EP1259602A1 - Methoden zur identifizierung von regulatorischen elementen der transkription und translation und damit verwandte verbindungen - Google Patents

Methoden zur identifizierung von regulatorischen elementen der transkription und translation und damit verwandte verbindungen

Info

Publication number
EP1259602A1
EP1259602A1 EP01903383A EP01903383A EP1259602A1 EP 1259602 A1 EP1259602 A1 EP 1259602A1 EP 01903383 A EP01903383 A EP 01903383A EP 01903383 A EP01903383 A EP 01903383A EP 1259602 A1 EP1259602 A1 EP 1259602A1
Authority
EP
European Patent Office
Prior art keywords
oligonucleotide
reporter
promoter
cassette
transcriptional
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01903383A
Other languages
English (en)
French (fr)
Inventor
Vincent P. Mauro
Gerald M. Edelman
Stephen A. Chappell
Frederick S. Jones
Geoffrey Owens
Robyn Meech
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of EP1259602A1 publication Critical patent/EP1259602A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1048SELEX
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1051Gene trapping, e.g. exon-, intron-, IRES-, signal sequence-trap cloning, trap vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/108Plasmid DNA episomal vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/001Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • This invention relates to methods for producing nucleotide sequences having regulatory functions using cellular selection of random nucleotide sequences, and to the sequences so produced.
  • Every eukaryotic gene has a core promoter that resides at the extreme 5' end of its transcription unit.
  • Most core promoters contain common recognition sequences such as the TATA box and GC-rich motifs, which allow binding of RNA polymerase, the enzyme required for the synthesis of messenger RNA on DNA templates.
  • the core promoter is essential for initiation of transcription. However, it alone usually does not contain all the information necessary for the modulated expression of a gene in different contexts in the developing or behaving organism.
  • RNA molecules transcribed from gene sequences contain translational regulatory elements, which regulate production of a polypeptide from the mRNA.
  • the mRNA can contain an internal ribosome entry site (IRES) sequence, which effects the manner in which ribosomes bind to an mRNA and initiate translation, and does not require interaction of the ribosome with the 5' end of an mRNA transcript.
  • IRES internal ribosome entry site
  • Eukaryotic promoters are complex and frequently contain combinations of several transcriptional regulatory elements. These DNA motifs are recognized by specific proteins (transcription factors) that bind to the element and regulate transcription of a particular gene. Hundreds of DNA segments that participate in the regulation of transcription of genes in eukaryotic systems have been characterized. However, these elements and their corresponding transcription factors generally have been analyzed only as individual units, for example, as to how an element and its associated transcription factors regulate the expression of a particular gene in a specific context. However, the rules by which regulatory elements function either by themselves or in combination with other elements in the many genes in which these elements are found are not well understood.
  • AP-1 activator protein 1
  • TRE TPA responsive gene regulatory element
  • the TRE is bound by members of the fas and jun families of transcriptional regulatory proteins, which are recruited in a number of regulatory situations in gene expression, particularly under conditions involving the integration of growth factor signals.
  • a TRE can be present in a regulatory region of a gene that is expressed only in the kidney during its differentiation or, alternatively, in a gene that is expressed constitutively by neural cell precursors.
  • IRESes Compared to transcriptional control sequences, little is known about translational control sequences. Some IRESes have been identified in viruses, and more recently cellular mRNA sequences having IRES activity have been identified. Unlike transcriptional regulatory elements, however, small modular elements having translational regulatory activity, including IRES activity, have not been identified.
  • the present invention relates to methods to create, select and assemble transcriptional or translational regulatory elements, including, for example, promoter, enhancer and IRES elements, and methods to examine the ability of such regulatory elements to modulate transcription or translation in eukaryotic cells.
  • a method of the invention can utilize, for example, an expression vector construct, which allows the insertion of relatively small nucleotide sequences (oligonucleotides) to be examined for regulatory activity, and for the systematic testing and isolation of such a regulatory element.
  • a method of the invention provides an analytic tool and an engine of discovery for transcriptional and translational regulatory sequences, and can provide a basis for diagnostic applications.
  • the present invention also provides regulatory oligonucleotides that can be used in expression vectors for controlling gene expression in diagnostic and therapeutic applications, and provides vectors useful for identifying such transcriptional and translational regulatory elements.
  • the present invention relates to a method of identifying an oligonucleotide having transcriptional or translational regulatory activity in a eukaryotic cell.
  • a method can be performed, for example, by integrating an oligonucleotide to be examined for transcriptional or translational regulatory activity into a eukaryotic cell genome, wherein the oligonucleotide is operatively linked to an expressible polynucleotide, and detecting a change in the level of expression of the expressible polynucleotide in the presence of the oligonucleotide as compared to the absence of the oligonucleotide.
  • the expressible polynucleotide generally contains a cloning site such that the oligonucleotide can be operatively linked to the expressible polynucleotide by insertion into the cloning site, and also can contain a transcription initiator sequence.
  • the expressible polynucleotide generally is a reporter polypeptide, which can be a fluorescent polypeptide, an antibiotic resistance polypeptide, a cell surface protein marker, an enzyme, or a peptide tag.
  • the invention provides a method to identify an oligonucleotide having transcriptional regulatory activity, for example, promoter activity, enhancer activity, or silencer activity.
  • the expressible polynucleotide generally is operatively linked minimal promoter, for example, a TATA box, a minimal enkephalin promoter, or a minimal SV40 early promoter.
  • the expressible polypeptide can comprise a monocistronic reporter cassette, which encodes a single reporter polypeptide, or can be a dicistronic reporter cassette, which includes, in operative linkage, a regulatory cassette comprising a minimal promoter and a cloning site, a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence comprising an internal ribosome entry site (IRES), and a nucleotide sequence encoding a second reporter polypeptide, whereby an oligonucleotide to be examined for transcriptional regulatory activity is operatively linked to the dicistronic reporter cassette by insertion into the cloning site.
  • IVS internal ribosome entry site
  • the expressible polynucleotide can be contained in a vector, which can be a plasmid based vector such as the vectors exemplified by SEQ ID NO: 2 and SEQ ID NO: 3, or can be contained in a retroviral vector such as the vectors exemplified by SEQ ID NO: 1 and SEQ ID NO: 9.
  • the oligonucleotide to be examined for transcriptional activity can be a synthetic oligonucleotide, for example, a random oligonucleotide sequence such an oligonucleotide in a library of randomized oligonucleotides, or a variegated oligonucleotide that is based on, but different from a known oligonucleotide such as a known transcriptional regulatory element.
  • the oligonucleotide to be examined for transcriptional activity also can be a portion of an oligonucleotide fragment of genomic DNA.
  • the invention provides a method to identify an oligonucleotide having translational regulatory activity, for example, a translational enhancer or inhibitor or an IRES element.
  • the expressible polynucleotide includes a promoter, which generally is a strong promoter such as an RSV promoter or CMV promoter or the like.
  • the expressible polynucleotide can include a monocistronic reporter cassette or dicistronic reporter cassette.
  • the expressible polynucleotide includes a dicistronic reporter cassette, which contains, in operative linkage, a regulatory cassette comprising a promoter, a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence comprising a cloning site, and a nucleotide sequence encoding a second reporter polypeptide, whereby an oligonucleotide to be examined for IRES activity is operatively linked to the nucleotide sequence encoding the second reporter polypeptide by insertion into the cloning site.
  • the expressible polynucleotide can be contained in a vector, for example, a retroviral vector such as that exemplified by SEQ ID NO: 109.
  • the oligonucleotide to be examined for translational activity can be a synthetic oligonucleotide, for example, a random oligonucleotide sequence such an oligonucleotide in a library of randomized oligonucleotides, or a variegated oligonucleotide that is based on, but different from a known oligonucleotide such as a known translational regulatory element.
  • the oligonucleotide to be examined for translational activity also can be a portion of a cDNA encoding a 5' untranslated region of an mRNA, or can be an oligonucleotide fragment of genomic DNA.
  • the oligonucleotide to be examined for translational regulatory activity can be based on a sequence complementary to an oligonucleotide sequence of rRNA, preferably an un-base paired oligonucleotide sequence of rRNA, including, for example, a variegated population of oligonucleotide sequences derived from an oligonucleotide sequence complementary to an un-base paired region of a rRNA.
  • a method of the invention is performed such that the oligonucleotide to be examined for transcriptional or translational regulatory activity is operatively linked to the expressible polynucleotide prior to integrating into the eukaryotic cell genome.
  • the expressible polynucleotide is an endogenous polynucleotide in the eukaryotic cell genome, and the oligonucleotide to be examined for regulatory activity is introduced into a cell containing the expressible polynucleotide and operatively linked to the endogenous polynucleotide, for example, by homologous recombination.
  • the eukaryotic cell is a cell of a transgenic non- human eukaryote, wherein the cell contains a transgene.
  • the transgene can be, for example, a recombinase recognition site that is positioned with respect to an endogenous expressible polynucleotide such that an oligonucleotide inserted into the site is operatively linked to the polynucleotide.
  • the transgene also can be a heterologous expressible polynucleotide, which is stably maintained in the eukaryotic cell genome, and can contain a cloning site for insertion of the oligonucleotide to be examined.
  • the oligonucleotide is an oligonucleotide to be examined for transcriptional regulatory activity
  • the transgene is a dicistronic reporter cassette comprising, in operative linkage, a regulatory cassette comprising a minimal promoter and a cloning site, a first reporter cassette, a spacer sequence comprising an internal ribosome entry site (IRES), and a second reporter cassette, whereby the oligonucleotide is operatively linked to the dicistronic reporter cassette by insertion into the cloning site.
  • the oligonucleotide is an oligonucleotide to be examined for translational regulatory activity
  • the transgene is a dicistronic reporter cassette comprising, in operative linkage, a regulatory cassette comprising a promoter, a first reporter cassette, a spacer sequence comprising a cloning site, and a second reporter cassette, whereby the oligonucleotide is operatively linked to the second cistron by insertion into the cloning site.
  • a method of the invention also can be performed by cloning a library of oligonucleotides to be examined for transcriptional or translation regulatory activity into multiple copies of an expression vector comprising an expressible polynucleotide, whereby the oligonucleotides are operatively linked to the expressible polynucleotide, thereby obtaining a library of vectors; contacting the library of vectors with eukaryotic cells under conditions such that the vectors are introduced into the cell and integrate into a chromosome in the cells; and detecting expression of an expressible polynucleotide operatively linked to an oligonucleotide at a level other than a level of expression of the expressible polynucleotide in the absence of the oligonucleotide.
  • the eukaryotic cells can be any eukaryotic cells, including insect, yeast, amphibian, reptilian, avian or mammalian cells.
  • the cells are mammalian cells, including, for example, neuronal cells, fibroblasts, hepatic cells, bone marrow cells, bone marrow derived cells, muscle cells and epithelial cells.
  • the library of oligonucleotides can be, for example, a library of randomized oligonucleotides, a library of variegated oligonucleotides based on a selected oligonucleotide sequence, or a library of genomic DNA fragments.
  • the oligonucleotide is an oligonucleotide to be examined for transcriptional regulatory activity
  • the expressible polynucleotide comprises, in operative linkage, a regulatory cassette comprising a minimal promoter and a cloning site, and a reporter cassette, whereby the oligonucleotide is operatively linked to the expressible polynucleotide by insertion into the cloning site.
  • the oligonucleotide is an oligonucleotide to be examined for transcriptional regulatory activity
  • the expressible polynucleotide comprises a dicistronic reporter cassette comprising, in operative linkage, a regulatory cassette comprising a minimal promoter and a cloning site, a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence comprising an internal ribosome entry site (IRES), and a nucleotide sequence encoding a second reporter polypeptide, whereby the oligonucleotide is operatively linked to the dicistronic reporter cassette by insertion into the cloning site.
  • IVS internal ribosome entry site
  • the expressible polynucleotide can be contained in a vector, for example, a plasmid vector as exemplified by SEQ ID NO: 2 and SEQ ID NO: 3 or a retroviral vector as exemplified by SEQ ID NO: 1 and SEQ ID NO: 9.
  • a method of identifying an oligonucleotide having transcriptional regulatory activity can further include selecting a population of cells expressing the expressible polynucleotide operatively linked to an oligonucleotide at a level other than a level of expression of the expressible polynucleotide in the absence of the oligonucleotide.
  • the method can further include isolating the operatively linked oligonucleotide.
  • the present invention provides an isolated synthetic transcriptional regulatory element obtained by the disclosed method, and further provides a recombinant nucleic acid molecule comprising a plurality of operatively linked isolated transcriptional regulatory elements, which can be the same or different.
  • the oligonucleotide is an oligonucleotide to be examined for translational regulatory activity
  • the expressible polynucleotide is a dicistronic reporter cassette comprising, in operative linkage, a regulatory cassette comprising a promoter, a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence comprising a cloning site, and a nucleotide sequence encoding a second reporter polypeptide, whereby the oligonucleotide is operatively linked to the second cistron by insertion into the cloning site.
  • the expressible polynucleotide can be contained in a vector, for example, a plasmid vector or a retroviral vector as exemplified by SEQ ID NO: 109.
  • the method can include further selecting a population of cells expressing the expressible polynucleotide operatively linked to an oligonucleotide at a level other than a level of expression of the expressible polynucleotide in the absence of the oligonucleotide, and can include a step of isolating the operatively linked oligonucleotide.
  • the invention provides an isolated synthetic translational regulatory element, for example, an IRES element, which is obtained using the disclosed method, as well as a recombinant nucleic acid molecule comprising a plurality of operatively linked isolated translational regulatory elements, which can be the same or different.
  • an isolated synthetic translational regulatory element for example, an IRES element, which is obtained using the disclosed method, as well as a recombinant nucleic acid molecule comprising a plurality of operatively linked isolated translational regulatory elements, which can be the same or different.
  • the present invention also relates to an integrating expression vector useful for identifying an oligonucleotide having transcriptional or translational regulatory activity.
  • An integrating expression vector for identifying a transcriptional regulatory element can contain, for example, in operative linkage in a 5' to 3' orientation, a long terminal repeat (LTR) containing a immediate early gene promoter, an R region, a U5 region, a truncated gag gene comprising sequences required for retrovirus packaging, a dicistronic reporter cassette including a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence containing an IRES, a nucleotide sequence encoding a second reporter polypeptide, and a regulatory cassette containing a cloning site and a minimal promoter, and an LTR.
