. Thus, within the aged population some animals are cognitively impaired and designated aged-impaired (AI) and other animals are not impaired and are designated aged-unimpaired (AU). See, e.g., Colombo et al., Proc. Natl. Acad. Sci.
  • Such an animal model of age-related cognitive impairment may be used to assay the effectiveness of the methods and compositions this disclosure in treating age-related cognitive impairment.
  • the efficacy of the methods and compositions of this disclosure in treating age-related cognitive impairment may be assessed using a variety of cognitive tests, including the Morris water maze and the radial arm maze, as discussed above.
  • treatment comprises improving cognitive function in patients with dementia.
  • treatment comprises slowing or delaying the progression of dementia.
  • treatment comprises reducing the rate of decline of cognitive function associated with dementia.
  • treatment comprises preventing or slowing the progression, of dementia.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with dementia.
  • the symptom to be treated is cognitive impairment.
  • the dementia is Alzheimer's disease (AD), vascular dementia, dementia with Lewy bodies, or frontotemporal dementia.
  • AD Alzheimer's disease
  • vascular dementia dementia with Lewy bodies
  • frontotemporal dementia vascular dementia
  • the methods and compositions may be used for human patients in clinical applications in treating dementia.
  • the dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • Animal models serve as an important resource for developing and evaluating treatments for dementia.
  • Features that characterize dementia in animal models typically extend to dementia in humans.
  • efficacy in such animal models is expected to be predictive of efficacy in humans.
  • Various animal models of dementia are known in the art, such as the PDAPP, Tg2576, APP23, TgCRND8, J20, hPS2 Tg, and APP + PS1 transgenic mice.
  • Sankaranarayanan Curr. Top. Medicinal Chem. 6: 609-627, 2006 ; Kobayashi et al. Genes Brain Behav. 4: 173-196. 2005 ; Ashe and Zahns, Neuron. 66: 631-45, 2010 .
  • Such animal models of dementia may be used to assay the effectiveness of the methods and compositions of this disclosure in treating dementia.
  • the efficacy of the methods and compositions of this disclosure in treating dementia, or cognitive impairment associated with dementia may be assessed in animals models of dementia, as well as human subjects with dementia, using a variety of cognitive tests known in the art, as discussed above.
  • This disclosure also provides methods and compositions for treating post traumatic stress disorder (PTSD) using an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof.
  • treatment comprises improving cognitive function in patients with PTSD.
  • treatment comprises slowing or delaying the progression of PTSD.
  • treatment comprises reducing the rate of decline of cognitive function associated with PTSD.
  • treatment comprises preventing or slowing the progression, of PTSD.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with PTSD.
  • the symptom to be treated is cognitive impairment.
  • the methods and compositions may be used for human patients in clinical applications in treating PTSD. The dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • PTSD patients with PTSD (and, to a lesser degree trauma-exposed patients without PTSD) have smaller hippocampal volumes ( Woon et al., Prog. Neuro-Psychopharm. & Biological Psych. 34, 1181-1188 ; Wang et al., Arch. Gen. Psychiatry 67:296-303, 2010 ).
  • PTSD is also associated with impaired cognitive performance. Older individuals with PTSD have greater declines in cognitive performance relative to control patients ( Yehuda et al., Bio. Psych. 60: 714-721, 2006 ) and have a greater likelihood of developing dementia ( Yaffe et al., Arch. Gen. Psych. 678: 608-613, 2010 ).
  • Animal models serve as an important resource for developing and evaluating treatments for PTSD.
  • Features that characterize PTSD in animal models typically extend to PTSD in humans.
  • efficacy in such animal models is expected to be predictive of efficacy in humans.
  • Various animal models of PTSD are known in the art.
  • TDS Time-dependent sensitization
  • Rats are placed in a restrainer, then placed in a swim tank and made to swim for a period of time, e.g., 20 min. Following this, each rat is then immediately exposed to a gaseous anesthetic until loss of consciousness, and finally dried. The animals are left undisturbed for a number of days, e.g., one week. The rats are then exposed to a "restress" session consisting of an initial stressor, e .
  • TDS results in an enhancement of the acoustic startle response (ASR) in the rat, which is comparable to the exaggerated acoustic startle that is a prominent symptom of PTSD ( Khan and Liberzon, Psychopharmacology 172: 225-229, 2004 ).
  • ASR acoustic startle response
  • Such animal models of PTSD may be used to assay the effectiveness of the methods and compositions of this disclosure in treating PTSD.
  • the efficacy of the methods and compositions of this disclosure in treating PTSD, or cognitive impairment associated with PTSD may also be assessed in animals models of PTSD, as well as human subjects with PTSD, using a variety of cognitive tests known in the art, as discussed above.
  • This disclosure provides methods and compositions for treating schizophrenia or bipolar disorder (in particular, mania) using an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof.
  • treatment comprises improving cognitive function in patients with schizophrenia.
  • treatment comprises slowing or delaying the progression of schizophrenia.
  • treatment comprises reducing the rate of decline of cognitive function associated with schizophrenia.
  • treatment comprises preventing or slowing the progression of schizophrenia or bipolar disorder (in particular, mania).
  • Schizophrenia is characterized by a wide spectrum of psychopathology, including positive symptoms such as aberrant or distorted mental representations (e.g., hallucinations, delusions), negative symptoms characterized by diminution of motivation and adaptive goal-directed action (e.g., anhedonia, affective flattening, avolition), and cognitive impairment.
  • treatment comprises alleviation, amelioration or slowing the progression of one or more positive and/or negative symptoms, as well as cognitive impairment, associated with schizophrenia.
  • psychiatric diseases such as schizotypical and schizoaffective disorder, other acute- and chronic psychoses and bipolar disorder (in particular, mania), which have an overlapping symptomatology with schizophrenia.
  • treatment comprises alleviation, amelioration or slowing the progression of one or more symptoms, as well as cognitive impairment, associated with bipolar disorder (in particular, mania).
  • bipolar disorder in particular, mania
  • the methods and compositions may be used for human patients in clinical applications in treating schizophrenia or bipolar disorder (in particular, mania).
  • the dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • Cognitive impairments are associated with schizophrenia. They precede the onset of psychosis and are present in non-affected relatives. The cognitive impairments associated with schizophrenia constitute a good predictor for functional outcome and are a core feature of the disorder. Cognitive features in schizophrenia reflect dysfunction in frontal cortical and hippocampal circuits. Patients with schizophrenia also present hippocampal pathologies such as reductions in hippocampal volume, reductions in neuronal size and dysfunctional hyperactivity. An imbalance in excitation and inhibition in these brain regions has also been documented in schizophrenic patients suggesting that drugs targeting inhibitory mechanisms could be therapeutic. See, e.g., Guidotti et al., Psychopharmacology 180: 191-205, 2005 ; Zierhut, Psych. Res. Neuroimag.
  • Animal models serve as an important resource for developing and evaluating treatments for schizophrenia.
  • Features that characterize schizophrenia in animal models typically extend to schizophrenia in humans.
  • efficacy in such animal models is expected to be predictive of efficacy in humans.
  • Various animal models of schizophrenia are known in the art.
  • Methionine-treated mice exhibit deficient expression of GAD67 in frontal cortex and hippocampus, similar to those reported in the brain of postmortem schizophrenia patients. They also exhibit prepulse inhibition of startle and social interaction deficits ( Tremonlizzo et al., PNAS, 99: 17095-17100, 2002 ).
  • Another animal model of schizophrenia is methylaoxymethanol acetate (MAM)-treatment in rats. Pregnant female rats are administered MAM (20 mg/kg, intraperitoneal) on gestational day 17. MAM-treatment recapitulate a pathodevelopmental process to schizophrenia-like phenotypes in the offspring, including anatomical changes, behavioral deficits and altered neuronal information processing.
  • MAM-treated rats display a decreased density of parvalbumin-positive GABAergic interneurons in portions of the prefrontal cortex and hippocampus.
  • MAM-treated rats display reduced latent inhibition.
  • Latent inhibition is a behavioral phenomenon where there is reduced learning about a stimulus to which there has been prior exposure with any consequence. This tendency to disregard previously benign stimuli, and reduce the formation of association with such stimuli is believed to prevent sensory overload. Low latent inhibition is indicative of psychosis.
  • Latent inhibition may be tested in rats in the following manner. Rats are divided into two groups. One group is pre-exposed to a tone over multiple trials. The other group has no tone presentation.
  • Both groups are then exposed to an auditory fear conditioning procedure, in which the same tone is presented concurrently with a noxious stimulus, e.g. an electric shock to the foot. Subsequently, both groups are presented with the tone, and the rats' change in locomotor activity during tone presentation is monitored. After the fear conditioning the rats respond to the tone presentation by strongly reducing locomotor activity. However, the group that has been exposed to the tone before the conditioning period displays robust latent inhibition: the suppression of locomotor activity in response to tone presentation is reduced. MAM-treated rats, by contrast show impaired latent inhibition. That is, exposure to the tone previous to the fear conditioning procedure has no significant effect in suppressing the fear conditioning. ( see Lodge et al., J. Neurosci., 29:2344-2354, 2009 ) Such animal models of schizophrenia may be used to assay the effectiveness of the methods and compositions of the disclosure in treating schizophrenia or bipolar disorder (in particular, mania).
  • MAM-treated rats display a significantly enhanced locomotor response (or aberrant locomotor activity) to low dose D-amphetamine administration.
  • the MAM-treated rats also display a significantly greater number of spontaneously firing ventral tegmental dopamine (DA) neurons.
  • DA ventral tegmental dopamine
  • MAM-treated rats in the above study may be suitable for use to assay the effectiveness of the methods and compositions of the present disclosure in treating schizophrenia or bipolar disorder (in particular, mania).
  • the methods and compositions of this disclosure maybe evaluated, using MAM-treated animals, for their effects on the central hippocampus (vHipp) regulation, on the elevated DA neuron population activity and on the hyperactive locomotor response to amphetamine in the MAM-treated animals.
  • vHipp central hippocampus
  • HPC hippocampal
  • PAM benzodiazepine-positive allosteric modulator
  • the ⁇ 5GABAAR PAM reduces the number of spontaneously active DA neurons in the ventral tegmental area (VTA) of MAM rats to levels observed in saline-treated rats (control group), both when administered systemically and when directly infused into the ventral HPC. Moreover, HPC neurons in both saline-treated and MAM-treated animals show diminished cortical-evoked responses following the ⁇ 5GABAAR PAM treatment. In addition, the increased locomotor response to amphetamine observed in MAM-treated rats is reduced following the ⁇ 5GABAAR PAM treatment. See Gill K. M et al. Neuropsychopharmacology (2011), 1-9 .
  • MAM-treated rats in the above study may be suitable for use in the present disclosure to assay the effectiveness of the methods and compositions of the disclosure in treating schizophrenia or bipolar disorder (in particular, mania).
  • the methods and compositions of this disclosure maybe evaluated, using MAM-treated animals, for their effects on the output of the hippocampal (HPC) and on the hyperactive locomotor response to amphetamine in the MAM-treated animals.
  • HPC hippocampal
  • Apomorphine-induced climbing (AIC) and stereotype (AIS) in mice is another animal model useful in this disclosure.
  • Agents are administered to mice at a desired dose level (e.g., via intraperitoneal administration).
  • a desired dose level e.g., via intraperitoneal administration.
  • experimental mice are challenges with apomorphine (e.g., with 1 mg/kg sc).
  • apomorphine e.g., with 1 mg/kg sc
  • the sniffing-licking-gnawing syndrome stereotyped behavior
  • climbing behavior induced by apomorphine are scored and recorded for each animal. Readings can be repeated every 5 min during a 30-min test session. Scores for each animal are totaled over the 30-min test session for each syndrome (stereotyped behavior and climbing).
  • the efficacy of the methods and compositions of this disclosure in treating schizophrenia or cognitive impairment associated with schizophrenia may also be assessed in animal models of schizophrenia or bipolar disorder (in particular, mania), as well as human subjects with schizophrenia, using a variety of cognitive tests known in the art, as discussed above.
  • schizophrenia or bipolar disorder in particular, mania
  • human subjects with schizophrenia using a variety of cognitive tests known in the art, as discussed above.
  • ALS Amyotropic Lateral Sclerosis
  • This disclosure additionally provides methods and compositions for treating ALS using an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises improving cognitive function in patients with ALS.
  • treatment comprises slowing or delaying the progression of ALS.
  • treatment comprises reducing the rate of decline of cognitive function associated with ALS.
  • treatment comprises preventing or slowing the progression, of ALS.
  • treatment comprises alleviation, amelioration or slowing the progression, of one or more symptoms associated with ALS.
  • the symptom to be treated is cognitive impairment.
  • the methods and compositions may be used for human patients in clinical applications in treating ALS.
  • the dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • ALS is characterized by neuronal degeneration in the entorhinal cortex and hippocampus, memory deficits, and neuronal hyperexcitability in different brain areas such as the cortex.
  • the efficacy of the methods and compositions of this disclosure in treating ALS, or cognitive impairment associated with ALS, may also be assessed in animal models of ALS, as well as human subjects with ALS, using a variety of cognitive tests known in the art, as discussed above.
  • This disclosure additionally provides methods and compositions for treating cancer therapy-related cognitive impairment using an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression, of cancer therapy-related cognitive impairment.
  • treatment comprises improving cognitive function in patients with cancer therapy-related cognitive impairment.
  • treatment comprises slowing or delaying the progression of cancer therapy-related cognitive impairment.
  • treatment comprises reducing the rate of decline of cognitive function associated with cancer therapy-related cognitive impairment. In certain instances, treatment comprises alleviation, amelioration or slowing the progression, of one or more symptoms associated with cancer therapy-related cognitive impairment.
  • the methods and compositions may be used for human patients in clinical applications in treating cancer therapy-related cognitive impairment. The dose of the composition and dosage interval for the method is, as described herein, one that is safe and efficacious in those applications.
  • Therapies that are used in cancer treatment can cause cognitive impairment in patients, in such functions as memory, learning and attention. Cytotoxicity and other adverse side-effects on the brain of cancer therapies are the basis for this form of cognitive impairment, which can persist for decades. ( Dietrich et al., Oncologist 13:1285-95, 2008 ; Soussain et al., Lancet 374:1639-51, 2009 ).
  • Cognitive impairment following cancer therapies reflects dysfunction in frontal cortical and hippocampal circuits that are essential for normal cognition.
  • exposure to either chemotherapy or radiation adversely affects performance on tests of cognition specifically dependent on these brain systems, especially the hippocampus ( Kim et al., J. Radiat. Res. 49:517-526, 2008 ; Yang et al., Neurobiol. Learning and Mem. 93:487-494, 2010 ).
  • drugs targeting these cortical and hippocampal systems could be neuroprotective in patients receiving cancer therapies and efficacious in treating symptoms of cognitive impairment that may last beyond the interventions used as cancer therapies.
  • Animal models serve as an important resource for developing and evaluating treatments for cancer therapy-related cognitive impairment.
  • Features that characterize cancer therapy-related cognitive impairment in animal models typically extend to cancer therapy-related cognitive impairment in humans.
  • efficacy in such animal models is expected to be predictive of efficacy in humans.
  • Various animal models of cancer therapy-related cognitive impairment are known in the art.
  • Examples of animal models of cancer therapy-related cognitive impairment include treating animals with anti-neoplastic agents such as cyclophosphamide (CYP) or with radiation, e.g., 60 Co gamma-rays. ( Kim et al., J. Radiat. Res. 49:517-526, 2008 ; Yang et al., Neurobiol. Learning and Mem. 93:487-494, 2010 ).
  • the cognitive function of animal models of cancer therapy-related cognitive impairment may then be tested with cognitive tests to assay the effectiveness of the methods and compositions of the disclosure in treating cancer therapy-related cognitive impairment.
  • Parkinson's disease is a neurological disorder characterized by a decrease of voluntary movements.
  • the afflicted patient has reduction of motor activity and slower voluntary movements compared to the normal individual.
  • the patient has characteristic "mask” face, a tendency to hurry while walking, bent over posture and generalized weakness of the muscles.
  • Another important feature of the disease is the tremor of the extremities occurring at rest and decreasing during movements.
  • Parkinson's disease the etiology of which is unknown, belongs to a group of the most common movement disorders named parkinsonism, which affects approximately one person per one thousand.
  • parkinsonism which affects approximately one person per one thousand.
  • These other disorders grouped under the name of parkinsonism may result from viral infection, syphilis, arteriosclerosis and trauma and exposure to toxic chemicals and narcotics. Nonetheless, it is believed that the inappropriate loss of synaptic stability may lead to the disruption of neuronal circuits and to brain diseases.
  • dysfunction in neuronal communication is considered the underlying cause for many neurologic diseases, such as PD ( Myrrhe van Spronsen and Casper C. Hoogenraad, Curr. Neurol. Neurosci. Rep. 2010, 10, 207-214 ).
  • the main pathologic feature is degeneration of dopaminergic cells in basal ganglia, especially in substantia nigra. Due to premature death of the dopamine containing neurons in substantia nigra, the largest structure of the basal ganglia, the striatum, will have reduced input from substantia nigra resulting in decreased dopamine release.
  • the understanding of the underlying pathology led to the introduction of the first successful treatment which can alleviate Parkinson's disease.
  • Virtually all approaches to the therapy of the disease are based on dopamine replacement. Drugs currently used in the treatment can be converted into dopamine after crossing the blood brain barrier, or they can boost the synthesis of dopamine and reduce its breakdown.
  • the main pathologic event, degeneration of the cells in substantia nigra is not helped. The disease continues to progress and frequently after a certain length of time, dopamine replacement treatment will lose its effectiveness.
  • This disclosure provides methods and compositions for treating PD using an SV2A inhibitor or a pharmaceutically acceptable salt thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression of PD.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with PD.
  • the symptom to be treated is cognitive impairment.
  • methods and compositions of the disclosure can be used to improve the motor/cognitive impairments symptomatic of Parkinson's disease.
  • methods and compositions of the disclosure may be useful for treating the memory impairment symptomatic of Parkinson's disease.
  • animal models for PD include the reserpine model, the methamphetamine model, the 6-hydroxydopamine (6-OHDA) model, the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) model, the paraquat (PQ)-Maneb model, the rotenone model, the 3-nitrotyrosine model and genetic models using transgenic mice.
  • Transgenic models include mice that over express ⁇ -synuclein, express human mutant forms of ⁇ -synuclein, or mice that express LRKK2 mutations. See review of these models by Ranjita B. et al. ( Ranjita B. et al.
  • BioEssays 2002, 24, 308-318 Additional information regarding these animal models is readily available from Jackson Laboratories (see also http://research.jax.org/grs/parkinsons.html), as well as in numerous publications disclosing the use of these validated models.
  • the efficacy of the methods and compositions of this disclosure in treating PD, or cognitive impairment associated with PD may be assessed in any of the above animal models of PD, as well as human subjects with PD, using a variety of cognitive tests known in the art, as discussed above.
  • autism refers to an autism spectrum disorder characterized by a neural development disorder leading to impaired social interaction and communication by restricted and repetitive behavior.
  • Autism Spectrum Disorder refers to a group of developmental disabilities that includes: autism; Asperger syndrome; pervasive developmental disorder not otherwise specified (PDD-NOS or atypical autism); Rett syndrome; and childhood disintegrative disorder.
  • Autism is a neurodevelopmental disorder characterized by dysfunction in three core behavioral dimensions: repetitive behaviors, social deficits, and cognitive deficits.
  • the repetitive behavior domain involves compulsive behaviors, unusual attachments to objects, rigid adherence to routines or rituals, and repetitive motor mannerisms such as stereotypies and self- stimulatory behaviors.
  • the social deficit dimension involves deficits in reciprocal social interactions, lack of eye contact, diminished ability to carry on conversation, and impaired daily interaction skills.
  • the cognitive deficits can include language abnormalities.
  • Autism is a disabling neurological disorder that affects thousands of Americans and encompasses a number of subtypes, with various putative causes and few documented ameliorative treatments.
