EP1299413A2 - Homogentisatphytyltransferase - Google Patents

Homogentisatphytyltransferase

Info

Publication number
EP1299413A2
EP1299413A2 EP01923581A EP01923581A EP1299413A2 EP 1299413 A2 EP1299413 A2 EP 1299413A2 EP 01923581 A EP01923581 A EP 01923581A EP 01923581 A EP01923581 A EP 01923581A EP 1299413 A2 EP1299413 A2 EP 1299413A2
Authority
EP
European Patent Office
Prior art keywords
derivatives
nucleic acid
organism
homogentisate
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01923581A
Other languages
English (en)
French (fr)
Inventor
Karin Herbers
Ralf Badur
Irene Kunze
Susanne Sommer
Rainer Lemke
Michael Geiger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SunGene GmbH
Original Assignee
SunGene GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SunGene GmbH filed Critical SunGene GmbH
Publication of EP1299413A2 publication Critical patent/EP1299413A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/58—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring other than with oxygen or sulphur atoms in position 2 or 4
    • C07D311/70—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring other than with oxygen or sulphur atoms in position 2 or 4 with two hydrocarbon radicals attached in position 2 and elements other than carbon and hydrogen in position 6
    • C07D311/72—3,4-Dihydro derivatives having in position 2 at least one methyl radical and in position 6 one oxygen atom, e.g. tocopherols
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)