  • LTR long terminal repeat
  • the first and second polypeptides independently can be selected from a fluorescent polypeptide such as green fluorescent protein, cyan fluorescent protein, red fluorescent protein, or an enhanced form thereof, an antibiotic resistance polypeptide such as puromycin N- acetyltransferase, hygromycin B phosphotransferase, neomycin (aminoglycoside) phosphotransferase, and the Sh ble gene product, a cell surface protein marker such as the cell surface protein marker is neural cell adhesion molecule (N-CAM), an enzyme such as ⁇ -galactosidase, chloramphenicol acetyltransferase, luciferase, and alkaline phosphatase, or a peptide tag such as a c-myc peptide, a polyhistidine, or the like.
  • a fluorescent polypeptide such as green fluorescent protein, cyan fluorescent protein, red fluorescent protein, or an enhanced form thereof
  • an antibiotic resistance polypeptide such as puromycin
  • the first reporter polypeptide can be puromycin N-acetyltransferase and the second reporter polypeptide can enhanced green fluorescent protein; or the first reporter polypeptide can be puromycin N-acetyltransferase and the second reporter polypeptide can be N-CAM.
  • the cloning site can be any sequence that facilitates insertion of an oligonucleotide in operative linkage to the expressible polynucleotide, for example, a restriction endonuclease recognition site or a multiple cloning site containing a plurality of such sites, or recombinase recognition site such as a lox sequence or an att sequence.
  • the minimal promoter can be any minimal promoter, for example, a TATA box, a minimal enkephalin promoter, or a minimal SV40 early promoter. Examples of integrating expression vectors of the invention are set forth as SEQ ID NO: 1 and SEQ ID NO: 9, and additional expression vectors, which can integrate into a cell genome, are exemplified by SEQ ID NO: 2 and SEQ ID NO: 3.
  • An integrating expression vector for identifying an oligonucleotide having translational regulatory activity, particularly IRES activity can contain, for example, in operative linkage in a 5' to 3' orientation, a long terminal repeat (LTR) containing a immediate early gene promoter, an R region, a U5 region, a truncated gag gene comprising sequences required for retrovirus packaging, a dicistronic reporter cassette including a nucleotide sequence encoding a first reporter polypeptide, a spacer sequence comprising a cloning site, a nucleotide sequence encoding a second reporter polypeptide, and a regulatory cassette comprising a promoter, and an LTR.
  • LTR long terminal repeat
  • the first and second reporter polypeptide independently can be any reporter polypeptide as disclosed herein or otherwise known in the art.
  • the first reporter polypeptide can be enhanced green fluorescent protein and the second reporter polypeptide can enhanced cyan fluorescent protein.
  • An example of an integrating expression vector is provided by SEQ ID NO: 109.
  • a method of the invention provides a means to identify a transcriptional regulatory element.
  • oligonucleotides in a library of synthetic DNA sequence elements are positioned next to a minimal (core) promoter and screened for activity in mammalian cells using a high throughput selection strategy. The selection process can identify a variety of individual transcriptional regulatory oligonucleotide sequences that can enhance gene expression from the minimal eukaryotic promoter.
  • a selected transcriptionally active element or an oligonucleotide to be examined for transcriptional regulatory activity and a known regulatory motif is combined to produce promoter/enhancer element cassettes.
  • promoter/enhancer element cassettes By varying the order, number and spacing of elements in these cassettes and subsequently selecting for promoter activity, transcriptional regulatory elements having desirable characteristics can be isolated and the rules that govern functional interactions between elements can be determined.
  • a method of the invention also provides a means to identify an oligonucleotide that confers a transcriptional regulatory function on an operatively linked polynucleotide in a eukaryotic cell.
  • the method can be performed, for example, by operatively linking an oligonucleotide to be examined for transcriptional regulatory activity to an expressible polynucleotide, the expression of which can be driven by a minimal promoter, and detecting an increased or decreased level of transcription of the polynucleotide due to the presence of the oligonucleotide.
  • the transcriptional activity due to the oligonucleotide can be examined in vitro or in vivo in a cell in culture or in an organism.
  • the transcriptional activity is examined in a cell in vivo following integration of the construct comprising the oligonucleotide and expressible polynucleotide into a chromosome in the cell.
  • a method provides a means to identify a regulatory element that can act by inducing a local change in the DNA or chromatin conformation, for example, DNA bending, which can increase access of the transcription machinery to the sequence to be transcribed.
  • regulatory elements cannot be detected using methods that rely exclusively on identifying a protein DNA interaction as a means to identify a regulatory element.
  • a method of identifying an oligonucleotide that confers transcriptional regulatory activity also can be performed by providing an expression vector, which contains a reporter cassette comprising a nucleotide sequence encoding a reporter molecule, wherein the reporter cassette is operatively linked to a regulatory cassette comprising a minimal promoter element; cloning a library of randomized oligonucleotides into multiple copies of the expression vector, wherein an oligonucleotide of the library is operatively linked to a minimal promoter element, and wherein the randomized oligonucleotide can potentially function as a transcriptional regulatory sequence, to form a library of vectors that differ in the potential regulatory sequences; transfecting eukaryotic cells with the library of different vectors to form transfected eukaryotic host cells; culturing the transfected eukaryotic cells under conditions suitable for integration of the vector into the host cell and expression of the reporter molecule; selecting a population of transfected eukaryotic cells that express
  • a reporter cassette useful for identifying a transcriptional regulatory element according to a method of the invention is a dicistronic construct that includes the nucleotide sequence encoding the first reporter molecule, and also includes a second nucleotide sequence encoding a second selectable marker, which is different from the first reporter molecule.
  • the dicistronic construct includes an IRES element in the intercistronic sequence. Such a construct facilitates the identification and isolation of transcriptional regulatory oligonucleotides.
  • a method of the invention also provides a means to identify a translational regulatory element, including a translational enhancer, an IRES element, and the like.
  • a complex library of synthetic DNA sequence elements is positioned in an intervening sequence between first and second nucleotide sequences that encode first and second reporter molecules in a dicistronic reporter cassette, and screened for translational regulatory activity in a eukaryotic cell, for example, a mammalian cell, optionally using a high throughput selection strategy.
  • a variety of regulatory oligonucleotide sequences that initiate cap-independent translation of the second reporter molecule and, therefore, function as IRES sequences have been identified.
  • a selected translational regulatory element is combined with a known regulatory motif such that, by varying the order, number and spacing of elements in a reporter cassette and subsequently selecting for expression, translational regulatory elements having desirable characteristics can be isolated and the rules that govern functional interactions between elements can be determined.
  • a method of the invention provides a means to identify an oligonucleotide that confers a translational regulatory function on an operatively linked polynucleotide in a eukaryotic cell.
  • Such a method can be performed, for example, by operatively linking an oligonucleotide to be examined for translational regulatory activity to an expressible polynucleotide, which includes or encodes the elements generally required for translation such as start and stop codons (i.e., a cistron), and detecting an increased or decreased level of translation of the polynucleotide due to the presence of the oligonucleotide.
  • the translational activity due to the oligonucleotide can be examined in vitro or in vivo in a cell in culture or in an organism. In one embodiment, the translational activity is examined in a cell in vivo following integration of the construct comprising the oligonucleotide and expressible polynucleotide into a chromosome in the cell.
  • a method of identifying an oligonucleotide having translational regulatory activity also can be practiced by providing an expression vector comprising a dicistronic reporter cassette, which includes a first nucleotide sequence encoding a first reporter protein and a second nucleotide sequence encoding a second reporter protein, which is different from the first reporter protein, wherein the dicistronic reporter cassette is operatively linked to a regulatory cassette comprising a promoter element, and wherein the reporter cassette contains an intercistronic spacer nucleotide sequence between the first and second encoding nucleotide sequences such that an oligonucleotide to be examined for translational regulatory activity can be introduced into the spacer sequence and is operatively linked to the second nucleotide sequence; cloning the oligonucleotides of a library of randomized oligonucleotides into multiple copies of said expression vector, wherein an oligonucleotide is introduced into the spacer nucleotide sequence
  • a reporter protein (and encoding nucleotide sequence) useful in a method or composition of the invention can be any reporter protein, as disclosed herein, including a fluorescent, luminescent or chemiluminescent protein, an enzyme, a receptor (or ligand), a protein can confers resistance to an antibiotic or other toxic agent, and the like.
  • the reporter molecule can be selected, for example, based on its cost, convenience, availability or other such factor, and generally provides a means to identify and, if desired, isolate a cell expressing the reporter molecule.
  • the present invention also provides isolated synthetic transcriptional or translational regulatory oligonucleotides, which can be identified and isolated using a method as disclosed herein.
  • Such synthetic regulatory oligonucleotides can be useful for regulating the expression of an operatively linked polynucleotide, and can be particularly useful for conferring tissue specific, developmental stage specific, or the like expression of the polynucleotide, including constitutive or inducible expression.
  • a synthetic regulatory oligonucleotide of the invention also can be a component of an expression vector or of a recombinant nucleic acid molecule comprising the regulatory oligonucleotide operatively linked to an expressible polynucleotide.
  • the present invention provides compositions comprising an oligonucleotide of the invention.
  • the composition is a vector, which generally is an expression vector and can be an integrating expression vector that, upon being introduced into a cell, can integrate into the genome of the cell, particularly a eukaryotic cell.
  • the invention also provides a host cell containing a synthetic transcriptional or translational regulatory oligonucleotide of the invention, which can be operatively linked to a heterologous polynucleotide.
  • a recombinant nucleic acid molecule which contains a transcriptional or translational regulatory element of the invention operatively linked to an expressible polynucleotide, which is heterologous to the regulatory element.
  • the present invention also provides systems, which can be in kit form and are useful for practicing aspects of the present invention.
  • the kit generally contains an oligonucleotide of the invention or contains a reagent for identifying a transcriptional or translational regulatory element according to a method of the invention.
  • the kit contains a synthetic regulatory oligonucleotide, which can be an isolated form or can be a component of a vector or a recombinant nucleic acid molecule.
  • the kit also can contain a plurality of synthetic transcriptional or translational regulatory oligonucleotides or combinations thereof, which, optionally, contain additional sequences that facilitate linking the regulatory oligonucleotide to a second nucleotide sequence, which can be a vector, for example.
  • kit form provides a convenient means to select a regulatory element having desired characteristics, for example, tissue specific expression or a low level of constitutive expression or other characteristic.
  • the kit contains a vector for identifying a transcriptional or translational regulatory element, for example, an integrating expression vector.
  • Figure 1 illustrates a portion of the MESVPv/EGFP*/IRESpacPro(ori) vector
  • LTR long terminal repeat
  • R RSV immediate early gene promoter
  • ⁇ gag indicates region of truncation of the group specific antigen gene
  • EGFP indicates enhanced green fluorescent protein
  • IRES indicates internal ribosome entry site
  • PAC indicates puromycin N-acetyltransferase coding sequence.
  • Dotted lines indicate an expanded view of the synthetic promoter (Promoter) located in the downstream LTR U3 region. This promoter contains a multiple cloning site (Nsi I-Bgl II), TATA box and consensus initiator (Inr) sequences. The position at which the synthetic promoter fuses into the downstream R region is indicated.
  • Figures 2A to 2C illustrate maps of various expression vectors useful for identifying an oligonucleotide regulatory element.
  • Figure 2A illustrates the vector pnZ-MEK (SEQ ID NO: 2).
  • MEK indicates minimal enkephalin promoter
  • Zeocin ® , NeoR and bla p indicate coding sequences for polypeptides conferring Zeocin ® (bleomycin), neomycin and kanamycin resistance, respectively.
  • SV40 intron and SV40 polyA + signal sequence are indicated.
  • TK polyA "1" indicates thymidine kinase polyA + signal sequence.
  • ColEl ori indicates E. coli origin of replication.
  • Figure 2B illustrates the vector pnL-MEK. Various sites and sequences are as in Figure 2A. Luciferase indicates luciferase coding sequence.
  • Figure 2C illustrates the vector pnH-MEK (SEQ ID NO: 3). Various sites and sequences are as in Figure 2A.
  • Hygromycin R indicates coding sequence for polypeptide conferring hygromycin B resistance.
  • Figure 3 illustrates the retroviral vector MES VR/EGFP/ECFP/RS VPro(ori-) (SEQ ID NO: 109). Various restriction endonuclease recognition sites are indicated.
  • Figure 4 shows the region of complementarity of the ICS1-23 sequence (SEQ ID NO: 105) and 18S rRNA (SEQ ID NO: 107). "a” and “b” indicate portions of the ICS1-23 sequence (SEQ ID NO: 105).
  • Figure 5 shows the complementary sequence matches between YAP1 or pi 50 leader sequences and 18S rRNA.
  • SEQ ID NOS: are indicated.
  • Vertical lines indicate base pairing and open circles represent GU base pairing.
  • the longest uninterrupted stretches of complementarity for each match are indicated by the shaded nucleotides.
  • FIGS 6 A and 6B illustrate sites in which IRES modules of the invention share complementarity to mouse 18S ribosomal RNA (rRNA; SEQ ID NO: 196).
  • Figure 6 A provides a linear representation of the 18S rRNA, the vertical lines below the linear representation are sites at which selected IRES modules share 8 or 9 nucleotides of complementarity with the to 18S rRNA sequence.
  • Figure 6B shows a secondary structure of the 18S rRNA, and the dark bars indicate the positions of the complementary sequence matches to selected IRES modules of the invention.
  • the present invention provides methods for identifying synthetic transcriptional and translational regulatory elements, vectors useful for identifying such regulatory elements, and isolated regulatory elements, which comprise oligonucleotide sequences that, when present in a gene expression context in a eukaryotic cell, can confer a regulatory function onto the gene or a polynucleotide encoded by the gene.
  • the gene segment or other expressible polynucleotide can be in any expression construct engineered for expression in a eukaryotic cell, particularly in the form of a chromosome-associated polynucleotide, which is subject to the nuances of complexity associated with gene expression in a chromosome as compared, for example, an episomal (extra-chromosomal) element.
  • a chromosomal context often is a consequence of a gene therapy procedure, wherein the transgene integrates into the chromosome.
  • a method of identifying a transcriptional regulatory element can be performed in various ways, as disclosed herein (see, also, Edelman et al, Proc. Natl. Acad. Sci.