  • the disorders of the autistic spectrum may be present at birth, or may have later onset, for example, at ages two or three.
  • autism There are no clear cut biological markers for autism. Diagnosis of the disorder is made by considering the degree to which the child matches the behavioral syndrome, which is characterized by poor communicative abilities, peculiarities in social and cognitive capacities, and maladaptive behavioral patterns. The dysfunction in neuronal communication is considered one of the underlying causes for autism ( Myrrhe van Spronsen and Casper C. Hoogenraad, Curr. Neurol. Neurosci. Rep. 2010, 10, 207-214 ).
  • This disclosure provides methods and compositions for treating autism using an SV2A inhibitor or a pharmaceutically acceptable salt thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression of autism.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with autism.
  • the symptom to be treated is cognitive deficit.
  • methods and compositions of the disclosure can be used to improve the motor/cognitive deficits symptomatic of autism.
  • VPA valproic acid
  • Mental retardation is a generalized disorder characterized by significantly impaired cognitive function and deficits in adaptive behaviors. Mental retardation is often defined as an Intelligence Quotient (IQ) score of less than 70. Inborn causes are among many underlying causes for mental retardation. The dysfunction in neuronal communication is also considered one of the underlying causes for mental retardation ( Myrrhe van Spronsen and Casper C. Hoogenraad, Curr. Neurol. Neurosci. Rep. 2010, 10, 207-214 ).
  • IQ Intelligence Quotient
  • mental retardation includes, but are not limited to, Down syndrome, velocariofacial syndrome, fetal alcohol syndrome, Fragile X syndrome, Klinefelter's syndrome, neurofibromatosis, congenital hypothyroidism, Williams syndrome, phenylketonuria (PKU), Smith-Lemli-Opitz syndrome, Prader-Willi syndrome, Phelan-McDermid syndrome, Mowat-Wilson syndrome, ciliopathy, Lowe syndrome and siderium type X-linked mental retardation.
  • Down syndrome is a disorder that includes a combination of birth defects, including some degree of mental retardation, characteristic facial features and, often, heart defects, increased infections, problems with vision and hearing, and other health problems.
  • Fragile X syndrome is a prevalent form of inherited mental retardation, occurring with a frequency of 1 in 4,000 males and 1 in 8,000 females. The syndrome is also characterized by developmental delay, hyperactivity, attention deficit disorder, and autistic-like behavior. There is no effective treatment for fragile X syndrome.
  • the present disclosure contemplates the treatment of mild mental retardation, moderate mental retardation, severe mental retardation, profound mental retardation, and mental retardation severity unspecified.
  • Such mental retardation may be, but is not required to be, associated with chromosomal changes, (for example Down Syndrome due to trisomy 21), heredity, pregnancy and perinatal problems, and other severe mental disorders.
  • This disclosure provides methods and compositions for treating mental retardation using an SV2A inhibitor or a pharmaceutically acceptable salt thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression of mental retardation. In certain instances, treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with mental retardation. In certain instances, the symptom to be treated is cognitive deficit/impairment.
  • methods and compositions of the disclosure can be used to improve the motor/cognitive impairments symptomatic of mental retardation.
  • Fragile X syndrome is a common form of mental retardation caused by the absence of the FMR1 protein, FMRP.
  • FMRP FMR1 protein
  • FXR1P and FXR2P Two homologs of FMRP have been identified, FXR1P and FXR2P.
  • FXR2P shows high expression in brain and testis, like FMRP
  • Fxr2 and Fmr1 knockout mice, and Fmr1 / Fxr2 double knockout mice are believed to be useful models for mental retardation such as Fragile X syndrome. See, Bontekoe C. J. M. et al. Hum. Mol. Genet. 2002, 11 (5): 487-498 .
  • the efficacy of the methods and compositions of this disclosure in treating mental retardation, or cognitive deficit/impairment associated with mental retardation may be assessed in the these mouse models and other animal models developed for mental retardation, as well as human subjects with mental retardation, using a variety of cognitive tests known in the art, as discussed above.
  • Obsessive compulsive disorder is a mental condition that is most commonly characterized by intrusive, repetitive unwanted thoughts (obsessions) resulting in compulsive behaviors and mental acts that an individual feels driven to perform (compulsion).
  • OCD Obsessive compulsive disorder
  • Current epidemiological data indicates that OCD is the fourth most common mental disorder in the United States. Some studies suggest the prevalence of OCD is between one and three percent, although the prevalence of clinically recognized OCD is much lower, suggesting that many individuals with the disorder may not be diagnosed. Patients with OCD are often diagnosed by a psychologist, psychiatrist, or psychoanalyst according to the Diagnostic and Statistical Manual of Mental Disorders, 4th edition text revision (DSM-IV-TR) (2000) diagnostic criteria that include characteristics of obsessions and compulsions.
  • Characteristics of obsession include: (1) recurrent and persistent thoughts, impulses, or images that are experienced as intrusive and that cause marked anxiety or distress; (2) the thoughts, impulses, or images are not simply excessive worries about real-life problems; and (3) the person attempts to ignore or suppress such thoughts, impulses, or images, or to neutralize them with some other thought or action.
  • the person recognizes that the obsessional thoughts, impulses, or images are a product of his or her own mind, and are not based in reality.
  • Characteristics of compulsion include: (1) repetitive behaviors or mental acts that the person feels driven to perform in response to an obsession, or according to rules that must be applied rigidly; (2) the behaviors or mental acts are aimed at preventing or reducing distress or preventing some dreaded event or situation; however, these behaviors or mental acts are not actually connected to the issue, or they are excessive.
  • OCD Online compulsion
  • Repetitive behaviors such as hand washing, counting, checking, or cleaning are often performed with the hope of preventing obsessive thoughts or making them go away. Performing these "rituals," however, only provides temporary relief.
  • People with OCD may also be diagnosed with a spectrum of other mental disorders, such as generalized anxiety disorder, anorexia nervosa, panic attack, or schizophrenia.
  • OCD may be related to abnormal levels of a neurotransmitter called serotonin.
  • the first-line treatment of OCD consists of behavioral therapy, cognitive therapy, and medications.
  • Medications for treatment include serotonin reuptake inhibitors (SRIs) such as paroxetine (SeroxatTM, Paxil®, XetanorTM, ParoMerckTM, RexetinTM), sertraline (Zoloft®, StimulotonTM), fluoxetine (Prozac®, BioxetinTM), escitalopram (Lexapro®), and fluvoxamine (Luvox®) as well as the tricyclic antidepressants, in particular clomipramine (Anafranil®).
  • SRIs serotonin reuptake inhibitors
  • Benzodiazepines are also used in treatment. As much as 40 to 60% of the patients, however, fail to adequately respond to the SRI therapy and an even greater proportion of patients fail to experience complete remission of their symptoms.
  • This disclosure provides methods and compositions for treating OCD using an SV2A inhibitor or a pharmaceutically acceptable salt thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression of OCD.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with OCD.
  • the symptom to be treated is cognitive deficit.
  • methods and compositions of the disclosure can be used to treat the cognitive deficits in OCD, and/or to improve cognitive function in patients with OCD.
  • a quinpirole-sensitized rat model has been developed for OCD.
  • the compulsive checking behavior of the quinpirole-sensitized rats is subject to interruption, which is an attribute characteristic of OCD compulsions.
  • the efficacy of the methods and compositions of this disclosure in treating OCD, or cognitive deficits associated with OCD may be assessed in this rat model and other animal models developed for OCD, as well as human subjects with OCD, using a variety of cognitive tests known in the art, as discussed above.
  • Substance addiction e.g., drug addiction, alcohol addiction
  • the addiction is not triggered instantaneously upon exposure to substance of abuse. Rather, it involves multiple, complex neural adaptations that develop with different time courses ranging from hours to days to months ( Kauer J. A. Nat. Rev. Neurosci. 2007, 8, 844-858 ).
  • the path to addiction generally begins with the voluntary use of one or more controlled substances, such as narcotics, barbiturates, methamphetamines, alcohol, nicotine, and any of a variety of other such controlled substances. Over time, with extended use of the controlled substance(s), the voluntary ability to abstain from the controlled substance(s) is compromised due to the effects of prolonged use on brain function, and thus on behavior.
  • substance addiction generally is characterized by compulsive substance craving, seeking and use that persist even in the face of negative consequences.
  • the cravings may represent changes in the underlying neurobiology of the patient which likely must be addressed in a meaningful way if recovery is to be obtained.
  • Substance addiction is also characterized in many cases by withdrawal symptoms, which for some substances are life threatening (e.g., alcohol, barbiturates) and in others can result in substantial morbidity (which may include nausea, vomiting, fever, dizziness, and profuse sweating), distress, and decreased ability to obtain recovery.
  • alcoholism also known as alcohol dependence
  • Alcoholism is primarily characterized by four symptoms, which include cravings, loss of control, physical dependence and tolerance. These symptoms also may characterize addictions to other controlled substances.
  • the craving for alcohol, as well as other controlled substances often is as strong as the need for food or water. Thus, an alcoholic may continue to drink despite serious family, health and/or legal ramifications.
  • This disclosure provides methods and compositions for treating substance addiction using an SV2A inhibitor or a pharmaceutically acceptable salt thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt thereof.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof is used in an immediate release form.
  • treatment comprises preventing or slowing the progression of substance addiction.
  • treatment comprises alleviation, amelioration, or slowing the progression of one or more symptoms associated with substance addiction.
  • the symptom to be treated is cognitive impairment.
  • methods and compositions of the disclosure can be used to treat the cognitive impairment and/or to improve cognitive function in patients with addiction.
  • SV2A synaptic vesicle protein-2
  • SV2B synaptic vesicle protein-2
  • SV2C synaptic vesicle protein-2
  • the proteins are integral membrane proteins and have a low-level homology (20-30%) to the twelve transmembrane family of bacterial and fungal transporter proteins that transport sugar, citrate, and xenobiotics ( Bajjalieh et al., Science. 257: 1271-1273. (1992 )).
  • SV2 family proteins are present in the brain and endocrine cells, and further are present in all synaptic and endocrine vesicles.
  • SV2 proteins are reported to play a role in normal synaptic function, and functions in a maturation step of primed vesicles that converts the vesicles into a Ca( 2+ )- and synaptotagmin-responsive state (Sudhof et al., 2009). Functionally, SV2 proteins are reported to enhance synaptic currents and increase the probability of transmitter release by maintaining the size of the readily releasable pool of vesicles (Custer et al., 2006).
  • SV2A inhibitor refers to any agent, substance or compound that binds to SV2A and reduces synaptic function by reducing pre-synaptic vesicle release (See, e.g., Noyer et al. 1995; Fuks et al. 2003; Lynch et al. 2004; Gillard et al.
  • a substance, or a compound or an agent is an SV2A inhibitor even if it does not itself bind to SV2A, as long as it causes, or affects the ability of, another compound or agent to bind SV2A or reduce synaptic function by reducing pre-synaptic vesicle release.
  • SV2A inhibitors include pharmaceutically acceptable salts of the inhibitors thereof. They also include hydrates, polymorphs, prodrugs, salts, and solvates of these inhibitors.
  • SV2A inhibitors or pharmaceutically acceptable salts, hydrates, solvates and polymorphs thereof that are useful in the methods and compositions of this disclosure are those disclosed, for example, United States ( U.S.) Patent Application 12/580,464 , International Patent Application PCT/US2009/005647 , U.S. Patent Application 61/105,847 , U.S. Patent Application 61/152,631 , and U.S. Patent Application 61/175,536 .
  • any SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof may be used in the methods and compositions of the disclosure.
  • the SV2A inhibitor is selected from the group of SV2A inhibitors referred to in International Patent Applications WO2010/144712 ; WO2010/002869 ; WO2008/132139 ; WO2007/065595 ; WO2006/128693 ; WO2006/128692 ; WO2005/054188 ; WO2004/087658 ; WO2002/094787 ; WO2001/062726 ; U.S. Patents 7,465,549 ; 7,244,747 ; 5,334,720 ; 4,696,943 ; 4,696,942 ; U.S.
  • Other SV2A inhibitors may also be used in this disclosure. Applicants also refer to methods of preparing these compounds found in the documents cited above. Other synthetic methods may also be used. These methods are well known to those skilled in the art.
  • the SV2A inhibitor is selected from the group consisting of levetiracetam, brivaracetam, and seletracetam or derivatives or analogs or pharmaceutically acceptable salts, solvates, hydrates, polymorphs, or prodrugs thereof.
  • the SV2A inhibitor is levetiracetam or a pharmaceutically acceptable salt thereof.
  • Levetiracetam refers to the International Union of Pure and Applied Chemistry (IUPAC) name of the compound (2S)-2-(2-oxopyrrolidin-1-yl) butanamide).
  • Levetiracetam is a widely used antiepileptic drug.
  • Levetiracetam binds to a specific site in the CNS: the synaptic vesicle protein 2A (SV2A) (See. e.g., Noyer et al. 1995; Fuks et al. 2003; Lynch et al. 2004; Gillard et al. 2006) and has further been shown to directly inhibit synaptic activity and neurotransmission by inhibiting presynaptic neurotransmitter release (Yang et al., 2007).
  • SV2A synaptic vesicle protein 2A
  • AChEIs useful for the methods and compositions of the disclosure are the following: zanapezil, ganstigmine, phenethylnorcymserine (PENC), cymserine, thiacymserine, SPH 1371 (galantamine plus), ER 127528, RS 1259, F3796, tetrahydroaminoacridine,DFP (diisopropylfluorophosphate), Ladostigil, Memoquin, SP-004, BGC-20-1259, NP-0361, ZT-1, INM-176, pyridostigmine, ambenonium, demarcarium, edrophonium, pralidoxime, Amirine, SW-10888, MF-217, Ro 45-5934, HP-290, ENA 713, CP 118.954, ONO 1603, eptastigmine, extract of magnolia, for example, magnolol, honokiol,
  • the AChE inhibitor employed in the present invention is the piperidine derivative donepezil.
  • Donepezil is also known as 2,3-dihydro-5,6-dimethoxy-2-((1-(phenylmethyl)-4-piperidinyl)methyl)-1H-inden-1-one, and is referenced by CAS number 120014-06-4 .
  • Donepezil may be used in the form of its salts, especially the halides, such as donepezil hydrochloride.
  • donepezil may also be used in the form of its pro-drugs in which the inhibitor is modified in accordance with principles of pro-drug construction known in the art. Examples of such modifications include the introduction of hydrophilic or lipophilic groups to enhance solubility, or penetration through cell membranes, respectively.
  • the present invention provides a pharmaceutical composition in accordance with the invention, for use in treating cognitive impairment associated with a central nervous system (CNS) disorder, or for use in delaying or slowing the progression of said cognitive impairment, or for use in reducing the rate of decline of cognitive function associated with said CNS disorder, in a subject having or at risk of having said cognitive impairment or decline of cognitive function.
  • CNS central nervous system
  • the disclosure provides methods and compositions for treating, or improving cognitive function in, a subject suffering from cognitive impairment associated with a CNS disorder (e.g., age-related cognitive impairment, MCI, amnestic MCI, dementia, AD, prodromal AD, PTSD, schizophrenia, bipolar disorder, ALS, cancer therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, and substance addiction), or the risk thereof in a subject in need thereof by administering a composition comprising an SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an extended release form in combination with an AChEI or a pharmaceutically acceptable salt, hydrate, solvate or polymorph, or prodrug thereof in an immediate release form.
  • a CNS disorder e.g., age-related cognitive impairment, MCI, amnestic MCI, dementia, AD, prodromal AD, PTSD, schizophrenia, bipolar disorder, ALS, cancer therapy-related cognitive impairment, mental retardation,
  • the SV2A inhibitor is selected from the group consisting of levetiracetam, seletracetam, and brivaracetam or derivatives or analogs or pharmaceutically acceptable salts, or solvates, or hydrates, or polymorphs, or prodrugs thereof.
  • the SV2A inhibitor is levetiracetam or a derivative or an analog or a pharmaceutically acceptable salt, or a solvate, or a hydrate, or a polymorph, or a prodrug thereof.
  • the AChEI is donepezil, tacrine, rivatigmine, physostigmine, galantamine, or metrifonate or derivatives or analogs or pharmaceutically acceptable salts, or solvates, or hydrates, or polymorphs, or prodrugs thereof.
  • the AChEI is donepezil or a derivative or an analog or a pharmaceutically acceptable salt or a solvate, or a hydrate, or a polymorph, or a prodrug thereof.
  • the cognitive impairment associated with a CNS disorder is age-related cognitive impairment, such as Mild Cognitive Impairment (MCI), Age-Associated Memory Impairment (AAMI), Age Related Cognitive Decline (ARCD).
  • the MCI is amnestic MCI.
  • the CNS disorder is dementia, post traumatic stress disorder (PTSD), schizophrenia, bipolar disorder, amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, and substance addiction.
  • the subject that suffers such cognitive impairment is a human patient.
  • the subject may be a human or other mammal such as a non-human primate, or rodent (e.g., rat).
  • the subject is a human patient.
  • donepezil When used clinically, donepezil shows a "cholinergic" side effect profile, and the dosage administered to patients is limited by such side effects.
  • the use of the SV2A inhibitors and pharmaceutically acceptable salts, hydrates, solvates and polymorphs thereof in combination with donepezil or other AChEIs and their pharmaceutically acceptable salts, hydrates, solvates and polymorphs reduces the amount of donepezil or other AChEIs necessary for the treatment of CNS disorders involving cognitive dysfunction and other affective disorders, including MCI, amnestic MCI, AAMI, ARCE, dementia, AD, PTSD, schizophrenia, bipolar disorder, amyotrophic lateral sclerosis (ALS), cancer-therapy-related cognitive impairment, mental retardation, Parkinson's disease (PD), autism, compulsive behavior, and substance addiction.
  • the subject that suffers such cognitive impairment is a human patient, and thus reduce the side effects caused by donepezil or other AChEIs without diminishing efficacy.
  • the efficacy of a combination of the SV2A inhibitor and donepezil or other AChEIs and pharmaceutically acceptable salts, solvates, hydrates, and polymorphs thereof exceeds the efficacy of either drug administered alone at its optimal dose and thus is an improved treatment for cognitive impairment associated with a CNS disorder.
  • compositions and methods of this disclosure preferably should readily penetrate the blood-brain barrier when peripherally administered.
  • Compounds which cannot penetrate the blood-brain barrier can still be effectively administered directly into the central nervous system, e.g., by an intraventricular or other neuro-compatible route.
  • the SV2A inhibitor and the AChEI, and pharmaceutically acceptable salts, solvates, hydrates, polymorphs thereof can be administered to a subject via any suitable route or routes.
  • the drugs are administered orally; however, administration intravenously, subcutaneously, intra-arterially, intramuscularly, intraspinally, rectally, intrathoracically, intraperitoneally, intracentricularly, or transdermally, topically, or by inhalation is also contemplated.
  • the agents can be administered orally, for example, in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, or the like, prepared by art recognized procedures.
  • the SV2A inhibitor and the AChEI, and pharmaceutically acceptable salts, solvates, hydrates, polymorphs thereof can be administered to a subject via different routes.
  • the SV2A inhibitor or its salt, solvate, hydrate, or polymorph is administered intravenously and the AChEI or its salt, solvate, hydrate, or polymorph is administered orally.
  • the administration is a slow or extended release.
  • extended release is widely recognized in the art of pharmaceutical sciences and is used herein to refer to a controlled release of an active compound or agent from a dosage form to an environment over (throughout or during) an extended period of time, e.g. greater than or equal to one hour.
  • An extended release dosage form will release drug at substantially constant rate over an extended period of time or a substantially constant amount of drug will be released incrementally over an extended period of time.
  • extended release used herein includes the terms "controlled release,” “prolonged release,” “sustained release,” “delayed release,” or “slow release” as these terms are used in the pharmaceutical sciences.
  • the extended release dosage is administered in the form of a patch or a pump.
  • extended release form refers to a dosage form that contains one or more active ingredients, where the release of at least one of the active ingredient, when placed in water or other biological fluids or solvents, may occur over an extended period, such as a period of at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 10 days, at least about 20 days, at least about 30 days, at least about 60 days, at least about 90 days, or at least about 150 days.
  • immediate release formulation refers to a formulation of an active pharmaceutical ingredient that releases greater than 80 percent of the active pharmaceutical ingredient in less than one hour in a USP dissolution method known in the art or by the manufacturer for a commercial product. Typically, the release of the active ingredient in an immediate release formulation is greater than 80 percent in less than 30 minutes.
  • the SV2A inhibitor is in an extended release form and the AChEI is in a form that is not extended release. In some instances, the AChEI is in an immediate release form.
  • the preparation When a solid carrier is used for administration, the preparation may be in a tablet, placed in a hard gelatin capsule in powder or pellet form, or it may be in the form of a troche or lozenge. If a liquid carrier is used, the preparation may be in the forms of a syrup, emulsion, soft gelatin capsule, or sterile injectable liquid such as an aqueous or non-aqueous liquid suspension or solution.