Definitions

  • the invention relates to nucleic acid sequences encoding a protein with homogentisate phytyltransferase activity, the use of the nucleic acids for the production of transgenic organisms, such as, for example, transgenic plants with an increased content of tocopherols and / or tocotrienols, a process for the production of plants with an increased content of tocopherols and tocotrienols , as well as the transgenic organisms, such as transgenic plants themselves.
  • the eight naturally occurring compounds with vitamin E activity are derivatives of 6-chromanol (Ulimann's Encyclopedia of Industrial Kitchen, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, Vitamin E) ,
  • the group of tocopherols (la-d) has a saturated side chain
  • the group of tocotrienols (2a-d) has an unsaturated side chain:
  • vitamin E is understood to mean all eight tocopherols and tocotrienols with vitamin E activity mentioned above.
  • Vitamin E compounds are important natural fat-soluble antioxidants. A lack of vitamin E leads to pathophysiological situations in humans and animals. Vitamin E compounds are therefore of great economic value as additives in the food and feed sectors, in pharmaceutical formulations and in cosmetic applications.
  • Particularly economical processes are biotechnological processes that use proteins and biosynthetic genes from tocopherol or tocotrienol biosynthesis from organisms that produce vitamin E.
  • Figure 5 shows a biosynthetic scheme of tocopherols and tocotrienols.
  • homogentisic acid is bound to phytyl pyrophosphate (PPP) or geranylgeranyl pyrophosphate in order to form the precursors of oc-tocopherol and ⁇ -tocotrienol, the 2-methyl-phytylhydroquinone and the 2-methyl-geranylgeranylhydro.
  • PPP phytyl pyrophosphate
  • geranylgeranyl pyrophosphate in order to form the precursors of oc-tocopherol and ⁇ -tocotrienol, the 2-methyl-phytylhydroquinone and the 2-methyl-geranylgeranylhydro.
  • WO 97/27285 describes a modification of the tocopherol content by increased expression or by downregulation of the enzyme p-hydroxyphenylpyruvate dioxygenase (HPPD).
  • HPPD p-hydroxyphenylpyruvate dioxygenase
  • WO 99/04622 describes gene sequences coding for a ⁇ -tocopherolmethyltransferase from Synechocystis PCC6803 and Arabidopsis thaliana and their incorporation into transgenic plants.
  • WO 99/23231 shows that the expression of a geranylgeranyl reductase in transgenic plants results in an increased tocopherol biosynthesis.
  • the invention was based on the object of providing a further biosynthetic gene of the vitamin E biosynthetic pathway and thus further advantageous transgenic plants with an increased content of tocopherols and tocotrienols.
  • the object was achieved by finding nucleic acid sequences coding for a homogentisate phytyltransferase and by overexpressing the homogentisate phytyltransferase gene in plants.
  • the present invention relates to proteins which have the activity of a homogentisate phytyltransferase (HGPT), that is to say the ability to bind phytyl pyrophosphate to homogentisate, for example an enzymatic activity for
  • HGPT homogentisate phytyltransferase
  • Preferred 2-methyl-phytyl hydroquinones are 2-methyl-6-phytyl hydroquinone or 2-methyl-5-phytyl hydroquinone.
  • Homogentisate phytyltransferases are understood below to mean the proteins according to the invention.
  • Preferred proteins have the enzymatic activity for converting homogenate and phytyl pyrophosphate into 2-methyl-phytyl hydroquinone and contain the amino acid sequence SEQ ID NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has a homology of at least 20%, preferably 40%, preferably at least 60%, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO. 2 has.
  • proteins according to the invention can be found, for example, from various organisms whose genomic sequence is known, for example from Arabidopsis thaliana, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO. 2 easy to find.
  • the proteins according to the invention can be used as homogentisate phytyl transferases.
  • the preferred proteins are preferred for all uses of the proteins according to the invention.
  • Substitution means the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.
  • Deletion is the replacement of an amino acid with a direct link.
  • Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
  • Inserts are insertions of amino acids into the polypeptide chain, whereby a direct bond is formally replaced by one or more amino acids.
  • Homology between two proteins means the identity of the amino acids over the respective total protein length, which is calculated by comparison with the aid of the program algorithm GAP (UWGCG, University of Wisconsin, Genetic Computer Group) with the following parameters:
  • a protein which has a homology of at least 20% at the amino acid level with the sequence SEQ ID.NO.2 is accordingly understood to be a protein which, when its sequence is compared with the sequence SEQ'-ID NO.2 according to the above program algorithm
  • the above parameter set has a homology of at least 20%.
  • the homogentisate phytyltransferases according to the invention are capable of converting ho ogentisate derivatives and phytyl pyrophosphate derivatives into 2-methyl-phytyl hydroquinone derivatives and / or homogentisate derivatives and geranyl-geranyl pyrophosphate derivatives into 2-methyl-geranyl-geranyl hydroquinone derivatives.
  • Homogentisate derivatives are understood to mean homogentisate and homogentisate compounds derived therefrom, which are accepted as substrates by the homogentisate phytyltransferases according to the invention.
  • Phytyl pyrophosphate derivatives are understood to mean phytyl pyrophosphate and phytyl pyrophosphate compounds derived therefrom, which are accepted as substrates by the homogeneous phytyl transferases according to the invention.
  • 2-methyl-phytylhydroquinone derivatives are understood to mean the resulting compounds of the enzymatic conversion, such as, for example, 2-methyl-phytylhydroquinone and the corresponding derived compounds.
  • Preferred 2-methyl-phytyl hydroquinone derivatives are derivatives of 2-methyl-6-phytyl hydroquinone or 2-methyl-5-phytyll hydroquinone.
  • Geranyl-geranyl pyrophosphate derivatives include geranyl-geranyl pyrophosphate and derivatives thereof. Geranyl-Geranyl-pyrophosphate compounds understood, the-i ⁇ pn the Homogentisatphytyltransferasen according to the invention as ⁇ ; Substrate are accepted.
  • 2-methyl-geranylgeranyl hydroquinone derivatives are understood to mean the resulting compounds of the enzymatic reaction, such as, for example, 2 ethyl-geranylgeranyl hydro ⁇ hinone and the corresponding derived compounds.
  • Preferred 2-methyl-geranylgeranyl hydroquinones are 2-methyl-6-geranylgeranyl hydroquinone or 2-methyl-5-geranylgeranyl hydroquinone.
  • Preferred 2-methyl-geranylgeranyl hydroquinone derivatives are derivatives of 2-methyl-6-geranylgeranylhydroquinone or 2-methyl-5-geranylgeranylhydroquinone.
  • the invention relates to a "process for biotransformation, characterized in that homogentisate derivatives and phytyl pyrophosphate derivatives in 2-methyl-phytylhydroquinone derivatives or homogentisate derivatives.
  • Geranyl-geranyl pyrophosphate derivatives in 2-methyl-geranyl ge anylhydroquinone Transferred in the presence of a homogentisate phytyl transferase according to the invention.
  • the biotransformation can in principle be carried out with whole cells which express the enzyme HGPT or cell extracts from these cells or with purified or highly pure HGPT.
  • the homogentisate phytyl transferase can also be present in free or in immobilized form.
  • the homogentisate phytyltransferases according to the invention can also be used for the production of vitamin E.
  • the enzymatic biosynthesis step of the homogeneous phytyl transferases can be carried out in vitro or, as described below, in vivo, for example in transgenic organisms, for example in transgenic plants.
  • the invention relates to a process for the preparation of vitamin E, characterized in that homogenate derivatives and phytyl pyrophosphate derivatives. converted into 2-methyl-phytylhydroquinone derivatives or homogentisate derivatives and geranyl-geranyl pyrophosphate derivatives into 2-methyl-geranylgeranylhydroquinone derivatives in the presence of homogentisate phytyl transferase according to the invention.
  • the vitamin E biosynthetic pathway continues to provide target enzymes for the development of inhibitors. Since, according to the current state of the art, there is no enzyme identical or similar to the Synechocystis HGPT in human and animal organisms, it can be assumed that inhibitors have a very specific effect on plants.
  • the invention therefore also relates to the use of the homogentisate phytyltransferase according to the invention as a herbicidal target for finding inhibitors of homogentisate phytyltransferase.
  • the HGPT is a target for herbicides.
  • the complete cDNA sequence of the HGPT from Synechocystis is cloned into an expression vector (pQE, Qiagen) and overexpressed in E. coli.
  • the HGPT protein expressed with the aid of the expression cassette according to the invention is particularly suitable for the detection of inhibitors specific for the HGPT.
  • the invention relates to a method for finding inhibitors of homogeneous phytyltransferase, characterized in that the enzymatic activity of the homogeneous measures tisate phytyl transferase in the presence of a chemical compound and, when the enzymatic activity is reduced compared to the uninhibited activity, the chemical compound is an inhibitor.
  • the HGPT can be used, for example, in an enzyme test in which the activity of the HGPT is determined in the presence and absence of the active substance to be tested. By comparing the two activity determinations, a qualitative and quantitative statement can be made about the inhibitory behavior of the active substance to be tested.
  • test system With the help of the test system according to the invention, a large number of chemical compounds can be checked quickly and easily for herbicidal properties.
  • the method makes it possible to selectively reproducibly select those with great potency from a large number of substances, in order to subsequently carry out further in-depth tests known to the person skilled in the art.
  • the invention therefore furthermore relates to herbicidal active ingredients which can be identified using the test system described above.
  • homogentisate phytyltransferases according to the invention can be produced from natural or genetically modified organisms, as described below, by gene expression of the corresponding nucleic acids which encode these proteins.
  • the invention furthermore relates to nucleic acids, hereinafter called homogentisate phytyltransferase genes (HPGT genes), which encode the proteins according to the invention described above.
  • HPGT genes homogentisate phytyltransferase genes
  • the nucleic acid sequence can be, for example, an RNA, DNA or cDNA sequence. Coding sequences suitable for insertion into a nucleic acid construct, such as, for example, an expression cassette, are, for example, those which code for an HGPT and which give the host the ability to overproduce tocopherols and / or tocotrienols.
  • Suitable nucleic acid sequences can be obtained by back-translating the polypeptide sequence according to the genetic code.
  • codons are preferably used for this that are frequently used according to the organism-specific codon usage.
  • the codon usage can be based on computer evaluations easily identify other known genes of the organism in question.
  • the protein is to be expressed in a plant, it is often advantageous to use the plant's codon usage for the back translation.
  • Preferred nucleic acids encode a vegetable homogenate phytyltransferase or a homogenate phytyltransferase from cyanobacteria.
  • the sequence SEQ ID NO has a particularly preferred nucleic acid. 1.
  • This nucleic acid is a prokaryotic genomic DNA from the cyanobacterium Synechocystis sp. PCC6803, which the Homogentisatphytyltransferase of the sequence SEQ ID NO. 2 coded.
  • All of the above-mentioned homogentisate phytyltransferase genes can be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general ionization methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • the invention further relates to the use of the HGPT according to the invention or the HGPT genes according to the invention for the production of antibodies.
  • the invention further relates to nucleic acid constructs containing one of the above-described homogentisate phytyltransferase genes which are functionally linked to one or more regulation signals which ensure transcription and translation in prokaryotic or eukaryotic organisms.
  • these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid.
  • the natural regulation of these sequences can be carried out before the actual structural genes are still present and may have been genetically modified so that natural regulation has been switched off and the expression of the genes has been increased.
  • the nucleic acid construct can also have a simpler structure, that is to say no additional regulation signals are inserted in front of the above-mentioned homogentisate phytyltransferase genes and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased.
  • These modified promoters can also be placed in front of the natural genes to increase activity.
  • the nucleic acid construct can also advantageously contain one or more so-called “enhancer sequences” functionally linked to the promoter, which enable increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences.
  • the above-mentioned homogentisate phytyltransferase genes can be contained in one or more copies in the gene construct.
  • Nucleic acid constructs are preferably used which enable the expression of the homogentisate phytyltransferase gene according to the invention in a host cell, hereinafter also called the expression cassette.
  • the expression cassettes contain regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell.
  • an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are functionally linked to the intervening coding sequence for the homogentisate phytyltransferase gene.
  • a functional link means the sequential arrangement of promoter, coding sequence
  • the sequences preferred but not limited to the operative linkage are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrial, in the endoplasmic reticulum (ER), in the cell nucleus, in oil corpuscles or other compartments and translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).
  • Advantageous regulatory sequences for the nucleic acid constructs according to the invention, for the method for producing vitamin E described below and for the genetically modified organisms described below are found, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac-, lpp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, 1-PR- or in the 1-PL promoter, which advantageously in gram-negative bacteria Find application.
  • promoters such as cos, tac, trp, tet, trp-tet, lpp, lac-, lpp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, 1-PR- or in the 1-PL promoter, which advantageously in gram-negative bacteria Find application.
  • promoters ay and SP02 are found, for example, in the gram-positive promoters ay and SP02, in the yeast or fungal promoters ADCl, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters CaMV / 35S [Franck et al., 1980, Cell 21: 285-294], PRP1 [Ward et al. , Plans. Mol. Biol. 22 (1993)], SSU, OCS, leb4, usp, STLSl, B33, nos or in the ubiquitin or phaseolin promoter.
  • any promoter which can control the expression of foreign genes in plants is in principle suitable as a promoter of the expression cassette.
  • a plant promoter or a plant virus-derived promoter is preferably used.
  • the CaMV 35S promoter from the Bluenkohl Mosaic Virus is particularly preferred (Franck et al., Cell 21 (1980), 285-294).
  • this promoter contains different recognition sequences for transcriptional effectors, which in their entirety lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).
  • the expression cassette can also contain a pathogen or chemically inducible promoter, by means of which the expression of the exogenous homogentisate phytyltransferase gene in the plant can be controlled at a specific point in time.
  • Such promoters as for example the PRPL promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a promoter inducible by salicylic acid (WO 95/19443), a by benzene sulfonamide-inducible (EP-A 388186), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2, 397-404), one that can be induced by abscisic acid (EP-A 335528) or one that by ethanol - or cyclohexanone-inducible (WO 93/21334) promoter can be used for example.
  • promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of tocopherol or its precursors takes place or in which the products are advantageously accumulated.
  • promoters for the whole plant based on constitutive expression such as the CaMV promoter, the OCS promoter from Agrobacterium (octopine synthase), the NOS promoter from Agrobacterium (nopalin synthase), the ubiquitin promoter, promoters of vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (wheat WO 9113991)
  • Promoters which ensure leaf-specific expression are also to be mentioned in particular. These include the promoter of the cytosolic FBPase from potatoes (WO9705900), the SSU promoter (small subunit) from Rubisco (ribulose-1, 5-bisphosphate carboylase) or the ST-LSI promoter from potatoes (Stockhaus et al., EMBO J. 8: 2445-245 (1989).
  • patatin promoter class I B33
  • GBSS1 starch synthase
  • fruit-specific promoters such as the fruit-specific promoter from tomato (EP409625),
  • fruit ripening-specific promoters such as the fruit ripening-specific promoter from tomato (WO 9421794),
  • flower-specific promoters such as the phytoene synthase promoter (W09216635) or the promoter of the P-rr gene (W09822593) or
  • RNA polymerase promoter W09706250
  • the promoter of the phosphoribosyl pyrophosphate amidotransferase from Glycine max see also Genbank Accession number U87999
  • another node-specific promoter as in EP 249676 can also be used advantageously.
  • the plant expression cassette can be installed in a derivative of the transformation vector pBin-19 with 35s promoter (Bevan, M., Nucleic Acids Research 12: 8711-8721 (1984)).
  • Figure 2 shows a derivative of the transformation vector pBin -19 with seed-specific legu in B4 promoter.
  • the expression cassette can be, for example, a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) Bce4 gene promoter from Brassica (WO 9113980) or LEB4 promoter (Fiedler and Conrad, 1995)), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.
  • a seed-specific promoter preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) Bce4 gene promoter from Brassica (WO 9113980) or LEB4 promoter (Fiedler and Conrad, 1995)
  • the LEB4 signal peptide the gene to be expressed and an ER retention signal.
  • An expression cassette is produced, for example, by fusing a suitable promoter with a suitable HGPT-DNA sequence and preferably a DNA inserted between the promoter and HGPT-DNA sequence, which codes for a chloroplast-specific transit peptide, and a polyadenylation signal according to common recombination methods. and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W.
  • Expression cassettes can also be used, the DNA sequence of which codes for an HGPT fusion protein, for example, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide.
  • Preferred transit peptides are preferred for the chloroplasts. location of the HGPT gene in the chloroplasts from the HGPT part are enzymatically cleaved.
  • the transit peptide which is derived from the plastid Nicotiana tabacum Transketolase or another transit peptide (for example the transit peptide of the small subunit of Rubisco or the ferredoxin NADP oxidoreductase as well as the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred.
  • DNA sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:
  • the inserted nucleotide sequence coding for an HGPT can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, as well as consist of different heterologous HGPT gene sections of different organisms.
  • synthetic nucleotide sequences with codons are generated which are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species.
  • various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
  • adapters or linkers can be attached to the fragments.
  • the promoter and the terminator regions can expediently in the transcription direction with a linker or polylinker which has one or more restriction sites for the
  • the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
  • the promoter can be native or homologous as well as foreign or heterologous to the host plant.
  • the expression cassette contains the promoter in the 5 '-3' transcription direction, a DNA sequence which codes for an HGPT gene and a region for the transcriptional termination. Different termination areas are interchangeable.
  • Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.
  • the fused expression cassette which codes for an HGPT gene is preferably cloned into a vector, for example pBin19, which is suitable for transforming Agrobacterium tumefaciens.
  • Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, such as, for example, tobacco plants, for example by wounded leaves or Leaf pieces are bathed in an agrobacterial solution and then cultivated in suitable media.
  • the transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38.
  • transgenic plants can be regenerated from the transformed cells of the wounded leaves or leaf pieces, which plants contain a gene integrated into the expression cassette for the expression of an HGPT gene.
  • the nucleic acid constructs according to the invention can be used for the production of genetically modified organisms.
  • the genetically modified organisms are produced by transforming the host organisms, hereinafter also referred to as parent organisms, with a construct containing the HGPT gene.
  • Starting or host organisms are understood to mean prokaryotic or eukaryotic organisms, such as, for example, microorganisms, mosses or plants.
  • Preferred microorganisms are bacteria, yeast, algae or fungi.
  • Preferred bacteria are bacteria of the genus Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes or cyano-bacteria of the genus Synechocystis.
  • Preferred yeasts are Candida, Saccharomyces, Hansenula or Pichia.
  • Preferred mushrooms are Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995) on page 15, Table 6 described mushrooms.
  • Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella.
  • the invention relates to a genetically modified organism, the genetic modification being the gene expression of a nucleic acid according to the invention compared to a wild type
  • the transgenic organisms containing the HGPT gene according to the invention are capable of converting homogentisate derivatives and phytylpyrophosphate derivatives into 2-methyl-phytylhydroquinone derivatives and / or homogentisate derivatives and geranyl-geranyl pyrophosphate derivatives into 2-methyl-geranylgeranylhydroquinone derivatives.
  • Transgenic organisms containing an exogenous HGPT gene according to the invention which already have the biosynthesis genes for the production of vitamin E as starting organisms, such as plants or other photosynthetically active organisms such as cyanobacteria, mosses or algae, have an increased content of tocopherols and / or tocotrienols compared to the respective wild type.