  • an oligonucleotide to be examined for transcriptional regulatory activity is operatively linked to an expressible polynucleotide, which is or can be operatively linked to a minimal promoter, and a change in the level of expression of the polynucleotide identifies the oligonucleotide as a transcriptional regulatory oligonucleotide.
  • transcriptional regulatory oligonucleotide or “transcriptional regulatory element” or the like refers to a nucleotide sequence that can effect the level of transcription of an operatively linked polynucleotide.
  • oligonucleotide sequences that increase the level of transcription of a polynucleotide, for example, a promoter element or an enhancer element, or that decrease the level of transcription of a polynucleotide, for example, a silencer element.
  • a transcriptional regulatory element can be constitutively active or inducible, which can be inducible from an inactive state or from a basal state, and can be tissue specific or developmental stage specific, or the like.
  • tissue specific when used in reference to a translational regulatory element, means a nucleotide sequence that effects translation of an operatively linked expressible polynucleotide in only one or a few cell types.
  • tissue specific when used in reference to a translational regulatory element, means a nucleotide sequence that effects translation of an operatively linked expressible polynucleotide in only one or a few cell types.
  • inducible when used in response to a translational regulatory element, means a nucleotide sequence that, when present in a cell exposed to an inducing agent, effects an increased level of translation of an operatively linked expressible polynucleotide as compared to the level of translation, if any, in the absence of an inducing agent.
  • inducing agent is used to refer to a chemical, biological or physical agent that effects translation from an inducible translational regulatory element.
  • translation from the element In response to exposure to an inducing agent, translation from the element generally is initiated de novo or is increased above a basal or constitutive level of expression.
  • induction can be identified using the methods disclosed herein, including detecting an increased level of a reporter polypeptide encoded by the expressible polynucleotide that is operatively linked to the translational regulatory element.
  • An inducing agent can be, for example, a stress condition to which a cell is exposed, for example, a heat or cold shock, a toxic agent such as a heavy metal ion, or a lack of a nutrient, hormone, growth factor, or the like; or can be exposure to a molecule that affects the growth or differentiation state of a cell such as a hormone or a growth factor.
  • a stress condition to which a cell is exposed for example, a heat or cold shock, a toxic agent such as a heavy metal ion, or a lack of a nutrient, hormone, growth factor, or the like; or can be exposure to a molecule that affects the growth or differentiation state of a cell such as a hormone or a growth factor.
  • the translational regulatory activity of an oligonucleotide can be examined in cells that are exposed to particular conditions or agents, or in cells of a particular cell type, and oligonucleotide that have translational regulatory activity in response to and only under the specified conditions or
  • an expressible polynucleotide is used broadly herein to refer to a nucleotide sequence that can be transcribed or translated.
  • an expressible polynucleotide is a polydeoxyribonucleotide, which can be transcribed in whole or in part into a polyribonucleotide, or is a polyribonucleotide that can be translated in whole or in part into a polypeptide.
  • the expressible polynucleotide can include, in addition to a transcribed or translated sequence, additional sequences required for transcription such as a promoter element, a transcription start site, a polyadenylation signal, and the like; or for translation such as a start codon, a stop codon and the like; or can be operatively linked to such sequences, which can be contained, for example, in a vector into which the polynucleotide is inserted.
  • the term "cistron” also is used herein to refer to an expressible polynucleotide that includes all or substantially all of the elements required for expression of an encoded polypeptide.
  • expressible polynucleotides include nucleotide sequences encoding a reporter polypeptide or other selectable marker, or a nucleotide sequence encoding a polypeptide of interest, for example, a polypeptide that is to be expressed in a cell as a means to produce the polypeptide in a convenient and commercially useful manner, or as part of a gene therapy treatment.
  • An oligonucleotide to be examined for transcriptional (or translational) activity can be operatively linked to an expressible polynucleotide, which, for example, can encode a reporter molecule.
  • operatively linked or “functionally adjacent” means that a regulatory element, which can be a synthetic regulatory oligonucleotide of the invention or an oligonucleotide to be examined for such activity, is positioned with respect to a transcribable or translatable nucleotide sequence such that the regulatory element can effect its regulatory activity.
  • An oligonucleotide having transcriptional enhancer activity can be located at any distance, including adjacent to or up to thousands of nucleotides away from, and upstream or downstream from the promoter, which can be a minimal promoter element, and nucleotide sequence to be transcribed, and still exert a detectable effect on the level of expression of an encoded reporter molecule.
  • a translational regulatory element generally is positioned within about 1 to 500 nucleotides, particularly within about 1 to 100 nucleotides of a translation start site.
  • an oligonucleotide to be examined for transcriptional enhancer activity generally is positioned relatively close to the minimal promoter element, for example, within about 1 to 100 nucleotides, preferably within about 3 to 50 nucleotides of the promoter.
  • operatively linked also is used herein with respect to a first and second polypeptide (or peptide) to refer to encoding sequences that are linked in frame such that a fusion polypeptide can be produced.
  • the term is used to refer to two or more cistrons of an expressible polynucleotide that are transcribed as a single RNA molecule, which can contain, for example, an IRES element of the invention in an intercistronic position.
  • a method of identifying a transcriptional regulatory element can be performed using an expression vector, which contains a reporter cassette comprising a nucleotide sequence encoding at least a first reporter molecule, wherein the reporter cassette is operatively linked to a regulatory cassette comprising a minimal promoter element, is used.
  • the reporter cassette functions to indicate (report) that the reporter molecule has been expressed by means of expression of the detectable reporter molecule.
  • the reporter cassette is expressed under the control of (operatively linked to) the regulatory cassette, which also contains cloning sites for the introduction of an oligonucleotide to be examined for transcriptional regulatory activity, and further contains a minimal promoter element such that, upon introduction of a regulatory oligonucleotide, expression of the reporter cassette is altered.
  • a library of randomized oligonucleotides to be examined for transcriptional regulatory activity can be provided, and one or more individual members of the library can be cloned into multiple copies of the regulatory cassette of the expression vector.
  • the oligonucleotide to be examined for transcriptional regulatory activity is introduced such that it is operatively linked to the minimal promoter element in the regulatory cassette and, therefore, has the potential to function as a transcriptional regulatory element.
  • a library of different constructs, which can be contained in a vector is formed, each construct differing in the introduced potential regulatory oligonucleotide sequence.
  • oligonucleotide sequences to be examined for transcriptional (or translational) regulatory activity also can be sequences isolated from genomic DNA (or mRNA) of a cell.
  • oligonucleotides to be examined for transcriptional regulatory activity can be obtained using an antibody that is specific for a particular transcription factor such as an anti-TATA box binding protein antibody such that nucleotide sequences bound to the TATA box binding protein are isolated.
  • the isolated sequences then can be amplified and examined for transcriptional regulatory activity using a method as disclosed herein.
  • transcriptionally active regions of genomic DNA can be obtained using an antibody that specifically binds acetylated histone H4, which is associated with unwound regions of chromosomal DNA.
  • this method provides a means to enrich for oligonucleotide sequences that are involved in transcriptional regulation.
  • Methods and reagents for isolating transcriptionally active regions of chromosomal DNA are well known (see, for example, Orlando and Paro, Cell 75:1187-1198, 1993; and Holmes and Tjian, Science. 288 : 867-870, 2000, each of which is incorporated herein by reference) and commercially available (for example, anti-acetyl histone H4 antibody, Upstate Biotechnology; anti-TFIID (TATA binding protein) antibody, Santa Cruz
  • Oligonucleotide to be examined for translational regulatory activity also can be, for example, cDNA sequences encoding 5' UTRs of cellular mRNAs, including a library of such cDNA molecules.
  • translational regulatory elements identified according to a method of the invention including synthetic IRES elements, have been found to be complementary to oligonucleotide sequences of ribosomal RNA (rRNA; see Figure 6), particularly to un-base paired oligonucleotide sequences of rRNA, which are interspersed among double stranded regions that form due to hybridization of self-complementary sequences within rRNA (see Figure 7B).
  • oligonucleotides to be examined for translational regulatory activity can be designed based on their being complementary to an oligonucleotide sequence of rRNA, particularly to an un-base paired oligonucleotide sequence of rRNA such as a yeast, mouse or human rRNA (SEQ ID NOS: 110, 111 or 112, respectively; see, also, GenBank Accession Nos. V01335, X00686, X03205, respectively, each of which is incorporated herein by reference).
  • oligonucleotides to be examined for translational regulatory activity can be a library of variegated oligonucleotide sequences (see, for example, U.S. Pat. No.
  • 5,837,500 which can be based, for example, on a translational regulatory element as disclosed herein or identified using a method of the invention, or on an oligonucleotide sequence complementary to an un-base paired region of a rRNA.
  • the effect of an introduced oligonucleotide on transcription of the reporter molecule can be examined in vitro or in vivo, including in a cell in culture or in a cell in an organism.
  • the expression of the reporter molecule from the minimal promoter is determined, then the effect of an introduced oligonucleotide on the level of expression is determined.
  • Expression from the minimal promoter can be determined prior to introducing the element or can be determined in a parallel study.
  • an in vitro transcription reaction can be used to determine the level of expression of the reporter in the presence or absence of the oligonucleotide, wherein a difference in the levels of expression indicates that the oligonucleotide has transcriptional regulatory activity.
  • the in vitro transcription reactions are performed in a high throughput format, for example, in the wells of a plate or in discrete identifiable positions in a microarray, for example, on a silicon wafer or glass slide or the like.
  • the oligonucleotide is examined in a cell, particularly a eukaryotic cell, which can be a cell in culture or a cell in an organism, for example, a transgenic non-human eukaryotic organism.
  • the construct comprising the oligonucleotide to be examined operatively linked to the reporter cassette and regulatory cassette is introduced into the cell by any of various transfection methods.
  • the construct is contained in a vector, which generally is an expression vector, although the elements required for expression also can be part of the construct.
  • Eukaryotic cells are transfected with a library of different vectors to form transfected eukaryotic host cells. Transfection can be performed using methods as disclosed herein or otherwise known in the art.
  • the construct comprising the reporter and regulatory cassettes is contained in a viral vector such as a retroviral vector, which is introduced into a target cell by viral infection.
  • the transfected cells then can be cultured under conditions suitable for the vector to integrate into the host cell, and for the reporter molecule to be expressed if the oligonucleotide has transcriptional regulatory activity.
  • a selection step then can be performed such that cells expressing the reporter molecule are identifiable, and the regulatory sequence in the selected cells can be isolated.
  • a method of identifying a translational regulatory element can be performed similarly.
  • a method of the invention provides a means to identify a translational regulatory element that can enhance the level of translation or can reduce or inhibit the level of translation of an operatively linked expressible polynucleotide.
  • a translational enhancer or inhibitor can be identified, for example, by operatively linking the oligonucleotide to be examined for translational regulatory activity to an expressible polynucleotide, which can, in turn, be operatively linked to a strong promoter, wherein an increase or decrease in the level of translation in the presence of the oligonucleotide as compared to its absence identifies the oligonucleotide as a translational regulatory element.
  • the construct comprising the oligonucleotide to be examined and the regulatory and reporter cassettes, which can be in a vector such as an expression vector, can include a dicistronic reporter cassette, which is operatively linked to a regulatory cassette comprising a strong promoter element.
  • the dicistronic reporter cassette contains a first nucleotide sequence encoding a first reporter molecule and a second nucleotide sequence, which is operatively linked to the first nucleotide sequence and encodes a second reporter protein, which is different from the first reporter protein.
  • the reporter cassette functions to indicate (report) that the first or second reporter protein or both have been expressed, by means of transcription and translation of the nucleotide sequences encoding the first and second reporter proteins.
  • the first and second nucleotide sequence in the dicistronic reporter cassette are separated by an intercistronic sequence, which facilitates the introduction and operative linkage of an oligonucleotide sequence to be examined for IRES or other translational regulatory activity.
  • the intercistronic spacer nucleotide sequence generally contains a site for cloning the oligonucleotide sequence to be examined for translational regulatory activity, particularly IRES activity, in a position to effect translation of the second cistron.
  • the second nucleotide sequence of the dicistronic reporter cassette is located
  • Asoh et al. (Proc. Natl. Acad. Sci.. USA 91:6982-6986, 1994) described a technique for cloning random fragments of genomic DNA in a polyoma virus in order to up-regulate the expression of the large T antigen.
  • This assay for enhancer activity was based on the ability of the virus to replicate more efficiently, and the activity of putative enhancer elements was scored by increased neomycin resistance.
  • the rationale of this method is that an active enhancer sequence would increase the ability of an enhancerless polyoma virus to replicate, and this would be scored as a neomycin resistant cell.
  • the selection system of Asoh et al. differs from the present invention in that increased viral replication is selected for rather than enhanced transcription. Furthermore, there is no testing of these sequences for promoter activity in an independent system.
  • the CAST technique was one of the first methods used to isolate DNA binding sites from a pool of random DNA sequences using the gel mobility shift assay.
  • the MuST technique is a multiplex selection approach, in which a library of potential DNA binding elements that may function in gene transcription, is subjected to one or more rounds of protein binding using nuclear extracts from different mammalian cell types. This assay gives a profile of all the elements that are capable of binding nuclear factors and represents an extremely useful "up-front" procedure that would complement our selection approach.
  • the CAST and MuST techniques fall short of the presently disclosed methods in that CAST and MuST do not provide an activity assay to demonstrate whether the elements that are selected in such DNA binding procedures function to regulate transcription in the cells from which the nuclear extracts are prepared.
  • the FROGS technique is similar to CAST and MuST, exploiting the advantage of selecting only those elements that bind to proteins. As such, these methods do not test the selected elements for regulatory activity, and bias against finding elements that can function as regulatory elements, but do not actually bind to proteins.
  • NOMAD Rebatchouk et al., Proc. Acad. Natl. Sci.. USA
  • the NOMAD vector system provides an alternative to the disclosed successive element ligation procedure used to ligate promoter elements in a defined order and polarity.
  • Dirks et al. U.S. Pat. No. 6,060,273, describe methods and compositions for identifying IRES elements.
  • Dirks et al describe IRES nucleotide sequences of viral, cellular or synthetic origin, they appear to refer only to synthesized nucleotide sequences as compared to those isolated from a biological source, but do not disclose screening synthetic oligonucleotides such as a library of random oligonucleotides as disclosed herein.