  • Dosage schedules of the agents and compositions according to the methods of the disclosure will vary according to the particular compound or compositions selected, the route of administration, the nature of the condition being treated, the age, and condition of the patient, the course, or stage of treatment, and will ultimately be at the discretion of the attending physician.
  • the amount of the SV2A inhibitor and the AChEI and their pharmaceutically acceptable salts, hydrates, solvates and polymorphs thereof administered will be amounts effective to produce a desired biological effect, such as beneficial results, including clinical results (e.g., an amount that increases GABAergic activity, reduces excitatory neurotransmission, and blocks, suppresses, or reduces acetylcholinesterase activity, and/or amounts that in combination result in an improvement in cognitive function). It will be understood that an effective amount can be administered in more than one dose and over a course of treatment.
  • Desired duration of administration of the SV2A inhibitor and the AChEI and their pharmaceutically acceptable salts, hydrates, solvates and polymorphs thereof can be determined by routine experimentation by one skilled in the art.
  • the SV2A inhibitor and the AChEI and their pharmaceutically acceptable salts, hydrates, solvates and polymorphs thereof may be administered for a period of 1-4 weeks, 1-3 months, 3-6 months, 6-12 months, 1-2 years, or more, up to the lifetime of the patient.
  • HED human equivalent dose
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof can be administered at doses according to, for example, U.S. Patent Application 12/580,464 , International Patent Application PCT/US2009/005647 , U.S. Patent Application 61/105,847 , U.S. Patent Application 61/152,631 , and U.S. Patent Application 61/175,536 .
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof is administered at a daily dose of about 0.001 mg/kg to 5 mg/kg.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof is administered at a daily dose of about 0.1 to 5 mg/kg, or about 1 to 2 mg/kg, or about 0.1 to 0.2 mg/kg, or about 0.01 to 2.5 mg/kg, or about 0.1 to 2.5 mg/kg, or about 0.4 to 2.5 mg/kg, or about 0.6 to 1.8 mg/kg, or about 0.04 to 2.5 mg/kg, or about 0.06 to 1.8 mg/kg, or about 0.01 to 1 mg/kg, or about 0.001 to 1 mg/kg, or about 0.5 to 5 mg/kg, or about 0.05 to 0.5 mg/kg.
  • the treatment is sustained until a sufficient level of cognitive function is achieved.
  • the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof can be administered at doses according to, for example, U.S. Patent Application 12/580,464 , International Patent Application PCT/US2009/005647 , U.S. Patent Application 61/105,847 , U.S. Patent Application 61/152,631 , U.S. Patent Application 61/175,536 and U.S. Patent Application 61/441,251 .
  • the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is administered at a daily dose of about 0.001 to 5 mg/kg, about 0.001 to 0.5 mg/kg, about 0.01 to 0.5 mg/kg, about 0.1 to 5 mg/kg, or about 1 to 2 mg/kg, or about 2 to 4 mg/kg, or about 2 to 3 mg/kg, or about 3 to 4 mg/kg, or about 0.2 to 0.4 mg/kg, or about 0.2 to 0.3 mg/kg, or about 0.3 to 0.4 mg/kg, or about 0.1 to 0.2 mg/kg, or about 0.01 to 2.5 mg/kg, or about 0.1 to 2.5 mg/kg, or about 0.4 to 2.5 mg/kg, or about 0.6 to 1.8 mg/kg, or about 0.5 to 2 mg/kg, or about 0.8 to 1.6, or about 0.8 to 3.6, or about 0.5 to 4 mg/kg, or about 0.04 to 2.5 mg/kg, or about 0.06 to 1.8 mg
  • the dose of the SV2A inhibitor is 0.001 - 5 mg/kg/day (which, given a typical human subject of 70 kg, is about 0.07 - 350 mg/day).
  • Doses that may be used include, but are not limited to 0.001 mg/kg/day, 0.0015 mg/kg/day, 0.002 mg/kg/day, 0.005 mg/kg/day, 0.0075 mg/kg/day, 0.01 mg/kg/day, 0.015 mg/kg/day, 0.02 mg/kg/day, 0.03 mg/kg/day, 0.04 mg/kg/day, 0.05 mg/kg/day, 0.1 mg/kg/day, 0.2 mg/kg/day, 0.3 mg/kg/day, 0.4 mg/kg/day, 0.5 mg/kg/day, 0.75 mg/kg/day, 1.0 mg/kg/day, 1.5 mg/kg/day, 2.0 mg/kg/day, 2.5 mg/kg/day, 3.0 mg/kg/day, 4.0 mg/kg/day, or 5.0
  • the dose of the SV2A inhibitor is 0.001 - 0.5 mg/kg/day (which, given a typical human subject of 70 kg, is about 0.07 - 35 mg/day), or 0.01 - 0.5 mg/kg/day (which is about 0.7 - 35 mg/day).
  • Other doses higher than, intermediate to, or less than these doses may also be used and may be determined by one skilled in the art following the methods of this disclosure.
  • the dose of the SV2A inhibitor is 0.1 to 5 mg/kg/day (which, given a typical human subject of 70 kg, is 7 to 350 mg/day). Doses that may be used include, but are not limited to 0.1 mg/kg/day, 0.5 mg/kg/day, 1 mg/kg/day, 1.5 mg/kg/day, 2 mg/kg/day, 2.5 mg/kg/day, 3 mg/kg/day, 4 mg/kg/day, or 5 mg/kg/day. In certain instances, the dose is 1-2 mg/kg/day (which, given a typical human subject of 70 kg, is 70-140 mg/day). In other instances, the dose of the SV2A inhibitor is 0.1 to 0.2 mg/kg/day. Other doses higher than, intermediate to, or less than these doses may also be used and may be determined by one skilled in the art following the methods of this disclosure.
  • the dose of the SV2A inhibitor is 0.01 to 2.5 mg/kg/day (which, given a typical human subject of 70 kg, is about 0.7 - 180 mg/day).
  • Doses that may be used include, but are not limited to 0.01 mg/kg/day, 0.02 mg/kg/day, 0.03 mg/kg/day, 0.04 mg/kg/day, 0.06 mg/kg/day, 0.08 mg/kg/day, 0.12 mg/kg/day, 0.14 mg/kg/day, 0.16 mg/kg/day, 0.18 mg/kg/day, 0.2 mg/kg/day, 0.4 mg/kg/day, 0.6 mg/kg/day, 0.8 mg/kg/day, 1.0 mg/kg/day, 1.2 mg/kg/day, 1.4 mg/kg/day, 1.6 mg/kg/day, 1.8 mg/kg/day, 2.0 mg/kg/day, 2.2 mg/kg/day, 2.4 mg/kg/day, or 2.5 mg/kg/day.
  • the dose of the SV2A inhibitor is 0.1 - 2.5 mg/kg/day (which, given a typical human subject of 70 kg, is about 7 - 180 mg/day), 0.1 - 0.2 mg/kg/day (which is about 7 - 15 mg/day), 0.2 - 0.4 mg/kg/day (about 14 - 30 mg/day), 0.4 - 2.5 mg/kg/day (about 25 - 180 mg/day), 0.6 - 1.8 mg/kg/day (about 40 - 130 mg/day), 0.04 - 2.5 mg/kg/day (about 2.5 - 180 mg/day) or 0.06 - 1.8 mg/kg/day (about 4 - 130 mg/day).
  • the dose of the SV2A inhibitor is 40 to 130 mg, 140 to 300 mg, 200 to 300 mg or 140 to 200 mg. Other doses higher than, intermediate to, or less than these doses may also be used and may be determined by one skilled in the art following the methods of this disclosure.
  • the dose of the SV2A inhibitor is 0.0015 to 7 mg/kg/day (which, given a typical human subject of 70 kg, is about 0.1 - 500 mg/day).
  • Daily doses that may be used include, but are not limited to 0.0015 mg/kg, 0.002 mg/kg, 0.0025 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1 mg/kg, 1.2 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.8 mg/kg, 2.0 mg/kg, 2.2 mg/kg, 2.4 mg/kg, 2.5 mg/
  • the daily dose of SV2A inhibitor that can be used in the methods of this disclosure include, without limitation, 0.0015 - 5 mg/kg (or 0.1 - 350 mg for a subject of 70kg), 0.01 - 0.8 mg/kg, 0.01 - 1 mg/kg, 0.01 - 1.5 mg/kg, 0.01 - 2 mg/kg, 0.01 - 2.5 mg/kg, 0.01 - 3 mg/kg, 0.01 - 3.5 mg/kg, 0.01 - 4 mg/kg, 0.01 - 5 mg/kg, 0.025 - 0.8 mg/kg, 0.025 - 1 mg/kg, 0.025 - 1.5 mg/kg, 0.025 - 2 mg/kg, 0.025 - 2.5 mg/kg, 0.025 - 3 mg/kg, 0.025 - 3.5 mg/kg, 0.025 - 4 mg/kg, 0.05 - 0.8 mg/kg, 0.05 - 1 mg/kg, 0.05 - 1.5 mg/kg, 0.05 - 2 mg/kg,
  • the interval of administration is 24 hours. Administration at less frequent intervals, such as once less than 24 hours, may also be used.
  • the SV2A inhibitor is administered at a total daily dose of 0.1 to 5 mg/kg. In some instances, the SV2A inhibitor is administered every 24 hours at a daily dose of 1 to 2 mg/kg. In another instance, the SV2A inhibitor is administered every 24 hours at a daily dose of 0.1 - 0.2 mg/kg. In some instances, the SV2A inhibitor is administered at a daily dose of 0.01 to 2.5 mg/kg. In some instances, the SV2A inhibitor is administered at a daily dose of 0.1 to 2.5 mg/kg.
  • the SV2A inhibitor is administered at a daily dose of 0.4 to 2.5 mg/kg. In some instances, the SV2A inhibitor is administered at a daily dose of 0.6 to 1.8 mg/kg. In some instances, the selective inhibitor of SV2A is administered at a daily dose of 0.04 - 2.5 mg/kg. In some instances, the selective inhibitor of SV2A is administered at a daily dose of 0.06 - 1.8 mg/kg. In some instances, the selective inhibitor of SV2A is administered at a daily dose of 0.001 -5 mg/kg. In some instances, the selective inhibitor of SV2A is administered at a daily dose of 0.001 - 0.5 mg/kg. In some instances, the selective inhibitor of SV2A is administered at a daily dose of 0.01 - 0.5 mg/kg.
  • the SV2A inhibitor is levetiracetam or a pharmaceutically acceptable salt thereof.
  • levetiracetam or its pharmaceutically acceptable salt is administered at a daily dose of about 1 to 2 mg/kg, or about 0.1 to 2.5 mg/kg, or about 0.4 to 2.5 mg/kg, or about 0.6 to 1.8 mg/kg, or about 2.0 to 3.0 mg/kg, or about 3.0 to 4.0 mg/kg, or about 2.0 to 4.0 mg/kg, or about 0.1 to 5 mg/kg, or about 70 to 140 mg, or about 7 to 180 mg, or about 25 to 180 mg, or about 40 to 130 mg, or about 140 to 300 mg, or about 200 to 300 mg, or about 140 to 200 mg, or about 7 to 350 mg.
  • the levetiracetam or its pharmaceutically acceptable salt is administered according to one of the daily dose ranges indicated as "+" listed in Table 1 or Table 2.
  • the levetiracetam or its pharmaceutically acceptable salt is administered at a daily dose of about 0.1 - 5 mg/kg, about 1 - 5 mg/kg, about 1.5 - 4 mg/kg, about 1.8 - 3.6 mg/kg, about 7 - 350 mg, about 70 - 350 mg, about 100 - 300 mg, or about 125 -250 mg.
  • the SV2A inhibitor is brivaracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof.
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is administered at a daily dose of about 0.1 to 0.2 mg/kg, or about 0.01 to 2.5 mg/kg, or about 0.04 to 2.5 mg/kg, or about 0.06 to 1.8 mg/kg, or about 0.2 to 0.4 mg/kg, or about 7 to 15 mg, or about 0.7 to 180 mg, or about 2.5 to 180 mg, or about 4.0 to 130 mg, or about 14 to 30 mg.
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.1 mg, 0.5 mg, 0.75 mg, 1.0 mg, 1.5 mg, or 2.0 mg, but no more than a daily dose of 2.5 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, or 35 mg.
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.0015 mg/kg, 0.0075 mg/kg, 0.01 mg/kg, 0.015 mg/kg, 0.02 mg/kg, or 0.03 mg/kg, but no more than a daily dose of 0.5 mg/kg, 0.4 mg/kg, 0.3 mg/kg, 0.2 mg/kg, 0.15 mg/kg, 0.1 mg/kg, 0.05 mg/kg, or 0.04 mg/kg.
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered according to one of the daily dose ranges indicated as "+" listed in Table 3 or Table 4.
  • the brivaracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof may be administered at a daily dose of 0.1 - 35 mg, 0.5 - 35 mg, 0.75 - 35 mg, 1.0 - 35 mg, 1.5 - 35 mg, 2.0 - 35 mg, 0.1 - 30 mg, 0.1 - 25 mg, 0.1 - 20 mg, 0.1 - 15 mg, 0.1 - 10 mg, 0.1 - 5 mg, 0.1 - 2.5 mg, 0.0015 - 0.5 mg/kg, 0.0075 - 0.5 mg/kg, 0.01 - 0.5 mg/kg, 0.015 - 0.5 mg/kg, 0.02 - 0.5 mg/kg, 0.03 - 0.5 mg/kg, 0.0015 - 0.4
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.0015 mg/kg, 0.002 mg/kg, 0.0025 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, but no more than a daily dose of 1 mg/kg, 1.2 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.8 mg/kg, 2.0 mg/kg, 2.2 mg/kg, 2.4 mg/kg, 2.5 mg/kg, 2.6 mg/kg, 2.8 mg/kg, 3.0 mg/kg, 3.5 mg/kg, 4.0 mg/kg, 4.5 mg/kg,
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.1 mg, 0.15 mg, 0.18 mg, 0.35 mg, 0.7 mg, 1.5 mg, 2.0 mg, 2.5 mg, 2.8 mg, 3.0 mg, 3.5 mg, 4.2 mg, 5 mg, 5.5 mg, 6.0 mg, 7 mg, 10 mg, 15 mg, 20 mg, 25 mg, 28 mg, 30 mg, or 35 mg but no more than a daily dose of 70 mg, 80 mg, 85 mg, 100 mg, 110 mg, 125 mg, 140 mg, 150 mg, 170 mg, 175 mg, 180 mg, 190 mg, 200 mg, 210 mg, 225 mg, 250 mg, 280 mg, 300 mg, or 350 mg.
  • the brivaracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof may be administered at a daily dose of 0.0015 - 5 mg/kg, 0.1 - 350 mg, 0.01 - 5 mg/kg, 0.7 - 350 mg, 0.05 - 4 mg/kg, 3 - 300 mg, 0.05 - 2.0 mg/kg, 3 - 150 mg, 0.05 - 1.5 mg, 3 - 110 mg, 0.1 - 1.0 mg/kg, 7 -70 mg.
  • the brivaracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered according to one of the daily dose ranges indicated as "+" listed in Table 5 or Table 6.
  • the brivaracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof may be administered at a daily dose of 0.01 - 0.8 mg/kg, 0.01 - 1 mg/kg, 0.01 - 1.5 mg/kg, 0.01 - 2 mg/kg, 0.01 - 2.5 mg/kg, 0.01 - 3 mg/kg, 0.01 - 3.5 mg/kg, 0.01 - 4 mg/kg, 0.01 - 5 mg/kg, 0.025 - 0.8 mg/kg, 0.025 - 1 mg/kg, 0.025 - 1.5 mg/kg, 0.025 - 2 mg/kg, 0.025 - 2.5 mg/kg, 0.025 - 3 mg/kg, 0.025 - 3.5 mg/kg, 0.025 - 5 mg/
  • the SV2A inhibitor is seletracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof.
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is administered at a daily dose of at least 0.1 mg, 0.5 mg, 0.75 mg, 1.0 mg, 1.5 mg, or 2.0 mg, but no more than a daily dose of 2.5 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, or 35 mg.
  • the seletracetam or a pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof is administered at a daily dose of at least 0.0015 mg/kg, 0.0075 mg/kg, 0.01 mg/kg, 0.015 mg/kg, 0.02 mg/kg, or 0.03 mg/kg, but no more than a daily dose of 0.5 mg/kg, 0.4 mg/kg, 0.3 mg/kg, 0.2 mg/kg, 0.15 mg/kg, 0.1 mg/kg, 0.05 mg/kg, or 0.04 mg/kg.
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered according to one of the daily dose ranges indicated as "+" listed in Table 7 or Table 8.
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate or polymorph may be administered at a daily dose of 0.1 - 35 mg, 0.5 - 35 mg, 0.75 - 35 mg, 1.0 - 35 mg, 1.5 - 35 mg, 2.0 - 35 mg, 0.1 - 30 mg, 0.1 - 25 mg, 0.1 - 20 mg, 0.1 - 15 mg, 0.1 - 10 mg, 0.1 - 5 mg, 0.1 - 2.5 mg, 0.0015 - 0.5 mg/kg, 0.0075 - 0.5 mg/kg, 0.01 - 0.5 mg/kg, 0.015 - 0.5 mg/kg, 0.02 - 0.5 mg/kg, 0.03 - 0.5 mg/kg, 0.0015 - 0.4 mg/kg, 0.0015
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.0015 mg/kg, 0.002 mg/kg, 0.0025 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, but no more than a daily dose of 1 mg/kg, 1.2 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.8 mg/kg, 2.0 mg/kg, 2.2 mg/kg, 2.4 mg/kg, 2.5 mg/kg, 2.6 mg/kg, 2.8 mg/kg, 3.0 mg/kg, 3.5 mg/kg, 4.0 mg/kg, 4.5 mg/kg, or
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered at a daily dose of at least 0.1 mg, 0.15 mg, 0.18 mg, 0.35 mg, 0.7 mg, 1.5 mg, 2.0 mg, 2.5 mg, 2.8 mg, 3.0 mg, 3.5 mg, 4.2 mg, 5 mg, 5.5 mg, 6.0 mg, 7 mg, 10 mg, 15 mg, 20 mg, 25 mg, 28 mg, 30 mg, or 35 mg but no more than a daily dose of 70 mg, 80 mg, 85 mg, 100 mg, 110 mg, 125 mg, 140 mg, 150 mg, 170 mg, 175 mg, 180 mg, 190 mg, 200 mg, 210 mg, 225 mg, 250 mg, 280 mg, 300 mg, or 350 mg.
  • the brivaracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof may be administered at a daily dose of 0.0015 - 5 mg/kg, 0.1 - 350 mg, 0.01 - 5 mg/kg, 0.7 - 350 mg, 0.05 - 4 mg/kg, 3 - 300 mg, 0.05 - 2.0 mg/kg, 3 - 150 mg, 0.05 - 1.5 mg, 3 - 110 mg, 0.1 - 1.0 mg/kg, 7 -70 mg.
  • the seletracetam or its pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug is administered according to one of the daily dose ranges indicated as "+" listed in Table 9 or Table 10.
  • the seletracetam or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof may be administered at a daily dose of 0.01 - 0.8 mg/kg, 0.01 - 1 mg/kg, 0.01 - 1.5 mg/kg, 0.01 - 2 mg/kg, 0.01 - 2.5 mg/kg, 0.01 - 3 mg/kg, 0.01 - 3.5 mg/kg, 0.01 - 4 mg/kg, 0.01 - 5 mg/kg, 0.025 - 0.8 mg/kg, 0.025 - 1 mg/kg, 0.025 - 1.5 mg/kg, 0.025 - 2 mg/kg, 0.025 - 2.5 mg/kg, 0.025 - 3 mg/kg, 0.025 - 3.5 mg/kg, 0.025 - 4
  • the SV2A inhibitor or its pharmaceutically acceptable salt, hydrate, solvate and polymorph may be administered at a subtherapeutic dosage levels when provided in combination with an AChEI or its pharmaceutically acceptable salt, hydrate, solvate and polymorph, due to an AChEI-dependent increase in the therapeutic index of the SV2A inhibitor.
  • the increase in the therapeutic index of the SV2A inhibitor, due to the combination with an AChEI, is greater than the therapeutic index of the SV2A inhibitor administered in the absence of the AChEI by at least about 1.5x or 2.0x or 2.5x or 3.0x or 3.5x or 4.0x or 4.5x or 5.0x or 5.5x or 6.0x or 6.5x or 7.0x or 7.5x or 8.0x or 8.5x or 9.0x or 9.5x or 10x, or greater than about 10x.
  • combinations of an SV2A inhibitor with an AChEI reduces the dosage of the SV2A inhibitor required for its therapeutic effect.
  • the amount of the SV2A inhibitor administered in combination with the AChEI is a subtherapeutic amount.
  • the SV2A inhibitor or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof is administered at a daily dose of less than 5 mg/kg, less than 2.5 mg/kg, less than 2 mg/kg, less than 1.5 mg/kg, less than 1 mg/kg, less than 0.5 mg/kg, less than 0.1 mg/kg, less than 0.05 mg/kg, less than 0.01 mg/kg, less than 0.005 mg/kg, or less than 0.001 mg/kg.
  • the AChEI or its pharmaceutically acceptable salt, hydrate, solvate and polymorph may be administered at a dosage level up to conventional dosage levels. Suitable dosage levels will depend upon the specific AChEI that is chosen.
  • the AChEI may be administered on a regimen of up to 2 times per day, 1 time per day, or it may be administered less often.
  • a typical daily dosage when administered alone is about 5 to 10 mg.
  • the amount of ARICEPT® administered in combination with an SV2A inhibitor is about 0.1 to 10 mg.
  • the amount of ARICEPT® administered in combination with the SV2A inhibitor is a subtherapeutic amount.
  • the amount of ARICEPT® administered in combination with the SV2A inhibitor is less than 10 mg daily, less than 5 mg daily, less than 1 mg daily, less than 0.5 mg daily, or less than 0.1 mg daily.
  • the AChEI or a salt, hydrate, solvate or polymorph, or prodrug thereof may be administered at dosage levels distinct from conventional levels when provided in combination with an SV2A inhibitor, due to an SV2A inhibitor-dependent increase in the AChEI's therapeutic index.
  • the increase in the AChEI's therapeutic index due to the combination with an SV2A inhibitor thereof is greater than the therapeutic index of the AChEI administered in the absence of an SV2A inhibitor by at least about 1.5x or 2.0x or 2.5x or 3.0x or 3.5x or 4.0x or 4.5x or 5.0x or 5.5x or 6.0x or 6.5x or 7.0x or 7.5x or 8.0x or 8.5x or 9.0x or 9.5x or 10x, or greater than about 10x.
  • combinations of an AChEI with the SV2A inhibitor reduces the dosage of the AChEI required for its therapeutic effect.
  • the amount of the AChEI administered in combination with the SV2A inhibitor thereof is about 0.1 to 10 mg. In some instances, the amount of the AChEI administered in combination with the SV2A inhibitor is a subtherapeutic amount. In some instances, the amount of the AChEI administered in combination with the SV2A inhibitor is less than 10 mg daily, less than 5 mg daily, less than 1 mg daily, less than 0.5 mg daily, or less that 0.1 mg daily.
  • the frequency of administration of the composition of this disclosure may be adjusted over the course of the treatment, based on the judgment of the administering physician. It will be clear that the SV2A inhibitor and the AChEI and their salts, hydrates, solvates and polymorphs can be administered at different dosing frequencies or intervals. For example, an SV2A inhibitor can be administered daily (including multiple doses per day) or less frequently. An AChEI can be administered daily (including multiple doses per day) or less frequently. In some instances, sustained continuous release formulations of an SV2A inhibitor and an AChEI may be desired. Various formulations and devices for achieving sustained release are known in the art.
  • AChEIs such as donepezil
  • their salts, hydrates, solvates and polymorphs can cause cholinergic side effects.
  • the use of a combination of an SV2A inhibitor and an AChEI may reduce the amount of the AChEI necessary for treatment of cognitive impairment associated with a CNS disorder, and may thus reduce the side effects caused by the AChEIs.
  • the combination of an SV2A inhibitor with a reduced amount of AChEI may reduce the cholinergic side effects without negatively impacting efficacy. Accordingly, in some instances, a subtherapeutic amount of AChEI is administered.
  • a suitable amount of the SV2A inhibitor is administered so as to reduce the dose of the AChEI (e.g., a dose required to effect a degree of cognitive function improvement or treat age-associated cognitive impairment) by at least about 20%, at least about 30%, at least about 40%, or at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more from to the dose of AChEI normally used when administered alone (i.e., individually and not in combination with other therapeutic agents or compounds).
  • the reduction may be reflected in terms of amount administered at a given administration and/or amount administered over a given period of time (reduced frequency).
  • the combined administration of an SV2A inhibitor or a salt, hydrate, solvate and polymorph, or prodrug thereof and an AChEI or a salt, hydrate, solvate and polymorph, or prodrug thereof can attain a longer or improved therapeutic effect in the subject than that attained by administering only the AChEI or only the SV2A inhibitor, by at least about 1.5x, or 2.0x, or 2.5x, or 3.0x, or 3.5x, or 4.0x, or 4.5x, or 5.0x, or 5.5x, or 6.0x, or 6.5x, or 7.0x, or 7.5x, or 8.0x, or 8.5x, or 9.0x, or 9.5x, or 10x, or greater than about 10x.
  • the disclosure provides compositions comprising an SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof in an extended release form and an AChEI and its salts, hydrates, solvates, polymorphs, or prodrugs.
  • the AChEI or the pharmaceutically acceptable salt thereof present in the composition is in a form that is not extended release.
  • the AChEI or the pharmaceutically acceptable salt thereof present in the composition is in an immediate release form.
  • the SV2A inhibitor and the AChEI may be present in a single dosage unit (e.g., combined together in one capsule, tablet, powder, or liquid, etc.).
  • the AChEI in the composition is donepezil.
  • the composition includes levetiracetam, or seletracetam, or brivaracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph, or prodrug thereof as the SV2A inhibitor, and includes donepezil or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate, or polymorph, or prodrug thereof as the AChEI.
  • the composition includes levetiracetam or a derivative or an analog or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof and donepezil or a pharmaceutically acceptable salt, hydrate, solvate and polymorph, or prodrug thereof.
  • the composition described herein can contain more than one SV2A inhibitor and/or more than one AChEI.
  • the extended release SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the composition does not affect the pharmacokinetics or the half-life clearance of the AChEI or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the same composition.
  • donepezil an example of an AChEI
  • levetiracetam an example of an SV2A inhibitor
  • the present disclosure provides a composition comprising an extended release form of levetiracetam and a non-extended release form of donepezil and such composition is a once daily formulation.
  • the once daily formulation is for higher compliance among patients suffering from cognitive impairment.
  • compositions described herein can further contain pharmaceutically acceptable excipient(s) and may contain other agents that serve to enhance and/or complement the effectiveness of the SV2A inhibitor and/or the AChEI.
  • compositions may also contain additional agents known to be useful for treating cognitive function disorder.