  • the invention therefore relates to such a genetically modified organism according to the invention which has an increased vitamin E content compared to the wild type.
  • the present invention further relates to the use of the HGPT or the HGPT genes according to the invention for the production of vitamin E in transgenic organisms.
  • Genetically modified organisms according to the invention preferably plants which can have an increased vitamin E content compared to the wild type, can be used to produce vitamin E.
  • the present invention therefore also relates to processes for the production of vitamin E by cultivating a genetically modified organism according to the invention, preferably a genetically modified plant according to the invention, which has an increased vitamin E content compared to the wild type
  • Organism is harvested and the vitamin E compounds are then isolated from the organism.
  • Genetically modified plants according to the invention with increased vitamin E content that can be consumed by humans and animals can also be used, for example, directly or after preparation known per se as food or feed.
  • plants are used to produce organisms with an increased vitamin E content (tocopherols and / or tocotrienols) compared to the wild type used as starting organisms and, accordingly, as genetically modified organisms.
  • vitamin E content tocopherols and / or tocotrienols
  • Preferred plants are, for example, tagetes, sunflower, arabidopsis, tobacco, red pepper, soy, tomato, eggplant, paprika, carrot, carrot, potato, corn, salads and cabbages, cereals, alfalfa, oats, barley, rye, wheat, triticale, millet , Rice, alfalfa, flax, cotton, hemp, brassicaca such as rape or canola, sugar beet, sugar cane, nut and wine species or woody plants such as aspen or yew.
  • Arabidopsis thaliana Tagetes erecta, Brassica napus, Nicotiana tabacum, canola, potatoes and oilseeds such as soybeans are particularly preferred.
  • the invention further relates to a method for producing genetically modified organisms in which a nucleic acid or a nucleic acid construct according to the invention is introduced into the genome of the starting organism.
  • an expression cassette is inserted as an insert into a recombinant vector, the vector DNA of which may preferably contain additional functional regulatory signals, for example sequences for replication or integration.
  • Suitable vectors for plants are inter alia in "Methods in Plant Molecular Biology and Biotechnology” (CRC Press), Chap. 6/7, pp. 71-119 (1993).
  • the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli.
  • suitable cloning vectors include pBR332, pUC series, M13mp series and pACYC184.
  • Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.
  • Another object of the invention relates to the use of an expression cassette containing a DNA sequence SEQ ID No. 1 or a DNA sequence hybridizing therewith for transforming plants, cells, tissues or parts of plants.
  • the aim of the use is preferably to increase the tocopherols and / or tocotrienols content of the plant.
  • the expression can take place specifically in the leaves, in the seeds, petals or other parts of the plant.
  • Such transgenic plants, their reproductive material and their plant cells, tissue or parts are a further subject of the present invention.
  • the expression cassette can also be used to transform bacteria, cyanobacteria, yeast, filamentous fungi, mosses and algae with the aim of increasing the tocopherol and / or tocotrienol content.
  • transformation The transfer of foreign genes into the genome of a plant is called transformation.
  • the methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium.
  • the methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev.
  • the construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).
  • Agrobacteria transformed with an expression cassette can also be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • Increasing the content of tocopherols or tocotrienols in the context of the present invention means the artificially acquired ability of an increased biosynthetic performance of these compounds by functional overexpression of an HGPT gene according to the invention in the plant compared to the non-genetically modified plant.
  • the content of tocopherols or tocotrienols can be increased.
  • the tocopherol content is preferably increased. But it is also possible under certain conditions to preferably increase the tocotrienol content.
  • the biosynthesis site of tocopherols is the leaf tissue, so that leaf-specific expression of the HGPT gene is useful.
  • the tocopherol biosynthesis need not be restricted to the leaf tissue, but can also be tissue-specific in all other parts of the plant - especially in fatty seeds.
  • constitutive expression of the exogenous HGPT gene is advantageous.
  • inducible expression may also appear desirable.
  • the effectiveness of the expression of the transgenically expressed HGPT gene can be determined, for example, in vitro by multiplication of the shoot meristem.
  • a change in the type and level of expression of the HGPT gene and its effect on the tocopherol biosynthesis performance on test plants can be tested in greenhouse experiments.
  • the invention also relates to transgenic plants, transformed with an expression cassette containing an HGPT gene according to the invention, and transgenic cells, tissues, parts and propagation material of such plants.
  • transgenic plants such as, for example, tagetes, sunflower, arabidopsis, tobacco,
  • Plants in the sense of the invention are mono- and dicotyledonous plants.
  • the invention further relates to further photosynthetically active organisms transformed with an expression cassette containing an HGPT gene according to the invention.
  • the invention therefore relates to a genetically modified organism according to the invention, preferably a plant which is genetically modified according to the invention and which is resistant to inhibitors of homogeneous phytyltransferase.
  • the present invention succeeds, for example, in increasing the activity of homogentisate phytyltransferase (HGPT) in transgenic plants by overexpressing the HGPT gene according to the invention. In principle, this can be achieved by expressing homologous or heterologous HGPT genes.
  • HGPT homogentisate phytyltransferase
  • Example 1 the cloning of an HGPT DNA sequence (SEQ ID No. 1) from Synechocystis spec. PCC 6803. To ensure plastid localization, the HGPT nucleotide sequence from Synechocystis is preceded by a transit signal sequence (Fig. 1-4).
  • HGPT gene according to the invention for the production of plants with an increased content of tocopherols and / or tocotrienols by expression of a HGPT DNA sequence in plants.
  • the DNA coding for the ORF slrl736 was obtained using polymerase chain reaction (PCR) from Synechocystis spec. PCC 6803 according to the method according to Crispin A. Howitt (BioTechniques 21: 32-34, July 1996) using a sense-specific primer (slrl7365 ' Figure 8, SEQ ID NO. 3) and an antisense-specific primer (slrl7363', Figure 9 , SEQ ID NO. 4).
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • Step 1 5 minutes 94 ° C (denaturation) Step 2 3 seconds 94 ° C
  • Step 3 2 minutes 48 ° C (annealing)
  • Step 4 2 minutes 72 ° C (elongation) 35 repetitions of steps 2-4
  • Step 5 10 minutes 72 ° C (post-elongation)
  • Step 6 4 ° C (hold)
  • the amplicon was cloned into the PCR cloning vector pGEM-T (Promega) using standard methods. The identity of the amplicon generated was confirmed by sequencing using the M13F (-40) primer.
  • the vector pGEM-T / slrl736 was digested using the restriction enzyme Hpal. This digest deletes a 348 bp internal fragment of the slrl736.
  • the aminoglycoside-3 'phosphotransferase of the transposon Tn903 was then cloned into the Hpal cleavage sites.
  • the Tn903 was isolated as an EcoRI fragment from the vector pUC4k (Vieira, J and Messing, J., Gene: 19, 259-268, 1982), the protruding ends of the restriction digest were converted into blunt ends by standard methods and into the Hpal cut vector pGEM-T / slrl736 ligated.
  • the ligation approach was used to transform E. coli Xll blue cells. Transformants were selected using kanamycin and ampicillin. A recombinant plasmid (pGEM-T / slrl736:: tn903, see Fig. 6) was isolated and used to transform Synechocystis spec. PCC 6803 used according to the Williams method (Methods Enzymol. 167: 776-778, 1987).
  • Figure 6 shows a construct for knock-out mutagense of ORF slrl736 in Synechocystis spec. PCC 6803.
  • Synechocystis spec. PCC 6803 transformants were selected on (km) BG-11 solid medium containing kanamycin (Castenholz, Methods in Enzymology, 68-93, 1988) at 28 ° C. and 30 ⁇ mol photons x (m 2 xs) -1 .
  • Four independent knock out mutants were generated after five rounds of selection (passages from individual colonies to fresh BG-11 km medium).
  • the biochemical analyzes could thus be carried out using three independently grown cultures of a mutant and the corresponding wild types.
  • the medium of the cell culture was removed by centrifugation twice at 14000 rpm in an Eppendorf table centrifuge.
  • the subsequent digestion of the cells was carried out by four incubations in an Eppendorf shaker at 30 ° C., 1000 rpm in 100% methanol for 15 minutes, the supernatants obtained in each case being combined. Further incubation steps resulted in no further release of tocopherols or tocotrienols.
  • the extracts obtained were analyzed immediately after extraction using a Waters Allience 2690 HPLC system. Tocopherols and tocotrienols were separated on a reverse phase column (ProntoSil 00-3-C30, Bischoff) with a mobile phase of 100% methanol and identified using standards (Merck). The fluorescence of the substances (excitation 295 nm, emission 320 nm) was used as the detection system, which was detected with the aid of a Jasco FP 920 fluorescence detector.
  • the hypothetical protein slr1736 from Synechocystis spec. PCC 6803 was identified by functional expression in E. coli as homogentisate phytyltransferase.
  • the from Synechocystis spec. PCC 6803 amplified gene slrl736 was subcloned in the correct reading frame into the expression vector pQE-30 (Qiagen).
  • the amplification of OFR slrl736 from Synechocystis spec. PCC 6803 primers slrl7365 'and slrl7363' (SEQ. ID. Nos.
  • the slrl736 fragment was isolated from the recombinant plasmid pGEM-T / slrl736 using these flanking BamHI restriction sites and ligated into a BamHI cut pQE-30 using standard methods.
  • the ligation batch was used to transform Ml5 E. coli cells and kanamycin and ampicillin resistant transformants were analyzed. Kanamycin resistance is mediated by the pREP-4 plasmid contained in the Ml5 cells.
  • a recombinant plasmid (pQE-30 / slrl736) which carried the slrl736 fragment in the correct orientation was isolated. The identity and orientation of the insert was confirmed by sequencing.
  • the recombinant plasmid pQE-30 / slrl736 was used to transform M15 E. coli cells to produce recombinant slrl736 protein.
  • an overnight culture in Luria Broth Medium was inoculated with 200 ⁇ g / ml ampicillin (Amp) and 50 ⁇ g / ml kanamycin (Km).
  • Amp ampicillin
  • Km 50 ⁇ g / ml kanamycin
  • a 100 ml Luria Broth culture (Amp / Km) was inoculated the next morning. This culture was incubated at 28 ° C. on a shaking incubator until an ODgoo: 0, 35-0, 4 was reached.
  • the production of the recombinant protein was then induced by adding 0.4 mM isopropyl- ⁇ -D-thiogalactopyranoside (IPTG).
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • the pellet was resuspended in 600 ⁇ l lysis buffer (approx. 1-1.5 ml / g pellet wet weight, 10 mM HEPES KOH pH 7.8, 5 mM dithiothreinol (DTT), 0.24 M sorbitol). Then PMSF (phenyl methyl sulfonate) was added to a final concentration of 0.15 mM and the mixture was placed on ice for 10 minutes. The cells were disrupted by a 10-second ultrasound pulse using an ultrasound rod. After adding Triton X100 (final concentration 0.1%), the cell suspension was incubated on ice for 30 minutes. The mixture was then centrifuged at 25,000 xg for 30 minutes and the supernatant was used for the assay. The activity of the homogentisate phytyltransferase is determined by detecting radioactively labeled 2-methyl-phytylhydroquinone as a reaction product.
  • PMSF phenyl methyl sulfonate
  • 235 ⁇ l of the enzyme (approx. 300-600 ⁇ g) together with 35 ⁇ l phytyl pyrophosphate and 50 ⁇ l (1.2 nmol) 3 H-homogentisic acid were added in the following reaction buffer: 100 ⁇ l (250mM) tricine-NaOH pH 7.6 , 100 ⁇ l (1.25 mM) sorbitol, 10 ⁇ l (50 mM) MgCl 2 and 20 ⁇ l (250 mM) ascorbate for 4 hours at 25 ° C.
  • the tritium-labeled homogentisic acid is present in an ethanolic solution with 1 mg ascorbate / ml. 50 ⁇ l of this are concentrated and the buffer, the enzyme and the phytyl pyrophosphate are added.
  • the reaction was stopped by extracting the mixture twice with ethyl acetate.
  • the ethyl acetate phases were concentrated and the residues were taken up in methanol and applied to a thin-layer plate for chromatographic separation of the substances (solid phase: HPTLC plates: silica gel 60 F 254 (Merk), liquid phase: toluene).
  • the radioactively labeled reaction product is detected by using a phospho-agent.
  • PCC 6803 encoded protein is a homogentisate phytyltransferase because it has the enzymatic activity to form 2-methyl-phytylhydroquinone from homogentisates and phytyl pyrophosphate.
  • Transgenic plants were generated which contain the homogeneous phytyltransferase from Synechocystis spec.
  • PCC 6803 on the one hand under the control of the constitutive 35S promoter of the CaMV (cauliflower mosaic virus) (Franck et al., Cell 21: 285-294, 1980) and on the other hand under the control of the seed-specific promoter of the legumin gene from Vicia faba (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986).
  • Plasmid generated by PCC 6803 was pBinAR-TkTp-9 (Ralf Badur, Dissertration University of Göttingen, 1998).
  • This vector is a derivative of the pBinAR (Höfgen and Willmitzer, Plant Sei. 66: 221-230, 1990) and contains the 35S promoter of the CaMV (cauliflower mosaic virus) (Franck et al., 1980) the termination signal of the octopine synthase gene ( Gielen et al., EMBO J. 3: 835-846, 1984) and the DNA encoding the transit peptide of Nicotiana tabacum plastidic transketolase Sequence.
  • CaMV cauliflower mosaic virus
  • the gene slrl736 was isolated from the plasmid pGEM-T / slrl736 using the flanking BamHI restriction sites. This fragment was ligated into a BamHI cut pBinAR-TkTp-9 using standard methods (see Figure 1). This plasmid (pBinAR-TkTp-9 / slrl736) was used to generate transgenic Nicotiana tabacum plants.
  • Fragment A (529 bp) in Figure 1 contains the 35S promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (245 bp) fragment encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (944Bp) encodes ORF slrl736 from Synechocystis spec. PCC 6803, fragment D (219 bp) codes for the termination signal of the octopine synthase gene.
  • the seed-specific promoter of the Legumin B4 gene (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986) was used.
  • the 2.7 Kb fragment of the legumin B4 gene promoter was isolated from the plasmid pCR-Script / lePOCS using the EcoRI and the 3 'flanking Kpnl cleavage sites.
  • the plasmid pBinAR-TkTp-9 / slrl736 was also treated with the restriction enzymes EcoRI and Kpnl. As a result, the CaMV 35S promoter was separated from this plasmid. The promoter of the legumin gene was then cloned into this vector as an EcoRI / Kpnl fragment, whereby a plasmid was generated which put the expression of the gene slrl736 under the control of this seed-specific promoter, see Figure 2.
  • This plasmid (pBinARleP-TkTp-9 / slrl736) was used to generate transgenic Nicotiana tabacum plants.
  • Fragment A (2700 bp) in Figure 2 contains the promoter of the legumin B4 gene from Vicia faba, fragment B (245bp) encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (944Bp) encodes the ORF slrl736 from Synechocystis spec. PCC 6803, fragment D (219 bp) for the termination signal of the octopine synthase gene. Generation of DNA constructs for the expression of the homogenate phytyltransferase from Synechocystis spec. PCC 6803 in A. thaliana and B. napus.
  • chimeric DNA constructs for the production of transgenic A. thaliana or B.napus plants, which the Homogentisatphytyltransferase from Synechocystis spec. Express PCC 6803, the vectors pPTVkan35S-IPP-Tp-90CS and pPTVkanLeP-IPP-Tp-IONOS were used. These vectors are derivatives of pGPTVkan (D.Becker, E. Kemper, J. Schell, R. Masterson. Plant Molecular Biology 20: 1195-1197, 1992) to which the uidA gene has been deleted.
  • the pPTVkan35S-IPP-Tp-90CS contains the 35S promoter of the CaMV (cauliflower mosaic virus) (Franck et al., 1980), the sequence coding for the transit peptide of A. thaliana plastid-specific isopentenyl pyrophosphate isomerase-2 (IPP-2) (Badur, unpublished) and the termination signal of the octopine synthase gene (Gielen et al., 1984)
  • the vector pPTVkanLeP-IPP-Tp-lOnos contains the seed-specific promoter of the Legumin B4 gene (Kafatos et al., Nuc. Acid.
  • Fragment A (529 bp) in Figure 3 contains the 35S ⁇ promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus).
  • Fragment B (205 bp) fragment coding for the transit peptide of A. thaliana isopentenyl pyrophosphate isomerase-2.
  • Fragment C (205 bp) fragment coding for the transit peptide of A. thaliana isopentenyl pyrophosphate isomerase-2.
  • Fragment A (2700 bp) in Figure 4 contains the promoter of the legumin B4 gene from Vicia faba, fragment B (206 bp) fragment coding for the transit peptide of A. thaliana isopentenylpyrophosphate isomerase-2.
  • Fragment C (944Bp) encodes the ORF slrl736 from Synechocystis spec. PCC 6803.
  • Fragment D (272 bp) for the termination signal of the nopaline synthase gene.
  • Wild-type Arabidopsis thaliana plants (Columbia) were transformed with the Agrabacterium tumefaciens strain (GV3101 [pMP90]) on the basis of a modified vacuum filtration method (Steve Clough and Andrew Bent. Floral dip: a simplified method for Agrobacterium mediated transformation of A. thaliana. Plant J 16 (6): 735-43, 1998; der Bechtold, N. Ellis, J. and Pelltier, G., in: Planta Agrobacterium-ediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sei Paris, 1993, 1144 (2 ): 204-212).
  • the Agrobacterium tumefaciens cells used had previously been transformed with the plas iden pPTVkan35SIPP-Tp9 / slrl736 or pPTVkanLePIPP-Tp9 / slrl736 ( Figures 3 and 4).
  • Seeds of the primary transformants were selected based on antibiotic resistance. Antibiotic-resistant seedlings were planted in soil and used as fully developed plants for biochemical analysis.
  • transgenic oilseed rape plants were based on a protocol by Bade, J.B. and dam, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer
  • the transformations were carried out with the Agrobacterium tumefaciens strain GV3101 [pMP90].
  • the plasmids pPTVkan35SIPP-Tp9 / slrl736 and pPTVkanLePIPP-TplO / slrl736 were used for the transformation ( Figures 3 and 4).
  • Brassica napus var. Westar seeds were surface sterilized with 70% ethanol (v / v), washed in water for 10 minutes at 55 ° C, in 1% hypochlorite solution (25% v / v tea pol, 0.1% v / v Tween 20) incubated for 20 minutes and washed six times with sterile water for 20 minutes each.
  • the seeds were dried on filter paper for three days and 10-15 seeds were germinated in a glass flask with 15 ml of germination medium.
  • the roots and apices were removed from several seedlings (approx. 10 cm in size) and the remaining hypocotyls were cut into pieces approx. 6 mm long.
  • the approximately 600 explants obtained in this way were washed with 50 ml of basal medium for 30 minutes transferred to a 300 ml flask. After adding 100 ml of callus induction medium, the cultures were incubated for 24 hours at 100 rpm.
  • An overnight culture of the Agrobacterium strain was set up at 29 ° C. in Luria Broth medium with kanamycin (20 mg / 1), of which 2 ml in 50 ml of Luria Broth medium without kanamycin for 4 hours at 29 ° C. until an ODßoo of Incubated 0.4-0.5. After pelleting the culture at 2000 rpm for 25 min, the cell pellet was resuspended in 10 25 ml of basal medium. The concentration of the bacteria in the solution was adjusted to an ODgoo of 0.3 by adding further basal medium.
  • the callus induction medium was removed from the oilseed rape explants using 15 sterile pipettes, 50 ml of Agrobacterium solution were added, mixed gently and incubated for 20 min. The agrobacterial suspension was removed, the oilseed rape explant was washed for 1 min with 50 ml of callus induction medium and then 100 ml of callus induction medium was added.
  • the co-cultivation 20 was carried out on a rotary shaker at 100 rpm for 24 h. The co-cultivation was stopped by removing the callus induction medium and the explants were washed twice for 1 min with 25 ml and twice for 60 min with 100 ml washing medium at 100 rpm. The washing medium with the explants 25 was transferred to 15 cm petri dishes and the medium was removed with sterile pipettes.
  • the petri dishes were closed with 2 layers of leucopor and incubated at 25 ° C. and 2000 lux with photoperiods of 16 hours light / 8 hours dark. The developing calli were transferred to fresh petri dishes with shoot induction medium every 12 days. All further
  • the wild-type plants from sterile culture were obtained by vegetative replication. For this purpose, only the tip of the plant was cut off and transferred to fresh 2MS medium in a sterile mason jar. The hair on the top of the leaf and the midribs of the leaves were removed from the rest of the plant. The leaves were cut into 2 large pieces with a razor blade. The agrobacterial culture was transferred to a small petri dish (2 cm in diameter). The leaf pieces were briefly drawn through this solution and the underside of the leaf was placed on 2MS medium in Petri dishes (diameter 9 cm) so that they touched the medium. After two days in the dark at 25 ° C, the explants were transferred to plates with callus induction medium and heated to 28 ° C in the climatic chamber.
  • the medium had to be changed every 7-10 days. As soon as calli formed, the explants were placed in sterile mason jars on shoot induction medium with Claforan (0.6% BiTec agar (g / v), 2.0 mg / 1 zeatin ribose,
  • Organogenesis occurred after about a month and the shoots formed could be cut off.
  • the shoots were cultivated on 2MS medium with Claforan and a selection marker. As soon as a strong root ball had formed, the plants could be potted in prickly soil.
  • the vitamin E biosynthesis is influenced in the transgenic plants
  • the tocopherol and tocotrienol contents in leaves and seeds of the plants transformed with the described constructs are analyzed.
  • the transgenic plants are cultivated in the greenhouse and plants which code the gene for the homogenate phytyltransferase from Synechocystis spec.
  • PCC 6803 express analyzed at Northern level. The tocopherol content and the tocotrienol content are determined in the leaves and seeds of these plants. In all cases, the tocopherol or tocotrienol concentration in transgenic plants which additionally express a nucleic acid according to the invention is increased in comparison to plants which have not been transformed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