  • Singer et al. (Genes Devel. 4:636-645, 1990) describe a method for selecting a basal promoter in yeast, but do not describe identifying cis enhancer elements or the use of the use of a method such as FACS sorting.
  • Bell et al. (Yeast 15:1747-1759, 1999) describe selection for yeast promoter using EGFP and FACS sorting, but do not describe screening random sequences for promoter activity.
  • a method of the invention can be useful for quickly and conveniently screening a large number of oligonucleotides to identify those having transcriptional or translational regulatory activity.
  • a library of randomized oligonucleotides can be cloned into multiple vectors comprising the dicistronic reporter cassette such that the oligonucleotides are operatively linked by insertion into the spacer sequence in a position to function as an IRES and initiate translation of the second reporter protein.
  • Eukaryotic cells can be transfected with the library of different vectors to form transfected eukaryotic host cells, in which the vector can integrate into the host cell genome and in which an oligonucleotide having IRES activity, for example, can effect the level of expression of the second reporter molecule.
  • Transfected cells expressing the reporter molecules then can be selected based on expression of the reporter molecule and the identified IRES oligonucleotide sequence can be isolated.
  • oligonucleotides identified herein as having transcriptional or translational regulatory activity provide modules that can be used alone or combined with each other to produce desired activities.
  • concatemers of the identified IRES elements can vastly increase polypeptide expression from an associated cistron, including concatemers of 2, 5, 10, 20, 35, 50 or 75 copies of an IRES element, which independently can be multiple copies of the same or different IRES elements, and which can be operatively linked adjacent to each other or separated by spacer nucleotide sequences that can vary from 1 to about 100 nucleotides in length.
  • spacer nucleotide sequences can vary from 1 to about 100 nucleotides in length.
  • the capacity to drive high levels of protein expression has many applications for large scale protein production as, for example, in bulk manufacturing of drugs such as those produced in the biotechnology industry, nutritional proteins, industrial enzymes, and the like.
  • IRES elements can be used to co-express proteins in a cell.
  • a dicistronic construct can contain a first cistron that encodes a polypeptide of interest such as a polypeptide drug or the like and a second cistron encoding a reporter polypeptide, which is expressed from an IRES element.
  • a construct provides a means to select cells that contain the first cistron, which encodes the polypeptide of interest, thus minimizing the presence of contaminating cells that do not express the polypeptide and facilitating isolation of the polypeptide.
  • the disclosed elements also can bind to cellular factors, for example, an IRES element can bind ribosomes in a cell, thus modifying or inhibiting its translational activity.
  • the elements can be used to modulate (or inhibit) transcription or translation of a gene product, for example, during an industrial process or as part of a therapeutic procedure.
  • the elements can be used as a genetic "toxin" to inhibit specific transcription or translation in a target cell.
  • introduction of a translational regulatory element identified according to a method of the invention as having translational enhancing activity can reduce the level of translation when introduced into a cell.
  • the element can bind to and sequester trans-acting translational regulatory factors such as eukaryotic initiation factors or the like, similar to effects seen with transcriptional regulatory elements when introduced into cells, or can bind to rRNA such that the rRNA is unavailable to effect translation.
  • translational regulatory element having translational enhancing activity or IRES activity into a eukaryotic cell, the translational activity in the eukaryotic cell can be reduced or inhibited.
  • translational activity in the cell is increased due, for example, to the sequestering of a trans-acting factor that otherwise binds to an endogenous translational inliibitory sequence in the cell to inhibit translation.
  • a dicistronic reporter cassette can be used for identifying a transcriptional or translational regulatory element, depending on the particular configuration as disclosed herein.
  • the dicistronic reporter cassette can contain a defined IRES element in the intercistronic spacer sequence, and the dicistronic reporter cassette is operatively linked, generally, to a minimal promoter element such that, upon introduction of a nucleotide sequence having transcriptional regulatory activity, transcription of the dicistronic cassette occurs.
  • the level of transcription can increase due to the oligonucleotide or can decrease due to the oligonucleotide. Since the promoter for the dicistronic reporter cassette is a minimal promoter, it can be difficult to identify a decrease in transcriptional activity due to the oligonucleotide.
  • the ability of the oligonucleotide to decrease transcriptional activity can be confirmed by examining the effect of the oligonucleotide on a corresponding construct having a strong promoter, for example, an RSV promoter, in place of the minimal promoter.
  • a strong promoter for example, an RSV promoter
  • the dicistronic reporter cassette is operatively linked, generally, to a strong promoter, and the oligonucleotide sequence to be examined for IRES activity is introduced into the spacer sequence between the first and second cistron.
  • a dicistronic reporter cassette allows for the sequential selection of cells expressing the first reporter molecule, followed by selection of cells expressing the second reporter molecule provides an additional level of confirmation that regulation of expression arises due to the contribution of the regulatory oligonucleotide and not, for example, due to an artifact, such as rearrangement of the vector sequences during transfection to produce a functional promoter or functional IRES, or other event that can lead to expression of the reporter molecule outside the control of the introduced regulatory oligonucleotide and the promoter element of the vector.
  • a dicistronic reporter cassette for identifying a transcriptional regulatory element can allow for antibiotic selection (puromycin) as a first (or second) reporter selection, followed (or preceded) by fluorescence-activated cell sorting (FACS) selection using a fluorescent reporter such as enhanced green fluorescent protein (EGFP).
  • FACS fluorescence-activated cell sorting
  • a dicistronic reporter cassette for identifying an IRES element can allow for FACS with EGFP as a first reporter selection, followed by a second FACS selection using enhanced cyan fluorescent protein
  • reporter molecules are disclosed herein or can otherwise be selected by the skilled artisan depending, for example, on cost, convenience or availability of the reporter molecule or the means for identifying (detecting) its expression.
  • a synthetic transcriptional or translational regulatory element can be identified by screening, for example, a library of oligonucleotides containing a large number of different nucleotide sequences.
  • the oligonucleotides can be variegated oligonucleotide sequences, which are based on but different from a known transcriptional or translational regulatory element, for example, an oligonucleotide complementary to an un-base paired sequence of a rRNA, or can be a random oligonucleotide library.
  • the use of randomized oligonucleotides provides the advantage that no prior knowledge is required of the nucleotide sequence, and provides the additional advantage that completely new regulatory elements can be identified.
  • a regulatory element can be of various lengths from a few nucleotides to several hundred nucleotides.
  • the length of an oligonucleotide in a library of oligonucleotides to be screened can be any length, including oligonucleotides as short as about 6 nucleotides or as long as about 100 nucleotides or more.
  • the oligonucleotides to be examined are about 6, 12, 18, 30 nucleotides or the like in length.
  • the complexity of the library i.e., the number of unique members, also can vary, although preferably the library has a high complexity so as to increase the likelihood that regulatory sequences are present.
  • Libraries can be made using any method known in the art, including, for example, using a oligonucleotide synthesizer and standard oligonucleotide synthetic chemistry.
  • the library complexity depends in part on the size of the expression vector population being used to clone the random library and transfect cells.
  • a theoretical limitation for the complexity of the library also relates to utilization of the library content by the recipient expression vector and by th ⁇ transfected cells, as well as by the complexity that can be obtained using a particular method of oligonucleotide synthesis.
  • a reporter cassette useful for identifying a transcriptional or translational regulatory element is a module that includes one or more nucleotide sequences encoding one or more reporter molecules, respectively.
  • the reporter cassette is operatively linked to an adjacent regulatory cassette such that expression of the reporter cassette is under the control of the regulatory cassette.
  • the term "cassette” is used herein to refer to a nucleotide sequence that can be easily and conveniently manipulated by recombinant DNA methods such that it can be linked, including operatively linked, to one or more other nucleotide sequences or can be inserted into or removed from a vector.
  • a cassette can include restriction endonuclease recognition and cleavage sites or recombinase recognition and cleavage sites, which provide a means for conveniently manipulating the cassette, for example, by insertion into a vector.
  • reporter cassette refers to a nucleotide sequence that includes the signals for encoding a complete reporter gene product, including the signals for initiation of translation, nucleotides encoding the structural protein, translation termination codons, and 3' sequence information to ensure a functional mRNA transcript can be produced following activation of transcription of a mRNA.
  • a reporter cassette can be monocistronic, wherein it encodes a single reporter molecule, can be dicistronic, wherein it encodes two reporter molecules, or polycistronic, wherein it contains more than two cistrons.
  • the reporter cassette generally is monocistronic or dicistronic and, when dicistronic, contains an IRES element in the intercistronic spacer sequence between the cistrons encoding the reporter molecules.
  • the reporter cassette generally is a dicistronic reporter cassette, wherein the oligonucleotide to be examined for IRES activity is introduced into the intercistronic spacer sequence, which otherwise lacks an IRES element.
  • the second nucleotide sequence encoding a second reporter protein is operatively linked to the first nucleotide sequence encoding the first reporter protein.
  • the first and second coding sequences are separated by an intercistronic spacer nucleotide sequence, into which an oligonucleotide sequence to be examined for IRES activity can be introduced in operative linkage to the second coding sequence.
  • An oligonucleotide to be examined for transcriptional or translational regulatory element can be operatively linked, as appropriate, using any recombinant DNA methodology for combining nucleotide sequences.
  • the method can vary depending upon the particular nucleotide sequences, including whether the cassettes are contained within a vector.
  • Particularly useful methods for inserting an oligonucleotide in operative linkage include the use of restriction endonucleases, for example, by including a restriction endonuclease recognition site or multiple cloning site in appropriate proximity to the regulatory or reporter cassette of interest and flanking the oligonucleotide to be introduced therein, or by including a site specific recombinase recognition site such as a topoisomerase recognition site, a lox site, or an att site at the appropriate location.
  • restriction endonucleases for example, by including a restriction endonuclease recognition site or multiple cloning site in appropriate proximity to the regulatory or reporter cassette of interest and flanking the oligonucleotide to be introduced therein, or by including a site specific recombinase recognition site such as a topoisomerase recognition site, a lox site, or an att site at the appropriate location.
  • the oligonucleotide can be operatively linked with respect to the regulatory and reporter cassettes.
  • the reporter molecules generally are polypeptides that can be expressed under the conditions of the assay being utilized and the expression of which is detectable. Where a method of the invention is performed in a cell, for example, the reporter molecule can confer a detectable or selectable phenotype on cells expressing the molecule. In a method utilizing a dicistronic reporter cassette, the encoded first and second reporter proteins generally are different from each other, thus providing independent selection criteria.
  • Reporter molecules also referred to as selectable markers, are well known in the art and include, a fluorescent protein such as green fluorescent protein (GFP) and enhanced and modified forms of GFP; an enzyme such ⁇ -galactosidase, chloramphenicol acetyltransferase, luciferase, or alkaline phosphatase; an antibiotic resistance protein such as puromycin N-acetyltransferase, hygromycin B phosphotransferase, neomycin (aminoglycoside) phosphotransferase, or the Zeocin R gene product (Stratagene); a cell surface protein marker such as N-CAM or a polypeptide that is expressed on a cell surface and has been modified to contain a tag peptide such as a polyhistidine sequence (e.g., hexahistidine), a V5 epitope, a c-myc epitope; a hemagglutinin A epitope
  • reporter molecule expression of the reporter molecule can be detected using the appropriate reagent, for example, by detecting light emission upon addition of luciferin to a luciferase reporter molecule, or by detecting binding of nickel ion to a polypeptide containing a polyhistidine tag. Furthermore, the reporter molecule can provide a means of isolating the expressed reporter molecule or a cell expressing the reporter molecule.
  • an anti-c-myc epitope antibody can be immobilized on a solid matrix and cells, some of which express the tagged polypeptide, can be contacted with the matrix under conditions that allow selective binding of the antibody to the epitope. Unbound cells can be removed by washing the matrix, and bound cells, which express the reporter molecule, can be eluted and collected.
  • Fluorescent reporter markers are particularly convenient for use in the compositions and methods of the invention because they allow the selection of cells containing the expressed reporter protein by fluorescence activated cell sorting (FACS). Similarly, proteins that confer antibiotic resistance are particularly useful as selectable markers because only cells expressing the antibiotic resistance protein can survive exposure to the particular antibiotic.
  • Cell surface protein markers which are expressed on the surface of a eukaryotic cell, represent a large class of proteins suitable for use as reporter proteins in the present invention. The surface marker can be selected, for example, using an antibody specific for the protein, or using a ligand (or receptor) that specifically interacts with and binds to the cognate cell surface receptor (or ligand).
  • Cells expressing a cell surface marker can be isolated, for example, by a panning method, which utilizes immobilized antibodies (or ligands or receptors) that selectively bind to the cell surface marker, or by a FACS method, in which case the antibody or ligand is fluorescently labeled and, therefore, labels the cell expressing the cell surface marker by specifically binding to the marker.
  • the cell adhesion molecule, N-CAM is an example of a cell surface marker useful according to the present invention.
  • a reporter cassette can be operatively linked to a regulatory cassette, thereby providing a construct useful for identifying a transcriptional or translational regulatory element according to a method of the invention.
  • a regulatory cassette refers to a nucleotide sequence required for transcription of a reporter cassette.
  • a regulatory cassette generally includes a promoter element, which can be a minimal promoter or strong promoter depending on the purpose for which a construct comprising the regulatory cassette is to be used, and can contain additional transcriptional regulatory elements, provided that the elements of the regulatory cassette do not interfere with the use of a construct comprising the regulatory cassette to identify a regulatory element according to a method of the invention.
  • a regulatory cassette useful in a method of identifying a transcriptional regulatory element is a nucleotide sequence comprising a minimal promoter element.
  • the regulatory cassette can contain a sequence that facilitates introduction of an oligonucleotide to be examined for transcriptional activity into the regulatory cassette in an operatively linked manner.
  • Such a sequence can be a restriction endonuclease recognition site, recombinase recognition site, and the like.
  • a minimal promoter is a nucleotide sequence that allows initiation of transcription by RNA polymerase II, and can be up-regulated by operative linkage of a regulatory element, particularly an oligonucleotide transcriptional regulatory element according to the present invention.
  • the regulatory cassette and operatively linked reporter cassette can be in an isolated form, or can be contained in a vector.
  • a regulatory cassette useful in a method of identifying an IRES element is a nucleotide sequence comprising a promoter element.