  • composition in the present disclosure may be in solid dosage forms such as capsules, tablets, dragrees, pills, lozenges, powders and granule. Where appropriate, they may be prepared with coatings such as enteric coatings or they may be formulated so as to provide controlled releases of one or more active ingredient such as sustained or prolonged release according to methods well known in the art. In certain instances, the composition is in form of a slow, controlled, or extended release.
  • extended release is widely recognized in the art of pharmaceutical sciences and is used herein to refer to a controlled release of an active compound or agent from a dosage form to an environment over (throughout or during) an extended period of time, e.g. greater than or equal to one hour.
  • extended release dosage form will release drug at substantially constant rate over an extended period of time or a substantially constant amount of drug will be released incrementally over an extended period of time.
  • extended release used herein includes the terms “controlled release”, “prolonged release”, “sustained release”, or “slow release”, as these terms are used in the pharmaceutical sciences.
  • the extended release dosage is administered in the form of a patch or a pump.
  • the composition may also be in liquid dosage forms including solutions, emulsions, suspensions, syrups, and elixirs.
  • compositions may be specifically formulated for administration by any suitable route as described herein and known in the art.
  • Compositions for parental administration include sterile aqueous and nonaqueous injectable solutions, dispersions, suspensions or emulsions as well as sterile powders to be reconstituted in sterile injectable solutions or dispersions prior to use.
  • Compositions for intraoral and oral delivery include but are not limited to bioadhesive polymers, tablets, patches, liquids and semisolids (see e.g., Smart et al).
  • compositions for respiratory delivery include but are not limited to a variety of pressurized metered dose inhalers, dry powder inhalers, nebulizers, aqueous mist inhalers, drops, solutions, suspensions, sprays, powders, gels, ointments, and specialized systems such as liposomes and microspheres (see e.g. Owens et al, "Alternative Routes of Insulin Delivery " and Martini et al).
  • Compositions for transdermal delivery include but are not limited to colloids, patches, and microemulsions.
  • Other suitable administration forms for the above and other include depot injectable formulations, suppositories, sprays, ointments, cremes, gels, inhalants, dermal patches, implants etc.
  • compositions may also contain adjuvants, such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride
  • Therapeutic formulations can be prepared by methods well known in the art of pharmacy, see, e.g., Goodman et al., 2001; Ansel, et al., 2004; Stoklosa et al., 2001; and Bustamante, et al., 1993.
  • a composition comprising an SV2A inhibitor and an AChEI and their salts, hydrates, solvates, polymorphs, prodrugs comprises an amount of the SV2A inhibitor between 0.07 and 350 mg, or between 50 and 200 mg, or between 3 and 50 mg. In some instances, the amount of the SV2A inhibitor is less than 350 mg, less than 250 mg, less than 200 mg, less than 150 mg, less than 100 mg, less than 50 mg, less than 10 mg, less than 5 mg, less than 1 mg, less than 0.5 mg, less than 0.1 mg, or less than 0.07 mg.
  • the amount of the AChEI in the composition is about 0.1 - 10 mg, 1 - 10 mg, 2 - 10 mg, 2 - 8 mg, or 2 - 5 mg. In some instances, the amount of the AChEI in the composition is less than 10 mg, less than 9 mg, less than 8 mg, less than 7 mg, less than 6 mg, less than 5 mg, less than 2 mg, less than 1 mg, or less than 0.5 mg.
  • the amount of the SV2A inhibitor present in the composition is 0.07 - 60 mg, 0.07 - 350 mg, 25 - 60 mg, 25 - 125 mg, 50 - 250 mg, 5 - 140 mg, 0.7 - 180 mg, 125 - 240 mg, 3 - 50 mg, 3 - 60 mg, 0.05 - 35 mg, 0.07 - 60 mg, 0.07 - 350 mg, 25 - 60 mg, 25 - 125 mg, 50 - 250 mg, 5 - 15 mg, 5 - 30 mg, 5 - 140 mg, 0.7 - 180 mg, 125 - 240 mg, 3 -50 mg, or 0.07 - 50 mg, or 3 - 60 mg.
  • the amount of the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the composition is less than 350 mg, less than 250 mg, less than 200 mg, less than 150 mg, less than 100 mg, less than 50 mg, less than 35 mg, less than 10 mg, less than 5 mg, less than 1 mg, less than 0.5 mg, less than 0.1 mg, less than 0.07 mg, or less than 0.05 mg.
  • the amount of the SV2A inhibitor or the pharmaceutically acceptable salt, hydrate, solvate, polymorph, or prodrug thereof present in the composition is about 0.1 - 500 mg, 0.1 - 300 mg, 0.7 - 300 mg, 3 - 300 mg, 3 - 150 mg, 3 - 110 mg, 7 - 70 mg, 7 - 300 mg, 70 - 300 mg, 100 - 300 mg, 125 - 250 mg, 0.5 - 50 mg, 0.5 - 75 mg, 0.5 - 100 mg, 0.5 - 150 mg, 0.5 - 200 mg, 0.5 - 225 mg, 0.5 - 250 mg, 0.5 - 300 mg, 1.5 - 50 mg, 1.5 - 75 mg, 1.5 - 100 mg, 1.5 - 150 mg, 1.5 - 200 mg, 1.5 - 225 mg, 1.5 - 250 mg, 1.5 - 300 mg, 3 - 50 mg, 3 - 75 mg, 3 - 100 mg, 3 - 150 mg, 3 - 200 mg, 1.5 - 225 mg, 1.5 - 250
  • the SV2A inhibitor is levetiracetam and the AChEI is donepezil. In some of the above instances, the SV2A inhibitor is brivaracetam and the AChEI is donepezil. In some of the above instances, the SV2A inhibitor is seletracetam and the AChEI is donepezil. In the above instances, the donepezil may be substituted with tacrine, rivatigmine, physostigmine, galantamine, or metrifonate.
  • the AChEI e.g., donepezil or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate
  • their salts, hydrates, solvates, polymorphs, or prodrugs is not in an extended release form.
  • the AChEI e.g., donepezil or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate
  • their salts, hydrates, solvates, polymorphs, or prodrugs is not in an extended release form.
  • the AChEI e.g., donepezil or tacrine, rivatigmine, physostigmine, galantamine, or metrifonate
  • their salts, hydrates, solvates, polymorphs, or prodrugs is not in an extended release form.
  • compositions and methods described herein may be adapted and modified as is appropriate for the application being addressed and that the compositions and methods described herein may be employed in other suitable applications, and that such other additions and modifications will not depart from the scope hereof.
  • a variety of conditions characterized by cognitive impairment e.g., Age-Associated Memory Impairment (AAMI), Mild Cognitive Impairment (MCI) and Age-related Cognitive Decline (ARCD) are believed to be related to aging. Others are related to disease, for example, AD.
  • Animal models serve as an important resource for developing and evaluating treatments for such age-related cognitive impairments. Features that characterize age-related cognitive impairment in animal models typically extend to age-related cognitive impairment in humans. Efficacy in such animal models is, thus, predictive of efficacy in humans.
  • a Long-Evans rat model of cognitive impairment is particularly well suited for distinguishing the difference between cognitive impairment related to illness and that related to aging. Indeed, extensive behavioral characterization has identified a naturally occurring form of cognitive impairment in an outbred strain of aged Long-Evans rats ( Charles River Laboratories; Gallagher et al., Behav. Neurosci. 107:618-626, (1993 )). In a behavioral assessment with the Morris Water Maze (MWM), rats learn and remember the location of an escape platform guided by a configuration of spatial cues surrounding the maze. The cognitive basis of performance is tested in probe trials using measures of the animal's spatial bias in searching for the location of the escape platform.
  • MMM Morris Water Maze
  • Aged rats in the study population have no difficulty swimming to a visible platform, but an age-dependent impairment is detected when the platform is camouflaged, requiring the use of spatial information. Performance for individual aged rats in the outbred Long-Evans strain varies greatly. For example, a proportion of those rats perform on a par with young adults. However, approximately 40-50% falls outside the range of young performance. This variability among aged rats reflects reliable individual differences. Thus, within the aged population some animals are cognitively impaired and designated aged-impaired (AI) and other animals are not impaired and are designated aged-unimpaired (AU). See, e.g., Colombo et al., Proc. Natl. Acad. Sci.
  • Example 1 Behavioral Assessment of Levetiracetam, Donepezil, and Combined Treatments in a Radial Arm Maze Task
  • mice Male Long-Evans rats were obtained at 8 to 9 months of age from Charles River Laboratories (Raleigh, NC) and housed in a vivarium until 24 to 26 months of age. All rats were individually housed at 25°C and maintained on a 12 h light/dark cycle. Food and water were provided ad libitum unless noted otherwise. The rats were examined for health and pathogen-free status throughout the experiments, as well as necropsies at the time of killing.
  • the radial maze consisted of eight arms projecting from each side of an octagonal center platform, with food well located at the distal end of each arm. PlexiglasTM blocks could be positioned to prevent entry into any arm. Extra-maze cues were provided in the room surrounding the maze and illumination was provided by an overhead light.
  • Pre-training as described in detail in Chappell et al. Neuropharmacology 37: 481-487 (1998 ), consisted of habituation, standard win-shift training, and win-shift training with delays interposed between information and memory test phases. Drug treatments began 2 days after the completion of pre-training. Three arms were blocked at the beginning of each trial (information phase). The identity and configuration of the blocked arms varied across trials.
  • the number of "errors" the AI rats made during the retention test phase was tracked.
  • An error consisted of returning to an arm (all four paws on the arm) from which food had already been obtained. For example, an error occurs in the trials if the rats enter an arm from which food has already been retrieved in the pre-delay component of the trial or if it re-visits an arm in the post-delay session that has already been visited.
  • the AI rats are pretreated 30-40 minutes before daily trials with a one-time shot of the following six conditions: 1) vehicle control (0.9% saline solution); 2) levetiracetam (1.25 mg/kg/day); 3) levetiracetam (2.5 mg/kg/day); 4) levetiracetam (5 mg/kg/day); 5) levetiracetam (10 mg/kg/day); 6) levetiracetam (20 mg/kg/day); through intraperitoneal (i.p.) injection. Injections are given every other day with intervening washout days. To counterbalance any potential bias, drug effect is assessed using ascending-descending dose series, i.e., the dose series are given first in an ascending order and then repeated in a descending order. Therefore, each dose has two determinations.
  • the AI rats are pretreated 30-40 minutes before daily trials with a one-time shot of the following three conditions: 1) vehicle control (0.9% saline solution); 2) donepezil (1 mg/kg/day); 3) donepezil (2 mg/kg/day); through intraperitoneal (i.p.) injection. Injections are given every day.
  • drug effect is assessed using ascending-descending dose series, i.e., the dose series are given first in an ascending order and then repeated in a descending order. Therefore, each dose has two determinations.
  • Parametric statistics are used to compare the retention test performance of the AI rats in a two-hour delay version of the RAM task in the context of different doses of donepezil and vehicle control ( see FIG. 2 ).
  • the AI rats are pretreated 30-40 minutes before daily trials with a one-time shot of the following two conditions: 1) vehicle control (0.9% saline solution); 2) donepezil (1 mg/kg/day) and levetiracetam (2.5 mg/kg/day); through intraperitoneal (i.p.) injection. Injections are given every day. To counterbalance any potential bias, drug effect is assessed using ascending-descending dose series, i.e., the dose series are given first in an ascending order and then repeated in a descending order. Therefore, each dose has two determinations.
  • Parametric statistics are used to compare the retention test performance of the AI rats in a two-hour delay version of the RAM task in the context of a combination of levetiracetam and donepezil and vehicle control ( see FIG. 2 ).
  • Example 2 Levetiracetam Treatments in Human Subjects with aMCI
  • a within-subjects trial of 8 weeks duration, involving 17 amnestic MCI (aMCI) subjects and 17 age-matched controls with a low dose treatment of levetiracetam is conducted.
  • each aMCI subject receives both drug and placebo treatments separately in two periods of two weeks each, with the order of treatments among different aMCI subjects counterbalanced (see FIG. 3 ).
  • Age-matched control subjects treated with placebo serve as a further control.
  • Cognitive testing and fMRI imaging data are obtained from the subjects after each two week period of drug/placebo treatment.
  • 17 right-handed aMCI patients are recruited from the Alzheimer's Disease Research Center (ADRC) at the Johns Hopkins Hospital and other referrals.
  • An additional 17 right-handed healthy volunteers are recruited from the pool of control participants in the ADRC and other referrals.
  • All participants are administered the Telephone Interview of Cognitive Status to determine if they are likely to pass the entry criteria of the study (including criteria for MRI scanning).
  • All participants further undergo neurological, psychiatric, and neuropsychological examination using standardized instruments and methods.
  • the psychiatric evaluation includes administration of the Structured Clinical Interview for DSM-IV Axis I Disorders and the Clinical Dementia Rating (CDR) scale. All aMCI patients have CDR scores of 0.5.
  • Diagnosis of aMCI is based on the criteria proposed by Petersen et al. (e.g., " Mild cognitive impairment: Aging to Alzheimer's Disease,” Oxford University Press, N.Y. (2003 ), which include a memory complaint (corroborated by an informant), impaired memory function on testing (1.5 standard deviations below norm), otherwise preserved cognitive functioning (within 1 standard deviation of norm), no decline in functional ability, and no dementia.
  • Final aMCI diagnoses are reached by clinical consensus. Exclusion criteria include major neurological or psychiatric disorders, head trauma with loss of consciousness, history of drug abuse or dependency, and general contraindications to an MRI examination (e.g. cardiac pacemaker, aneurysm coils, claustrophobia).
  • Each aMCI subject is required to have a study partner (i.e., an informant) who can provide information about the subject's daily function and assure that medications are taken appropriately. See FIGS. 14A and 14B .
  • Study Visits The study consists of 4 visits over the course of 8 weeks (see FIG. 3 ).
  • the Baseline Visit is for the purpose of performing medical, neurological, psychiatric, and neurocognitive assessments. Visits 1 and 2 are identical to the Baseline Visit but include a fMRI session.
  • the Washout Visit at the end of a 4 week washout period, is for the purpose of a brief clinical assessment and initiation of the second drug/placebo phase.
  • Baseline Visit At the screening visit, informed consent is obtained from the subject (and an informant in the case of MCI subjects). The subject and the informant participate in a standardized clinical interview that is used to determine the degree of the subject's functional impairment in daily life, based on the Clinical Dementia Rating (CDR) scale.
  • CDR Clinical Dementia Rating
  • the subject's medical, neurological, and psychiatric history is obtained (including a review of current medications), as well as the family history of dementia. Brief medical, neurological and psychiatric exams are conducted (including vital signs). Blood is drawn in order to perform standard laboratory tests needed to determine if the subject meets the entry criteria. The subject is re-screened for contraindications to MRI scanning, using the standard form employed at the Kirby Imaging Center.
  • Visit 1 At the end of the first drug/placebo period 2 weeks after the Baseline Visit, the medical, neurological and psychiatric evaluations and cognitive testing are repeated. The subject is also clinically evaluated for suicidal ideation. Blood is drawn again to repeat the standard tests and to determine whether there are any changes related to drug treatment; the subject's blood levetiracetam level is also obtained. All medication dispensed at the Baseline Visit (drug or placebo) is collected and subject compliance with the medication regimen is assessed. The first fMRI session (with cognitive tests) is conducted on the same day, either immediately before or immediately after the clinical assessment. Subjects discontinue first period treatment at this visit.
  • Washout Visit At the end of a washout period (4 weeks) following Visit 1, the subject receives a brief medical screening, including a medical and psychiatric evaluation. Blood is drawn to obtain the blood levetiracetam level (to confirm washout). The subject is provided with new medication (drug or placebo, alternated from what was assigned in the previous treatment period) for the final phase of the study with instructions about how it should be taken.
  • Visit 2 At approximately 2 weeks after the Washout Visit (i.e., 2 weeks after starting the second treatment period), the medical, neurological and psychiatric evaluations and the cognitive testing are repeated. The subject is clinically evaluated for suicidal ideation. Blood is drawn again to repeat the standard tests and to determine whether there were any changes related to drug treatment; the subject's blood levetiracetam level is also obtained. All medication dispensed at the Washout Visit is collected and subject compliance with the medication regimen is assessed. The second fMRI session (with cognitive tests) is repeated on the same day, either immediately before or immediately after the clinical assessment.
  • the drug treatment period is the two weeks preceding Visit 1 or 2 (with the two week period preceding the other Visit being the placebo phase).
  • half a scored 250 mg tablet of levetiracetam is used to achieve a dose of 125 mg twice a day, which is approximately 3.6 mg/kg/day (assuming an average adult human weight of 70 kg).
  • All drug and placebo preparations are performed on a 1:1 allocation.
  • the pharmacy randomizes patients top drug dose and condition as they enroll, and keep a list of drug assignment.
  • Levetiracetam is rapidly and almost completely absorbed after oral administration, and its bioavailability is not affected by food.
  • Plasma half-life of levetiracetam is approximately 7 ⁇ 1 hour (expected to be 9-10 hours in elderly due to decreased renal function). Absorption is rapid, with peak plasma concentrations occurring about 1 hour following oral administration. Steady state can be achieved after 2 days of multiple twice-daily dosing.
  • a typical starting dose of levetiracetam in treating epilepsy in humans is 500 mg twice a day, which is approximately 14.3 mg/kg/day. The dosage is then is increased until optimal efficacy, up to 50 mg/kg/day. Thus, the dose used in this experiment is a quarter of the lowest human dose used for treating epilepsy.
  • HED human equivalent dose
  • Imaging data are obtained through high-resolution methods developed in the Stark laboratory. Data are collected on a Phillips 3 Tesla scanner (Eindhoven, The Netherlands) equipped with an 8-channel SENSE (Sensitivity Encoding) head coil, located at the F.M. Kirby Research Center for Functional Brain Imaging at the Kennedy Krieger Institute (Baltimore, MD). High-resolution echo-planar images are collected using an acquisition matrix of 64 x 64, a repetition time of 1500 milliseconds, an echo time of 30 milliseconds, a flip angle of 70 degrees, a SENSE factor of 2, and an isotropic resolution of 1.5 mm x 1.5 mm x 1.5 mm with no gap.
  • oblique slices Nineteen oblique slices are acquired parallel to the principal longitudinal axis of the hippocampus and covered the entire medial temporal lobe region bilaterally. In addition to the functional runs, a whole-brain MPRAGE structural scan (parameters: 150 oblique slices, 1mm isotropic resolution) is acquired.
  • Data analysis is carried out using the Analysis for Functional Neuroimages (AFNI, release 2008_07_18_1710) software. Images are first co-registered to correct for within- and across-scan head motion. Acquisitions in which a significant motion event occur (more than 3 degrees of rotation or 2 mm of translation in any direction relative to prior acquisition), plus and minus one time repetition for 1.5 seconds, are excluded from the analyses. Structural anatomical data are registered to standard stereotaxic space (Talairach & Tournoux, 1988), and the same parameters are subsequently applied to the functional data. Behavioral vectors are produced to model different trial types.
  • AFNI Analysis for Functional Neuroimages
  • the ROI-LDDMM (large deformation diffeomorphic metric mapping of the region of interest) method increases the power of multisubject regional fMRI studies by focusing the alignment power specifically on the ROIs (regions of interest) and not elsewhere in the brain.
  • all subjects' anatomical and functional scans are normalized to the Talairach atlas using AFNI.
  • Sub-regions of the medial temporal lobe and the hippocampus are segmented in three dimensions on the MPRAGE scans.
  • the labels for the CA3 region and dentate gyrus (DG) are combined.
  • the anatomically defined ROIs are then used to calculate the ROI-LDDMM 3D vector field transformation for each subject using a customized template based on the mean of the entire sample tested as the target.
  • the ROI-LDDMM transformations for each individual subject's ROIs are then applied to the fit coefficient maps.
  • Group data are analyzed using a two-way Analysis of Variance (ANOVA) with trial types and group as fixed factors, and subject as a random factor nested within group.
  • a liberal peak threshold of p ⁇ 0.05, along with a spatial extent threshold of 10 voxels are used to define functional ROIs on the overall F statistic.
  • This threshold is then combined with the anatomical segmentations to only include voxels inside the regions of interest. This serves to exclude voxels that does not change with any of the model's factors, effectively limiting the analysis to voxels showing any changes with task condition or group. Voxels within each functional ROI are collapsed for further analysis.
  • the activity of the subject's medial temporal lobe is measured by functional MRI during the subject's participation in an explicit 3-alternative forced choice task, where participants view novel, repeated and similar ("lure") stimuli.
  • the Psychophysics Toolbox extensions in Matlab 7.0 (The MathWorks, Natick, MA) is used for stimulus presentation and behavioral data collection. Stimuli are color photographs of common objects.
  • lure stimuli Of critical interest are the participants' responses when presented with the second of the pair of similar objects (the "lure”; see FIG. 6B ).
  • Identification of lure stimuli as "old” indicates that the subject focused on the similarities between the lure stimulus and the earlier-shown partner image. Identification of the lure stimulus as "new” indicates that the subject failed to recall the earlier-shown partner image altogether.
  • Each run also contains a number of baseline trials that use a challenging perceptual discrimination task known to provide a lower and more-stable estimate of baseline activity in the medial temporal lobe ( Stark & Squire, 2001 PNAS ; Law et al, 2005).
  • the activity level in the aMCI subject treated with the drug in fact, is normalized to the extent that that it is statistically indistinguishable from the activity of control subjects treated with placebo. See FIG. 4C for the mean activity values shown in FIGS. 4A and 4B .