Die Erfindung betrifft Nukleinsäuresequenzen kodierend ein Protein mit Homogentisatphytyltransferase-Aktivität, die Verwendung der Nukleinsäuren zur Herstellung von transgenen Organismen, wie beispielsweisetransgenen Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen, ein Verfahren zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und/oder Tocotrienolen, sowie die transgenen Pflanzen selbst.

Description

Homogentisatphytyltransferase
Beschreibung
Die Erfindung betrifft Nukleinsäuresequenzen kodierend ein Protein mit Homogentisatphytyltransferase-Aktivität, die Verwendung der Nukleinsäuren zur Herstellung von transgenen Organismen, wie beispielsweise .transgenen Pflanzen mit erhöhtem Gehalt an Tocopherolen und/oder Tocotrienolen, ein Verfahren zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen, sowie die transgenen Organismen, wie beispielsweise transgene Pflanzen selbst.
Die in der Natur vorkommenden acht Verbindungen mit Vitamin E- Aktivität sind Derivate des 6-Chromanols (Ulimann' s Encyclopedia of Industrial Che istry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, Vitamin E) . Die Gruppe der Toco- pherole (la-d) weist eine gesättigte Seitenkette auf, die Gruppe der Tocotrienole (2a-d) eine ungesättigte Seitenkette:
la , α-Tocopherol : R1 = R2 = R3 = CH3 lb, ß-Tocopherol [ 148-03-8] : R1 = R3 = CH3 , R2 = H lc , γ-Tocopherol [ 54-28-4 ] : R1 = H, R2 = R3 = CH3 ld, δ-Tocopherol [ 119-13-1] : R1 = R2 = H, R3 = CH3
2a , α-Tocotrienol [1721-51-3 ] : R1 = R2 = R3 = CH3
2b, ß-Tocotrienol [490-23-3 ] : R1 = R3 = CH3 , R2 = H
2c , γ-Tocotrienol [ 14101-61-2 ] : R1 = H, R2 = R3 = CH3
2d, δ-Tocotrienol [25612-59-3 ] : R1 = R2 = H, R3 = CH3 In der vorliegenden Erfindung werden unter Vitamin E alle acht vorstehend erwähnten Tocopherole und Tocotrienole mit Vitamin-E- Aktivität verstanden.
Diese Verbindungen mit Vitamin-E-Aktivität sind wichtige natürliche fett-lösliche Antioxidantien. Ein Mangel an Vitamin E führt bei Menschen und Tieren zu pathophysiologischen Situationen. Vitamin E-Verbindungen haben daher einen hohen wirtschaftlichen Wert als Zusatzstoffe im Food-.und Feed-Bereich, in pharma- zeutischen Formulierungen und in kosmetischen Anwendungen.
Ein wirtschaftliches Verfahren zur Herstellung von Vitamin E-Verbindungen sowie Nahrungs- und Futtermittel mit erhöhtem Vitamin E-Gehalt sind daher von großer Bedeutung.
Besonders wirtschaftliche Verfahren sind biotechnologische Verfahren, die Proteine und Biosynthesegene der Tocopherol- bzw. Tocotrienol-Biosynthese aus Vitamin-E-produzierenden Organismen nutzen.
Abbildung 5 zeigt ein Biosyntheseschema von Tocopherolen und Tocotrienolen.
Im Verlauf der Biosynthese wird Homogentisinsäure (Homogentisat) an Phytylpyrophosphat (PPP) bzw. Geranylgeranylpyrophosphat gebunden, um die Vorläufer von oc-Tocopherol und α-Tocotrienol, das 2-Methyl-phytylhydrochinon bzw. das 2-Methyl-geranylgeranylhydro- chinon zu bilden. Durch Methylierungsschritte mit S-Adenosyl- methionin als Methyl-Gruppen-Donor entsteht zunächst 2,3-Di- methyl-6-phytylhydrochinon, dann durch Zyklisierung γ-Tocopherol und durch nochmalige Methylierung -Tocopherol .
Katani et al., Annu. Rev. Plant Physiol. Plant Mol. Biol, 1998, 49, 151 bis 157, beschreiben die genomische Gesamtsequenz des Cyanobakteriums Synechocystis sp. PCC6803.
Über die Erhöhung des Metabolitflusses zur Steigerung des Tocopherol- bzw. Tocotrienolgehaltes in transgenen Organismen, beispielsweise in transgenen Pflanzen durch Überexpression einzelner Biosynthesegene ist bisher wenig bekannt.
WO 97/27285 beschreibt eine Modifikation des Tocopherol-Gehaltes durch verstärkte Expression bzw. durch Herunterregulation des Enzyms p-Hydroxyphenylpyruvatdioxygenase (HPPD) . WO 99/04622 beschreibt Gensequenzen codierend für eine γ-Toco- pherolmethyltransferase aus Synechocystis PCC6803 und Arabidopsis thaliana und deren Einbau in transgene Pflanzen.
WO 99/23231 zeigt, daß die Expression einer Geranylgeranyl- Reductase in transgenen Pflanzen eine gesteigerte Tocopherσl- biosynthese zur Folge hat .
Der Erfindung lag die Aufgabe zugrunde, ein weiteres Biosynthese- gen des Vitamin-E-Biosyntheweges und damit weitere vorteilhafte transgene Pflanzen mit erhöhtem Gehalt an Tocopherolen und Tocotrienolen zur Verfügung zu stellen.
Die Aufgabe wurde durch Auffinden von Nukleinsäuresequenzen, codierend eine Homogentisatphytyltransferase und durch Überexpression des Homogentisatphytyltransferase-Gens in Pflanzen gelöst.
Dementsprechend betrifft die vorliegende Erfindung Proteine, die die Aktivität einer Homogentisatphytyltransferase (HGPT) aufweisen, also die Fähigkeit Phytylpyrophosphat an Homogentisat zu binden, also beispielsweise eine enzymatische Aktivität zur
Umwandlung von Homogentisat und Phytylpyrophosphat in 2-Methyl- phytylhydrochinon aufweisen.
Bevorzugte 2-Methyl-phytylhydrochinone sind 2-Methyl-6-phytyl- hydrochinon oder 2-Methyl-5-phytylhydrochinon.
Unter Homogentisatphytyltransferasen werden im folgenden die erfindungsgemäßen Proteine verstanden.
Bevorzugte Proteine weisen die enzymatische Aktivität zur Umwandlung von Homogentisat und Phytylpyrophosphat in 2-Methyl-phytyl- hydrochinon auf und enthalten die Aminosäuresequenz SEQ ID NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Homologie von mindestens 20 %, bevorzugt 40 %, vorzugsweise mindestens 60 %, bevorzugter mindestens 80 %, besonders bevorzugt mindestens 90 % auf Aminosäureebene mit der Sequenz SEQ ID NO. 2 aufweist.
Weitere Beispiele für die erfindungsgemäßen Proteine lassen sich beispielsweise aus verschiedenen Organismen deren genomische Sequenz bekannt ist, wie beispielsweise aus Arabidopsis thaliana durch Homologievergleiche der Aminosäuresequenzen oder der ent- sprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID. NO. 2 leicht auffinden. Die erfindungsgemäßen Proteine können als Homogentisatphytyl- transferasen verwendet werden.
Für alle erfindungsgemäßen Verwendungen der erfindungsgemäßen Proteine sind die bevorzugten Proteine bevorzugt.
Unter Substitution ist der Austausch einer oder mehrerer Aminosäuren durch eine oder mehrere Aminosäuren zu verstehen. Bevorzugt werden sog. konservative Austausche durchgeführt, bei denen die ersetzte Aminosäure eine ähnliche Eigenschaft hat wie die ursprüngliche Aminosäure, beispielsweise Austausch von Glu durch Asp, Gin durch Asn, Val durch Ile, Leu durch Ile, Ser durch Thr.
Deletion ist das Ersetzen einer Aminosäure durch eine direkte Bindung. Bevorzugte Positionen für Deletionen sind die Termini des Polypeptides und die Verknüpfungen zwischen den einzelnen Proteindomänen.
Insertionen sind Einfügungen von Aminosäuren in die Polypeptid- kette, wobei formal eine direkte Bindung durch ein oder mehrere Aminosäuren ersetzt wird.
Unter Homologie zwischen zwei Proteinen wird die Identität der Aminosäuren über die jeweils gesamte Proteinlänge verstanden, die durch Vergleich mit Hilfe des Programmalgorithmus GAP (UWGCG, University of Wisconsin, Genetic Computer Group) unter Einstellung folgender Parameter berechnet-wird:
Gap Weight: 12
Length Weight: 4 Average Match: 2,912
Average Mismatch: -2,003
Unter einem Protein, das eine Homologie von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID.NO.2 aufweist, wird dementsprechend ein Protein verstanden, das bei einem Vergleich seiner Sequenz mit der Sequenz SEQ'-ID NO.2 nach obigen Programmalgorithmus mit obigem Parametersatz eine Homologie von mindestens 20 % aufweist.
Die erfindungsgemäßen Homogentisatphytyltransferasen sind in der Lage Ho ogentisatderivate und Phytylpyrophosphat-Derivate in 2-Methyl-Phytylhydrochinonderivate und/oder Homogentisatderivate und Geranyl-Geranyl-pyrophosphatderivate in 2-Methyl-geranyl- geranylhydrochinonderivate zu überführen. Unter Homogentisatderivaten werden Homogentisat und davon abgeleitete Homogentisatverbindungen verstanden, die von den erfindungsgemäßen Homogentisatphytyltransferasen als Substrat akzeptiert werden.
Unter Phytylpyrophosphat-Derivaten werden-Phytylpyrophosphat und davon abgeleitete Phytylpyrophosphatverbindungen verstanden, die von den erfindungsgemäßen Homogentisatphytyltransferasen als Substrat akzeptiert werden.
Unter 2-Methyl-Phytylhydrochinonderivaten werden dementsprechend die resultierenden Verbindungen der enzymatischen Umsetzung verstanden, wie beispielsweise 2-Methyl-Phytylhydrochinon und die entsprechenden abgeleiteten Verbindungen.
Bevorzugte 2-Methyl-phytylhydrochinonderivate sind Derivate des 2-Methyl-6-phytylhydrochinon oder 2-Methyl-5-phytyllhydrochinon.
Unter Geranyl-Geranyl-pyrophosphatderivaten werden Geranyl- Geranyl-pyrophosphat und davon abgeleitete. Geranyl-Geranyl- pyrophosphatverbindungen verstanden, die-iςpn den erfindungsgemäßen Homogentisatphytyltransferasen als~; Substrat akzeptiert werden.
Unter 2-Methyl-Geranylgeranylhydrochϊnonderivaten werden dementsprechend die resultierenden Verbindungen der enzymatischen Umsetzung verstanden, wie beispielsweise 2 ethyl-geranylgeranyl- hydroαhinon und die entsprechenden abgeleiteten Verbindungen.
Bevorzugte 2-Methyl-Geranylgeranyihydrochi£ιone sind 2-Methyl- 6-Geranylgeranylhydrochinon oder 2-Methyl-5-Geranylgeranylhydro- chinon.
Bevorzugte 2-Methyl-Geranylgeranylhydrochinonderivate sind Derivate des 2-Methyl-6-Geranylgeranylhyd ochinon oder 2-Methyl- 5-Geranylgeranylhydrochinon.
Dementsprechend betrifft die Erfindung e n" Verf hren zur Biotransformation, dadurch gekennzeichnet, daß man Homogentisat- derivate und Phytylpyrophosphat-Derivate in 2-Methyl-Phytylhydro- chinonderivate oder Homogentisatderivate.Λnd Geranyl-Geranyl- pyrophosphatderivate in 2-Methyl-geranylge anylhydrochinon- derivate in Gegenwart einer erfindungsgemä-ßen Homogentisatphytyltransferase überführt. Die Biotransformation läßt sich prinzipiell mit ganzen Zellen, die das Enzym HGPT exprimieren oder Zellextrakten aus diesen Zellen oder aber mit aufgereinigter oder hochreiner HGPT durchführen. Die Homogentisatphytyltransferase kann dabei auch in freier oder in immobilisierter Form vorliegen.
Die erfindungsgemäßen Homogentisatphytyltransferasen können ferner zur Herstellung von Vitamin E verwendet werden. Der enzymatische Biosyntheseschritt Schritt der Homogentisatphytyl- transferasen kann dabei in vitro oder wie nachstehend beschrieben in vivo, beispielsweise in transgenen Organismen, wie beispielsweise in transgenen Pflanzen erfolgen.
Dementsprechend betrifft die Erfindung ein Verfahren zur Her- Stellung von Vitamin E, dadurch gekennzeichnet, daß man Homogentisatderivate und Phytyl-Pyrophosphat-Derivate. in 2-Methyl- Phytylhydrochinonderivate oder Homogentisatderivate und Geranyl- Geranyl-Pyrophosphatderivate in 2-Methyl-geranylgeranylhydro- chinonderivate in Gegenwart erfindungsgemäßen Homogentisatphytyl- transferase überführt.
Der Biosyntheseweg von Vitamin E bietet weiterhin Targetenzyme für die Entwicklung von Inhibitoren. Da sich nach heutigem Stand der Technik kein mit der Synechocystis HGPT identisches oder ähnliches Enzym in humanen und tierischen Organismen befindet, ist davon auszugehen, daß Inhibitoren sehr spezifisch auf Pflanzen wirken.
Daher betrifft die Erfindung auch die Verwendung der erfindungs- gemäßen Homogentisatphytyltransferase als herbizides Target zum Auffinden von Inhibitoren der Homogentisatphytyltransferase.
Die HGPT ist ein Target für Herbizide. Um effiziente Hemmstoffe der HGPT finden zu können, ist es notwendig, geeignete Test- Systeme, mit denen Inhibitor-Enzym-Bindungsstudien durchgeführt werden können, zur Verfügung zu stellen. Hierzu wird beispielsweise die komplette cDNA-Sequenz der HGPT aus Synechocystis in einen Expressionsvektor (pQE, Qiagen) kloniert und in E. coli überexprimiert .
Das mit Hilfe der erfindungsgemäßen Expressionskassette exprimierte HGPT-Protein eignet sich besonders zur Auffindung von für die HGPT spezifischen Hemmstoffen.
Dementsprechend betrifft die Erfindung ein Verfahren zum Auffinden von Inhibitoren der Homogentisatphytyltransferase, dadurch gekennzeichnet, daß man die enzymatische Aktivität der Homogen- tisatphytyltransferase in Gegenwart einer chemischen Verbindung misst und bei Erniedrigung der enzymatischen Aktivität im Vergleich zur nicht gehemmten Aktivität die chemische Verbindung einen Inhibitor darstellt.
Dazu kann die HGPT beispielsweise in einem Enzymtest eingesetzt werden, bei dem die Aktivität der HGPT in An- und Abwesenheit des zu testenden Wirkstoffs ermittelt wird. Aus dem Vergleich der beiden Aktivitätsbestimmungen läßt sich eine qualitative und quantitative Aussage über das Hemmverhalten des zu testenden Wirkstoffes machen.
Mit Hilfe des erfindungsgemäßen Testsystems kann eine Vielzahl von chemischen Verbindungen schnell und einfach auf herbizide Eigenschaften überprüft werden. Das Verfahren gestattet es, reproduzierbar aus einer großen Anzahl von Substanzen gezielt solche mit großer Wirkstärke auszuwählen, um mit diesen Substanzen anschließend weitere, dem Fachmann geläufige vertiefte Prüfungen durchzuführen.
Ein weiterer Gegenstand der Erfindung sind deshalb herbizide Wirkstoffe, die mit dem oben beschriebenen Testsystem identifizierbar sind.
Die erfindungsgemäßen Homogentisatphytyltransferasen lassen sich, wie nachstehend beschrieben durch Genexpression der entsprechenden Nukleinsäuren, die diese Proteine kodieren, aus natürlichen oder genetisch veränderten Organismen herstellen.
Ein weiterer Gegenstand der Erfindung sind Nukleinsäuren, im folgenden Homogentisatphytyltransferase-Gene (HPGT-Gene) genannt, die die vorstehend beschriebenen erfindungsgemäßen Proteine kodieren.
Die Nukleinsäuresequenz kann beispielsweise eine RNA-, DNA- oder cDNA-Sequenz sein. Zur Insertion in ein Nukleinsäurekonstrukt, wie beispielsweise eine Expressionskassette, geeignete kodierende Sequenzen sind beispielsweise solche, die für eine HGPT kodieren und die dem Wirt die Fähigkeit zur Überproduktion von Toco- pherolen und/oder Tocotrienolen verleihen.
Geeignete Nukleinsäuresequenzen sind durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der Organismus spezifischen codon usage häufig verwendet werden. Die codon usage läßt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.
Soll das Protein beispielsweise in einer Pflanze exprimiert werden, so ist es häufig vorteilhaft, die codon usage der Pflanze bei der Rückübersetzung zu verwenden.
Bevorzugte Nukleinsäuren codieren eine pflanzliche Homogentisatphytyltransferase oder eine Homogentisatphytyltransferase aus Cyanobakterien.
Eine besonders bevorzugte Nukleinsäure hat die Sequenz SEQ ID NO. 1. Diese Nukleinsäure stellt eine prokaryontische genomische DNA aus dem Cyanobakterium Synechocystis sp. PCC6803 dar, die die Homogentisatphytyltransferase der Sequenz SEQ ID NO. 2 codiert.
Alle vorstehend erwähnten Homogentisatphytyltransferase-Gene sind in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligo- nukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow- Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine lonierungsverfahren werden in Sambrook et al . (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Die Erfindung betrifft ferner die Verwendung der erfindungsgemäßen HGPT oder der erfindungsgemäßen HGPT-Gene zur Herstellung von Antikörpern.
Die Erfindung betrifft weiterhin Nukleinsäurekonstrukte, enthaltend eine der vorstehend beschriebenen, erfindungsgemäßen Homogentisatphytyltransferase-Gene, die mit einem oder mehreren Regulationssignalen funktioneil verknüpft sind, die die Transkription und Translation in prokaryontisehen oder eukaryontisehen Organismen gewährleisten.
Beispielsweise handelt es sich bei diesen regulatorischen Sequenzen um Sequenzen an die Induktoren oder Repressoren binden und so die Expression der Nukleinsäure regulieren. Zusätzlich zu diesen neuen Regulationssequenzen oder anstelle dieser Sequenzen kann die natürliche Regulation dieser Sequenzen vor den eigent- liehen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so daß die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde. Das Nukleinsäurekonstrukt kann aber auch einfacher aufgebaut sein, das heißt es werden keine zusätzlichen Regulationssignale vor die vorstehend erwähnten Homogentisatphytyltransferase-Gene inseriert und der natürliche Promotor mit seiner Regulation wird nicht entfernt. Stattdessen wird die natürliche Regulationssequenz so mutiert, daß keine Regulation mehr erfolgt und die Genexpression gesteigert wird. Diese veränderten Promotoren können auch allein vor die natürlichen Gene zur Steigerung der Aktivität gebracht werden.