  • the promoter in such a regulatory element is a strong promoter, and preferably the construct comprising the regulatory cassette and operatively linked reporter cassette is contained in a vector. Since an oligonucleotide to be examined for translational regulatory activity must be transcribed, a site for introducing the oligonucleotide into the regulatory cassette/reporter cassette construct is positioned downstream of the transcription start site and, in one embodiment, is positioned in an intercistronic spacer sequence of a dicistronic reporter cassette.
  • An oligonucleotide having IRES activity generally is positioned in an intercistronic position, from which it can exert its translational activity, and, as disclosed herein, can be at various distances from the translation start site of the second cistron.
  • An oligonucleotide to be examined for IRES activity can be many hundreds of nucleotides from the transcriptional promoter, which generally is positioned upstream (5') of the first cistron of a dicistronic reporter cassette. As such, it should be recognized that such an oligonucleotide to be examined for translational regulatory activity is operatively linked to the second cistron such that an oligonucleotide having IRES activity can be identified by its effecting translation of the second cistron.
  • a promoter element generally acts as a substrate for RNA polymerase II, in combination with additional protein factors, to initiate transcription.
  • promoters useful in a regulatory cassette as disclosed herein include the adenovirus promoter TATA box, an SP1 site (GGGCGG; SEQ ID NO: 4), a minimal enkephalin gene promoter (MEK), an SV40 early minimal promoter, a TRE/AP- 1 element (TGACTCA; SEQ ID NO: 5), an erythroid cell GAT A element (GATAGA; SEQ ID NO: 6), a myeloid tumor element NF-KB binding site (GGGAATTCCCC; SEQ ID NO: 7), a cyclic AMP response element (TGACGTCA; SEQ ID NO: 8), and the like.
  • an active transcriptional promoter can comprise a variety of elements
  • the present invention can involve the use of a regulatory cassette with additional features so as to preferentially select regulatory oligonucleotides having an activity that depends upon the included feature.
  • the regulatory cassette can include a consensus transcription initiator sequence, or can include a transcription initiator sequence derived from a tissue specific gene, thereby increasing the tissue specificity of the selected regulatory oligonucleotide.
  • a construct comprising a regulatory cassette operatively linked to a reporter cassette is useful for identifying transcriptional and translational regulatory elements.
  • the construct is contained in a vector, which generally is an expression vector that contains certain components, but otherwise can vary widely in sequence and in functional element content.
  • the vector contains a reporter cassette, which can be a dicistronic reporter cassette, operatively linked to a regulatory cassette, which contains a minimal promoter element or a strong promoter element, depending on the specific type of regulatory element that is to be identified.
  • the vector also can contain sequences that facilitate recombinant DNA manipulations, including, for example, elements that allow propagation of the vector in a particular host cell (e.g., a bacterial cell, insect cell or mammalian cell), selection of cells containing the vector (e.g., antibiotic resistance genes for selection in bacterial or mammalian cells), and cloning sites for introduction of reporter genes or the elements to be examined (e.g., restriction endonuclease sites or recombinase recognition sites).
  • elements that allow propagation of the vector in a particular host cell e.g., a bacterial cell, insect cell or mammalian cell
  • selection of cells containing the vector e.g., antibiotic resistance genes for selection in bacterial or mammalian cells
  • cloning sites for introduction of reporter genes or the elements to be examined e.g., restriction endonuclease sites or recombinase recognition sites.
  • the regulatory cassette and operatively linked reporter cassette which can be monocistronic or dicistronic, are contained in an expression vector that is characterized, in part, in that it can integrate into a eukaryotic chromosome.
  • a construct provides the advantage that the activity of an oligonucleotide can be examined in the context or milieu of the whole eukaryotic chromosome.
  • a chromosome offers unique and complex regulatory features with respect to the control of gene expression, including translation. As such, it is advantageous to have a system and method for obtaining regulatory oligonucleotides that function in the context of a chromosome.
  • a method of the invention can be practiced such that integration of the expression vector into the eukaryotic host cell chromosome occurs, forming a stable construct prior to selection for an expressed reporter molecule.
  • a system provides a means to identify a regulatory element that effects its activity due, for example, to a confbrmational change in a chromosome such as a nucleosome unwinding or DNA bending event.
  • a construct comprising a regulatory cassette operatively linked to a reporter cassette, which can be contained in a vector, can be integrated into a chromosome by a variety of methods and under a variety of conditions.
  • the present invention should not be construed as limited to the exemplified methods, for example, the use of an integrating retroviral vector Shotgun transfection, for example, can result in stable integration if selection pressure is maintained upon the transfected cell through several generations of cell division, during which time the transfected nucleic acid construct becomes stably integrated into the cell genome.
  • Directional vectors which can integrate into a host cell chromosome and form a stable integrant, also can be used.
  • vectors can be based on targeted homologous recombination, which restricts the site of integration to regions of the chromosome having the homology, and can be based on viral vectors, which can randomly associate with the chromosome and form a stable integrant, or can utilize site specific recombination methods and reagents such as a lox-Cre system and the like.
  • Shotgun transfections can be accomplished by a variety of well known methods, including, for example, electroporation, calcium phosphate mediated transfection, DEAE dextran mediated transfection, a biolistic method, a lipofectin method, and the like.
  • the culture conditions are maintained for several generations of cell division to ensure that a stable integration has resulted and, generally, a selective pressure also is applied.
  • a viral vector based integration method also can be used and provides the advantage that the method is more rapid and establishes a stable integration by the first generation of cell division.
  • a viral vector based integration also provides the advantage that the transfection (infection) can be performed at a low vector. ell ratio, which increases the probability of single copy transfection of the cell.
  • a single copy expression vector in the cell during selection increases the reliability that an observed regulatory activity is due to a particular oligonucleotide, and facilitates isolation of such an oligonucleotides.
  • a type C retrovirus viral vector is particularly useful for practicing a method of the invention.
  • retroviral systems for infecting cells with genes There are a variety of retroviral systems for infecting cells with genes.
  • the production of recombinant retrovirus particles suitable for the introducing the expression vectors described herein are well known, and exemplary methods are described by Pear et al., Proc. Natl. Acad. Sci.. USA. 90:8392-8396, 1993; Owens et al., Cancer Res.. 58:2020-2028, 1998; and Gerstmayer et al., J. Virol. Meth.. 81:71-
  • Additional viral vectors suitable for use in the present invention include the lentivirus vector described by
  • the invention also provides an isolated synthetic regulatory oligonucleotide having transcriptional or translational regulatory activity.
  • Such an oligonucleotide can be used in a variety of gene expression configurations for regulating control of expression.
  • a synthetic transcriptional regulatory oligonucleotide which can be obtained by a method of the invention, can increase (enhance) or decrease (silence) the level of expression of a recombinant expression construct when operatively linked to a regulatory cassette comprising a minimal or other promoter element.
  • the regulatory oligonucleotide selectively regulates expression in a context specific manner, including, for example, in a cell or tissue specific manner, or with respect to a particular promoter or other effector sequences associated with a promoter.
  • a synthetic translational regulatory oligonucleotide which can be obtained using a method of the invention, can increase or decrease the level of translation of an mRNA containing the oligonucleotide, and can have IRES activity, thereby allowing cap-independent translation of the mRNA.
  • a translational regulatory oligonucleotide can selectively regulate translation in a context specific manner, depending, for example, on the cell type for expression, the nature of the IRES sequence, or the presence of other effector sequences in the expression construct.
  • the present invention provides an isolated synthetic transcriptional or translational regulatory oligonucleotide, which can be identified using the methods disclosed herein.
  • isolated when used in reference to a regulatory oligonucleotide, indicates that the nucleotide sequence is in a form other than the form in which it is found in nature.
  • an isolated regulatory oligonucleotide is separated, for example, from a gene in which it normally can be found in nature, and particularly from a chromosome in a cell.
  • the regulatory oligonucleotide can comprise additional nucleotide or other sequences, yet still be considered “isolated” provided the construct comprising the regulatory oligonucleotide is not in a form that is found in nature.
  • the oligonucleotide can be contained within a cloning vector or and expression vector, or can be operatively linked to a second nucleotide sequence, for example, another regulatory element or an expressible polynucleotide.
  • a regulatory oligonucleotide as disclosed herein also is referred to generally as a synthetic regulatory oligonucleotide, for example, a synthetic IRES.
  • synthetic indicates that oligonucleotides that can be screened using the disclosed methods can be produced using routine chemical or biochemical methods of nucleic acid synthesis. It should be recognized, however, that screening of synthetic randomized oligonucleotide libraries can identify regulatory elements that correspond to portions of nucleotide sequences found in genes in nature. Nevertheless, such oligonucleotides generally are present in an isolated form and, therefore, cannot be construed to be products of nature.
  • the methods of the invention can identify previously known regulatory element, including, for example, binding sites for the transcription factors SP1, API, NF- ⁇ B, CREB, zeste and glucocorticoid receptor (see Tables 1 and 2). It should be recognized that such previously known regulatory elements are not considered to be within the scope of compositions encompassed within the present invention.
  • oligonucleotide is used broadly herein to mean a sequence of two or more deoxyribonucleotides or ribonucleotides that are linked together by a phosphodiester bond.
  • the terms include RNA and DNA, which can be a gene or a portion thereof, a cDNA, a synthetic polydeoxyribonucleic acid sequence or polyribonucleic acid sequence, or the like, and can be single stranded or double stranded, as well as a DNA/RNA hybrid.
  • oligonucleotide include naturally occurring nucleic acid molecules, which can be isolated from a cell, as well as synthetic molecules, which can be prepared, for example, by methods of chemical synthesis or by enzymatic methods such as by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • Synthetic methods for preparing a nucleotide sequence include, for example, the phosphotriester and phosphodiester methods (see Narang et al., Meth. Enzymol. 68:90, (1979); U.S. Pat. No. 4,356,270, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,416,988, U.S. Pat. No. 4,293,652; and Brown et al, Meth. Enzymol. 68:109, (1979), each of which is incorporated herein by reference).
  • an oligonucleotide of the invention or a polynucleotide useful in a method of the invention can contain nucleoside or nucleotide analogs, or a backbone bond other than a phosphodiester bond.
  • oligonucleotide generally is used to refer to a nucleotide sequence that is being examined for transcriptional or translational regulatory activity
  • polynucleotide or “nucleotide sequence” generally refers to a sequence that encodes a peptide or polypeptide, acts as or encodes a desired regulatory element, provides a spacer sequence or cloning site, or the like. It should be recognized, however, that such a use only is for convenience and is not intended to suggest any particular length or other physical, chemical, or biological characteristic of the nucleic acid molecule.
  • the nucleotides comprising an oligonucleotide generally are naturally occurring deoxyribonucleotides, such as adenine, cytosine, guanine or thymine linked to 2'-deoxyribose, or ribonucleotides such as adenine, cytosine, guanine or uracil linked to ribose.
  • a polynucleotide also can contain nucleotide analogs, including non-naturally occurring synthetic nucleotides or modified naturally occurring nucleotides.
  • nucleotide analogs are well known in the art and commercially available, as are polynucleotides containing such nucleotide analogs (Lin et al., Nucl. Acids Res. 22:5220-5234 (1994); Jellinek et al, Biochemistry 34:11363-11372 (1995); Pagratis et al., Nature Biotechnol. 15:68-73
  • the covalent bond linking the nucleotides of an oligonucleotide or polynucleotide generally is a phosphodiester bond.
  • the covalent bond also can be any of numerous other bonds, including a thiodiester bond, a phosphorothioate bond, a peptide-like bond or any other bond known to those in the art as useful for linking nucleotides to produce synthetic polynucleotides (see, for example, Tarn et al., Nucl. Acids Res. 22:977-986 (1994); Ecker and Crooke, BioTechnology 13:351360 (1995), each of which is incorporated herein by reference).
  • nucleotide sequence is to be exposed to an environment that can contain a nucleolytic activity, including, for example, a tissue culture medium or upon administration to a living subject, since the modified nucleotide sequences can be less susceptible to degradation.
  • a polynucleotide comprising naturally occurring nucleotides and phosphodiester bonds can be chemically synthesized or can be produced using recombinant DNA methods, using an appropriate polynucleotide as a template.
  • a polynucleotide comprising nucleotide analogs or covalent bonds other than phosphodiester bonds generally are chemically synthesized, although an enzyme such as T7 polymerase can incorporate certain types of nucleotide analogs into a polynucleotide and, therefore, can be used to produce such a polynucleotide recombinantly from an appropriate template (Jellinek et al., supra, 1995).
  • the present invention also provides an expression vector, which is useful for identifying a transcriptional or translational regulatory oligonucleotide according to the present invention.
  • a vector useful for identifying a transcriptional regulatory oligonucleotide generally contains a reporter cassette, which includes a nucleotide sequence encoding at least one reporter molecule, and a regulatory cassette, which is operatively linked to the reporter cassette and comprises a minimal promoter element.
  • the construct comprising the regulatory and reporter cassettes also generally contains a site for introducing an oligonucleotide to be examined for transcriptional or translational regulatory activity into the construct in an operatively linked manner.
  • the reporter cassette generally does not contain a promoter for regulating transcription of the reporter gene, and the regulatory cassette generally is operatively linked to the reporter cassette such that expression of the reporter gene is regulated by the regulatory cassette.
  • the reporter cassette comprises a dicistronic construct, which includes first and second cistrons, which encode two different reporter molecules.
  • the nucleotide sequences encoding the first and second reporter molecules are operatively linked by a spacer nucleotide sequence that contains an IRES, or contains a site that facilitates insertion of an oligonucleotide to be examined for IRES activity in an operatively linked manner.
  • a vector useful for identifying an oligonucleotide having IRES activity generally contains a dicistronic reporter cassette, which includes first and second nucleotide sequences that encode respective first and second reporter proteins, and a regulatory cassette operatively linked to the dicistronic reporter cassette.
  • the dicistronic reporter cassette further contains an intervening (intercistronic) spacer nucleotide sequence between the first and second encoding nucleotide sequences;
  • the spacer nucleotide sequence generally contains a sequence that facilitates insertion of an oligonucleotide to be examined for IRES activity, for example, a cloning site, generally a multiple cloning site comprising one or more unique restriction enzyme recognition sites or a recombinase recognition site to facilitate insertion of the oligonucleotide sequence.
  • a vector is useful for identifying an IRES by detecting a change in the level of expression of the second reporter.