  • levetiracetam treatment normalizes activity in aMCI subjects in EC as well.
  • Levetiracetam treatment increases EC activity during memory judgments in aMCI subjects, such that it is statistically indistinguishable from placebo-treated control subjects.
  • FIG. 5C for the mean activity values shown in FIGS. 5A and 5B .
  • control-placebo subjects and aMCI subjects with drug or placebo treatment is also compared in other common cognitive tests, such as the Buschke Selective Reminding Test - Delayed Recall ( FIGS. 10A and 10B ), the Benton Visual Rentention Test ( FIGS. 11A and 11B ), Verbal Paired Associates Test - Recognition ( FIGS. 12A and 12B ) and Verbal Paired Associates Test - Delayed Recall ( FIGS. 13A and 13B ).
  • aMCI subjects treated with placebo perform worse than placebo-treated control subjects, and levetiracetam treatment fail to rescue performance in aMCI subjects.
  • the explicit 3-alternative forced choice task done in the fMRI study is a task that is especially sensitive to DG/CA3 function. As such, the performance of the subjects in this task may be particularly attuned to the changes in DG/CA3 activity resulting from levetiracetam treatment. Further, the aMCI subjects were treated with levetiracetam for only two weeks prior to the administration of the cognitive tests. It is contemplated that a treatment duration of longer than two weeks, e.g., 16 weeks or 8 months, for the drug treatment will result in improved efficacy. Finally, comparative animal studies (see Example 1) indicate that an even lower dose would be more effective.
  • the human dosage of 125 mg twice a day is equivalent to a rat dosage of 22.3 mg/kg/day.
  • 20 mg/kg levetiracetam is too high a dose in rats, and it fails to improve the performance of AI rats in the radial maze task.
  • the effective doses of levetiracetam used in the animal model are 5-10 mg/kg.
  • the human equivalent dose (HED) of the optimal rat dose is 0.8-1.6 mg/kg/day. Such a dosage would result in the administration of 28-56 mg twice a day (which is substantially lower than the 125 mg twice a day used in this study).
  • aMCI subjects will exhibit a further normalization of DG/CA3 and EC activity, as well as further improved performance in cognitive tests, if they are treated with lower doses equivalent to the effective doses in rat, e.g., 25 - 60 mg twice a day of levetiracetam.
  • a within-subjects trial of 8 weeks duration, involving 38 amnestic MCI (aMCI) subjects and 17 age-matched controls with a low dose treatment of levetiracetam is conducted.
  • each aMCI subject receives both drug and placebo treatments separately in two periods of two weeks each, with the order of treatments among different aMCI subjects counterbalanced (see FIG. 7 ).
  • Age-matched control subjects treated with placebo serve as a further control.
  • Cognitive testing and fMRI imaging data are obtained from the subjects after each two-week period of drug/placebo treatment.
  • aMCI patients 38 right-handed aMCI patients are recruited from the Alzheimer's Disease Research Center (ADRC) at the Johns Hopkins Hospital and other referrals. An additional 17 right-handed healthy volunteers are recruited from the pool of control participants in the ADRC and other referrals. All participants are administered the Telephone Interview of Cognitive Status to determine if they are likely to pass the entry criteria of the study (including criteria for MRI scanning). All participants further undergo neurological, psychiatric, and neuropsychological examination using standardized instruments and methods. The psychiatric evaluation includes administration of the Structured Clinical Interview for DSM-IV Axis I Disorders and the Clinical Dementia Rating (CDR) scale. All aMCI patients have CDR scores of 0.5.
  • CDR Clinical Dementia Rating
  • Diagnosis of aMCI is based on the criteria proposed by Petersen et al. (e.g., " Mild cognitive impairment: Aging to Alzheimer's Disease,” Oxford University Press, N.Y. (2003 ), which include a memory complaint (corroborated by an informant), impaired memory function on testing (generally 1.5 standard deviations below the norm and at least 1 standard deviation below the norm), otherwise preserved cognitive functioning (within 1 standard deviation of norm), no decline in functional ability, and no dementia.
  • Final aMCI diagnoses are reached by clinical consensus. Exclusion criteria include major neurological or psychiatric disorders, head trauma with loss of consciousness, history of drug abuse or dependency, and general contraindications to an MRI examination (e.g. cardiac pacemaker, aneurysm coils, claustrophobia).
  • MRI examination e.g. cardiac pacemaker, aneurysm coils, claustrophobia.
  • Each aMCI subject is required to have a study partner (i.e., an informant) who can provide
  • Study Visits The study consists of 4 visits over the course of 8 weeks (see FIG. 7 ).
  • the Baseline Visit is for the purpose of performing medical, neurological, psychiatric, and neurocognitive assessments. Visits 1 and 2 are identical to the Baseline Visit but include an fMRI session.
  • the Washout Visit at the end of a 4 week washout period, is for the purpose of a brief clinical assessment and initiation of the second drug/placebo phase.
  • Baseline Visit At the screening visit, informed consent is obtained from the subject (and an informant in the case of MCI subjects). The subject and the informant participate in a standardized clinical interview that is used to determine the degree of the subject's functional impairment in daily life, based on the Clinical Dementia Rating (CDR) scale.
  • CDR Clinical Dementia Rating
  • the subject's medical, neurological, and psychiatric history is obtained (including a review of current medications), as well as the family history of dementia. Brief medical, neurological and psychiatric exams are conducted (including vital signs). Blood is drawn in order to perform standard laboratory tests needed to determine if the subject meets the entry criteria. The subject is re-screened for contraindications to MRI scanning, using the standard form employed at the Kirby Imaging Center.
  • Visit 1 At the end of the first drug/placebo period 2 weeks after the Baseline Visit, the medical, neurological and psychiatric evaluations and cognitive testing are repeated. The subject is also clinically evaluated for suicidal ideation. Blood is drawn again to repeat the standard tests and to determine whether there are any changes related to drug treatment; the subject's blood levetiracetam level is also obtained. All medication dispensed at the Baseline Visit (drug or placebo) is collected and subject compliance with the medication regimen is assessed. The first fMRI session (with cognitive tests) is conducted on the same day, either immediately before or immediately after the clinical assessment. Subjects discontinue first period treatment at this visit.
  • Washout Visit At the end of a washout period (4 weeks) following Visit 1, the subject receives a brief medical screening, including a medical and psychiatric evaluation. Blood is drawn to obtain the blood levetiracetam level (to confirm washout). The subject is provided with new medication (drug or placebo, alternated from what was assigned in the previous treatment period) for the final phase of the study with instructions about how it should be taken.
  • Visit 2 At approximately 2 weeks after the Washout Visit (i.e., 2 weeks after starting the second treatment period), the medical, neurological and psychiatric evaluations and the cognitive testing are repeated. The subject is clinically evaluated for suicidal ideation. Blood is drawn again to repeat the standard tests and to determine whether there were any changes related to drug treatment; the subject's blood levetiracetam level is also obtained. All medication dispensed at the Washout Visit is collected and subject compliance with the medication regimen is assessed. The second fMRI session (with cognitive tests) is repeated on the same day, either immediately before or immediately after the clinical assessment.
  • the drug treatment period is the two weeks preceding Visit 1 or 2 (with the two week period preceding the other Visit being the placebo phase).
  • the 250 mg BID BID stands for twice daily
  • two 250 mg tablets of levetiracetam are used to achieve a dose of 250 mg twice a day, i.e., 500 mg/day, which is approximately 7.1 mg/kg/day (assuming an average adult human weight of 70 kg).
  • a quarter of a scored 250 mg tablet of levetiracetam is used to achieve a dose of 62.5 twice a day, i.e., 125 mg/day which is approximately 1.5 mg/kg/day.
  • All drug and placebo preparations are performed on a 1:1 allocation.
  • the pharmacy randomizes patients to drug dose and condition as they enroll, and keep a list of drug assignment.
  • Levetiracetam is rapidly and almost completely absorbed after oral administration, and its bioavailability is not affected by food.
  • Plasma half-life of levetiracetam is approximately 7 ⁇ 1 hour (expected to be 9-10 hours in elderly due to decreased renal function). Absorption is rapid, with peak plasma concentrations occurring about 1 hour following oral administration. Steady state can be achieved after 2 days of multiple twice-daily dosing.
  • a typical starting dose of levetiracetam in treating epilepsy in humans is 500 mg twice a day, which is approximately 14.3 mg/kg/day. The dosage is then is increased until optimal efficacy, up to 50 mg/kg/day.
  • the 250 mg BID dose (500 mg/day) used in this experiment is one-half of the lowest human dose used for treating epilepsy.
  • the 62.5 mg BID dose (125 mg/day) is one eighth of the lowest human dose used for treating epilepsy.
  • Imaging data are obtained through high-resolution methods developed in the Stark laboratory. Data are collected on a Phillips 3 Tesla scanner (Eindhoven, The Netherlands) equipped with an 8-channel SENSE (Sensitivity Encoding) head coil, located at the F.M. Kirby Research Center for Functional Brain Imaging at the Kennedy Krieger Institute (Baltimore, MD). High-resolution echo-planar images are collected using an acquisition matrix of 64 x 64, a repetition time of 1500 milliseconds, an echo time of 30 milliseconds, a flip angle of 70 degrees, a SENSE factor of 2, and an isotropic resolution of 1.5 mm x 1.5 mm x 1.5 mm with no gap.
  • oblique slices Nineteen oblique slices are acquired parallel to the principal longitudinal axis of the hippocampus and covered the entire medial temporal lobe region bilaterally. In addition to the functional runs, a whole-brain MPRAGE structural scan (parameters: 231 oblique slices, 0.65mm isotropic resolution) is acquired.
  • the ROI-LDDMM (large deformation diffeomorphic metric mapping of the region of interest) method increases the power of multisubject regional fMRI studies by focusing the alignment power specifically on the ROIs (regions of interest) and not elsewhere in the brain.
  • all subjects' anatomical and functional scans are normalized to the Talairach atlas using AFNI.
  • Sub-regions of the medial temporal lobe and the hippocampus are segmented in three dimensions on the MPRAGE scans.
  • the labels for the CA3 region and dentate gyrus (DG) are combined.
  • the anatomically defined ROIs are then used to calculate the vector field transformation for each subject using the Advanced Normalization Tools (ANTs) software package and a customized template based on the mean of the entire sample tested as the target.
  • the resulting vector transformations for each individual subject's ROIs are then applied to the fit coefficient maps.
  • Group data are analyzed using a two-way Analysis of Variance (ANOVA) with trial types and group as fixed factors, and subject as a random factor nested within group.
  • a liberal peak threshold of p ⁇ 0.07, along with a spatial extent threshold of 40 voxels are used to define functional ROIs on the overall F statistic. This approach, rather than using a direct pair-wise contrast, reduces voxel selection biases because any differences amongst the various conditions allowed for a voxel to be selected.
  • This threshold is then combined with the anatomical segmentations to only include voxels inside the regions of interest. This serves to exclude voxels that does not change with any of the model's factors, effectively limiting the analysis to voxels showing any changes with task condition or group. Voxels within each functional ROI are collapsed for further analysis.
  • the activity of the subject's medial temporal lobe is measured by functional MRI during the subject's participation in an explicit 3-alternative forced choice task, where participants view novel, repeated and similar ("lure") stimuli.
  • the Psychophysics Toolbox extensions in Matlab 7.0 (The MathWorks, Natick, MA) is used for stimulus presentation and behavioral data collection. Stimuli are color photographs of common objects.
  • lure stimuli Of critical interest are the participants' responses when presented with the second of the pair of similar objects (the "lure”; see FIG. 10B ) .
  • Identification of lure stimuli as "old” indicates that the subject focused on the similarities between the lure stimulus and the earlier-shown partner image. Identification of the lure stimulus as "new” indicates that the subject failed to recall the earlier-shown partner image altogether.
  • Each run also contains a number of baseline trials that use a challenging perceptual discrimination task known to provide a lower and more-stable estimate of baseline activity in the medial temporal lobe ( Stark & Squire, 2001 PNAS ; Law et al, 2005).
  • the level of DG/CA3 activity during memory judgments by levetiracetam treatment is mirrored in the change seen in the aMCI subjects' performance in the cognitive task.
  • aMCI patients perform worse than control subjects, correctly identify lure items as "similar” less often and incorrectly identifying them as "old” more often in both the 62.5 mg BID cohort and the 250 mg BID cohort. See FIGS. 19A and 23B .
  • the performance of aMCI subjects improves significantly under 62.5 mg BID levetiracetam treatment. See FIG. 20A .
  • the MWM protocol was substantially the same as the one described in Example 1. See, also, Gallagher et al., Behav. Neurosci. 107:618-626, (1993 ). Briefly, the rats were trained for eight days (three trials per day) to locate a camouflaged escape platform that remained at the same location throughout training in a water maze. Every sixth trial consisted of a probe trial (free swim with no escape platform) that served to assess the development of a spatially localized search for the escape platform.
  • a learning index was generated from the proximity of the rat to the escape platform and was used to define impairment in the aged rats.
  • the learning index is the sum of weighted proximity scores obtained during probe trials, with low scores reflecting a search near the escape platform and high scores reflecting searches farther away from the platform (Gallagher et al, 1993).
  • Cue training (visible escape platform) occurred on the last day of training to test for sensorimotor and motivational factors independent of spatial learning.
  • Aged rats with impaired spatial memory performance i.e., those with learning index scores outside the young "normative" range
  • successful cued training performance were characterized as Aged-Impaired rats (i.e., AI rats).
  • the AI rats were used for the studies as described below.
  • the radial arm maze experiments used acute administration of seletracetam (0 - 4 mg/kg), brivaracetam (0 - 4 mg/kg), or saline vehicle given by intraperitoneal injection (in a volume of 1 ml/kg) 30-40 min prior to test sessions.
  • memory-impaired aged rats were implanted subcutaneously in the intrascapular region with osmotic mini-pumps (ALZET, Durect Corporation, Cupertino, CA) with brivaracetam (2 mg/kg/day) or saline vehicle starting two weeks prior to assessment in the water maze.
  • a radial arm maze (RAM) task was used to assess effects of acute drug treatment with seletracetam and brivaracetam. This protocol allowed within-subject assessment across drugs at different doses.
  • the radial maze consisted of eight arms projecting from each side of an octagonal center platform, with a food well located at the distal end of each arm. Plexiglas blocks could be positioned to prevent entry into any arm. Extra-maze cues were provided in the room surrounding the maze and illumination was provided by an overhead light.
  • Pre-training as described in detail in Chappell et al. Neuropharmacology 37: 481-487, (1998 ), consisted of habituation, standard win-shift training, and win-shift training with delays interposed between information and memory test phases. Drug treatments began two days after the completion of pre-training. Three arms were blocked at the beginning of each trial (information phase). The identity and configuration of the blocked arms were varied across trials. Food-deprived rats were allowed to retrieve food reward (Kellogg's Froot Loops cereal) from the five unblocked arms. The rat was then removed from the maze for 2 hr (retention interval), during which time the barriers on the blocked arms were removed allowing access to all eight arms.
  • Rats were then placed back onto the center platform and allowed to retrieve the remaining food rewards (memory test phase). An error consisted of returning to an arm (all four paws on the arm) from which food had already been obtained.
  • Rats were trained and tested in a novel water maze environment to assess the effect of drug treatment.
  • the water maze used here was housed in a different building and was surrounded by curtains with a novel set of patterns relative to the maze used for initial assessment of cognitive status.
  • the training protocol consisted of 6 trials per day for 2 days to locate a submerged escape platform.
  • a rat was released in the maze from one of four equally spaced starting positions around the perimeter of the pool. The starting position varied from trial to trial. If the rat did not locate the escape platform within 60 s on any trial, the experimenter guided and placed the rat on the platform, where it remained for 20 s. The rat was then removed from the platform and placed in a holding cage for another 40 s before the next trial.
  • the learning index is the sum of weighted proximity scores obtained during probe trials, with low scores reflecting a search near the escape platform and high scores reflecting searches farther away from the platform (Gallagher et al, 1993).
  • Cue training visible escape platform
  • Aged rats with impaired spatial memory performance i.e., those with learning index scores outside the young "normative" range
  • successful cued training performance were used for the studies as described below.
  • rats were anesthetized with isoflurane and perfused transcardiacally with 0.1 M phosphate buffer saline, followed by 4% paraformaldehyde in phosphate buffer. Brains were removed and post-fixed in paraformaldehyde overnight. The brains were then moved into 4% paraformaldehyde in phosphate buffer containing 16% sucrose. The brains were then sectioned with a freezing microtome on the coronal plane at 40 ⁇ m and stored in either 4% paraformaldehyde at 4°C for in situ hybridization or cryoprotectant at -20°C for immunohistochemistry.
  • Probe templates were synthesized as described in Haberman et al. (2008). Initial primer sequences for reelin were as follows: left, agtactcagacgtgcagtgg, right, ctcatgaagcaaagtccaa; PCR products were verified by restriction endonuclease digestion. Initial PCR products were amplified further with the same PCR primers that had been modified by the addition of T7 or SP6 RNA polymerase binding sites. PCR products containing T7 and SP6 extensions were purified by SVgel and a PCR cleanup kit (Promega). 35S-UTP labeled riboprobe was then generated using the Maxiscript kit (Ambion). The probe was then phenol/choloroform extracted and precipitated in ethanol at -80°C. The final probe was resuspended in RNase-free water and the specific activity was determined by scintillation counter.
  • sections were transferred to hybridization buffer containing 20% formamide, 0.4x Denhardt's solution, 4% dextran sulfate, and 1.6x SSC) supplemented with 0.25 mg/ml tRNA, 0.33 mg/ml sheared salmon sperm DNA, 100 mM DTT, and 1 x 107 cpm/ml 35S-UTP-labeled probe for overnight reaction at 60°C.
  • sections were washed at 60°C in 4xSSC/0.01M DTT and 2x SSC/ 50% formamide. They were then incubated with RNase (20 ⁇ g/ml) at 37°C for 30 min. Sections were washed with progressively decreasing concentrations of SSC before mounting on slides.
  • Tissue was labeled with anti-SOM antiserum (Santa Cruz Biotechnology; cat. no. SC7819-P) using an established immunoperoxidase protocol and tissue sections were processed concurrently to minimize inter-replication variability (Haberman et al., 2009).
  • the anti-SOM antiserum can detect somatostatin. Briefly, sections were washed in 0.1M phosphate-buffered saline (PBS) to remove cryoprotectant, and endogenous peroxidases were quenched in 0.3% H202 in PBS. After additional PBS washes, sections were blocked in 5% normal horse serum in PBS with 0.3% Triton.
  • PBS phosphate-buffered saline
  • Sections were then incubated with primary antibody at a dilution of 1:1600 in PBS containing 0.15% Triton and 3% normal serum for 72 hours at 4°C with agitation. Following primary antibody incubation, sections were washed in PBS and reacted with horse anti-goat IgG biotinylated secondary antibody (Vector Laboratories Inc., Burlingame, CA) diluted in PBS with 0.15% Triton and 5% normal horse serum for 45 minutes.
  • horse anti-goat IgG biotinylated secondary antibody Vector Laboratories Inc., Burlingame, CA
  • the secondary antibody was detected with avidin-biotin complex (ABC Elite; Vector Laboratories Inc., Burlingame, CA) and the avidin-biotin complex was visualized with nickel-enhanced diaminobenzadine (Vector Laboratories Inc., Burlingame, CA). Tissue sections were mounted onto coated slides and dried, dehydrated with increasing concentrations of ethanol, cleared with xylene, and coverslipped using DPX mounting media.
  • Interneuron quantification was performed using a Zeiss Axioplan 2 microscope equipped with a motorized stage. All analyses were conducted blind with regards to animal age and cognitive status.
  • the dentate hilar region was defined using the Paxinos and Watson rat brain atlas (1998).
  • Dorsal hilar neuron counts were derived bilaterally from four matched tissue sections per animal with a 40x objective lens (Bregma -3.80mm to -4.16mm). Neuron counts were analyzed as the total number of hilar interneurons per hippocampal section for each rat.
  • Somatostatin is a peptide hormone that regulates the endocrine system and affects neurotransmission and cell proliferation via interaction with G protein-coupled somatostatin receptors and inhibition of the release of numerous secondary hormones. Somatostatin levels in the brain have been shown to drop as low as 10-20% in association with aging and Alzheimer's disease progression. A four-week treatment with levetiracetam at a dose of 10 mg/kg/day in aged-impaired rats restores the levels of somatostatin in DG hilus. See FIG. 21 .
  • Rats Blood was drawn from aged-impaired rats by cardiac puncture during perfusion after a 28-day levetiracetam treatment period and sent for analysis of levetiracetam plasma levels by MedTox Laboratories in St. Paul, MN. Aged-impaired rats treated with 10 mg/kg/day of levetiracetam showed a mean levetiracetam blood plasma level of 3.8 mcg/ml (SEM ⁇ 0.255), while those treated with 60 mg/kg/day showed a mean levetiracetam blood plasma level of 22.4 mcg/ml (SEM ⁇ 3.371).