Das Nukleinsäurekonstrukt kann außerdem vorteilhafterweise auch eine oder mehrere sogenannte "enhancer Sequenzen" funktioneil verknüpft mit dem Promotor enthalten, die eine erhöhte Expression der Nucleinsäuresequenz ermöglichen. Auch am 3 ' -Ende der DNA- Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren. Die vorstehend erwähnten Homogentisatphytyltransferase-Gene können in einer oder mehreren Kopien im Genkonstrukt enthalten sein.
Bevorzugt werden Nukleinsäurekonstrukte verwendet, die die Expression des erfindungsgemäßen Homogentisatphytyltransferase- Gens in einer Wirtszelle ermöglichen, im folgenden auch Expressionskassette genannt.
Die Expressionskassetten beinhalten regulative Nukleinsäure- Sequenzen, welche die Expression der kodierenden Sequenz in der Wirtszelle steuern. Gemäß einer bevorzugten Ausführungsform umfaßt eine Expressionskassette stromaufwärts, d.h. am 5 '-Ende der kodierenden Sequenz, einen Promotor und stromabwärts, d.h. am 3 '-Ende, ein Polyadenylierungssignal und gegebenenfalls weitere regulatorische Elemente, welche mit der dazwischenliegenden kodierenden Sequenz für das homogentisatphytyltransferase-Gen funktioneil verknüpft sind.
Unter einer funktioneilen Verknüpfung versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz,
Terminator und ggf. weiterer regulativer Elemente derart, daß jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann. Die zur operativen Verknüpfung bevorzugten aber nicht darauf beschränkten Sequenzen sind Targeting-Sequenzen zur Gewährleistung der subzellulären Lokalisation im Apoplasten, in der Vakuole, in Piastiden, im Mitochondriu , im Endoplasmatischen Retikulum (ER) , im Zellkern, in Ölkörperchen oder anderen Kompartimenten und Translationsverstärker wie die 5'-Führungssequenz aus dem Tabak-Mosaik-Virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711) .
Je nach nachstehend näher beschriebenen WirtsOrganismus oder Ausgangsorganismus der durch Einbringen der Expressionskassette in einen genetisch veränderten oder transgenen Organismus überführt wird, eignen sich verschiedene Regulationssequenzen.
Vorteilhafte Regulationssequenzen für die erfindungsgemäßen Nukleinsäurekonstrukte, für das nachstehend beschriebene Verfahren zur Herstellung von Vitamin E und für die nachstehend beschrieben genetisch veränderten Organismen sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, lpp-, lac-, lpp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, 1-PR- oder im 1-PL-Promotor enthalten, die vorteilhafterweise in gramnegativen Bakterien Anwendung finden.
Weitere vorteilhafte RegulationsSequenzen sind beispielsweise in den gram-positiven Promotoren a y und SP02, in den Hefe- oder Pilzpromotoren ADCl, MFa , AC, P-60, CYC1, GAPDH, TEF, rp28, ADH oder in den Pflanzenpromotoren CaMV/35S [Franck et al., Cell 21(1980) 285-294], PRP1 [Ward et al . , Plant. Mol. Biol. 22 (1993)], SSU, OCS, leb4, usp, STLSl, B33, nos oder im Ubiquitin- oder Phaseolin-Promotor enthalten.
Für Pflanzen als genetisch veränderte Organismen ist als Promotor der Expressionskassette grundsätzlich jeder Promotor geeignet, der die Expression von Fremdgenen in Pflanzen steuern kann.
Vorzugsweise verwendet man insbesondere einen pflanzlichen Promotor oder einen Promotor, der einem Pflanzenvirus entstammt. Insbesondere bevorzugt ist der CaMV 35S-Promotor aus dem Blu en- kohl-Mosaik-Virus (Franck et al., Cell 21 (1980), 285-294). Dieser Promotor enthält bekanntlich unterschiedliche Erkennungssequenzen für transkriptionale Effektoren, die in ihrer Gesamtheit zu einer permanenten und konstitutiven Expression des eingeführten Gens führen (Benfey et al., EMBO J. 8 (1989), 2195-2202). Die Expressionskassette kann auch einen pathogen- oder chemisch induzierbaren Promotor enthalten, durch den die Expression des exogenen Homogentisatphytyltransferase-Gens in der Pflanze zu einem bestimmten Zeitpunkt gesteuert werden kann.
Derartige Promotoren wie z.B. der PRPl-Promotor (Ward et al . , Plant. Mol. Biol. 22 (1993), 361-366), ein durch Salizylsäure induzierbarer Promotor (WO 95/19443), ein durch Benzene- sulfonamid-induzierbarer (EP-A 388186) , ein durch Tetrazyklin- induzierbarer (Gatz et al., (1992) Plant J. 2, 397-404), ein durch Abscisinsäure-induzierbarer (EP-A 335528) bzw. ein durch Ethanol- oder Cyclohexanon-induzierbarer (WO 93/21334) Promotor können beispielsweise verwendet werden.
Weiterhin sind insbesondere solche Promotoren bevorzugt, die die Expression in Geweben oder Pflanzenteilen sicherstellen, in denen beispielsweise die Biosynthese -von Tocopherol bzw. dessen Vor- stufen stattfindet oder in denen die Produkte vorteilhafterweise akkumuliert werden.
Insbesondere zu nennen sind Promotoren für die ganze Pflanze aufgrund konstitutiver Expression, wie beispielsweise der CaMV Promotor, der OCS Promotor aus Agrobacterium (Octopin Synthase) , der NOS Promotor aus Agrobacterium (Nopalin synthase) , der Ubiquitin Promotor, Promotoren vakuolärer ATPase Untereinheiten oder der Promotor eines Prolin-reichen Proteins aus Weizen (Weizen WO 9113991)
Weiterhin insbesondere zu nennen sind Promotoren, die eine blattspezifische Expression gewährleisten. Zu nennen sind der Promotor der cytosolischen FBPase aus Kartoffel (WO9705900) , der SSU Promotor (small subunit) der Rubisco (Ribulose-1, 5-bisphosphat carboylase) oder der ST-LSI Promotor aus Kartoffel (Stockhaus et al., EMBO J. 8 (1989), 2445-245).
Weitere geeignete Promotoren sind beispielsweise
spezifische Promotoren für Knollen, Speicherwurzeln oder Wurzeln, wie beispielsweise der Patatin Promotor Klasse I (B33), der Promotor des Cathepsin D Inhibitors aus Kartoffel, der Promotor der Stärke Synthase (GBSS1) oder der Sporamin Promotor,
fruchtspezifische Promotoren, wie beispielsweise der fruchtspezifische Promotor aus Tomate (EP409625) ,
fruchtreifung-spezifische Promotoren, wie beispielsweise der fruchtreifung-spezifische Promotor aus Tomate (WO 9421794) ,
blütenspezifische Promotoren, wie beispielsweise der Phytoen Synthase Promotor (W09216635) oder der Promotor des P-rr Gens (W09822593) oder
spezifische Piastiden- oder Chromoplasten-Promotoren, wie beispielsweise der RNA-Polymerase Promotor (W09706250) oder Auch der Promotor der Phosphoribosylpyrophosphat Amidotransferase aus Glycine max (siehe auch Genbank Accession Nummer U87999) oder ein anderer Nodien-spezifischer Promotor wie in EP 249676 können vorteilhaft verwendet werden.
Prinzipiell können alle natürlichen Promotoren mit ihren Regulationssequenzen wie die oben genannten für das erfindungsgemäße Verfahren verwendet werden. Darüberhinaus können auch synthetische Promotoren vorteilhaft verwendet werden.
Beispielhaft kann die pflanzliche Expressionskassette in ein Derivat des Transformationsvektors pBin-19 mit 35s Promotor (Bevan, M. , Nucleic Acids Research 12: 8711-8721 (1984)) eingebaut werden. Abbildung 2 zeigt ein Derivat des Transformations- vektors pBin -19 mit samenspezifischem Legu in B4-Promotor.
Die Expressionskassette kann beispielsweise einen samenspezifischen Promotor (bevorzugt den Phaseolin-Promotor (US 5504200), den USP- (Baumlein, H. et al . , Mol. Gen. Genet . (1991) 225 (3), 459-467), den Bce4-Gen Promotor aus Brassica (WO 9113980) oder LEB4-Promotor (Fiedler und Conrad, 1995)), das LEB4-Signalpeptid, das zu exprimierende Gen und ein ER-Retentionssignal enthalten.
Die Herstellung einer Expressionskassette erfolgt beispielsweise durch Fusion eines geeigneten Promotors mit einer geeigneten HGPT-DNA Sequenz und vorzugsweise einer zwischen Promotor und HGPT-DNA-Sequenz inserierten DNA, die für ein chloroplasten- spezifisches Transitpeptid kodiert, sowie einem Polyadenylie- rungssignal nach gängigen Rekombinations- und Klonierungstechni- ken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al . , Current Protocols in Molecular Biology, Greene Publishing Assoc . and Wiley-Interscience (1987) beschrieben sind.
Insbesondere bevorzugt sind Sequenzen, die ein Targeting in den Piastiden gewährleisten.
Es können auch Expressionskassetten verwendet werden, deren DNA-Sequenz beispielsweise für ein HGPT-Fusionsprotein kodiert, wobei ein Teil des Fusionsproteins ein Transitpeptid ist, das die Translokation des Polypeptides steuert. Bevorzugt sind für die Chloroplasten spezifische Transitpeptide, welche nach Trans- lokation des HGPT-Gens in die Chloroplasten vom HGPT-Teil enzymatisch abgespalten werden. Insbesondere bevorzugt ist das Transitpeptid, das von der plastidären Nicotiana tabacum Transketolase oder einem anderen Transitpeptid (z.B. dem Transitpeptid der kleinen Untereinheit der Rubisco oder der Ferredoxin NADP Oxidoreduktase als auch der Isopentenylpyrophosphat Isomerase-2) oder dessen funktionellem Äquivalent abgeleitet ist.
Besonders bevorzugt sind DNA-Sequenzen von drei Kassetten des Plastiden-Transitpeptids der plastidären Transketolase aus Tabak in drei Leserastern als Kpnl/BamHI Fragmente mit einem ATG-Codon in der Ncol Schnittstelle:
pTP09
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI
pTPlO
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI
pTPll
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG' TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI
Die inserierte Nukleotid-Sequenz kodierend für eine HGPT kann synthetisch hergestellt oder natürlich gewonnen sein oder eine Mischung aus synthetischen und natürlichen DNA-Bestandteilen enthalten, sowie aus verschiedenen heterologen HGPT-Gen- abschnitten verschiedener Organismen bestehen. Im allgemeinen werden synthetische Nukleotid-Sequenzen mit Kodons erzeugt, die von Pflanzen bevorzugt werden. Diese von Pflanzen bevorzugten Kodons können aus Kodons mit der höchsten Proteinhäufigkeit bestimmt werden, die in den meisten interessanten Pflanzenspezies exprimiert werden. Bei der Präparation einer Expressionskassette können verschiedene DNA-Fragmente manipuliert werden, um eine Nukleotid-Sequenz zu erhalten, die zweckmäßigerweise in der korrekten Richtung liest und die mit einem korrekten Leseraster ausgestattet ist. Für die Verbindung der DNA-Fragmente mit- einander können an die Fragmente Adaptoren oder Linker angesetzt werde .
Zweckmäßigerweise können die Promotor- und die Terminator- Regionen in Transkriptionsrichtung mit einem Linker oder Poly- linker, der eine oder mehrere Restriktionsstellen für die
Insertion dieser Sequenz enthält, versehen werden. In der Regel hat der Linker 1 bis 10, meistens 1 bis 8, vorzugsweise 2 bis 6 Restriktionsstellen. Im allgemeinen hat der Linker innerhalb der regulatorischen Bereiche eine Größe von weniger als 100 bp, häufig weniger als 60 bp, mindestens jedoch 5 bp. Der Promotor kann sowohl nativ bzw. homolog als auch fremdartig bzw. heterolog zur Wirtspflanze sein. Die Expressionskassette beinhaltet in der 5 ' -3 ' -Transkriptionsrichtung den Promotor, eine DNA-Sequenz die für ein HGPT-Gen codiert und eine Region für die transkriptionale Ter ination. Verschiedene Terminationsbereiche sind gegeneinander beliebig austauschbar.
Ferner können Manipulationen, die passende Restriktionsschnittstellen bereitstellen oder die überflüssige DNA oder Restrikti- onsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen wie z.B. Transitionen und Transversionen in Frage kommen, können in vitro-Mutagenese, "primer- repair" , Restriktion oder Ligation verwendet werden. Bei geeigneten Manipulationen, wie z.B. Restriktion, "chewing-back" oder Auffüllen von Überhängen für "bluntends", können komplementäre Enden der Fragmente für die Ligation zur Verfügung gestellt werden.
Bevorzugte Polyadenylierungssignale sind pflanzliche Poly- adenylierungssignale, vorzugsweise solche, die im wesentlichen T-DNA-Polyadenylierungssignale aus Agrobacterium tumefaciens, insbesondere des Gens 3 der T-DNA (Octopin Synthase) des Ti- Plasmids pTiACH5 entsprechen (Gielen et al . , EMBO J. 3 (1984), 835 ff) oder funktioneile Äquivalente.
Vorzugsweise wird die fusionierte Expressionskassette, die für ein HGPT-Gen kodiert, in einen Vektor, beispielsweise pBinl9, kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren. Mit einem solchen Vektor transformierte Agrobakterien können dann in bekannter Weise zur Transformation von Pflanzen, insbesondere von Kulturpflanzen, wie z.B. von Tabakpflanzen, verwendet werden, indem beispielsweise verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden. Die Transformation von Pflanzen durch Agrobakterien ist unter anderem bekannt aus F.F. White, Vectors for Gene Transfer in Higher Plants; in Trans- genic Plants, Vol. 1, Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press, 1993, S. 15-38. Aus den transformierten Zellen der verwundeten Blätter bzw. Blattstücke können in bekannter Weise transgene Pflanzen regeneriert werden, die ein in die Expressionskassette integriertes Gen für die Expression eines HGPT-Gens enthalten.
Die erfindungsgemäßen Nukleinsäurekonstrukte können zur Herstellung von genetisch veränderten Organismen verwendet werden. Die Herstellung der genetisch veränderten Organismen erfolgt durch Transformation der Wirtsorganismen, im folgenden auch AusgangsOrganismen bezeichnet, mit einem das HGPT-Gen enthaltenden Konstrukt.
Unter Ausgangs- oder Wirtsorganismen werden prokaryontische oder eukaryontische Organismen, wie beispielsweise Mikroorganismen, Moose oder Pflanzen verstanden. Bevorzugte Mikroorganismen sind Bakterien, Hefen, Algen oder Pilze.
Bevorzugte Bakterien sind Bakterien der Gattung Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes oder Cyano- bakterien der Gattung Synechocystis .
Bevorzugte Hefen sind Candida, Saccharomyces , Hansenula oder Pichia.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium oder weitere in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus , Phaedactylum tricornatum, Volvox oder Dunaliella.
Die Erfindung betrifft einen genetisch veränderten Organismus, wobei die genetische Veränderung die Genexpression einer erfindungsgemäßen Nukleinsäure gegenüber einem Wildtyp
für den Fall, daß der Ausgangsorganismus eine erfindungsgemäße Nukleinsäure enthält, erhöht oder
für den Fall, daß der Ausgangsorganismus eine erfindungsgemäße Nukleinsäure nicht enthält, verursacht. Die transgenen Organismen, enthaltend das erfindungsgemäße HGPT- Gen sind in der Lage Homogentisatderivate und Phytylpyrophosphat- Derivate in 2-Methyl-Phytylhydrochinonderivate und/oder Homogentisatderivate und Geranyl-Geranyl-pyrophosphatderivate in 2-Methyl-geranylgeranylhydrochinonderivate zu überführen.
Diese Organismen können beispielsweise zur vorstehend beschriebenen Biotransformation verwendet werden. ι 1 Transgene Organismen, enthaltend ein exogenes erfindungsgemäßes HGPT-Gen, die bereits als Ausgangsorganismen die Biosynthesegene zur Herstellung von Vitamin E besitzen, wie beispielsweise Pflanzen oder weitere photosynthetisch aktive Organismen wie beispielsweise Cyanobakterien, Moose oder Algen, weisen einen erhöhten Gehalt an Tocopherolen und/oder Tocotrienolen im Vergleich zum jeweiligen Wildtyp auf.
Die Erfindung betrifft daher einen solchen erfindungsgemäßen, genetisch veränderten Organismus, der gegenüber dem Wildtyp einen erhöhten Vitamin E-Gehalt aufweist.
Die vorliegende Erfindung betrifft ferner die Verwendung der erfindungsgemäßen HGPT oder der erfindungsgemäßen HGPT-Gene zur Herstellung von Vitamin E in transgenen Organismen.
Erfindungsgemäße, genetisch veränderte Organismen, vorzugsweise Pflanzen die gegenüber dem Wildtyp einen erhöhten Vitamin E- Gehalt aufweisen können zur Herstellung von Vitamin E verwendet werden.
Daher betrifft die vorliegende Erfindung auch Verfahren zur Herstellung von Vitamin E indem man einen erfindungsgemäßen genetisch veränderte Organismus, vorzugsweise eine erfindungsgemäß genetisch veränderte Pflanze, der gegenüber dem Wildtyp einen erhöhten Vitamin E-Gehalt aufweist kultiviert, den
Organismus erntet und die Vitamin-E-Verbindungen anschließend aus dem Organismus isoliert.