  • an IRES also can have translational enhancing activity or translation inhibitory activity, which can be conveniently detected using a monocistronic reporter cassette and detecting an increased or decreased level of translation, respectively, due to the oligonucleotide comprising the IRES.
  • the expression vector is an integrating expression vector, which comprises nucleotide sequences that provide a means for stable integration of the regulatory and reporter cassettes into a chromosome of a eukaryotic host cell.
  • Sequence elements that facilitate stable integration are disclosed herein or otherwise known in the art. Stable integration is conveniently effected using a retroviral based expression vector having the elements to facilitate packaging into an infectious retroviral particle and the elements to facilitate stable integration.
  • the packaging elements comprise a truncated gag gene comprising sequences required for retrovirus packaging located within the expression vector nucleotide sequence, and the integration elements which comprise and upstream long terminal repeat (LTR) and downstream LTR elements positioned at the respective upstream and downstream flank of the packaging element and the regulatory/reporter cassette elements.
  • the upstream LTR preferably comprises an immediate early gene promoter, an R region, and a U5 region, as are well known in the retroviral and expression vector arts.
  • An integrating expression vector useful for identifying a transcriptional regulatory oligonucleotide generally contains an immediate early gene promoter that is derived from Rous sarcoma virus or cytomegalovirus, and the downstream LTR generally comprises a consensus transcription initiator sequence. Integrating expression vectors such as MESVR/EGFP*/IRES ⁇ acPro(ori) (SEQ ID NO: 1) and MESVR/EGFP*/IRESNCAMPro(ori) (SEQ ID NO: 9) as disclosed herein provide examples of integrating expression vectors useful for identifying a transcriptional regulatory oligonucleotide.
  • cassettes in the exemplified vectors can be substituted with other cassettes encoding, for example, reporter molecules having a desired characteristic, or comprising a desired promoter, enhancer, silencer or other regulatory element; or can be modified to contain a desirable cloning site, for example, by substituting a restriction endonuclease recognition site or multiple cloning site with a recombinase recognition site.
  • An integrating expression vector useful for identifying an oligonucleotide having IRES activity also generally contains an immediate early gene promoter that is derived from Rous sarcoma virus or cytomegalovirus, and the downstream LTR generally comprises a consensus transcription initiator sequence.
  • An integrating expression vector such as MES VR/EGFP/ECFP/RSVPro (SEQ ID NO: 109) provides an example of an integrating expression vector useful for identifying an oligonucleotide having IRES activity.
  • SEQ ID NO: 109 provides an example of an integrating expression vector useful for identifying an oligonucleotide having IRES activity.
  • various modifications and substitutions to the exemplified vector readily can be made using routine methods and commercially available reagents.
  • the present invention also provides a recombinant nucleic acid molecule comprising a transcriptional or translational regulatory element of the invention linked to a second heterologous polynucleotide.
  • second is used herein in reference to a nucleotide sequence only to distinguish it from the nucleotide sequence comprising the regulatory oligonucleotide.
  • heterologous is used herein in a relative sense to indicate that the second nucleotide sequence is not normally associated with the oligonucleotide comprising regulatory element in nature (where the synthetic regulatory element corresponds to a regulatory element that exists in nature) or, if it is associated with the regulatory element in nature, is linked to the regulatory element such that the recombinant nucleic acid molecule is different from the corresponding sequence that exists in nature.
  • the second heterologous polynucleotide can be an expressible polynucleotide, which can encode an RNA of interest such as an antisense RNA molecule or a ribosome, or can encode a polypeptide of interest, for example, a polypeptide to be expressed pursuant to a gene therapy procedure.
  • the heterologous polynucleotide is an expressible polynucleotide, it generally is operatively linked to the synthetic regulatory oligonucleotide such that the oligonucleotide can effect its regulatory activity.
  • the second heterologous polynucleotide also can comprise or encode one or more additional regulatory element, which can be known promoter, enhancer, silencer or translational regulatory elements, including such elements that have been identified according to a method of the invention.
  • additional regulatory element can be known promoter, enhancer, silencer or translational regulatory elements, including such elements that have been identified according to a method of the invention.
  • a recombinant nucleic acid molecule comprising such a combination of regulatory elements can be useful for selectively expressing an RNA or polypeptide in a cell, which can be only one or a few different types of cell or any cell, and can be constitutively or inducibly expressed at a desired level.
  • the second heterologous polynucleotide also can be a vector, which can be a plasmid vector, viral vector or the like. Accordingly, the present invention also provides a vector comprising a regulatory oligonucleotide of the invention. Insofar as a regulatory oligonucleotide of the invention can be utilized in a variety of configurations for regulating gene expression or protein translation, the general structure of a vector of the invention requires only that it contain a regulatory oligonucleotide as disclosed herein.
  • the vector also can contain nucleotides sequences that facilitate the introduction of an expressible polynucleotide or other nucleotide sequence into the vector, particularly such that it is operatively linked to the regulatory oligonucleotide.
  • the vector also can contain other elements commonly contained in a vector, for example, an bacterial origin or replication, an antibiotic resistance gene for selection in bacteria, or corresponding elements for growing and selecting the vector in a eukaryotic cell.
  • the synthetic regulatory element in a vector can be designed such that it can readily be removed from the vector, for example, by treatment with a restriction endonuclease.
  • a characteristic provides a means for developing a system comprising a vector and a plurality of synthetic regulatory oligonucleotides of the invention, any of which alone or in combination can be inserted into the vector.
  • the present invention also provides a system, which can be in kit form, that provides one or more regulatory oligonucleotide sequences of the invention.
  • a kit of the invention can contain a packaging material, for example, a container having a regulatory oligonucleotide according to the invention and a label that indicates uses of the oligonucleotide for regulating transcription or translation of a polynucleotide in an expression vector or other expression construct.
  • the system preferably in kit form, provides an integrating expression vector for use in selecting a regulatory oligonucleotide using a method as disclosed herein.
  • a kit can contain a packaging material, which comprises, a container having an integrating expression vector and a label that indicates uses of the vector for selecting oligonucleotide sequences capable of regulatory function.
  • kits of the invention Such instructions for use generally include a tangible expression describing the components, for example, a regulatory oligonucleotide, including its concentration and sequence characteristics, and can include a method parameter such as the manner by which the reagent can by utilized for its intended purpose.
  • the reagents, including the oligonucleotide, which can be contained in a vector or operably linked to an expressible polynucleotide, can be provided in solution, as a liquid dispersion, or as a substantially dry power, for example, in a lyophilized form.
  • the packaging materials can be any materials customarily utilized in kits or systems, for example, materials that facilitate manipulation of the regulatory oligonucleotides and, if present, of the vector, which can be an expression vector.
  • the package can be any type of package, including a solid matrix or material such as glass, plastic (e.g., polyethylene, polypropylene and polycarbonate), paper, foil, or the like, which can hold within fixed limits a reagent such as a regulatory oligonucleotide or vector.
  • a package can be a bottle, vial, plastic and plastic-foil laminated envelope, or the like container used to contain a contemplated reagent.
  • the package also can comprise one or more containers for holding different components of the kit.
  • a promoter element proviral vector library was constructed using the retroviral-mediated EGFP/FACS selection strategy for synthetic promoter elements according to the disclosed methods.
  • a library of promoter elements random 18mers;
  • Rani 8 was constructed in the proviral selection vector, which was packaged into retroviral particles in COSl cells.
  • the retroviral particles were harvested and used to infect target cells, which were then treated for 3 days with puromycin to kill uninfected or poorly expressing cells.
  • the surviving cells were subjected to FACS analysis and the most highly fluorescent cells collected.
  • Genomic DNA was prepared from these cells and the regulatory oligonucleotides were recovered by PCR and direct sequencing.
  • the elements then were religated into the proviral vector for a second round of selection. Finally the elements were ligated into the pLuc luciferase reporter vector and the activities of the elements was quantitated by luciferase assay.
  • Such a method involves the generation of several million enhancer/promoter cassettes, and testing their transcriptional activity in mammalian cell culture.
  • a library of element cassettes was ligated immediately upstream of a minimal promoter unit that contains a TATA box and an initiator sequence in a selection vector (see below; see, also, Figure 1).
  • a selection vector was designed based on a retrovirus.
  • the use of a retroviral delivery system has three advantages over a plasmid based system: 1) the introduction of the constructs into cells by retroviral infection is extremely efficient; 2) on average each cell receives only one promoter construct; and 3) the introduced construct is stably integrated into the cellular genome.
  • proviral vector Production of retroviruses from a proviral vector (packaging) was achieved by transfecting the proviral vector into cells together with helper plasmids that encode the packaging functions.
  • the promoter element library that was constructed in a proviral vector was packaged into retroviruses by transfection into COSl cells. These viruses were then used to infect the target cells.
  • Each synthetic promoter element cassette in the proviral promoter element library was linked to a reporter cassette that reports on its activity after integration into the genome of the target cell.
  • the reporter cassette contained nucleotide sequences encoding enhanced green fluorescent protein (EGFP) and puromycin N-acetyltransferase (pac), arranged in a dicistronic construct that allows two separate gene products to be expressed from a single mRNA that is driven by a single promoter. This arrangement enabled selection of synthetic promoters using fluorescent activated cell sorting (FACS) and resistance to puromycin.
  • EGFP enhanced green fluorescent protein
  • pac puromycin N-acetyltransferase
  • each promoter was scored for its transcriptional activity by examining the activity of the reporter gene EGFP.
  • each cell generally received only one promoter cassette. After 2 to 3 days of infection by the retroviruses, uninfected cells were removed by treatment them with puromycin, then the surviving cells were subjected to FACS analysis and cells having the most active promoters were selected.
  • the level of EGFP expression in each cell reflects the strength of an individual synthetic promoter element cassette, such that highly fluorescent cells are likely to contain highly active promoter elements.
  • the promoters were amplified from the cellular genome using the polymerase chain reaction (PCR) and subjected to automated DNA sequencing to determine the identity of each of the synthetic promoter elements.
  • the activity of the regulatory cassette was confirmed using a luciferase reporter system that is more amenable to quantitation of promoter activity levels.
  • each synthetic promoter/luciferase plasmid was independently transfected into the cell line in which the initial selection was performed (e.g. Neuro2A neuroblastoma cells) and luciferase activity was measured using standard methods.
  • a library of synthetic DNA sequences to be tested for transcriptional regulatory activity was generated and screened as described below.
  • the pool (library) of promoter elements containing random sequences or combinations of known motifs was ligated into a proviral selection vector generating a proviral promoter element library.
  • Any of at least three different types of libraries of oligonucleotides can be prepared and examined according to the disclosed methods.
  • One type of library consists of random sequences of a given length, for example, 18-mers, which are tested for their ability to enhance the activity of a minimal promoter such as a TATA motif and a site for the initiation of transcription.
  • Such a library which was examined as disclosed herein, has the potential to identify novel cis regulatory elements and transcription factors that bind to these elements.
  • a second type of library combines a random oligonucleotide sequence and a known regulatory motif, for example, a TPA responsive element (TRE; API binding site).
  • a known regulatory motif for example, a TPA responsive element (TRE; API binding site).
  • TRE TPA responsive element
  • a second type of library combines a random oligonucleotide sequence and a known regulatory motif, for example, a TPA responsive element (TRE; API binding site).
  • TRE TPA responsive element
  • a third type of library combines transcription factor binding sites already known to function in particular contexts of eukaryotic gene regulation, for example, the binding sites for Krox, paired domain (Pax) and AP-1 (TRE), which are present in naturally occurring neuronally-expressed genes.
  • Such a library can be used to establish rules and constraints that govern functional interactions between elements and their associated transcription factors. Construction of the library involves linking several elements together such that the order, number, and spacing of the elements are controlled, for example, the successive element ligation procedure as disclosed herein
  • a key feature of the synthetic transcriptional regulatory element methodology of the invention is the strategy for the selection of functional promoter elements.
  • a screening procedure strategy was devised that allows testing of random elements or combinations of elements for transcriptional modulating activity in mammalian cells.
  • Several key requirements necessary for successful selection of synthetic transcriptional regulatory elements in mammalian cells are 1) each cell should receive a single unique cassette to avoid selection of inactive elements that happen to be present in the same cell as an active element; 2) the synthetic elements should be shielded from the effects of genomic sequences that may activate or repress transcription; 3) the delivery system should be efficient so that a complex library can be readily screened; and 4) the selection process should be stringent and should be based on a reporter gene assay that is highly sensitive and that faithfully reports the activity of the promoter elements.
  • oligonucleotide A library of single stranded oligonucleotides containing eighteen randomized positions (A, C, G or T at each position) was synthesized on an Applied Biosystems DNA synthesizer. This portion of the oligonucleotide was designated Rani 8. Flanking the Ran 18 cassette were short regions of defined sequence, including recognition sequences for the restriction enzyme Mlu I, which allowed the cassette to be inserted into the MESV/IRES/EGFP/ ⁇ acPro(ori) proviral vector (SEQ ID NO: 1 ; see, also, Figure 1).
  • an additional primer that was complementary to the right flanking portion of the single stranded oligonucleotide was synthesized and annealed to the Rani 8 oligonucleotide.
  • Annealing was performed with equimolar amounts of the flanking primer and the RanlS oligonucleotide in a solution containing Tris-HCl (pH 7.5) and 1mm MgCl 2 at 100°C for 5 minutes, followed by slow cooling to room temperature.
  • the second strand was generated by primer extension using the Klenow fragment of DNA polymerase I and 50mM of dNTPs at 30°C.
  • the double stranded oligonucleotide was purified and digested with Mlu I at 37°C for 12 hr, and was purified by extraction from an 8% polyacrylamide gel.
  • the library of Rani 8 cassettes was ligated into the proviral vector at a 1 : 1 molar ratio of oligonucleotide to vector. Typically 0.5 to 2 ⁇ g of vector was used in each ligation in a volume of 100 ml.
  • DNA was purified using QiaQuick PCR purification columns (Qiagen) and the ligation mixture was used to transform frozen electrocompetent XL 1 -Blue E. coli cells (Stratagene) by electroporation. The transformation mix was plated onto 150 mm LB plate containing Ampicillin. Smaller aliquots of the transformation mix were plated onto 100mm plates and colonies were counted to determine the number of transformants per microgram of vector. Plasmid DNA from the library was prepared via standard procedures (Qiagen Maxi-plasmid
  • Retroviruses are extremely useful tools to deliver genes into eukaryotic cells both in culture and in whole animals.