Landscapes

  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Psychiatry (AREA)
  • Emergency Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Psychology (AREA)
  • Addiction (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Claims (5)

  1. Composition pharmaceutique comprenant :
    (a) du lévétiracétam, ou un sel pharmaceutique acceptable correspondant, qui est sous une forme à libération étendue ; et
    (b) du donépézil, ou un sel pharmaceutique acceptable correspondant, qui n'est pas sous une forme à libération étendue,
    pour une utilisation dans le traitement d'une déficience cognitive associée à un trouble du système nerveux central (SNC), ou pour une utilisation dans le retardement ou le ralentissement de la progression de ladite déficience cognitive, ou pour une utilisation dans la réduction de la vitesse de déclin d'une fonction cognitive associée audit trouble du SNC, chez un sujet ayant ou risquant d'avoir ladite déficience cognitive ou ledit déclin d'une fonction cognitive.
  2. Composition pharmaceutique pour une utilisation selon la revendication 1, le lévétiracétam, ou le sel pharmaceutiquement acceptable correspondant, étant administré à raison d'une dose quotidienne d'environ 7 à 350 mg, 70 à 350 mg, 100 à 300 mg, ou 125 à 250 mg.
  3. Composition pharmaceutique pour une utilisation selon la revendication 1 ou 2, le donépézil, ou le sel pharmaceutiquement acceptable correspondant, étant administré à raison d'une dose quotidienne de 0,1 mg à 10 mg, 1 à 10 mg, 2 à 10 mg, 2 à 8 mg, ou 2 à 5 mg.
  4. Composition pharmaceutique pour une utilisation selon l'une quelconque des revendications 1 à 3, la déficience cognitive ou le déclin d'une fonction cognitive étant associé(e) à une déficience cognitive légère, une déficience cognitive légère amnésique, une schizophrénie, une sclérose latérale amyotrophique, un trouble de stress post-traumatique, une thérapie cancéreuse, un trouble bipolaire, un retard mental, la maladie de Parkinson, l'autisme, un comportement compulsif, une addiction à une substance, la maladie d'Alzheimer prodromique, ou la maladie d'Alzheimer, la déficience cognitive légère et la déficience cognitive légère amnésique étant des affections liées à l'âge.
  5. Composition pharmaceutique pour une utilisation selon l'une quelconque des revendications 1 à 4, la composition pharmaceutique étant sous une forme de dosage unitaire ou dans des unités séparées conditionnées ensemble en une unique formulation.
EP14764293.8A 2013-03-15 2014-03-14 Procédés et compositions pour améliorer la fonction cognitive Active EP2968220B1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361800191P 2013-03-15 2013-03-15
PCT/US2014/029362 WO2014144801A1 (fr) 2013-03-15 2014-03-14 Procédés et compositions pour améliorer la fonction cognitive

Publications (3)

Publication Number Publication Date
EP2968220A1 EP2968220A1 (fr) 2016-01-20
EP2968220A4 EP2968220A4 (fr) 2016-10-19
EP2968220B1 true EP2968220B1 (fr) 2021-05-05

Family

ID=51537797

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14764293.8A Active EP2968220B1 (fr) 2013-03-15 2014-03-14 Procédés et compositions pour améliorer la fonction cognitive

Country Status (10)

Country Link
US (1) US11160785B2 (fr)
EP (1) EP2968220B1 (fr)
JP (4) JP6433482B2 (fr)
CN (1) CN105142623A (fr)
AU (3) AU2014228512A1 (fr)
CA (1) CA2904767C (fr)
DK (1) DK2968220T3 (fr)
ES (1) ES2881081T3 (fr)
HK (2) HK1218623A1 (fr)
WO (1) WO2014144801A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2563935B1 (fr) * 2010-04-30 2014-04-16 Exiqon A/S Procédé et tampon d'hybridation in situ
CA2891122C (fr) 2012-11-14 2021-07-20 The Johns Hopkins University Methodes et compositions pour le traitement de la schizophrenie
EP3827820A1 (fr) 2013-03-15 2021-06-02 The Johns Hopkins University Brivaracetam pour améliorer la fonction cognitive
RU2578446C1 (ru) * 2014-12-15 2016-03-27 государственное бюджетное образовательное учреждение высшего профессионального образования "Пермский государственный медицинский университет имени академика Е.А. Вагнера" Министерства здравоохранения Российской Федерации Способ активации когнитивных функций у лабораторных животных
CN112843005B (zh) 2015-05-22 2023-02-21 艾吉因生物股份有限公司 左乙拉西坦的延时释放药物组合物
MA50634A (fr) * 2015-05-22 2021-04-28 Agenebio Inc Compositions pharmaceutiques à libération prolongée comportant du lévétiracétam
CN111172274B (zh) * 2020-01-22 2021-10-15 清华大学 Synaptotagmin-7在双向情感障碍诊断和治疗中的用途