Von Menschen und Tieren verzehrbare erfindungsgemäße, genetisch veränderte Pflanzen mit erhöhtem Vitamin-E-Gehalt können auch beispielsweise direkt oder nach an sich bekannter Aufbereitung als Nahrungsmittel oder Futtermittel verwendet werden.
Zur Herstellung von Organismen mit einem erhöhten Vitamin E-Gehalt (Tocopherole und/oder Tocotrienole) im Vergleich zum Wildtyp werden in einer bevorzugten Ausführungsform Pflanzen als Ausgangsorganismen und dementsprechend auch als genetisch veränderte Organismen verwendet.
Bevorzugte Pflanzen sind beispielsweise Tagetes, Sonnenblume, Arabidopsis, Tabak, Roter Pfeffer, Soja, Tomate, Aubergine, Paprika, Möhre, Karotte, Kartoffel, Mais, Salate und Kohlarten, Getreide, Alfalfa, Hafer, Gerste, Roggen, Weizen, Triticale, Hirse, Reis, Luzerne, Flachs, Baumwolle, Hanf, Brassicacaen wie beispielsweise Raps oder Canola, Zuckerrübe, Zuckerrohr, Nuß- und Weinspezies oder Holzgewächse wie beispielsweise Espe oder Eibe.
Besonders bevorzugt sind Arabidopsis thaliana, Tagetes erecta, Brassica napus, Nicotiana tabacum, Canola, Kartoffeln sowie Ölsaaten, wie beispielsweise Soja.
Die Erfindung betrifft weiterhin ein Verfahren zur Herstellung von genetisch veränderten Organismen in dem man eine erfindungsgemäße Nukleinsäure oder ein erfindungsgemäßes Nukleinsäurekonstrukt in das Genom des Ausgangsorganismus einführt.
Zur Transformation eines Wirtsorganismus, wie beispielsweise einer Pflanze, mit einer für eine HGPT kodierenden DNA wird eine Expressionskassette als Insertion in einen rekombinanten Vektor eingebaut, dessen Vektor-DNA vorzugsweise zusätzliche funktioneile Regulationssignale, beispielsweise Sequenzen für Replikation oder Integration enthalten kann.
Geeignete Vektoren für Pflanzen sind unter anderem in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Kap. 6/7, S. 71-119 (1993) beschrieben.
Unter Verwendung der oben zitierten Rekombinations- und Klonierungstechniken können die Expressionskassetten in geeignete Vektoren kloniert werden, die ihre Vermehrung, beispielsweise in E. coli, ermöglichen. Geeignete Klonierungsvektoren sind u.a. pBR332, pUC-Serien, M13mp-Serien und pACYC184. Besonders geeignet sind binäre Vektoren, die sowohl in E. coli als auch in Agro- bakterien replizieren können.
Ein weiterer Gegenstand der Erfindung betrifft die Verwendung einer Expressionskassette enthaltend eine DNA-Sequenz SEQ-ID Nr. 1 oder eine mit dieser hybridisierende DNA-Sequenz zur Transformation von Pflanzen, -zellen, -geweben oder Pflanzenteilen. Vorzugsweise ist Ziel der Verwendung die Erhöhung des Gehaltes an Tocopherolen und/oder Tocotrienolen der Pflanze. Dabei kann je nach Wahl des Promotors die Expression spezifisch in den Blättern, in den Samen, Blütenblättern oder anderen Teilen der Pflanze erfolgen. Solche transgenen Pflanzen, deren Vermehrungsgut, sowie deren Pflanzenzellen, -gewebe oder -teile sind ein weiterer Gegenstand der vorliegenden Erfindung.
Die Expressionskassette kann darüberhinaus auch zur Transformation von Bakterien, Cyanobakterien, Hefen, filamentösen Pilzen, Moosen und Algen mit dem Ziel einer Erhöhung des Gehaltes an Tocopherolen und/oder Tocotrienolen eingesetzt werden.
Die Übertragung von Fremdgenen in das Genom einer Pflanze wird als Transformation bezeichnet. Es werden dabei die beschriebenen Methoden zur Transformation und Regeneration von Pflanzen aus Pflanzengeweben oder Pflanzenzellen zur transienten oder stabilen Transformation genutzt. Geeignete Methoden sind die Protoplasten- transformation durch Polyethylenglykol-induzierte DNA-Aufnahme, das biolistische Verfahren mit der Genkanone - die sogenannte particle bombardment Methode, die Elektroporation, die Inkubation trockener Embryonen in DNA-haltiger Lösung, die Mikroinjektion und der durch Agrobacterium vermittelte Gentransfer. Die genannten Verfahren sind beispielsweise in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press (1993), 128-143 sowie in Potrykus, Annu. Rev. Plant Physiol. Plant Molec . Biol. 42 (1991), 205-225) beschrieben. Vorzugsweise wird das zu exprimierende Konstrukt in einen Vektor kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren, beispielsweise pBinl9 (Bevan et al., Nucl. Acids Res. 12 (1984) , 8711) .
Mit einer Expressionskassette transformierte Agrobakterien können ebenfalls in bekannter Weise zur Transformation von Pflanzen verwendet werden, z.B. indem verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden.
Erhöhung des Gehaltes an Tocopherolen oder Tocotrienolen bedeutet im Rahmen der vorliegenden Erfindung die künstlich erworbene Fähigkeit einer erhöhten Biosyntheseleistung dieser Verbindungen durch funktioneile Überexpression eines erfindungsgemäßen HGPT- Gens in der Pflanze gegenüber der nicht gentechnisch modifizierten Pflanze. Dabei kann sowohl der Gehalt an Tocopherolen oder Tocotrienolen gesteigert werden. Vorzugsweise wird der Gehalt an Tocopherolen gesteigert. Aber es ist auch möglich unter bestimmten Bedingungen vorzugsweise den Gehalt an Tocotrienolen zu steigern.
Der Biosyntheseort von Tocopherolen beispielsweise ist unter anderem das Blattgewebe, so daß eine blattspezifische Expression des HGPT-Gens sinnvoll ist. Es ist jedoch naheliegend, daß die Tocopherol-Biosynthese nicht auf das Blattgewebe beschränkt sein muß, sondern auch in allen übrigen Teilen der Pflanze - besonders in fetthaltigen Samen - gewebespezifisch erfolgen kann.
Darüberhinaus ist eine konstitutive Expression des exogenen HGPT- Gens von Vorteil. Andererseits kann aber auch eine induzierbare Expression wünschenswert erscheinen.
Die Wirksamkeit der Expression des transgen exprimierten HGPT- Gens kann beispielsweise in vitro durch Sproßmeristemvermehrung ermittelt werden. Zudem kann eine in Art und Höhe veränderte Expression des HGPT-Gens und deren Auswirkung auf die Tocopherol- Biosyntheseleistung an Testpflanzen in Gewächshausversuchen getestet werden.
Gegenstand der Erfindung sind außerdem transgene Pflanzen, trans- formiert mit einer Expressionskassette enthaltend ein erfindungsgemäßes HGPT-Gen, sowie transgene Zellen, Gewebe, Teile und Vermehrungsgut solcher Pflanzen.
Bevorzugt sind dabei, wie vorstehend erwähnt, transgene Pflanzen, wie beispielsweise Tagetes, Sonnenblume, Arabidopsis, Tabak,
Roter Pfeffer, Soja, Tomate, Aubergine, Paprika, Möhre, Karotte, Kartoffel, Mais, Salate und Kohlarten, Getreide, Alfalfa, Hafer, Gerste, Roggen, Weizen, Triticale, Hirse, Reis, Luzerne, Flachs, Baumwolle, Hanf, Brassicacaen wie beispielsweise Raps oder Canola, Zuckerrübe, Zuckerrohr, Nuß- und Weinspezies oder Holzgewächse wie beispielsweise Espe oder Eibe
Pflanzen im Sinne der Erfindung sind mono- und dikotyle Pflanzen.
Gegenstand der Erfindung sind weiterhin weitere photosynthetisch aktive Organismen transformiert mit einer Expressionskassette enthaltend ein erfindungsgemäßes HGPT-Gen.
Durch Überexpression der für eine erfindungsgemäße HGPT kodierenden Gensequenz in einer Pflanze wird zusätzlich zum erhöhten Vitamin E-Gehalt eine erhöhte Resistenz gegenüber Inhibitoren der HGPT erreicht. Der Erfindung betrifft daher einen erfindungsgemäßen genetisch veränderten Organismus, vorzugsweise eine erfindungsgemäß genetisch veränderte Pflanze die gegenüber Inhibitoren der Homogentisatphytyltransferase eine Resistenz aufweist.
Durch die vorliegende Erfindung gelingt es beispielsweise in transgenen Pflanzen die Aktivität der Homogentisatphytyltransferase (HGPT) durch Überexpression des erfindungsgemäßen HGPT-Gens zu erhöhen. Dies kann prinzipiell durch Expression homologer oder heterologer HGPT-Gene erreicht werden.
In Beispiel 1 wird erstmals die Klonierung einer HGPT-DNA-Sequenz (SEQ-ID Nr. 1) aus Synechocystis spec . PCC 6803 beschrieben. Um eine Plastidenlokalisation zu gewährleisten wird der HGPT- Nukleotidsequenz aus Synechocystis eine Transitsignalsequenz (Abb. 1-4) vorangestellt.
Das durch die zusätzliche Expression des HGPT-Gens nun vermehrt zur Verfügung stehende 2-Methyl-Phytylhydrochinon bzw. 2-Methyl- Geranylgeranylhydrochinon wird weiter in Richtung Tocopherole und Tocotrienol umgesetzt (Abbildung 5) .
Messungen an HGPT Synechocystis knock out Mutanten ergaben bezüglich des Gehaltes an Tocopherolen eine drastische Abnahme. Dies belegt den direkten Einfluß der plastidären pflanzlichen HGPT auf die Synthese von Tocopherolen und Tocotrienolen.
Weitere Gegenstände der Erfindung sind:
- Verfahren zur Transformation einer Pflanze dadurch gekennzeichnet, daß man Expressionskassetten enthaltend ein erfindungsgemäßes HGPT-Gen in eine Pflanzenzelle oder Protoplasten von Pflanzen einbringt und diese zu ganzen Pflanzen regeneriert.
Verwendung des erfindungsgemäßes HGPT-Gen zur Herstellung von Pflanzen mit erhöhtem Gehalt an Tocopherolen und/oder Tocotrienolen durch Expression einer HGPT DNA-Sequenz in Pflanzen.
Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt:
Allgemeine Bedingungen: Sequenzanalyse rekombinanter DNA Die Sequenzierung rekombinanter DNA-Moleküle erfolgte mit einem Laserfluoreszenz-DNA-Sequenzierer der Firma Licor (Vertrieb durch MWG Biotech, Ebersbach) nach der Methode von Sanger (Sanger et al., Proc. Natl . Acad. Sei. USA 74 (1977), 5463-5467)
Beispiel 1
Klonierung der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803.
Die DNA kodierend für den ORF slrl736 wurde mittels polymerase chain reaction (PCR) aus Synechocystis spec. PCC 6803 gemäß der Methode nach Crispin A. Howitt (BioTechniques 21:32-34, July 1996) unter Verwendung eines sense spezifischen Primers (slrl7365' Abbildung 8, SEQ ID NO. 3) und eines antisense spezifischen Primers (slrl7363', Abbildung 9, SEQ ID NO. 4) amplifiziert .
Die PCR Bedingungen waren die folgenden:
Die PCR erfolgte in einem 50 μl Reaktionsansatz in dem enthalten war:
5 μl einer Synechocystis spec. PCC 6803 Zellsuspension
0,2 mM dATP, dTTP, dGTP, dCTP
1,5 mM Mg (OAc)2 - 5 μg Rinderserum-Albumin
40 pmol slrl7365'
40 pmol slrl7363'
15 μl 3,3X rTth DNA Polymerase XLPuffer (PE Applied
Biosystems) - 5 U rTth DNA Polymerase XL (PE Applied Biosystems)
Die PCR wurde unter folgenden Zyklus Bedingungen durchgeführt:
Schritt 1 5 Minuten 94°C (Denaturierung) Schritt 2 3 Sekunden 94°C
Schritt 3 2 Minuten 48°C (Annealing)
Schritt 4 2 Minuten 72°C (Elongation) 35 Wiederholungen der Schritte 2-4 Schritt 5: 10 Minuten 72°C (Post-Elongation) Schritt 6: 4°C (Warteschleife)
Das Amplikon wurde unter Verwendung von Standardmethoden in den PCR Klonierungsvektor pGEM-T (Promega) kloniert. Die Identität des erzeugten Amplikons wurde durch Sequenzierung unter Ver- wendung des M13F (-40) Primers bestätigt. Beispiel 2
Erzeugung einer slrl736 Knock out Mutante.
Ein DNA Konstrukt zur Erzeugung einer Deletionsmutante des ORF slrl736 in Synechocystis spec. PCC 6803 wurde unter Anwendung von Standard Klonierungstechniken erzeugt.
Der Vektor pGEM-T/slrl736 wurde unter Verwendung des Restriktionsenzyms Hpal verdaut. Durch diesen Verdau wird ein 348 Bp umfassendes internes Fragment des slrl736 deletiert. In die Hpal Schnittstellen wurde anschließend die Aminoglycosid-3 'Phospho- transferase des Transposons Tn903 kloniert. Dazu wurde das Tn903 als EcoRl Fragment aus dem Vektor pUC4k (Vieira, J und Messing, J., Gene:19, 259-268, 1982) isoliert, die überstehenden Enden des Restriktionsverdaus nach Standardmethoden in glatte Enden überführt und in den Hpal geschnittenen Vektor pGEM-T/slrl736 ligiert. Der Ligationsansatz wurde zur Transformation von E. coli Xll blue Zellen verwendet. Transformanden wurden durch Verwendung von Kanamycin und Ampicillin selektioniert . Ein rekombinantes Plasmid (pGEM-T/slrl736 : : tn903, siehe Abb. 6) wurde isoliert und zur Transformation von Synechocystis spec. PCC 6803 gemäß der Methode nach Williams (Methods Enzymol. 167:776-778, 1987) eingesetzt .
Abbildung 6 zeigt ein Konstrukt zur Knock-out Mutagense des ORF slrl736 in Synechocystis spec. PCC 6803.
Synechocystis spec. PCC 6803 Transformanden wurden selektioniert auf Kanamycin haltigem (km) BG-11 Festmedium (Castenholz, Methods in Enzymology, 68-93, 1988) bei 28°C und 30 μmol Photonen x (m2x s)-1. Vier unabhängige Knock out Mutanten konnten nach fünf Selektionsrunden (Passagen von Einzelkolonien auf frisches BG-11 km Medium) erzeugt werden.
Der vollständige Verlust des slrl736 Endogens bzw. der Austausch gegen die rekombinante slrl736 : : tn903 DNA, wurde durch PCR Analysen bestätigt.
Beispiel 3 Vergleich der Tocopherolproduktion in Synechocystis spec. PCC 6803 Wildtypzellen und den erzeugten Knock out Mutanten des ORF slrl736
Die auf den BG-11 km Agarmedium kultivierten Zellen der vier unabhängigen Synechocystis spec. PCC 6803 Knock out Mutanten des ORF slrl736 sowie untransformierte Wildtypzellen wurden zum Animpfen von Flüssigkulturen verwendet . Diese Kulturen wurden bei 28°C und 30 μmol Photonen x (mx s)"1 (30 μE) für ca. 3 Tage kultiviert. Nach Bestimmung der OD730 der einzelnen Kulturen, wurde die OD 3Q aller Kulturen durch entsprechende Verdünnungen mit BG-11 (Wildtypen) bzw. BG-11 km (Mutanten) synchronisiert. Diese auf Zelldichte synchronisierten Kulturen wurden zum
Animpfen von drei Kulturen pro Mutante bzw. der Wildtypkontrollen verwendet . Die biochemischen Analysen konnten somit unter Verwendung von jeweils drei unabhängig gewachsenen Kulturen einer Mutante und der entsprechenden .Wildtypen durchgeführt werden. Die Kulturen wurden bis zu einer optischen Dichte von OD3o=0,3 angezogen. Das Medium der Zellkultur wurde durch zweimalige Zentrifugation bei 14000 rpm in einer Eppendorf Tischzentrifuge entfernt. Der daran anschließende Aufschluß der Zellen erfolgte durch viermalige Inkubation im EppendorfSchüttler bei 30°C, 1000 rpm in 100 % Methanol für 15 Minuten, wobei die jeweils erhaltenen Überstände vereinigt wurden. Weitere Inkubationsschritte ergaben keine weitere Freisetzung von Tocopherolen oder Tocotrienolen.
Um Oxidation zu vermeiden, wurden die erhaltenen Extrakte direkt nach der Extraktion mit Hilfe einer Waters Allience 2690 HPLC- Anlage analysiert. Tocopherole und Tocotrienole wurden über eine reverse Phase Säule ( ProntoSil 00-3-C30, Bischoff) mit einer mobilen Phase von 100 % Methanol getrennt und anhand von Standards (Merck) identifiziert. Als Detektionssystem diente die Fluoreszenz der Substanzen (Anregung 295 nm, Emission 320 nm) , die mit Hilfe eines Jasco Fluoreszensdetektors FP 920 nachgewiesen wurde.
In den Synecchocystis spec. PCC 6803 knock out Mutanten des ORF slrl736 konnten keine Tocopherole gefunden werden. Tocopherole wurden jedoch in den Synechocystis spec. PCC 6803 Wildtypzellen gemessen.
Der Verlust der Fähigkeit zur Produktion von Tocopherolen innerhalb der knock out Mutanten des ORF slr 1736 im Vergleich zu den Synecchocystis spec. PCC 6803 Wildtypzellen zeigt, daß das Gen slrl736 für eine Homogentisatphytyltransferase kodiert.
Beispiel 4
Funktionelle Charakterisierung der Homogentisatphytyltransferase aus Synechocystis spec. PCC6803 durch heterologe Expression in E. coli .
Das hypothetische Protein slr1736 aus Synechocystis spec. PCC 6803 konnte durch funktionelle Expression in E. coli als Homogentisatphytyltransferase identifiziert werden. Das aus Synechocystis spec. PCC 6803 amplifizierte Gen slrl736 wurde im korrekten Leserahmen in den Expressionsvektor pQE-30 (Qiagen) subkloniert. Die zur Amplifikation des OFR slrl736 aus Synechocystis spec. PCC 6803 verwendeten Primer slrl7365' bzw. slrl7363' (SEQ.-ID Nr. 2 und 3) waren so konstruiert, daß an das 5 ' Ende und das 3 ' Ende des Amplikons BamHl Restriktionsschnittstellen addiert wurden, siehe SEQ.-ID Nr. 1. Das slrl736 Fragment wurde unter Verwendung dieser flankierenden BamHl Restriktionsschnittstellen aus dem rekombinanten Plasmid pGEM-T/slrl736 iso- liert und unter Anwendung von Standardmethoden in einen BamHl geschnittenen pQE-30 ligiert. Der Ligationsansatz wurde zur Transformation von Ml5 E. coli Zellen verwendet und Kanamycin und Ampicillin resistente Transformanden wurden analysiert. Die Kanamycin Resistenz wird durch das in den Ml5 Zellen ent- haltene pREP-4 Plasmid vermittelt . Ein rekombinantes Plasmid (pQE-30/slrl736) welches das slrl736 Fragment in der richtigen Orientierung trug, wurde isoliert. Die Identität und Orientierung des Inserts wurde durch Sequenzierung bestätigt.