  • most retroviral vectors are not tailored for tissue specific or developmental stage specific delivery of genes.
  • a benefit of screening a retroviral library for functional synthetic regulatory elements as disclosed herein is the potential to create novel retroviruses with extraordinarily target specificity.
  • Such vectors can be extremely useful for generating cell lines or transgenic animals for diagnostic screening procedures and drug development.
  • such vectors can be useful for gene therapy in humans.
  • a retrovirus is a single stranded RNA virus that infects a cell and integrates into the genome of a cell by copying itself into a double stranded DNA molecule by reverse transcription.
  • the integrated retrovirus genome is referred to as a provirus.
  • Retroviruses have a two stage life cycle, existing both an RNA and DNA form.
  • the RNA form of the virus is packaged into an infectious particle that is coated with a glycoprotein that is recognized by receptors on the host cell. This interaction promotes a receptor mediated internalization event, resulting in exceptionally efficient delivery of the viral genome into the cell.
  • the RNA genome is reverse transcribed into a DNA form (a provirus).
  • Retroviruses do not integrate in a completely random fashion, but instead have a distinct preference for integration into regions of the genome that are transcriptionally competent. This characteristic reduces the likelihood that the provirus will be silenced by integration into a transcriptionally repressive domain.
  • retrovirus the entire coding region of the virus is removed and replaced with a transgene. This replacement is done by standard molecular biological techniques using a proviral version of the virus that is propagated as a bacterial plasmid (a pro-retro viral vector).
  • pro-retro viral vector a pro-retro viral vector.
  • other sequences in the retrovirus genome are required for the functions of viral transcription and packaging: these genes encode the viral gag and pol proteins, and the viral glycoprotein coat.
  • sequences can be removed from the pro-retroviral plasmid, in order to obtain a fully functional recombinant virus, they must be provided in trans, for example, on other plasmids that are introduced into the host cell via cellular transfection.
  • these helper functions can be designed to already be integrated into the cellular genome of the viral packaging line.
  • Retroviruses have two viral promoters called long terminal repeats (LTRs), one located at each end of the viral genome.
  • the upstream LTR is responsible for promoting transcription of the DNA provirus into the RNA form.
  • the downstream LTR is not used for transcription during the RNA phase of the life cycle.
  • the downstream LTR provides a template for the replication of the upstream LTR.
  • native retroviruses contain identical sequences in their upstream and downstream LTRs.
  • Nucleotide sequences that encode enhanced green fluorescent protein (EGFP) and puromycin N-acetyltransferase (pac) were inserted into a retroviral vector (see below).
  • the two reporter genes are expressed as a single transcript, and are linked by an internal ribosome entry sequence (IRES). Expression of both reporter genes is controlled by the same promoter.
  • the upstream LTR was modified to contain a strong promoter from the Rous sarcoma virus (RSV), thus ensuring efficient transcription of the RNA viral genome and a high viral titer.
  • the downstream LTR was modified to contain a minimal synthetic promoter and a multiple cloning site for insertion of the Rani 8 elements. The downstream LTR is not used for transcription during the RNA phase of the lifecycle. However, during reverse transcription of the
  • the downstream LTR provides a template for the replication of the upstream LTR. From this position, the Rani 8/minimal promoter cassette can drive expression of the reporter genes in the integrated form of the virus.
  • the MESVR/EGFP*/IRESpacPro(ori) was based on MESV/TRESneo (Owens et al., supra, 1998), which, in turn, was based on the Murine Embryonic Stem cell Virus (MESV) retrovirus (Mooslehner et al., J. Virol.. 64:3056- 3058, 1990; Rohdekard et al., J. Virol.. 61:336-343, 1987, each of which is incorporated herein by reference).
  • MESV is a C-type retrovirus that was modified to remove sequences that are necessary for independent replication. Consequently, the virus can only replicate with the assistance of helper genes that encode the proteins required for viral genome packaging and insertion into the host genome.
  • MESVR/EGFP*/IRESpacPro(ori) vector which contains 6357 base pairs (SEQ ID NO: 1).
  • a cassette containing a polylinker for the insertion of Ran 18 elements, the adeno virus major late promoter, and the initiator (Inr) from the mouse terminal deoxynucleotidyl transferase gene and a complete R region were inserted at the downstream U3 region (Lagrange et al., Genes Devel. 12:34-44, 1998; Colgan et al., Proc. Acad. Natl. Sci.. USA 92:1955-1959, 1995, each of which is incorporated herein by reference).
  • the U3 region enhancer elements from RSV were inserted at the upstream LTR.
  • the source of the RSV enhancer elements was the pRc/RSV plasmid (Invitrogen Corp., La Jolla CA).
  • GFP green fluorescent protein
  • EGFP enhanced expression
  • pac puromycin N-acetyltransferase
  • an SV40 origin of replication was inserted into the plasmid.
  • the source of the SV40 origin was the plasmid pcDNA3.1 (Invitrogen Corp.). Many of the fragments were generated as PCR products from vectors from commercial sources.
  • SEQ ID NO: 1 (SEQ ID NO: 1) is shown in Figure 1. As indicated above, it contains a strong enhancer from RSV in the position of the upstream LTR that drives expression of the
  • RNA viral genome contains a minimal synthetic promoter in the position of the downstream LTR ( Figure 1).
  • the multiple cloning site upstream of this minimal promoter permits the insertion of oligonucleotides such as the Rani 8 elements to generate a library of pro viruses, each containing a unique promoter cassette in the downstream LTR.
  • the proviral vector library was transfected into mammalian cells together with helper plasmids required for viral production including a plasmid that encodes the group antigen (gag) and the integrase enzyme (pol) that is packaged with the RNA genome as well as a plasmid that encodes the glycoprotein coat (VSV-G).
  • Retroviruses exist as RNA and DNA forms.
  • the DNA form is referred to as the provirus and must be transcribed to generate the RNA form that is packaged into an infectious viral particle.
  • the viral particle is coated with a glycoprotein that is recognized by receptors on the host cell leading to receptor-mediated internalization. After entry into the cell nucleus, the RNA genome is reverse transcribed into the DNA form which is stably integrated into the host cell genome.
  • the viral packaging protocol involved a triple transfection into Cos- 1 cells of a library containing pro-retroviral vectors that harbor the putative promoter elements together with the two separate plasmids that encode the gag/pol and VSV-G proteins, respectively.
  • Cellular transcription machinery is used to generate the viral RNA strands that are packaged into viral particles and subsequently bud from the cell membrane. These viral particles can infect a naive cell as described above.
  • the strong promoter located in the upstream LTR is lost and is replaced by the Ranl8/minimal promoter cassette from the downstream LTR.
  • the viral library is fully representative of the original vector library because all viral RNAs were transcribed from the same strong promoter.
  • each integrated DNA version of the virus contains a different Rani 8 cassette in the upstream LTR, which now drives expression of the selectable markers, EGFP and pac, selection for which indicates the strength of activity of the promoter cassette.
  • Packaging of the proviral vector library was achieved by cotransfection of the proviral DNA into COSl cells together with the packaging genes, which are contained on two separate helper plasmids, pCMV-GP(sal) and pMD.G.
  • the pCMV-GP(sal) plasmid has a cytomegalovirus promoter (pCMV) driving the genes that encode the group antigen (gag) and reverse transcriptase enzyme (pol) from the Moloney murine leukemia virus (MMLV).
  • the pMD.G plasmid encodes the vesicular stomatitis virus G glycoprotein (Naldini et al., Science 272(5259):263-267, 1996, which is incorporated herein by reference). These two plasmids were cotransfected into COSl cells along with the library of recombinant retroviral vectors containing putative promoter elements in order to generate a library of retroviruses.
  • COSl cells were seeded into 100mm dishes at 8 x 10 5 cells/dish and transfected 24hr later with 4 ⁇ g of proviral library DNA and 4 ⁇ g of the pCMV/gag-pol and pCMV/VS V-G plasmids using Fugene transfection reagent
  • the cellular transcription machinery generates viral RNA strands that are packaged into viral particles and subsequently bud from the cell membrane into the culture medium.
  • the medium was collected, diluted with an equal volume of media, filtered to remove cellular debris, and combined with polybrene to a final concentration of 2.5 mg/ml of viral supernatant. This mixture was used to infect
  • Neuro2A cells in monolayer culture.
  • the ratio of viral particles to cells was optimized so as to ensure a high probability of single infection integration events, and generally resulted in infection of 25-40% of the Neuro2A cells.
  • proviral plasmids were prepared containing the minimal promoter, Pmin, alone; a minimal promoter containing three copies of the TRE/AP- 1 element (3X TRE); or a full strength RSV promoter.
  • the latter two regulatory elements were expected to drive expression of the EGFP gene at a high level, whereas the minimal promoter represents the baseline activity.
  • Actively infecting retroviruses were prepared for each of these three promoter constructs by carrying out a triple transfection of a monolayer of actively dividing
  • COS-1 cells with two helper plasmids encoding genes that are essential for the propagation of active virus The culture media containing fully active viral particles corresponding to each of the three promoters was collected and used to infect the target neuroblastoma cell line, Neuro2A. These cells were selected for this study because they grow quickly, are relatively non-adherent, have a high transfection efficiency, and are efficiently infected using the retroviral vector.
  • a library of synthetic oligonucleotides, each containing a random sequence of eighteen base pairs (Rani 8) to be examined for transcriptional regulatory activity was ligated into the Mlu I restriction site immediately upstream of the minimal promoter in the proviral selection vector, generating a library of greater than 5 x 10 7 individual members.
  • This Rani 8 promoter element library was packaged into retroviral particles, which were used to infect the neuroblastoma cell line Neuro2A. After 24 hours, 1 mg/ml puromycin was added to the infected cells, and treatment with puromycin was continued for 3 days to kill uninfected cells. Surviving cells were sorted using a FACSTAR fluorescence activated cell sorter (Becton Dickinson).
  • Control cells were infected with a reporter retrovirus containing either the minimal promoter (Pmin) or a strong promoter (RSV) to drive expression of the EGFP reporter gene.
  • the Pmin control provides a baseline for the level of EGFP expression that is produced by the minimal promoter in the absence of an enhancer.
  • the RSV control provides a measure of infection efficiency.
  • the fluorescence profile of cells infected with the Ran 18 library was compared with that of the Pmin promoter control to determine the fluorescence threshold for promoter element selection. Approximately 1% of the cells showed greater fluorescence than that observed for the minimal promoter alone. Given a viral infectivity of about 33% based on expression for the RSV promoter, about 3% of the elements in the Ran 18 promoter element library enhanced the activity of the minimal promoter.
  • the most highly fluorescent cells were collected and genomic DNA was extracted using the QiaAmp Tissue Kit (Qiagen).
  • the Ran 18 cassettes were recovered from the genomic DNA by PCR amplification using primers that flank the Rani 8 promoter cassette.
  • the amplified promoters were digested with Nsi I and
  • Rani 8 promoter element cassettes were again recovered by genomic PCR.
  • the amplified promoter cassettes were digested with Nsi I and Eco RI to generate a fragment that includes the Rani 8 cassette and the minimal promoter, and the liberated fragments were ligated into a promoter-less luciferase reporter vector (pLuc) to generate
  • the pLuc plasmid was made by introducing a polylinker containing restriction endonuclease sites for Nsi I, Stu I and Eco RI into the Kpn I/Hind III site of the luciferase reporter plasmid PGL3basic (Promega).
  • a large number of the selected Rani 8 sequences contained binding sites for known transcription factors, including c-Ets-2, glucocorticoid receptor (GR), E2F-1, Spl, API, kY factor, CP1, TFIID, PTF-l ⁇ , " DTF-l, AP2, PEA3, TBP, NF-1, UCRF-L, F-ACT1, CTF, ETF, GATA-1, c-Myc, E2F-1, C/EBP ⁇ , lk2, GATA, and ⁇ EF1.
  • GR glucocorticoid receptor
  • the transcriptional activity of individual Rani 8 promoter elements was quantified by luciferase assays after transient transfection of the Ranl8/pLuc subclones into Neuro2A cells.
  • Each Rani 8/pLuc reporter vector was co-transfected with the control plasmid CMV ⁇ gal, which encodes ⁇ -galactosidase, to normalize for transfection efficiency.
  • a pLuc reporter vector containing only the minimal promoter unit was used to provide a baseline for the activity of the minimal promoter.
  • Two hundred Ranl8/pLuc subclones containing selected Rani 8 elements were analyzed by transient transfection and luciferase assay.
  • the selected transcriptional regulatory elements can be examined in a variety of ways, including 1) the level of transcriptional activity produced by each element can be determined using luciferase assays, 2) novel sequences within the element can be multimerized and used as bait in either yeast one-hybrid screening assay or a southwestern screening procedure to isolate potentially novel transcription factors to which the elements bind, 3) activity of the elements can be compared in different cell types or cellular environments such as in the presence of growth factor treatment to identify elements that function in one context but not the other and, therefore, can be useful as a fingerprint for a particular cell type or cellular state, and 4) functional elements can be recombined to examine the rules and constraints governing functional interactions between cis-acting regulatory sequences. In addition, recombination of the elements can produce new elements that combine the benefits of particular individual elements such as strength or cell-type specificity.
  • a database was created containing the functional Rani 8 elements obtained in the above selection procedure, and elements were categorized into those that contained sequences that bind to known transcription factors and those that contained completely novel sequences. In addition, these functional elements were compared to each other to determine the frequency of particular sequence motifs, which reflects the relative abundance of specific transcription factors present in the cells used in the selection process.
  • This promoter element database can be compared to lists of elements that are selected in different cell lines, or in the same cell population that is treated with a different growth factor or drug (see below), thus extending the disclosed selection process to identify Ran 18 elements or other regulatory oligonucleotides that function in different cellular environments, for example, in different cell types or in proliferating versus differentiating cells, to determine differences and similarities in the sets of transcriptional regulatory elements that function during these processes.