Family Cites Families (248)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL181407B (nl) 1952-09-20 Merck & Co Inc Verbetering van een werkwijze ter bereiding van een farmaceutisch preparaat met antibacteriele werking, dat een combinatie van een verbinding van het 3-fluor-d-alaninetype en een cycloserineverbinding bevat.
GB1039113A (en) 1964-08-06 1966-08-17 Ucb Sa New n-substituted lactams
GB1309692A (en) 1970-02-13 1973-03-14 Ucb Sa N-substituted lactams
JP2000319257A (ja) 1969-01-06 2000-11-21 Eisai Co Ltd １−ベンジル−４−［（５，６−ジメトキシ−２−フルオロ−１−インダノン）−２−イル］メチルピペリジン
IT1045043B (it) 1975-08-13 1980-04-21 Isf Spa Derivati pirrolidinici
IT1075280B (it) 1977-02-11 1985-04-22 Isf Spa Procedimento per la preparazione di derivati pirrolidinici
BE864269A (fr) 1977-03-03 1978-06-16 Parke Davis & Co Nouveaux n-(aminoalkyl substitue)-2-oxo-1-pyrrolidine-acetamides et procedes pour les produire
EP0005689B1 (fr) 1978-05-08 1981-03-18 U C B, S.A. Nouveaux acides lactame-N-acétiques et leurs amides, leurs procédés de préparation et compositions thérapeutiques
US4654370A (en) 1979-03-12 1987-03-31 Abbott Laboratories Glyceryl valproates
US4372960A (en) 1980-12-12 1983-02-08 Warner-Lambert Company Quaternary derivatives of N-(substituted-aminoalkyl)-2-oxo-1-pyrrolidine-acetamides as cognition activators
FR2515179A1 (fr) 1981-07-24 1983-04-29 Hoffmann La Roche Derives de pyrrolidine, leur procede de preparation, les intermediaires pour leur synthese et leur application therapeutique
IL67623A (en) 1983-01-05 1984-09-30 Teva Pharma 1'-ethoxycarbonyloxyethyl ester of valproic acid,its preparation and pharmaceutical compositions containing it
IL72381A (en) 1983-07-20 1988-03-31 Sanofi Sa Pharmaceutical composition based on valproic acid
US4558070A (en) 1983-10-26 1985-12-10 Abbott Laboratories Acid salts of valproic acid
GB8412358D0 (en) 1984-05-15 1984-06-20 Ucb Sa Pharmaceutical composition
GB8412357D0 (en) 1984-05-15 1984-06-20 Ucb Sa Pharmaceutical composition
US4668687A (en) 1984-07-23 1987-05-26 Bristol-Myers Company Psychogeriatric 1-(2-pyrimidinyl)piperazinyl derivatives of 1-pyrrolidin-2-ones
US4913906B1 (en) 1985-02-28 2000-06-06 Yissum Res Dev Co Controlled release dosage form of valproic acid
IL74497A (en) 1985-03-05 1990-02-09 Proterra Ag Pharmaceutical compositions containing phenyl carbamate derivatives and certain phenyl carbamate derivatives
JPS6222785A (ja) 1985-07-23 1987-01-30 Sanwa Kagaku Kenkyusho:Kk 新規な２−オキソピロリジン化合物及びその塩、その製法並びにこれらを有効成分とする脳機能障害の予防及び治療剤
US4663318A (en) 1986-01-15 1987-05-05 Bonnie Davis Method of treating Alzheimer's disease
IT1190133B (it) 1986-06-19 1988-02-10 Chiesi Farma Spa Derivati di acido valproico e di acido (e)-2-valproenoico,procedimento per la loro preparazione e relative composizioni farmaceutiche
US4816456A (en) 1986-10-01 1989-03-28 Summers William K Administration of monoamine acridines in cholinergic neuronal deficit states
WO1988008708A1 (fr) 1987-05-04 1988-11-17 Bonnie Davis Composes permettant le traitement de la maladie d'alzheimer
HU201906B (en) 1987-03-04 1991-01-28 Sandoz Ag Process for producing phenyl-carbamate derivative and acid additional salts and pharmaceutical compositions containing them
FI91401C (fi) 1987-03-17 1994-06-27 Hoechst Roussel Pharma Menetelmä terapeuttisesti aktiivisten substituoitujen 9-aminotetrahydroakriinien ja niille läheisten yhdisteiden valmistamiseksi
DE3709230A1 (de) 1987-03-20 1988-10-06 Desitin Arzneimittel Gmbh Neues calciumsalz der valproinsaeure
IT1225462B (it) 1987-04-03 1990-11-14 Mediolanum Farmaceutici Srl Sali organici di derivati della fisostigmina
US5002955A (en) 1987-04-23 1991-03-26 Hoechst-Roussel Pharmaceuticals Inc. Fused heteroalkylene quinolinamines and use as cholinergic agents
US5187165A (en) 1987-05-15 1993-02-16 Hoechst-Roussel Pharmaceuticals Inc. Memory enhancing and analgesic 1,2,3a,8,8a-hexahydro-3a,8(and 1,3a,8)-di(and tri)methylpyrrolo[2,3-b]indoles
FI95572C (fi) 1987-06-22 1996-02-26 Eisai Co Ltd Menetelmä lääkeaineena käyttökelpoisen piperidiinijohdannaisten tai sen farmaseuttisen suolan valmistamiseksi
JPS6422883A (en) 1987-07-17 1989-01-25 Sanwa Kagaku Kenkyusho Co 1-pyrrolidine acetamide derivative, its salt, production thereof and prophylactic and remedial agent for cereral dysfunction containing said derivative and salt as active ingredient
ES2026198T3 (es) 1987-07-22 1992-04-16 Farvalsa Ag Compuesto a base de acido valproico solido, estable a la humedad y metodo para su preparacion.
US4950658A (en) 1988-12-06 1990-08-21 Board Of Trustees Of Southern Illinois Univ. Method of medical treatment of Alzheimer's disease
NZ232112A (en) 1989-01-17 1992-07-28 Hoffmann La Roche ((5-oxo-2-pyrrolidinyl)methyl)cyclohexaneacetamides, intermediates therefor and pharmaceutical compositions
FR2643556B1 (fr) 1989-02-27 1993-03-05 Sanofi Sa Composition pharmaceutique a liberation prolongee d'acide valproique
US4981870A (en) 1989-03-07 1991-01-01 Pfizer Inc. Use of 4-phenyl-1,2,3,4-tetrahydro-1-naphthalenamine derivatives in the treatment of psychosis, inflammation and as immunosuppressants
US5238945A (en) 1989-04-11 1993-08-24 H. Lundbeck A/S Method of treating psychoses
US5364866A (en) 1989-05-19 1994-11-15 Hoechst-Roussel Pharmaceuticals, Inc. Heteroarylpiperidines, pyrrolidines and piperazines and their use as antipsychotics and analetics
EP0403713A1 (fr) 1989-06-22 1990-12-27 Merrell Dow Pharmaceuticals Inc. Inhibiteurs d'acétylcholinestérase
US5693668A (en) 1989-06-22 1997-12-02 Merrell Pharmaceuticals Inc. Acetylcholinesterase inhibitors
IT1231477B (it) 1989-07-12 1991-12-07 Sigma Tau Ind Farmaceuti (pirrolidin-2-one-1-il) acetammidi quali attivatori dei processi di apprendimento e della memoria e composizioni farmaceutiche comprendenti tali composti
US4999430A (en) 1989-07-31 1991-03-12 Warner-Lambert Company Derivatives of 1,2,3,4-tetrahydro-9-acrisinamine
DE3927049A1 (de) 1989-08-16 1991-02-21 Sandoz Ag Halogenalkyl-phenyl-ketone und deren hydrate, ihre herstellung und verwendung
US5387590A (en) 1989-08-30 1995-02-07 Pfizer Inc. Benzazabicyclic carbamates as novel cholinesterase inhibitors
US4914102A (en) 1989-09-28 1990-04-03 Hoechst Roussel Pharmaceuticals, Inc. N-aminocarbamates related to physostigmine, pharmacentical compositions and use
EP0445095A1 (fr) 1990-03-02 1991-09-04 Uni Patent Ab Appareil pour prévenir le classement de matières en vrac
NZ237241A (en) 1990-03-02 1993-11-25 Pharmetrix Corp Method for increasing the storage stability of physostigmine
JP2807577B2 (ja) 1990-06-15 1998-10-08 エーザイ株式会社 環状アミド誘導体
US5102891A (en) 1990-07-23 1992-04-07 Hoechst-Roussel Pharmaceuticals Inc. 1-(substituted pyridinylamino)-1H-indol-5-yl substituted carbamates
US5264442A (en) 1990-08-13 1993-11-23 Hoechst-Roussel Pharmaceuticals Incorporated Carbamoyl-1-(pyridinylalkyl)-1H-indoles, indolines and related analogs
TW200462B (fr) 1990-09-27 1993-02-21 Hoechst Roussel Pharma
US5190951A (en) 1990-10-19 1993-03-02 Ss Pharmaceutical Co., Ltd. Quinoline derivatives
JP2965675B2 (ja) 1990-11-21 1999-10-18 エーザイ株式会社 （―）―１―ベンジル―４―〔（５，６―ジメトキシ―１―インダノン）―２―イル〕メチルピペリジンの製造方法
TW197435B (fr) 1990-11-22 1993-01-01 Takeda Pharm Industry Co Ltd
US5668117A (en) 1991-02-22 1997-09-16 Shapiro; Howard K. Methods of treating neurological diseases and etiologically related symptomology using carbonyl trapping agents in combination with previously known medicaments
US5334720A (en) 1991-03-07 1994-08-02 Fisons Corporation Diphenyl-1-(aminoalkyl)-2-piperidinone and -2-pyrrolidinone derivatives having anticonvulsant properties
HU225047B1 (en) 1991-03-28 2006-05-29 Eisai Co Ltd Heterocyclic-piperidin-derivatives, pharmaceutical compositions containing them and process for their production
US5750542A (en) 1993-09-28 1998-05-12 Pfizer Benzisoxazole and benzisothizole derivatives as cholinesterase inhibitors
US5104880A (en) 1991-05-01 1992-04-14 Mayo Foundation For Medical Education And Research Huperzine a analogs as acetylcholinesterase inhibitors
CA2067614C (fr) 1991-05-02 2002-07-30 Eiichi Otomo Agent pour le traitement de la demence
FR2677019B1 (fr) 1991-05-27 1994-11-25 Pf Medicament Nouvelles piperidines disubstituees-1,4, leur preparation et leur application en therapeutique.
US5106856A (en) 1991-06-07 1992-04-21 Hoechst-Roussel Pharmaceuticals Inc. [(Arylalkylpiperidin-4-yl)methyl]-2a,3,4,5-tetrahydro-1(2H)-acenaphthylen-1-ones and related compounds
FR2679555B1 (fr) 1991-07-25 1993-11-19 Fabre Medicament Pierre Nouveaux derives de l'uree, leur preparation et leur application en therapeutique.
AU665207B2 (en) 1991-07-29 1995-12-21 Warner-Lambert Company Quinazoline derivatives as acetylcholinesterase inhibitors
IT1251166B (it) 1991-08-09 1995-05-04 Chiesi Farma Spa Derivati di geneserina,loro preparazione e composizioni farmaceutiche che li contengono
US5246947A (en) 1991-09-23 1993-09-21 Hoechst-Roussel Pharmaceuticals Incorporated Substituted pyridinylamino-1,2-benzisothiazoles and their use for treating depression
US5231093A (en) 1991-10-01 1993-07-27 Hoechst-Roussel Pharmaceuticals Incorporated Carbamate derivatives of 4-amino-3-isoxazolidinones, 3-amino-1-hydroxypyrrolidin-2-ones and 1-amino-1-cyclopropanecarboxylic acid analogs
TW263504B (fr) 1991-10-03 1995-11-21 Pfizer
ES2042384B1 (es) 1991-12-26 1994-06-01 Boehringer Ingelheim Espana Procedimiento para obtener derivados bis-piridinicos.
AU3171493A (en) 1991-12-31 1993-07-28 Fujisawa Pharmaceutical Co., Ltd. Oxadiazole derivatives having acetylcholinesterase-inhibitory and muscarinic agonist activity
JPH07505145A (ja) 1992-02-25 1995-06-08 ワーナー−ランバート・コンパニー 細胞保護組成物およびその製法および使用法
US5439930A (en) 1992-04-14 1995-08-08 Russian-American Institute For New Drug Development Biologically active n-acylprolydipeptides having antiamnestic, antihypoxic and anorexigenic effects
IT1254996B (it) 1992-06-25 1995-10-11 Mediolanum Farmaceutici Srl Esteri amminoalchilcarbammici dell'eserolina atti all'impiego come anticolinesterasici e relativo procedimento di preparazione
US5440023A (en) 1992-09-18 1995-08-08 Beckman Instruments, Inc. Method for making valproic acid derivatives
TW251284B (fr) 1992-11-02 1995-07-11 Pfizer
EP0611769A1 (fr) 1993-02-16 1994-08-24 Merrell Dow Pharmaceuticals Inc. Inhibiteurs d'acétylcholinerase silylés
AU4982293A (en) 1993-03-02 1994-09-26 Fujisawa Pharmaceutical Co., Ltd. Novel heterocyclic compound
EP0627400A1 (fr) 1993-06-04 1994-12-07 Merrell Dow Pharmaceuticals Inc. Inhibiteurs aromatiques d'acétylcholinesterase
SE9302080D0 (sv) 1993-06-16 1993-06-16 Ab Astra New compounds
GB9319732D0 (en) 1993-09-24 1993-11-10 Ucb Sa Use of (s)-alpha-ethyl-2-oxo-l-pyrrolidineacetamide for the treatment of anxiety
US5744476A (en) 1994-06-27 1998-04-28 Interneuron Pharmaceuticals, Inc. Dopamine D1 agonists for the treatment of dementia
US5603176A (en) 1995-02-27 1997-02-18 Hasbro, Inc. Simulated suspended animation biosphere
IL118279A (en) 1995-06-07 2006-10-05 Abbott Lab Compounds 3 - Pyridyloxy (or Thio) Alkyl Heterocyclic Pharmaceutical Compositions Containing Them and Their Uses for Preparing Drugs to Control Synaptic Chemical Transmission
IL115113A (en) 1995-08-31 2002-11-10 Israel State 3-carbamoyloxy pyridinium derivatives and pharmaceutical compositions containing them
ES2100129B1 (es) 1995-10-11 1998-02-16 Medichem Sa Nuevos compuestos aminopiridinicos policiclicos inhibidores de acetilcolinesterasa, procedimiento para su preparacion y su utilizacion.
AU717012B2 (en) 1995-11-17 2000-03-16 Merck & Co., Inc. Novel substituted aryl compounds useful as modulators of acetylcholine receptors
US5783584A (en) 1995-12-11 1998-07-21 Mayo Foundation For Medical Education And Research THA analogs useful as cholinesterase inhibitors
GB9606736D0 (en) 1996-02-19 1996-06-05 Shire International Licensing Therapeutic method
CA2252039C (fr) 1996-04-12 2002-12-24 Hoechst Marion Roussel, Inc. Derives d'isatine utilises comme inhibiteurs d'acetylcholinesterase et comme analgesiques
AU1153097A (en) 1996-06-07 1998-01-05 Eisai Co. Ltd. Stable polymorphs of donepezil (1-benzyl-4-{(5,6-dimethoxy-1-indanon)-2-yl}methylpiperidine ) hydrochloride and process for production
TW513409B (en) 1996-06-07 2002-12-11 Eisai Co Ltd Polymorphs of donepezil hydrochloride
CA2180703A1 (fr) 1996-07-08 1998-01-09 Paul Marie Victor Gilis Comprime de bromhydrate de galanthamine a dissolution rapide
HU229024B1 (en) 1996-07-24 2013-07-29 Bristol Myers Squibb Pharma Co Azolo-pyridimidines, pharmaceutical compositions containing the same and use thereof
AU4078997A (en) 1996-08-22 1998-03-06 New York University Cholinesterase inhibitors for treatment of parkinson's disease
IT1285801B1 (it) 1996-10-10 1998-06-24 Sigma Tau Ind Farmaceuti Procedimento migliorato per la preparazione dell'acido valproico
AU5716898A (en) 1997-01-08 1998-08-03 Warner-Lambert Company Acetylcholinesterase inhibitors in combination with muscarinic agonists for the treatment of alzheimer's disease
DE69815090T2 (de) 1997-03-03 2004-02-19 Eisai Co., Ltd. Verwendung von cholinesterasehemmer zur behandlung von konzentrationsstörungen
GB9716879D0 (en) 1997-08-08 1997-10-15 Shire Int Licensing Bv Treatment of attention deficit disorders
AU8742198A (en) 1997-08-15 1999-03-08 Shire International Licensing B.V. Use of cholinesterase inhibitor for treating diseases associated with pro teolytic enzyme activity
US6479523B1 (en) 1997-08-26 2002-11-12 Emory University Pharmacologic drug combination in vagal-induced asystole
UA72189C2 (uk) 1997-11-17 2005-02-15 Янссен Фармацевтика Н.В. Фармацевтична композиція, що містить водну суспензію субмікронних ефірів 9-гідроксирисперидон жирних кислот
ATE260896T1 (de) 1997-12-05 2004-03-15 Eisai Co Ltd Donepezil polykristalle und verfharen zu ihrer herstellung
US6131106A (en) 1998-01-30 2000-10-10 Sun Microsystems Inc System and method for floating-point computation for numbers in delimited floating point representation
GB9805561D0 (en) 1998-03-16 1998-05-13 Merck Sharp & Dohme A combination of therapeutic agents
US6262081B1 (en) 1998-07-10 2001-07-17 Dupont Pharmaceuticals Company Composition for and method of treating neurological disorders
US6218383B1 (en) 1998-08-07 2001-04-17 Targacept, Inc. Pharmaceutical compositions for the prevention and treatment of central nervous system disorders
IL125809A (en) 1998-08-17 2005-08-31 Finetech Lab Ltd Process and intermediates for production of donepezil and related compounds
IT1304904B1 (it) 1998-09-11 2001-04-05 Eisai Co Ltd Derivati anticolinesterasici per il trattamento delle sindromidolorose funzionali e/o organiche
CN1367697A (zh) 1998-10-16 2002-09-04 詹森药业有限公司 改善认识的疗法
WO2000030446A1 (fr) 1998-11-23 2000-06-02 Bonnie Davis Formulations de dosage d'inhibiteurs de l'acetylcholinesterase
CA2354035A1 (fr) 1998-12-11 2000-06-15 Bonnie Davis Utilisation d'inhibiteurs d'acetylcholine esterase pour la modulation de l'axe hypothalamo-hypophyso-gonadique
US6277866B1 (en) 1999-03-03 2001-08-21 Eisai Co., Ltd. 1-benzyl-4[(5,6-dimethoxy-2-fluoro-1-indanon)-2-yl]methylpiperidine
WO2000059544A1 (fr) 1999-03-31 2000-10-12 Eisai Co., Ltd. Compositions stabilisees contenant des medicaments nootropes
EP1050303A3 (fr) 1999-04-27 2003-01-15 Pfizer Products Inc. Methodes et compositions pour le traitement des troubles du comportement liées à l'age des animaux de compagnie
AU6053900A (en) 1999-06-25 2001-01-31 Morris Notelovitz Compositions for treating or preventing neurodegeneration and cognitive decline
CA2382117C (fr) 1999-09-01 2009-11-10 Eisai Co., Ltd. Compose de piperidine 4-substituee
JP4242048B2 (ja) 1999-09-01 2009-03-18 エーザイ・アール・アンド・ディー・マネジメント株式会社 ４−置換ピペリジン誘導体
ATE264301T1 (de) 1999-09-22 2004-04-15 Schering Corp Muscarin-antagonisten
US6620802B1 (en) 1999-11-23 2003-09-16 Corcept Therapeutics, Inc. Methods of treating mild cognitive impairment using a glucocorticoid-specific receptor antagonist
SK7492002A3 (en) 1999-12-01 2003-02-04 Ucb Sa A pyrrolidineacetamide derivative alone or in combination for treatment of CNS disorders
GB0004297D0 (en) 2000-02-23 2000-04-12 Ucb Sa 2-oxo-1 pyrrolidine derivatives process for preparing them and their uses
DE60124730T2 (de) 2000-03-03 2007-10-04 Eisai R&D Management Co., Ltd. Neue methoden unter verwendung von cholinesteraseinhibitoren
WO2001066096A2 (fr) 2000-03-06 2001-09-13 Immune Network Ltd. Compositions destinees a la prevention et au traitement de la demence
JP4150519B2 (ja) 2000-04-13 2008-09-17 エーザイ・アール・アンド・ディー・マネジメント株式会社 １−ベンジルピリジニウム塩を含有してなるアセチルコリンエステラーゼ阻害剤
US20010036949A1 (en) 2000-05-09 2001-11-01 Coe Jotham Wadsworth Pharmaceutical composition and method of treatment of diseases of cognitive dysfunction in a mammal
US6756385B2 (en) 2000-07-31 2004-06-29 Pfizer Inc. Imidazole derivatives
US20020151591A1 (en) 2000-10-17 2002-10-17 Anabella Villalobos Combination use of acetylcholinesterase inhibitors and GABAa inverse agonists for the treatment of cognitive disorders
KR100823668B1 (ko) 2000-12-28 2008-04-21 해밀턴 파마슈티컬스 인코포레이티드 신경성 통증 치료 및 예방약
US6610326B2 (en) 2001-02-16 2003-08-26 Andrx Corporation Divalproex sodium tablets
CA2438930A1 (fr) 2001-02-23 2002-09-06 Johns Hopkins University Traitement des tics, tremblements et troubles afferents
CA2442717A1 (fr) 2001-03-15 2002-09-26 Saegis Pharmaceuticals, Inc. Methodes permettant de retablir la fonction cognitive suite a un stress systemique
ES2254611T3 (es) 2001-05-11 2006-06-16 Pfizer Products Inc. Derivados de tiazol.
WO2002094787A1 (fr) 2001-05-23 2002-11-28 Ucb, S.A. Derives d'acide alcanoique 2-oxo-piperidinyl- et 2-oxo-azepanyle destines au traitement de l'epilepsie et d'autres troubles neurologiques
US8354438B2 (en) 2001-08-08 2013-01-15 Michael Chez Neurological functions
JP2005501108A (ja) 2001-08-22 2005-01-13 第一製薬株式会社 神経変性治療におけるネフィラセタムの使用
CA2459146A1 (fr) 2001-08-30 2003-03-13 Ortho-Mcneil Pharmaceutical, Inc. Traitement de la demence et des troubles de la memoire par le biais d'anticonvulsifs et d'inhibiteurs de l'acetylcholinesterase
WO2003032981A1 (fr) 2001-10-16 2003-04-24 Memory Pharmaceuticals Corporation Derives 4-(4-alcoky-3-hydroxyphenyle)-2-pyrrolidone utilises en tant qu'inhibiteurs de la pde4 pour le traitement de syndromes neurologiques
US6495700B1 (en) 2002-01-09 2002-12-17 Axonyx, Inc. Process for producing phenserine and its analog
US6759552B2 (en) 2002-03-28 2004-07-06 Council Of Scientific And Industrial Research Compound as cholinesterase inhibitor and its isolation from fungus sporotrichum species
JP4405811B2 (ja) 2002-03-29 2010-01-27 エーザイ・アール・アンド・ディー・マネジメント株式会社 （１−インダノン）−（１，２，３，６−テトラヒドロピリジン）誘導体
CA2484217A1 (fr) 2002-04-26 2003-11-06 Schering Corporation Antagonistes muscariniques
WO2004034963A2 (fr) 2002-05-17 2004-04-29 Eisai Co., Ltd. Methodes et compositions utilisant des inhibiteurs de la cholinesterase
ATE414519T1 (de) 2002-05-31 2008-12-15 Lundbeck & Co As H Kombination aus einem nmda-antagonist und acetylcholinesterase-hemmern zur behandlung der alzheimer-krankheit
US20040116506A1 (en) 2002-06-20 2004-06-17 Krusz John Claude Use of levetiracetam for treating or preventing acute headaches
US7557137B2 (en) 2002-08-05 2009-07-07 Bristol-Myers Squibb Company Gamma-lactams as beta-secretase inhibitors
US7635709B2 (en) 2002-09-26 2009-12-22 The United States Of America As Represented By The Department Of Veterans Affairs Compositions and methods for bowel care in individuals with chronic intestinal pseudo-obstruction
GB0223494D0 (en) 2002-10-09 2002-11-13 Neuropharma Sa Dual binding site acetylcholinesterase inhibitors for the treatment of alzheimer's disease
AU2003274353B2 (en) 2002-10-24 2007-04-05 Merz Pharma Gmbh & Co. Kgaa Combination therapy using 1-aminocyclohexane derivatives and acetylcholinesterase inhibitors
ATE540129T1 (de) 2002-11-22 2012-01-15 Univ Johns Hopkins Target zur therapie kognitiver behinderungen
US7090985B2 (en) 2002-12-03 2006-08-15 Ucb, S.A. Methods for the identification of agents for the treatment of seizures, neurological diseases, endocrinopathies and hormonal diseases
US7465549B2 (en) 2002-12-03 2008-12-16 Ucb, S.A. Methods for identifying agents that bind a levetiracetam binding site (LBS) or compete with LEV binding to a LBS of a synaptic vesicle protein 2 (SV2)
AU2003279492A1 (en) 2002-12-11 2004-06-30 Pharmacia & Upjohn Company Llc Treatment of diseases with combinations of alpha 7 nicotinic acetylcholine receptor agonists and other compounds
JP2006519875A (ja) 2003-03-06 2006-08-31 セルジーン・コーポレーション 中枢神経系障害を治療するための選択的サイトカイン阻害剤
ITMI20030573A1 (it) 2003-03-24 2004-09-25 Nikem Research Srl Composti ad azione nootropica, loro preparazione,
US20040191334A1 (en) 2003-03-24 2004-09-30 Pang-Chui Shaw Use of transhinone derivates as cholinesterase inhibitors in treating related diseases
TW200508197A (en) 2003-03-31 2005-03-01 Ucb Sa Indolone-acetamide derivatives, processes for preparing them and their uses
US7732162B2 (en) 2003-05-05 2010-06-08 Probiodrug Ag Inhibitors of glutaminyl cyclase for treating neurodegenerative diseases
ZA200508306B (en) 2003-05-23 2007-03-28 Otsuka Pharma Co Ltd Carbostyril derivatives and mood stabilizers for treating mood disorders
GB0322140D0 (en) 2003-09-22 2003-10-22 Pfizer Ltd Combinations
US7244843B2 (en) * 2003-10-07 2007-07-17 Bristol-Myers Squibb Company Modulators of serotonin receptors
JP2007508288A (ja) 2003-10-08 2007-04-05 ファイザー株式会社 縮合ラクタム化合物
JP2007508336A (ja) 2003-10-16 2007-04-05 ニューロサーチ、アクティーゼルスカブ モノアミン神経伝達物質再取り込みインヒビター及びアセチルコリンエステラーゼインヒビターを含む医薬組成物
EP1689704A2 (fr) 2003-10-21 2006-08-16 CoLucid Pharmaceuticals, Inc. Esters de carbamoyle inhibant la cholinesterase et liberant des agents pharmacologiquement actifs
ZA200604410B (en) 2003-12-02 2008-09-25 Ucb Sa Imidazole derivatives, processes for preparing them and their uses
US20050222123A1 (en) 2004-01-27 2005-10-06 North Shore-Long Island Jewish Research Institute Cholinesterase inhibitors for treating inflammation
WO2005074535A2 (fr) 2004-01-30 2005-08-18 Eisai Co., Ltd. Inhibiteurs de cholinesterase pour des troubles de la colonne vertebrale
EP1727538A2 (fr) 2004-02-13 2006-12-06 Neuromolecular Inc. Methodes et compositions destinees au traitement de l'epilepsie, des troubles epileptiques et d'autres troubles du systeme nerveux central
US20050182044A1 (en) 2004-02-17 2005-08-18 Bruinsma Gosse B. Combinatorial therapy with an acetylcholinesterase inhibitor and (3aR)-1,3a,8-trimethyl-1,2,3,3a,8,8a-hexahydropyrrolo[2,3,-b]indol-5-yl phenylcarbamate
US20070213388A1 (en) 2004-03-19 2007-09-13 Bruinsma Gosse B Acetylcholinesterase Inhibitors and N-Methyl-D-Aspartate Antagonists Useful in the Treatment of of Cognitive Disorders
WO2005108358A2 (fr) 2004-04-22 2005-11-17 Eli Lilly And Company Inhibiteurs de la bace
CA2569411A1 (fr) 2004-06-04 2005-12-22 Mood Management Sciences, Llc Compositions et methodes de traitement des troubles de l'humeur
US20070212428A1 (en) 2004-06-04 2007-09-13 Mood Management Sciences, Inc. Methods and compositions for treating mood disorder
EA010912B1 (ru) 2004-06-11 2008-12-30 Юсб, С.А. Способ получения производных 2-оксо-1-пирролидина внутримолекулярным аллилированием
WO2006034196A1 (fr) 2004-09-17 2006-03-30 Lifelike Biomatic Inc. Compositions pour renforcer la mémoire et procédés idoines
EP1807087A2 (fr) 2004-10-12 2007-07-18 Ernir Snorrason Inhibiteurs de l'acetylinesterase pour traiter des maladies de la peau
US7354951B2 (en) 2004-10-18 2008-04-08 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists
WO2006060082A1 (fr) 2004-10-22 2006-06-08 THE GOVERNMENT OF THE U.S.A. as represented by THE SEC., DEPT. OF HEALTH & HUMAN SERVICES, NATIONAL INSTITUTES OF HEALTH Composes tricycliques, leur preparation, et leur utilisation comme inhibiteurs de l'activite de la cholinesterase
WO2006071274A2 (fr) 2004-12-23 2006-07-06 Voyager Pharmaceutical Corporation Acetate de leuprolide et inhibiteurs de l'acetylcholinesterase ou antagonistes des recepteurs nmda pour le traitement de la maladie d'alzheimer
WO2006070394A1 (fr) 2004-12-28 2006-07-06 Council Of Scientific And Industrial Research Esters d'acide carbamique quinoline-6-yle substitues utiles en tant qu'inhibiteurs de l'acetylcholinesterase
JP5739080B2 (ja) 2005-01-27 2015-06-24 アレムビック・リミテッドＡｌｅｍｂｉｃ Ｌｉｍｉｔｅｄ レベチラセタムの徐放性製剤
FR2881618B1 (fr) 2005-02-10 2007-04-13 Centre Nat Rech Scient Utilisation de composes derives de pyrimidinetrione en tant qu'inhibiteurs de l'acetylcholinesterase, compositions contenant ces derives et leurs utilisations en tant qu'insecticides
US20070298098A1 (en) 2005-02-16 2007-12-27 Elan Pharma International Limited Controlled Release Compositions Comprising Levetiracetam
ES2403069T3 (es) 2005-02-22 2013-05-13 Sun Pharma Advanced Research Company Ltd Composición oral de liberación controlada que contiene levetiracetam
US8216611B2 (en) 2005-03-30 2012-07-10 Mylan Pharmaceuticals Ulc Combined-step process for pharmaceutical compositions
EP1874282B1 (fr) 2005-04-06 2010-09-15 Adamas Pharmaceuticals, Inc. Procedes et compositions pour le traitement des pathologies associees au systeme nerveux central
US20060241144A1 (en) 2005-04-20 2006-10-26 Albert Cha Method for treating apathy syndrome
RU2445092C2 (ru) 2005-04-28 2012-03-20 Эйсай Ар Энд Ди Менеджмент Ко., Лтд. Композиция, содержащая средство против деменции
WO2006130522A2 (fr) 2005-05-31 2006-12-07 Orexigen Therapeutics, Inc. Methodes et compositions pour traiter des troubles psychotiques
AU2006254336B9 (en) 2005-06-01 2013-02-28 Ucb Pharma, S.A. 2 -oxo-I -pyrrolidine derivatives/ processes for preparing them and their therapeutic use on the central nervous system
EP1731149A1 (fr) 2005-06-08 2006-12-13 Ucb S.A. Utilisation de Brivaracetam pour le traitement de maladies caracterisées par l'épilepsie myoclonique progressive
MX2007004294A (es) 2005-07-26 2008-03-11 Ucb Pharma Sa Composiciones farmaceuticas que comprenden levetiracetam y proceso para su preparacion.
EP2682481A3 (fr) 2005-08-03 2014-09-17 The Johns-Hopkins University Procédés de caractérisation et de traitement de la déficience cognitive lors du vieillissement et de la maladie
GB0517740D0 (en) 2005-08-31 2005-10-12 Novartis Ag Organic compounds
AU2006322349A1 (en) 2005-12-07 2007-06-14 Ucb Pharma, S.A. Xanthine derivatives, processes for preparing them and their uses
EP1991212A1 (fr) 2006-03-08 2008-11-19 Braincells, Inc. Modulation de neurogenèse par des agents nootropes
US20100216734A1 (en) 2006-03-08 2010-08-26 Braincells, Inc. Modulation of neurogenesis by nootropic agents
JP2009531323A (ja) 2006-03-20 2009-09-03 カウンシル オブ サイエンティフィック アンド インダストリアル リサーチ アセチルコリンエステラーゼ阻害剤として有用な薬剤組成物
WO2007127474A2 (fr) 2006-04-28 2007-11-08 Northwestern University Compositions et traitements utilisant des pyridazines et des inhibiteurs de cholinestérase
US7858611B2 (en) 2006-05-09 2010-12-28 Braincells Inc. Neurogenesis by modulating angiotensin
CA2651862A1 (fr) 2006-05-09 2007-11-22 Braincells, Inc. Neurogenese induite par le recepteur 5ht
ES2444009T3 (es) 2006-06-08 2014-02-21 Ucb Pharma, S.A. Co-cristales de pirrolidinonas
US20080014271A1 (en) 2006-07-13 2008-01-17 Ucb, S.A. Novel pharmaceutical compositions comprising levetiracetam
WO2008021666A2 (fr) 2006-08-18 2008-02-21 Morton Grove Pharmaceuticals, Inc. Compositions stables de lévétiracétam et procédés
WO2008062446A2 (fr) 2006-09-14 2008-05-29 Alembic Limited Composition de lévétiracétam à libération prolongée n'impliquant pas d'effets indésirables en présence d'aliments
AU2007299726A1 (en) 2006-09-22 2008-03-27 Braincells, Inc. Combination comprising an HMG-COA reductase inhibitor and a second neurogenic agent for treating a nervous system disorder and increasing neurogenesis
AU2007309390A1 (en) 2006-10-27 2008-05-02 Medivation Neurology, Inc. Methods and combination therapies for treating Alzheimer's disease
NZ578187A (en) 2006-12-11 2012-05-25 Reviva Pharmaceuticals Inc Compositions, synthesis, and methods of using indanone based cholinesterase inhibitors
WO2008074896A1 (fr) 2006-12-21 2008-06-26 Prendergast Patrick T Compositions et procédés de traitement de troubles neurologiques chroniques
WO2008097546A2 (fr) 2007-02-02 2008-08-14 Colucid Pharmaceuticals, Inc. Composés inhibiteurs de cholinestérase
FR2912056B1 (fr) 2007-02-05 2009-12-18 Rd Pharmagal Composition a liberation prolongee de levetiracetam et procede de preparation
AU2007346591A1 (en) 2007-02-07 2008-08-14 Gosforth Centre (Holdings) Pty Ltd Treatment of ADHD
WO2008132142A2 (fr) 2007-04-27 2008-11-06 Ucb Pharma S.A. Nouveaux dérivés hétérocycliques utiles pour le traitement des troubles du système nerveux central
US7846930B2 (en) 2007-05-18 2010-12-07 Janssen Pharmaceutica Nv Diaryl-substituted tetrahydroisoquinolines as histamine H3 receptor and serotonin transporter modulators
RU2339620C1 (ru) 2007-07-09 2008-11-27 Общество С Ограниченной Ответственностью "Фармвинг" Оксалат n, n-диметил-2-n, n-диметиламинометилпиридил-3-карбамат, обладающий антихолинэстеразной активностью и способностью улучшать когнитивные функции
JP2010533126A (ja) 2007-07-13 2010-10-21 エーザイ・アール・アンド・ディー・マネジメント株式会社 神経因性疼痛の治療ためのａｍｐａ受容体アンタゴニストとアセチルコリンエステラーゼ阻害剤との併用
US20090030403A1 (en) 2007-07-27 2009-01-29 Leyde Kent W Methods and Systems for Attenuating the Tolerance Response to a Drug
WO2009038412A2 (fr) 2007-09-21 2009-03-26 Lg Life Sciences, Ltd. Composés inhibiteurs de la béta-sécrétase
US20090176740A1 (en) 2007-11-30 2009-07-09 Phillips Ii Dauglas James Treatment of neurological conditions by the co-administration of aniracetam and l-alpha glycerylphosphorylcholine
EP2254577A1 (fr) 2007-12-26 2010-12-01 Eisai R&D Management Co., Ltd. Antagonistes des récepteurs ampa pour le traitement de l'épilepsie, de troubles mentaux ou de déficits de l'organe sensoriel
PT2273975E (pt) 2008-03-03 2014-07-17 Ucb Pharma Sa Processos de preparação e utilizações terapêuticas de soluções farmacêuticas
US20110212944A1 (en) 2008-07-01 2011-09-01 Julie Liu 2-oxo-1-pyrrolidine derivatives
JP2010024156A (ja) 2008-07-16 2010-02-04 Ucb Pharma Sa レベチラセタムを含む医薬組成物
JP2011529923A (ja) 2008-08-06 2011-12-15 ゴスフォース センター（ホールディングス）プロプライエタリー リミテッド 精神障害（ｐｓｙｃｈｉａｔｒｉｃｄｉｓｏｒｄｅｒ）を治療するための組成物および方法
AU2009303834B2 (en) 2008-10-16 2016-08-11 The Johns Hopkins University Methods and compositions for improving cognitive function
US9125898B2 (en) 2008-11-14 2015-09-08 Neurotune Ag Acetam derivatives for pain relief
WO2010057088A2 (fr) 2008-11-17 2010-05-20 Auspex Pharmaceuticals, Inc. Modulateurs de pyrrolidinyle de récepteurs nicotiniques d'acétylcholine
CN102215829B (zh) 2008-11-18 2014-12-10 Ucb医药有限公司 含有2-氧代-1-吡咯烷衍生物的延长释放制剂
US20100172979A1 (en) 2008-12-24 2010-07-08 Zhongshui Yu Controlled-release formulations
EP2391351B1 (fr) 2009-01-29 2014-08-20 UCB Pharma, S.A. Compositions pharmaceutiques comprenant des dérivés de 2-oxo-1-pyrrolidine
WO2010089372A1 (fr) 2009-02-09 2010-08-12 Ucb Pharma, S.A. Compositions pharmaceutiques comprenant du brivaracetam
US8846411B2 (en) 2009-06-11 2014-09-30 Microgenics Corporation Derivatives, reagents, and immunoassay for detecting levetiracetam
WO2011015349A2 (fr) 2009-08-07 2011-02-10 Ucb Pharma, S.A. Méthodes d’amélioration de la fonction cognitive
CN101647789B (zh) 2009-09-01 2011-08-17 天津药物研究院药业有限责任公司 左乙拉西坦缓释微丸胶囊制剂
WO2011049309A2 (fr) * 2009-10-09 2011-04-28 영진약품공업 주식회사 Composition pharmaceutique présentant à la fois des caractéristiques de libération lente et de libération immédiate
US20110262442A1 (en) 2009-11-06 2011-10-27 Adenios, Inc. Compositions for treating cns disorders
BR112012019923A2 (pt) 2010-02-09 2016-08-09 Univ Johns Hopkins métodos e composições para melhorar a função cognitiva
WO2011143721A1 (fr) 2010-05-21 2011-11-24 Gosforth Centre (Holdings) Pty Ltd Compositions et procédés pour le traitement de troubles neurodégénératifs
KR20120055313A (ko) 2010-11-23 2012-05-31 주식회사 바이오파마티스 레베티라세탐 또는 이의 약학적으로 허용되는 염을 포함하는 용출 안정성이 개선된 서방형 약학 조성물 및 이의 제조방법
JP2014505108A (ja) 2011-02-09 2014-02-27 ザ・ジョンズ・ホプキンス・ユニバーシティー 認知機能を改善するための方法および組成物
DE102011103270A1 (de) 2011-05-26 2012-11-29 Stada Arzneimittel Ag Pulverförmige Mischung zur Herstellung von Levetiracetam-haltigen Tabletten
GB201111712D0 (en) * 2011-07-08 2011-08-24 Gosforth Ct Holdings Pty Ltd Pharmaceutical compositions
CN104619175A (zh) 2012-08-08 2015-05-13 法莫泰克有限公司 延长释放左乙拉西坦和制备方法
CA2891122C (fr) 2012-11-14 2021-07-20 The Johns Hopkins University Methodes et compositions pour le traitement de la schizophrenie
US20160030391A1 (en) 2013-03-15 2016-02-04 The Johns Hopkins University Methods and compositions for improving cognitive function
EP3827820A1 (fr) 2013-03-15 2021-06-02 The Johns Hopkins University Brivaracetam pour améliorer la fonction cognitive
CN104586806B (zh) 2014-12-26 2018-03-13 东北制药集团沈阳第一制药有限公司 一种左乙拉西坦缓释片及其制备方法
CN112843005B (zh) 2015-05-22 2023-02-21 艾吉因生物股份有限公司 左乙拉西坦的延时释放药物组合物