Das rekombinante Plasmid pQE-30/slrl736 wurde zur Transformation von M15 E. coli Zellen verwendet, um rekombinantes slrl736 Protein zu erzeugen. Unter Verwendung einer aus der Transformation hervorgegangenen Kolonie wurde eine Übernachtkultur in Luria Broth Medium mit 200 μg/ml Ampicillin (Amp) und 50 μg/ml Kanamycin (Km) angeimpft. Ausgehend von dieser Kultur wurde am nächsten Morgen eine 100 ml Luria Broth Kultur (Amp/Km) angeimpft. Diese Kultur wurde bei 28°C auf einem Schüttelinkubator bis zum erreichen einer ODgoo : 0, 35-0, 4 inkubiert. Anschließend wurde die Produktion des rekombinanten Proteins durch Zugabe von 0 , 4 mM Isopropyl- ß-D-thiogalaktopyranosid (IPTG) induziert. Die Kultur wurde für weitere 3 Stunden bei 28°C geschüttelt und die Zellen anschließend durch Zentrifugation bei 8000 g pelletiert.
Das Pellet wurde in 600 μl Lysispuffer (ca. 1-1,5 ml /g Pellet Naßgewicht, 10 mM HEPES KOH pH 7,8, 5 mM Dithiothreinol (DTT) , 0,24 M Sorbitol) resuspendiert. Anschließend wurde PMSF (Phenyl- methylsulfonat) zu einer Endkonzentration von 0,15 mM beigefügt und der Ansatz für 10 Minuten auf Eis gestellt. Der Aufschluß der Zellen erfolgte durch einen 10 Sekunden Ultraschall-Puls unter Verwendung eines Ultraschallstabes. Nach Zugabe von Triton X100 (Endkonzentration 0,1 %) wurde die Zellsuspension für 30 Minuten auf Eis inkubiert. Der Ansatz wurde anschließend für 30 Minuten bei 25000 xg abzentrifugiert und der Überstand zum Assay eingesetzt. Die Aktivitätsbestimmung der Homogentisatphytyltransferase erfolgt durch Nachweis von radioaktiv markierten 2-Methyl- phytylhydrochinon als Reaktionsprodukt.
Dazu wurden 235 μl des Enzyms (ca. 300-600 μg) zusammen mit 35 μl Phytyl-Pyrophosphat und 50 μl (1,2 nmol) 3H-Homogentisinsäure in folgendem Reaktionspuffer : 100 μl (250mM) Tricine-NaOH pH 7,6, 100 μl (1,25 mM) Sorbitol, 10 μl (50 mM) MgCl2 und 20 μl (250 mM) Ascorbat für 4 Stunden bei 25°C inkubiert. Die Tritium markierte Homogentisinsäure liegt in einer ethanolischen Lösung mit 1 mg Ascorbat/ml vor. Davon werden 50 μl eingeengt und der Puffer sowie das Enzym und das Phytyl-Pyrophosphat hinzugegeben.
Das Abstoppen der Reaktion erfolgte durch zweimalige Extraktion des Ansatzes mit Ethylacetat. Die Ethylacetatphasen wurden eingeengt und die Rückstände in Methanol aufgenommen und auf eine Dünnschicht-Platte zur chromatographischen Trennung der Substanzen aufgetragen (feste Phase: HPTLC-Platten:Kieselgel 60 F254 (Merk), flüssige Phase :Toluol) . Der Nachweis des radio- aktiv markierten Reaktionsproduktes erfolgt durch Verwendung eines Phosphoi agers .
Diese Experimente bestätigten, daß es sich bei dem durch das Gen slrl736 (SEQ-ID Nr.l) aus Synechocystis spec. PCC 6803 kodierte Protein um eine Homogentisatphytyltransferase handelt, da es die enzymatische Aktivität zur Bildung von 2-Methyl-phytylhydrochinon aus Homogentisate und Phytyl-Pyrophosphat besitzt.
Beispiel 5 Herstellung von Expressionskassetten enthaltend das HGPT-Gen
Transgene Pflanzen wurden erzeugt, die die Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 zum einen unter Kontrolle des konstitutiven 35S-Promotor des CaMV (Blumenkohl- mosaikvirus) (Franck et al., Cell 21: 285-294, 1980) und zum anderen unter Kontrolle des samenspezifischen Promotors des Legumin Gens aus Vicia faba (Kafatos et al . , Nuc. Acid. Res., 14(6) :2707-2720, 1986) exprimieren. Die Grundlage des zur konstitutiven Expression der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 erzeugten Plasmides war der pBinAR- TkTp-9 (Ralf Badur, Dissertration Universität Göttingen, 1998) . Dieser Vektor ist ein Derivat des pBinAR (Höfgen und Willmitzer, Plant Sei. 66: 221-230, 1990) und enthält den 35S-Promotor des CaMV (Blumenkohlmosaikvirus) (Franck et al., 1980) das Terminationssignal des Octopin-Synthase Gens (Gielen et al., EMBO J. 3: 835-846, 1984) sowie die für das Transitpeptid der Nicotiana tabacum plastidären Transketolase kodierenden DNA Sequenz . Die unter Berücksichtigung des korrekten Leserasters erfolgte Klonierung der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 in diesen Vektor, erzeugt eine Translationsfusion der Homogentisatphytyltransferase mit dem plastidären Transitpeptid. Dadurch erfolgt ein Transport des Transgens in die Piastiden.
Zur Erstellung dieses Plasmides wurde das Gen slrl736 unter Verwendung der flankierenden BamHl Restriktionsschnittstellen aus dem Plasmid pGEM-T/slrl736 isoliert. Dieses Fragment wurde unter Anwendung von Standardmethoden in einen BamHl geschnittenen pBi- nAR-TkTp-9 ligiert (siehe Abbildung. 1) Dieses Plasmid (pBinAR- TkTp-9/slrl736) wurde zur Erzeugung transgener Nicotiana tabacum Pflanzen verwendet .
Fragment A (529 bp) in Abbildung 1 beinhaltet den 35S-Promotor des CaMV (Nukleotide 6909 bis 7437 des Blumenkohlmosaikvirus) , Fragment B (245bp) Fragment kodiert für das Transitpeptid der Nicotiana tabacum Transketolase, Fragment C (944Bp) kodiert ORF slrl736 aus Synechocystis spec. PCC 6803, Fragment D (219Bp) kodiert für das Terminationssignal des Octopin-Synthase Gens .
Zur Erzeugung eines Plasmides, welches die samenspezifische Expression der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 in Pflanzen ermöglicht, wurde der samenspezifiche Promotor des Legumin B4 Gens (Kafatos et al., Nuc. Acid. Res. ,14(6) :2707-2720, 1986) verwendet. Aus dem Plasmid pCR- Script/lePOCS wurde das 2,7 Kb Fragment des Legumin B4 Gen Promotors unter Verwendung der den Promotor 5 ' flankierenden EcoRl und der 3' flankierenden Kpnl Schnittstellen isoliert. Das Plasmid pBinAR-TkTp-9/slrl736 wurde ebenfalls mit den Restriktionsenzymen EcoRl und Kpnl behandelt. Dies hatte zur Folge, daß der 35S-Promotor des CaMV aus diesem Plasmid herausgetrennt wurde. Der Promotor des Legumin Gens wurde anschließend als EcoRl/Kpnl Fragment in diesen Vektor kloniert, wodurch ein Plasmid erzeugt wurde, welches die Expression des Gen slrl736 unter die Kontrolle dieses samenspezifischen Promotors stellte, siehe Abbildung 2 . Dieses Plasmid (pBinARleP-TkTp-9/slrl736) wurde zur Erzeugung transgener Nicotiana tabacum Pflanzen ver- wendet.
Fragment A (2700 bp) in Abbildung 2 beinhaltet den Promotor des Legumin B4 Gens aus Vicia faba, Fragment B (245bp) kodiert für das Transitpeptid der Nicotiana tabacum Transketolase, Fragment C (944Bp) kodiert für den ORF slrl736 aus Synechocystis spec. PCC 6803, Fragment D (219Bp) für das Terminationssignal des Octopin- Synthase Gens . Erzeugung von DNA Konstrukten zur Expression der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 in A. thaliana und B. napus .
Zur Herstellung von chimären DNA Konstrukten zur Erzeugung transgener A. thaliana bzw. B.napus Pflanzen, die die Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 exprimieren, wurden die Vektoren pPTVkan35S-IPP-Tp-90CS bzw. pPTVkanLeP-IPP- Tp-IONOS verwendet. Diese Vektoren sind Derivate des pGPTVkan (D.Becker, E. Kemper, J. Schell, R. Masterson. Plant Molecular Biology 20: 1195-1197, 1992) denen das uidA Gen deletiert wurde. Stattdessen enthält der pPTVkan35S-IPP-Tp-90CS den 35S-Promotor des CaMV (Blumenkohlmosaikvirus) (Franck et al., 1980) die Sequenz kodierend für das Transitpeptid der A . thaliana plastiden- spezifischen Isopentenylpyrophosphat Isomerase-2 (IPP-2) (Badur, unveröffentlicht) und das Terminationssignal des Octopin-Synthase Gens (Gielen et al . , 1984)
Der Vektor pPTVkanLeP-IPP-Tp-lOnos enthält den samenspezifichen Promotor des Legumin B4 Gens (Kafatos et al., Nuc. Acid.
Res. ,14(6) :2707-2720, 1986), ebenfalls die Sequenz kodierend für das Transitpeptid der A. thaliana plastiden-spezifischen Isopentenyl-pyrophosphat Isomerase-2 (IPP-2) (Badur, unveröffentlicht) und das Terminationssignal der Nopalinsynthase aus A . tumefaciens (Depicker et al., J. Mol . Appl . Genet . 1, 561-73, 1982) .
Die DNA Moleküle kodierend für den ORF slrl736 aus Synechocystis spec. PCC 6803 wurden als BamHl Fragmente mit durch die T4-Polymerase aufgefüllten stumpfen Enden in die Vektoren pPTVkan35S-IPP-Tp-90CS (Abb.3) bzw. pPTVkanLeP-IPP-Tp-lOnos (Abb.4) kloniert, wodurch eine Translationsfusion mit dem Transitpeptid der IPP-2 erzeugt wurde. Somit konnte ein Import der Homogentisatphytyltransferase in die Piastiden gewährleistet werden.
Fragment A (529 bp) in Abbildung 3 beinhaltet den 35S~Promotor des CaMV (Nukleotide 6909 bis 7437 des Blumenkohlmosaikvirus) . Fragment B (205bp) Fragment kodierend für das Transitpeptid der A. thaliana Isopentenylpyrophosphat-Isomerase-2. Fragment C
(944 bp) ORF slrl736 aus Synechocystis spec. PCC 6803. Fragment D (219Bp) Terminationssignal des Octopin-Synthase Gens.
Fragment A (2700 bp) in Abbildung 4 beinhaltet den Promotor des Legumin B4 Gens aus Vicia faba, Fragment B (206bp) Fragment kodierend für das Transitpeptid der A. thaliana Isopentenylpyro- phosphat-Isomerase-2. , Fragment C (944Bp) kodiert für den ORF slrl736 aus Synechocystis spec. PCC 6803. Fragment D (272Bp) für das Terminationssignal des Nopalin-Synthase Gens.
Beispiel 6 Herstellung transgener Arabidopis thaliana Pflanzen
Wildtyp Arabidopsis thaliana Pflanzen (Columbia) wurden mit dem Agrabacterium tumefaciens Stamm (GV3101 [pMP90]) auf Grundlage einer modifizierten Vacuuminfiltrationsmethode transformiert (Steve Clough und Andrew Bent. Floral dip: a simplified method for Agrobacterium mediated transformation of A. thaliana. Plant J 16(6) :735-43, 1998; der Bechtold, N. Ellis, J. und Pelltier, G., in: Planta Agrobacterium- ediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sei Paris, 1993, 1144 (2) : 204-212 ) . Die verwendeten Agrobacterium tumefaciens Zellen waren im Vorfeld mit den Plas iden pPTVkan35SIPP- Tp9/slrl736 bzw. pPTVkanLePIPP-Tp9/slrl736 (Abbildung 3 und 4) transformiert worden.
Samen der Primärtransformanden wurden auf Grundlage der Antibiotikaresistenz selektioniert. Antibiotika resistente Keimlinge wurden in Erde gepflanzt und als vollentwickelte Pflanzen zur biochemischen Analyse verwendet.
Beispiel 7
Herstellung transgener Brassica napus Pflanzen
Die Herstellung transgener Raps Pflanzen orientierte sich an einem Protokoll von Bade, J.B. und Damm,B. (in Gene Transfer to Plants, Potrykus, I. und Spangenberg, G., eds, Springer
Lab Manual, Springer Verlag, 1995, 30-38), in welchem auch die Zusammensetzung der verwendeten Medien und Puffer angegeben ist.
Die Transformationen erfolgten mit dem Agrobacterium tumefaciens Stamm GV3101 [pMP90] . Zur Transformation wurden die Plasmide pPTVkan35SIPP-Tp9/slrl736 bzw. pPTVkanLePIPP-TplO/slrl736 verwendet (Abbildung 3 und 4) . Samen von Brassica napus var. Westar wurden mit 70 % Ethanol (v/v) oberflächensteril gemacht, 10 Minuten bei 55°C in Wasser gewaschen, in 1 %iger Hypochlorit- Lösung (25 % v/v Teepol, 0,1 % v/v Tween 20) für 20 Minuten inkubiert und sechsmal mit sterilem Wasser für jeweils 20 Minuten gewaschen. Die Samen wurden drei Tage auf Filterpapier getrocknet und 10-15 Samen in einem Glaskolben mit 15 ml Keimungsmedium zur Keimung gebracht. Von mehreren Keimlingen (ca. 10 cm groß) wurden die Wurzeln und Apices entfernt und die verbleibenden Hypokotyle in ca. 6 mm lange Stücke geschnitten. Die so gewonnenen ca. 600 Explantate wurden 30 Minuten mit 50 ml Basalmedium gewaschen und in einem 300 ml Kolben überführt. Nach Zugabe von 100 ml Kallusinduktionsmedium wurden die Kulturen für 24 Stunden bei 100 U/min inkubiert.
5 Vom Agrobacterium Stamm wurde eine Übernachtkultur bei 29°C in Luria Broth-Medium mit Kanamycin (20 mg/1) angesetzt, davon 2 ml in 50 ml Luria Broth-Medium ohne Kanamycin für 4 Stunden bei 29°C bis zu einer ODßoo von 0,4-0,5 inkubiert. Nach der Pelletierung der Kultur bei 2000 U/min für 25 min wurde das Zellpellet in 10 25 ml Basalmedium resuspendiert. Die Konzentration der Bakterien in der Lösung wurde durch Zugabe von weiterem Basalmedium auf eine ODgoo von 0,3 eingestellt.
Aus den Raps-Explanten wurde das Kallus-Induktionsmedium mit 15 sterilen Pipetten entfernt, 50 ml Agrobakterium-Lösung hinzugefügt, vorsichtig gemischt und für 20 min inkubiert. Die Agro- bacterien-Suspension wurde entfernt, die Raps-Explante für 1 min mit 50 ml Kallus-Induktionsmedium gewaschen und anschließend 100 ml Kallus-Induktionsmedium hinzugefügt. Die Co-Kultivierung 20 wurde für 24 h auf einem Rotiationsschüttler bei 100 U/min durchgeführt . Die Co-Kultivierung wurde durch Wegnahme des Kallus- Induktionsmediums gestoppt und die Explante zweimal für jeweils 1 min mit 25 ml und zweimal für 60 min mit jeweils 100 ml Waschmedium bei 100 U/min gewaschen. Das Waschmedium mit den Explanten 25 wurde in 15 cm Petrischalen überführt und das Medium mit sterilen Pipetten entfernt.
Zur Regeneration wurden jeweils 20-30 Explante in 90 mm Petrischalen überführt, welche 25 ml Sproß-Induktionsmedium mit
30 Kanamycin enthielten. Die Petrischalen wurden mit 2 Lagen Leukopor verschlossen und bei 25 °C und 2000 lux bei Photoperioden von 16 Stunden Licht/ 8 Stunden Dunkelheit inkubiert. Alle 12 Tage wurden die sich entwickelnden Kalli auf frische Petrischalen mit Sproß-Induktionsmedium umgesetzt. Alle weiteren
35 Schritte zur Regeneration ganzer Pflanzen wurden wie von Bade, J.B und Damm, B. (in: Gene Transfer to Plants, Potrykus, I. und Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38) beschrieben durchgeführt. 0 Beispiel 8
Herstellung transgener Nicotiana tabacum Pflanzen.
Zehn ml YEB-Medium mit Antibiotikum (5 g/1 Rinder-Extrakt, 1 g/1 Hefe-Extrakt, 5 g/1 Pepton, 5 g/1 Saccharose und 2 mM MgS04.) 5 wurden mit einer Kolonie von Agrobacterium tumefaciens beimpft und über Nacht bei 28°C kultiviert. Die Zellen wurden 20 min bei 4°C, 3500 U/min in einer Tischzentrifuge pelletiert und danach in frischem YEB-Medium ohne Antibiotika unter sterilen Bedingungen resuspendiert. Die Zellsuspension wurde für die Transformation eingesetzt .
Die Wildtyp-Pflanzen aus Sterilkultur wurden durch vegetative Replikation erhalten. Dazu wurde nur die Spitze der Pflanze abgeschnitten und auf frisches 2MS-Medium in ein steriles Einweckglas überführt. Vom Rest der Pflanze wurden die Haare auf der Blattoberseite und die Mittelrippen.der Blätter entfernt. Die Blätter wurden mit einer Rasierklinge in etwa lern2 große Stücke geschnitten. Die Agrobakterienkultur wurde in eine kleine Petri- schale überführt (Durchmesser 2 cm) . Die Blattstücke wurden kurz durch diese Lösung gezogen und mit der Blattunterseite auf 2MS- Medium in Petrischalen (Durchmesser 9 cm) gelegt, so daß sie das Medium berührten. Nach zwei Tagen im Dunkeln bei 25°C wurden die Explantate auf Platten mit Kallusinduktionsmedium überführt und in der Klimakammer auf 28°C temperiert. Das Medium mußte alle 7-10 Tage gewechselt werden. Sobald sich Kalli bildeten, wurden die Explantate in sterile Einweckgläser auf Sproßinduktionsmedium mit Claforan (0,6 % BiTec-Agar (g/v) , 2,0 mg/1 Zeatinribose,
0,02 mg/1 Naphtylessigsäure, 0,02 mg/1 Gibberelinsäure, 0,25 g/ml Claforan, 1,6 % Glukose (g/v) und 50 mg/1 Kanamycin) überführt. Nach etwa einem Monat trat Organogenese ein und die gebildeten Sprosse konnten abgeschnitten werden. Die Kultivierung der Sprosse wurde auf 2MS-Medium mit Claforan und Selektionsmarker durchgeführt. Sobald sich ein kräftiger Wurzelballen gebildet hatte, konnten die Pflanzen in Pikiererde getopft werden.
Beispiel 9 Charakterisierung der transgenen Pflanzen.
Um zu bestätigen, daß durch die Expression der Homogentisatphytyltransferase aus Synechocystis spec. PCC 6803 die Vitamin E Biosynthese in den transgenen Pflanzen beeinflußt wird, werden die Tocopherol- und Tocotrienol-Gehalte in Blätter und Samen der mit den beschriebenen Konstrukten transformierten Pflanzen (Arabidopsis thaliana, Brassica napus und Nicotiana tabacum) analysiert . Dazu werden die transgenen Pflanzen im Gewächshaus kultiviert und Pflanzen die das Gen kodierend für die Homogen- tisatphytyltransferase aus Synechocystis spec. PCC 6803 exprimieren auf Northern-Ebene analysiert. In Blättern und Samen dieser Pflanzen wird der Tocopherolgehalt und der Tocotrienol- gehalt ermittelt. In allen Fällen ist die Tocopherol- bzw. Toco- trienol-Konzentration in transgenen Pflanzen, die zusätzlich eine erfindungsgemäße Nukleinsäure exprimieren, im Vergleich zu nicht transformierten Pflanzen erhöht.