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KARAKAYA T. ET AL.: "Pharmacological treatment of Mild Cognitive Impairment as a prodromal syndrome of Alzheimer's disease", CURRENT NEUROPHARM., vol. 11, January 2013 (2013-01-01), pages 102 - 108 *
KOIDE R. ET AL.: "Donepezil for memory decline in mild cognitive impairment: Efficacy and limitations in a seven-year follow-up study", ALZHEIMER & DEMENTIA, vol. 8, no. 4 SUPPL, 1 July 2012 (2012-07-01), pages P370 *

Also Published As

Publication number Publication date
CA2904767C (fr) 2022-06-21
US11160785B2 (en) 2021-11-02
HK1220364A1 (zh) 2017-05-05
JP6808679B2 (ja) 2021-01-06
DK2968220T3 (da) 2021-06-14
AU2020210168B2 (en) 2021-09-16
CA2904767A1 (fr) 2014-09-18
US20160271108A1 (en) 2016-09-22
AU2019201994A1 (en) 2019-04-18
EP2968220A4 (fr) 2016-10-19
JP2018131462A (ja) 2018-08-23
JP2019206576A (ja) 2019-12-05
JP2021046438A (ja) 2021-03-25
CN105142623A (zh) 2015-12-09
JP7084632B2 (ja) 2022-06-15
HK1218623A1 (zh) 2017-03-03
EP2968220A1 (fr) 2016-01-20
JP6433482B2 (ja) 2018-12-05
ES2881081T3 (es) 2021-11-26
WO2014144801A1 (fr) 2014-09-18
JP2016514688A (ja) 2016-05-23
AU2020210168A1 (en) 2020-08-13
AU2014228512A1 (en) 2015-10-01

Similar Documents

Publication Publication Date Title
EP2968220B1 (fr) Procédés et compositions pour améliorer la fonction cognitive
JP5289765B2 (ja) 自閉症、強迫神経症、および衝動性の治療のためのメマンチン（ナメンダ）の使用
JP2017137298A (ja) ラキニモドおよびフィンゴリモドを組み合わせた多発性硬化症の治療
JP2017081930A (ja) ラキニモドおよび酢酸グラチラマーを組み合わせた多発性硬化症の治療
EA037187B1 (ru) Способ и композиция для лечения когнитивного расстройства
AU2005204358A1 (en) Memantine for the treatment of mild and mild-to-moderate Alzheimer's disease
US20160256449A1 (en) H3 receptor antagonist for use in the treatment of alzheimer's disease
US20230270753A1 (en) Combinations of gabaa alpha 5 agonists and sv2a inhibitors and methods of using in the treatment of cognitive impairment
US20190381049A1 (en) Compositions and methods for treating dementia
US20190298740A1 (en) Methods and compositions for treating hallucinations and conditions related to the same
US9259423B2 (en) Method of treatment for mental disorders
US20220062265A1 (en) Dose regimens for use of ly3154207 in the treatment of dopaminergic cns disorders
US20230000799A1 (en) Effects of mescaline and of mescaline analogs (scalines) to assist psychotherapy
WO2023191952A1 (fr) Médicaments psychoactifs et leur utilisation pour le traitement de pathologies et de troubles psychiatriques et neurologiques
CN109152768B (zh) 用于促进成体神经发生的方法和组合物
US20110065674A1 (en) Methods and compositions for improving cognitive function
US20160106727A1 (en) Composition and method for the treatment of neurodegeneration
US20200038420A1 (en) Aminosterol compositions and methods of using the same for treating depression
US9682067B2 (en) Methods of improving cognitive function
JP2007532624A (ja) アルツハイマー病の治療のための療法組合せ
EP3297611B1 (fr) Compositions pharmaceutiques de lévétiracétam à libération prolongée
CN111032048B (zh) 丁螺环酮用于治疗功能性头晕的用途
TW201534301A (zh) 以組合療法治療認知損傷
Fekete et al. Parkinson’s Disease
Goodman STATINS ARE PROMISING THERAPEUTIC TOOLS FOR ALZHEIMER DISEASE

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20150917

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20160915

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 31/4015 20060101ALI20160909BHEP

Ipc: A61P 25/28 20060101ALI20160909BHEP

Ipc: A61K 31/445 20060101ALI20160909BHEP

Ipc: A61K 31/13 20060101AFI20160909BHEP

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1220364

Country of ref document: HK

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20190614

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20201015

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

RAP3 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AGENEBIO, INC.

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 1388924

Country of ref document: AT

Kind code of ref document: T

Effective date: 20210515

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602014077190

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

Effective date: 20210607

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: FI

Ref legal event code: FGE

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: NO

Ref legal event code: T2

Effective date: 20210505

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG9D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210805

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2881081

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20211126

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210906

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210806

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210905

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602014077190

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

REG Reference to a national code

Ref country code: AT

Ref legal event code: UEP

Ref document number: 1388924

Country of ref document: AT

Kind code of ref document: T

Effective date: 20210505

26N No opposition filed

Effective date: 20220208

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210905

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20220314

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NO

Payment date: 20230309

Year of fee payment: 10

Ref country code: FR

Payment date: 20230309

Year of fee payment: 10

Ref country code: DK

Payment date: 20230314

Year of fee payment: 10

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20230227

Year of fee payment: 10

Ref country code: IT

Payment date: 20230228

Year of fee payment: 10

Ref country code: BE

Payment date: 20230315

Year of fee payment: 10

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230502

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20230407

Year of fee payment: 10

Ref country code: CH

Payment date: 20230401

Year of fee payment: 10

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20140314

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20240215

Year of fee payment: 11

Ref country code: IE

Payment date: 20240209

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20240226

Year of fee payment: 11

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210505

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FI

Payment date: 20240315

Year of fee payment: 11

Ref country code: DE

Payment date: 20240213

Year of fee payment: 11

Ref country code: GB

Payment date: 20240208

Year of fee payment: 11