Claims

Patentansprüche
1. Protein, das eine enzymatische Aktivität zur Umwandlung von Homogentisat und Phytyl-Pyrophosphat in 2-Methyl-Phytylhydro- chinon aufweist.
2. Protein nach Anspruch 1, enthaltend die Aminosäuresequenz SEQ ID NO. 2 oder eine von. dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Homologie von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO. 2 aufweist.
3. Nukleinsäure, codierend ein Protein gemäß einem der Ansprüche 1 oder 2.
4. Nukleinsäure gemäß Anspruch 3 , codierend ein Protein aus Pflanzen, Cyanobakterien, Moose oder Algen.
5. Nukleinsäure nach Anspruch 3, dadurch gekennzeichnet, daß sie aus der in SEQ ID NO 1 dargestellten Sequenz besteht.
6. Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure gemäß einem der Ansprüche 3 bis 5 , die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in prokaryontischen oder eukaryontischen Organismen gewährleisten.
7. Nukleinsäurekonstrukt nach Anspruch 6 , dadurch gekenn- zeichnet, daß die Regulationssignale einen oder mehrere
Promotoren enthalten, die die Transkription und Translation in prokaryontischen oder eukaryontischen Organismen gewährleisten.
8. Genetisch veränderter Organismus, wobei die genetische
Veränderung die Genexpression einer Nukleinsäure gemäß einem der Ansprüche 3 bis 5 gegenüber einem Wildtyp
für den Fall, daß der AusgangsOrganismus eine Nukleinsäure gemäß einem der Ansprüche 3 bis 5 enthält, erhöht oder
für den Fall, daß der AusgangsOrganismus eine Nukleinsäure gemäß einem der Ansprüche 3 bis 5 nicht enthält, verursacht.
Zeichn.
9. Genetisch veränderter Organismus nach Anspruch 8, dadurch gekennzeichnet, daß der genetisch veränderte Organismus gegenüber dem Wildtyp einen erhöhten Vitamin E-Gehalt aufweist .
5
10. Genetisch veränderter Organismus nach Anspruch 8, dadurch gekennzeichnet, daß der genetisch veränderte Organismus gegenüber Inhibitoren der Homogentisatphytyltransferase eine Resistenz aufweist.
10
11. Genetisch veränderter Organismus nach einem der Ansprüche 8 bis 10, dadurch gekennzeichnet, daß man als Organismus einen eukaryontischen Organismus verwendet.
15 12. Genetisch veränderter Organismus nach Anspruch 11, dadurch gekennzeichnet, daß man als eukaryontischen Organismus eine Pflanze verwendet.
13. Verwendung eines genetisch veränderten Organismus nach einem 20 der Ansprüche 8 bis 12 zur Herstellung von Vitamin E oder zur
Biotransformation von Homogentisatderivaten und Phytyl-Pyro- phosphat-Derivaten in 2-Methyl-Phytylhydrochinonderivate oder Homogentisatderivaten und Geranyl-Geranyl-Pyrophosphat- derivaten in 2-Methyl-geranylgeranylhydrochinonderivate. 25
14. Verfahren zur Herstellung von genetisch veränderten Organismen gemäß einem der Ansprüche 8 bis 12 , dadurch gekennzeichnet, daß man eine Nukleinsäure gemäß einem der Ansprüche 3 bis 5 oder ein Nukleinsäurekonstrukt gemäß
30 Anspruch 6 oder 7 in das Genom des AusgangsOrganismus einführt .
15. Verwendung der Nukleinsäure gemäß einem der Ansprüche 3 bis 5 oder der Nukleinsäurekonstrukte gemäß Anspruch 6 oder 7 zur
35 Herstellung von genetisch veränderten Organismen.
16. Verwendung der Nukleinsäure gemäß einem der Ansprüche 3 bis 5 zur Expression in Organismen.
40 17. Verfahren zur Herstellung von Vitamin E, dadurch gekennzeichnet, daß man Homogentisatderivate und Phytyl-Pyrophosphat- Derivate in 2-Methyl-Phytylhydrochinonderivate oder Homogentisatderivate und Geranyl-Geranyl-Pyrophosphatderivate in 2-Methyl-geranylgeranylhydrochinonderivate in Gegenwart eines
45 Proteins gemäß einem der Ansprüche 1 oder 2 überführt.
18. Verfahren nach Anspruch 17, dadurch gekennzeichnet, daß man einen Organismus gemäß einem der Ansprüche 8 -bis 12 kultiviert, den Organismus erntet und die Vitamin-E-Verbindungen anschließend aus dem Organismus isoliert.
5
19. Verfahren zur Biotransformation, dadurch gekennzeichnet, daß man Homogentisatderivate und Phytyl-Pyrophosphat-Derivate in 2-Methyl-Phytylhydrochinonderivate oder Homogentisatderivate und Geranyl-Geranyl-Pyrophpsphatderivate in 2-Methyl-geranyl-
10 geranylhydrochinonderivate in Gegenwart eines Proteins gemäß einem der Ansprüche 1 oder 2 überführt .
20. Verfahren nach Anspruch 19, dadurch gekennzeichnet, daß das Protein in einem Organismus, in freier oder in immobilisier-
15 ter Form vorliegt .
21. Verwendung des Proteins nach Anspruch 1 oder 2 als Homogentisatphytyltransferase .
20 22. Verwendung des Proteins nach Anspruch 1 oder 2 zur Umwandlung von Homogentisatderivaten und Phytyl-Pyrophosphat-Derivaten in 2-Methyl-Phytylhydrochinonderivate oder Homogentisatderivaten und Geranyl-Geranyl-Pyrophosphatderivaten in 2-Methyl-geranylgeranylhydrochinonderivate.
25
23. Verwendung des Proteins nach Anspruch 1 oder 2 oder der
Nukleinsäure nach einem der Ansprüche 3 bis 5 zur Herstellung von Vitamin E.
30 24. Verwendung des Proteins nach Anspruch 1 oder 2 oder der
Nukleinsäure nach einem der Ansprüche 3 bis 5 zur Herstellung von Vitamin E in transgenen Organismen.
25. Verwendung des Proteins nach Anspruch 1 oder 2 oder der 35 Nukleinsäure nach einem der Ansprüche 3 bis 5 zur Herstellung von Vitamin E in transgenen Pflanzen.
26. Verwendung des Proteins nach Anspruch 1 oder 2 oder der
Nukleinsäure nach einem der Ansprüche 3 bis 5 zur Herstellung 40 von Antikörpern.
27. Verwendung des Proteins nach Anspruch 1 oder 2 oder der
Nukleinsäure nach einem der Ansprüche 3 bis 5 als herbizides Target zum Auffinden von Inhibitoren der Homogentisatphytyl- 45 transferase. Verfahren zum Auffinden von Inhibitoren der Homogentisatphytyltransferase, dadurch gekennzeichnet, daß man die enzymatische Aktivität der Homogentisatphytyltransferase in Gegenwart einer chemischen Verbindung misst und bei Erniedrigung der enzymatischen Aktivität im Vergleich zur nicht gehemmten Aktivität die chemische Verbindung einen Inhibitor darstellt.
Herbizide Wirkstoffe, erhältlich durch einen Verfahren gemäß Anspruch 28.
EP01923581A 2000-02-25 2001-02-16 Homogentisatphytyltransferase Withdrawn EP1299413A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10009002A DE10009002A1 (de) 2000-02-25 2000-02-25 Homogentisatphytyltransferase
DE10009002 2000-02-25
PCT/EP2001/001720 WO2001062781A2 (de) 2000-02-25 2001-02-16 Homogentisatphytyltransferase

Publications (1)

Publication Number Publication Date
EP1299413A2 true EP1299413A2 (de) 2003-04-09

Family

ID=7632465

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01923581A Withdrawn EP1299413A2 (de) 2000-02-25 2001-02-16 Homogentisatphytyltransferase

Country Status (7)

Country Link
US (1) US20030084479A1 (de)
EP (1) EP1299413A2 (de)
AU (1) AU2001250321A1 (de)
BR (1) BR0108649A (de)
CA (1) CA2400783A1 (de)
DE (1) DE10009002A1 (de)
WO (1) WO2001062781A2 (de)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003527077A (ja) 1999-04-15 2003-09-16 カルジーン エルエルシー トコフェロール合成に関与するタンパク質の核酸配列
BR0010318A (pt) 1999-05-07 2002-05-28 Pioneer Hi Bred Int ácidos nucléicos de fitil/prenil-transferase, polipeptìdeos e uso dos mesmos
US6872815B1 (en) 2000-10-14 2005-03-29 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
AR030124A1 (es) 2000-08-07 2003-08-13 Monsanto Technology Llc Genes de la via del fosfato de metil-d-eritritol
DE10046462A1 (de) * 2000-09-19 2002-05-29 Sungene Gmbh & Co Kgaa Verbesserte Verfahren zur Vitamin E Biosynthese
US7161061B2 (en) 2001-05-09 2007-01-09 Monsanto Technology Llc Metabolite transporters
DE60230608D1 (de) 2001-05-09 2009-02-12 Monsanto Technology Llc Tyra-gene und ihre verwendung
WO2003016482A2 (en) 2001-08-17 2003-02-27 Monsanto Technology Llc Methyltransferase genes and uses thereof
WO2003034812A2 (en) 2001-10-25 2003-05-01 Monsanto Technology Llc Aromatic methyltransferases and uses thereof
US7112717B2 (en) 2002-03-19 2006-09-26 Monsanto Technology Llc Homogentisate prenyl transferase gene (HPT2) from arabidopsis and uses thereof
DE10212703A1 (de) * 2002-03-21 2003-10-02 Sungene Gmbh & Co Kgaa Erhöhung Vitamin-E-Gehalts in Organismen durch Erhöhung der 2-Methyl-6-phytythydrochinon-Methyltransferase-Aktivität
DE10231587A1 (de) * 2002-07-11 2004-01-29 Sungene Gmbh & Co. Kgaa Transgene Expressionskonstrukte und Verfahren zum Erhöhen des Vitamin E-Gehaltes in pflanzlichen Organismen
DE10232483A1 (de) * 2002-07-17 2004-02-05 Sungene Gmbh & Co. Kgaa Transgene Expressionskonstrukte und Verfahren zum Erhöhen des Vitamin E-Gehaltes in pflanzlichen Organismen
EP1546334A4 (de) 2002-08-05 2007-01-03 Monsanto Technology Llc Gene in verbindung mit tocopherol-biosynthese und verwendungen davon
WO2006092449A2 (en) * 2005-03-02 2006-09-08 Metanomics Gmbh Process for the production of fine chemicals

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5618988A (en) * 1990-03-02 1997-04-08 Amoco Corporation Enhanced carotenoid accumulation in storage organs of genetically engineered plants
JP2003527077A (ja) * 1999-04-15 2003-09-16 カルジーン エルエルシー トコフェロール合成に関与するタンパク質の核酸配列
BR0010318A (pt) * 1999-05-07 2002-05-28 Pioneer Hi Bred Int ácidos nucléicos de fitil/prenil-transferase, polipeptìdeos e uso dos mesmos

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0162781A2 *

Also Published As

Publication number Publication date
WO2001062781A2 (de) 2001-08-30
CA2400783A1 (en) 2001-08-30
WO2001062781A3 (de) 2002-01-24
DE10009002A1 (de) 2001-08-30
BR0108649A (pt) 2003-04-29
US20030084479A1 (en) 2003-05-01
AU2001250321A1 (en) 2001-09-03

Similar Documents

Publication Publication Date Title
EP1294913B1 (de) Veränderung des gehalts an feinchemikalien in organismen durch genetische veränderung des shikimatweges
EP1009841A1 (de) Dna-sequenz codierend für eine hydroxyphenylpyruvatdioxygenase und deren überproduktion in pflanzen
EP1299413A2 (de) Homogentisatphytyltransferase
EP1102852A1 (de) Dna-sequenz kodierend für eine 1-deoxy-d-xylulose-5-phosphat synthase und deren überproduktion in pflanzen
EP1373533B1 (de) Erhöhung des vitamin-e-gehalts in organismen durch erhöhung der tyrosinaminotransferase-aktivität
DE10046462A1 (de) Verbesserte Verfahren zur Vitamin E Biosynthese
EP1194577A1 (de) Indentifizierung und ueberexpression einer dna-sequenz kodierend fuer eine 2-methyl-6-phytylhydrochinon-methyltransferase in pflanzen
DE19918949A1 (de) Überexpression einer DNA-Sequenz codierend für eine 1-Desoxy-D-Xylulose-5-Phosphat Reduktoisomerase in Pflanzen
DE19937957A1 (de) Homogentisat-Dioxygenase
DE19835219A1 (de) DNA-Sequenz codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und deren Überproduktion in Pflanzen
WO2000044911A1 (de) Überexpression einer dna-sequenz codierend für transketolase in pflanzen
DE10212703A1 (de) Erhöhung Vitamin-E-Gehalts in Organismen durch Erhöhung der 2-Methyl-6-phytythydrochinon-Methyltransferase-Aktivität
DE10260871A1 (de) Verfahren zur Herstellung von transgenen Pflanzen mit erhöhtem Vitamin E-Gehalt durch Veränderung des Serin-Acetyltransferase-Gehalts
DE10030647A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
DE10064454A1 (de) Veränderung des Gehalts an Feinchemikalien in Organismen durch genetische Veränderung des Shikimatweges
DE10232483A1 (de) Transgene Expressionskonstrukte und Verfahren zum Erhöhen des Vitamin E-Gehaltes in pflanzlichen Organismen
DE10231587A1 (de) Transgene Expressionskonstrukte und Verfahren zum Erhöhen des Vitamin E-Gehaltes in pflanzlichen Organismen
DE19845231A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Pphosphat Synthase, eine Hydroxyphenylpyruvat Dioxygenase und eine Geranylgeranylpyrophosphat Oxidoreduktase und deren Überproduktion in Pflanzen
DE19845216A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Hydroxyphenylpyruvat Dioxygenase und deren Überproduktion in Pflanzen
DE19845224A1 (de) DNA-Sequenzen codierend für eine 1-Deoxy-D-Xylulose-5-Phosphat Synthase und eine Geranylgeranyl-Pyrosphat Oxidoreduktase und deren Überproduktion in Pflanzen
DE10231588A1 (de) Transgene Expressionskonstrukte und Verfahren zum Erhöhen des Vitamin E-Gehaltes in pflanzlichen Organismen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020810

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20040803