  • Active oligonucleotide regulatory elements such as the exemplified Rani 8 elements also can be selected for combinatorial analysis by ligating them together using a method such as the selective element ligation procedure (see Example IF). Once combinations of functional elements are prepared, the synthetic promoter selection procedure is performed on this combinatorial element library. The identified functional promoter elements then are used in DNA/protein binding studies to characterize the transcriptional regulatory proteins to which these elements bind and to identify novel transcription factors. The southwestern screening procedure (Vinson et al., Genes Devel.. 2:801 1988; Singh et al., CeU, 52:415-423, 1988) or the yeast one hybrid technique (Wang et al, Nature.
  • EMS A electrophoretic mobility shift assay
  • the ability of cellular proteins to specifically interact with three selected Ranl8 elements S131 (SEQ ID NO: 16), which contains API, SP1, CP1, ETF and c-Ets-2 binding motifs; SI 33 (SEQ ID NO: 12), which contain an SP1 binding motif; and S146 (SEQ ID NO: 17), which contains C/EBP ⁇ , GR, and PR binding motifs, was examined.
  • the Rani 8 elements were radiolabelled and combined with nuclear extracts from the Neuro2A neuroblastoma cells or from 3T3 fibroblasts, then the resulting DNA-protein complexes were examined by EMSA. Both cell type-specific and ubiquitous complexes were observed.
  • the S131 and SI 33 elements both contained Spl binding sites, and an Spl competitor oligonucleotide, which corresponds to the sequence of an Spl binding site, competed for some or all of the complexes formed with these probes.
  • element SI 46 which contains a glucocorticoid response element, formed one complex that was disrupted by incubation with a specific GR competitor, as well as additional complexes that were not disrupted by the GR competitor.
  • Rani 8 elements can specifically interact with nuclear proteins, including with nuclear proteins only expressed in Neuro2A cells.
  • the promoter selection techniques disclosed herein can be readily applied for use in disease diagnostic procedures by identifying regulatory elements that are highly active only in specific cell types or cellular contexts.
  • a library of random promoter elements is screened for transcriptional activity in cell lines derived from several different tissue types or from cells that are subjected to a particular treatment, for example, treatment with a growth and differentiation factor such as the TGF- ⁇ family growth factor, bone morphogenic factor-4, with signaling molecules or with antiproliferative agents.
  • Regulatory elements that are highly active in these different contexts are sequenced and used to create a "transcriptional element profile" for the cell type or cellular response.
  • the synthetic promoters also can be used as markers for disease. Many disease states are characterized by aberrant regulation of transcription, often affecting multiple genes.
  • the synthetic promoter selection strategy is used to rapidly identify promoters that show elevated levels of expression in a specific disease state. These promoters are then linked to a reporter gene such as EGFP and integrated into cultured mammalian cells to create a battery of cell lines that model the aberrant transcriptional regulation associated with the disease.
  • Candidate drug treatments can be tested for the ability to alter the activities of these promoters. In a simple model, a panel of drugs can be screened and a drug can be identified that reduces the activity, for example, of
  • the reporter constructs also can be integrated into transgenic mice such that the expression of EGFP provides a dynamic reporter system that allows the effectiveness of therapeutic agents to be monitored over the course of treatment.
  • Synthetic promoters that regulate cell specific expression can be used for cell specific expression of a therapeutic gene product in patients using a retroviral mediated gene therapy procedure.
  • a pro-apoptotic agent such as the Bax gene product can be expressed under the control of a synthetic promoter that was selected based on its ability to function only in glioma cells, but not in normal cells, such that expression of the Bax gene only occurs in the glioma cells and selectively kills the glioma cells.
  • a set of synthetic promoters can be identified that are responsive (i.e., have transcriptional competence in a particular cellular context), thereby providing a means to diagnose a disease state.
  • a population of such elements can be used, for example, as an array to fingerprint a particular disease phenotype. For instance, the growth patterns and responsiveness of specific tumor cells to various hormones, cytokines, and synthetic agonists or antagonists of these molecules can be probed by determining the regulatory elements and associated transcriptional proteins that are utilized in particular tumor cells.
  • the method can be useful for constructing synthetic promoters for tissue specific or cellular state specific delivery of transgenes, for example, for gene therapy in humans, or for developmental and gene replacement studies in animals.
  • the successive element ligation procedure provides a method for producing multimers of individual regulatory elements into larger cassettes, thus providing a means to generate combinations of particular regulatory elements that lead to a desired pattern or level of expression of an operatively linked polynucleotide.
  • the procedure generally provides a means to randomly link individual transcriptional or translational regulatory elements into cassettes using successive unidirectional ligation to a DNA adaptor immobilized on a solid support, for example, paramagnetic particles coated with streptavidin.
  • Individual regulatory elements are designed to contain CTCT and GAGA overhangs (or other selected anti-complementary sequences) on the "top" and
  • bottom strands respectively.
  • An adaptor oligonucleotide, containing a biotin group at its 5' end is annealed to a bottom strand oligonucleotide, which contains the 5' overhang sequence, GAGA.
  • the resulting duplex adaptor contains an Nsi I restriction site, which allows cleavage of the multimerized cassette at the end of the procedure.
  • a biotin tagged adaptor is then attached to streptavidin beads and phosphorylated, thereby enabling the ligation of the first regulatory element to the immobilized adaptor complex; the first element contains a donor 5' overhang sequence, CTCT, that is compatible with the recipient GAGA of the adaptor.
  • the phosphorylation reaction is repeated and the first element is now ready to accept ligation of a second element.
  • This procedure is reiterated to generate a growing chain of regulatory elements.
  • a capping adaptor oligonucleotide containing an Mlu I restriction site is ligated, terminating the synthesis of elements.
  • the cassettes produced by this procedure are then amplified by PCR, digested with Nsi I and Bgl II to remove the capping adaptors and biotin, and cloned into the Nsi I and Bgl II sites of the proviral promoter selection vector.
  • the combinatorial proviral promoter library is screened to select effective regulatory element combinations as described above.
  • streptavidin MagneSphere Paramagnetic Particles (Promega, Madison WT) are washed three times with 0.5X SSC, capturing the beads using a magnetic stand each time between washes. The beads are then resuspended in 100 ⁇ l of 0.5X SSC and 200 pmol of an adaptor oligonucleotide, which contains a biotin group on the 5' end, is attached to the beads through the streptavidin-biotin interaction.
  • the adaptor also contains an Nsi I restriction enzyme cleavage site to clone the cassette following its synthesis.
  • the bound adaptor then is phosphorylated using 300 pmol of ATP and 100 units of polynucleotide kinase in preparation for ligation with individual elements. Pools of elements in equimolar amounts (3 mM each, 30 mM total) are ligated onto the adaptor using 5 units of T4 DNA ligase. The oligonucleotides encoding these elements all contain compatible overhangs of GAGA on the 5' end and CTCT on the 3' end to facilitate assembly. Between enzymatic manipulations, the beads are washed 3 times with 0.5X SSC and once with the reaction buffer of the next step. This step is reiterated to generate the desired cassette length.
  • a capping oligonucleotide which contains a Bgl II site, is ligated onto the assembled element cassette.
  • This oligonucleotide in combination with the adaptor is used to facilitate cassette amplification via PCR.
  • the amplified products are then digested with Nsi I and Bgl II and cloned into the proviral selection vector, and combinations of regulatory elements having desirable characteristics can be selected.
  • This example demonstrates the disclosed synthetic regulatory element selection method can be used routinely to screen libraries of oligonucleotides and can consistently identify synthetic transcriptional regulatory elements.
  • the retrovirus vector MESVR/EGFP*/IRES/pacPro(ori) (SEQ ID NO: 1; see Example IB) was used to screen a second library of Ran 18 sequences using the synthetic promoter construction method (SPCM). More than 100 DNA sequences that showed increased promoter activity (4 to 50-fold) in the neuroblastoma cell line
  • Neuro2A were identified.
  • the DNA sequences of selected synthetic promoters were determined and database search using the RIGHT software package, which allowed simultaneous comparison of a database of active Ran 18 elements to existing databases . such as TransFac.
  • the search revealed a predominance of eight motifs - AP2, CEBP, GRE, Ebox, ETS, CREB, API, and SP1/MAZ; about 5 to 10%of the active DNA sequences were not represented in known transcription factor databases and appeared to be novel.
  • the most active of the selected synthetic promoters contained composites of pairs, triples, or quadruples of these motifs.
  • Double stranded Ran 18 sequences were generated by primer extension, digested with Mlu I, and purified by extraction from an 8% polyacrylamide gel.
  • the library of Rani 8 sequences was ligated into the MESVR/EGFP*/IRES/pacPro(ori) (SEQ ID NO: 1) retroviral vector and transformed into XLl-Blue E. coli (Stratagene, San Diego, CA). Plasmid DNA was prepared using Maxi-Prep columns (Qiagen, Valencia, CA). Packaging was achieved by co-transfection of the proviral DNA library into COSl cells together with the helper plasmids, pCMV-GP(sal) and pMD.G (see Example 1).
  • the ratio of viral particles to cells was optimized to ensure a high probability of single infection/integration events; this ratio generally resulted in infection of 25 to 40% of the Neuro2A cells.
  • each cell incorporated on average a single integrated DNA provirus containing a different Rani 8 element upstream of the minimal promoter and the selectable markers, EGFP and pac. Identification of active Rani 8 promoter elements involved two selection steps (see Example 1).
  • the Ranl8/pLucPro plasmids were transfected into Neuro2A cells in 24 well tissue culture plates. One hundred nanograms of each reporter was transfected together with CMV ⁇ gal to normalize for transfection efficiency and 48 hr later the cells were harvested and assayed for ⁇ -galactosidase and luciferase activity (Example 1). The activity of pLucPro was used as a reference standard for measuring the levels of luciferase activity generated by selected Ranl8/promoters.
  • Rani 8 elements were sequenced using an automated DNA sequencer (Model 373, PE Biosystems, Foster City, C A). Sequences were searched for candidate transcription factor binding motifs present in the TransFac database (release 3.5) using the RIGHT (Reeke's Interactive Gene hacking Tool) software package. RIGHT is a motif recognition program based on a regular expression search and is particularly useful for SPCM because it allows a batch format for sequence input and has the capacity to simultaneously analyze large numbers of Rani 8 promoter sequences.
  • the unselected (“U") Rani 8 elements showed a Gaussian distribution with a mean activity of 2-fold and a standard deviation of 0.8. Using this distribution for the activities of the U Ran 18 elements and allowing for a confidence interval of 98%, it was determined that 4-fold activity above that of the minimal promoter represented a statistically significant level.
  • the DNA sequences of 106 SLA, 133 S, and 132 U Ranl ⁇ elements were determined and compared to known motifs within the TransFac database. Only motifs having 100% sequence identity with TransFac motifs with a length of 6 base pairs or greater were scored as matches. Known regulatory motifs were identified in each of the three sets, but the prevalence and linear arrangement of particular motifs differed among the sets. Twenty of the most active Rani 8 sequences from the SLA set showed 78 matches with known motifs (Table 1; SEQ ID NOS: 20 to 39). A significant number of these matches occurred as composites consisting of two or more motifs that either were overlapping or contiguous.
  • MS44 SEQ ID NO: 20
  • S173 SEQ ID NO: 21
  • MS44 SEQ ID NO: 20
  • S173 SEQ ID NO: 21
  • SLA and S sets contained approximately twice as many motifs as the U set.
  • a significant proportion of the motifs identified in all three sets (46% for U, 46.5% for S, and 51% for SLA)were made up of only eight motifs, which represented putative binding sites for eight different families of transcriptional regulators - AP2, CEBP, GRE, E-box, ETS, CREB, API, and SP1/MAZ.
  • the SLA and S sets also contained approximately twice as many of these motifs as the U set .
  • Composites were further categorized into three types: category A, including those containing two or more of the 8 most common motifs; category B, including those containing one of the 8 common motifs and a motif other than one of the 8 common motifs; and category C, including those containing that two or more motifs other than the 8 most frequent TABLE 1
  • sequences corresponding to known motifs are underlined; bold and italics identify indicated motif imbedded within larger motif.
  • SEQ ID NOS: are indicated in parentheses at end of sequences. "ACTIV.” indicates promoter activity of sequence relative to minimal promoter.
  • the number of composites containing each of the 8 frequent motifs also was determined.
  • the number of composites containing GRE, Ebox, API, CREB, and SPl/MAZ motifs increased dramatically and those containing ETS increased moderately.
  • no increase was observed in the number of composites containing AP2 and CEBP elements.
  • MS44B contains an ETS/CREB composite and
  • MSI 13 contains a MAZ/SPl motif.
  • ETS and CREB mutations in MS446 also resulted in substantial reductions of MS448 promoter activity.
  • Luciferase reporter variants of MS448 with mutations in the ETS, the CREB, or in both ETS and CREB motifs had only 21%, 5%, and 3%, respectively, of the promoter activity of MS44B.
  • SPCM was designed to address several problems confronted in analyzing the complex machinery of eukaryotic gene transcription.
  • a basic problem is to survey the types and frequencies of DNA motifs that contribute to promoter activity. As such, it is important to understand which combinations of cis and trans elements work in concert with a core promoter and the basic transcription machinery in a given cellular context.
  • the present results demonstrate that the disclosed methods can be used to identify functional motifs active in the context of a cell, including in various cell types, under a variety of conditions, and in various combinations.
  • the RIGHT software package was used to analyze the occurrence of various motifs in three different sets of synthetic promoters: unselected (the U set), those selected by GFP fluorescence to have promoter activity as integrants in the genome (the S set), and GFP-selected synthetic promoters that, as measured after cellular transfection, gave high levels of activity in an episomal state with the luciferase assay (the SLA set). Approximately twice as many matches with known transcriptional regulatory motifs were found in the SLA and S sets than were found in the U set.
  • SPCM Percentrosine kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase, kinase, kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase
  • the present methods allows for separate determinations of the activity of a motif when integrated in the genome or in the episomal state.
  • 480 integrated motifs that were selected as active by GFP-sensitive cell sorting 120 exceeded the 4-fold threshold as plasmids in the luciferase assay.
  • the present method 74 Selected transcriptional regulatory elements or combinations thereof as disclosed herein, for example, in matrix arrays, can be used to detect differential responses of normal cells and cells from various diseased tissues for diagnostic purposes or drug development.
  • the retroviral vector, MESVR/EGFP*/IRESNCAMPro(ori) (SEQ ID NO: 9), was made essentially by substituting a cDNA sequence encoding the 140 kD form of the human neural cell adhesion molecule, N-CAM, for the Pac coding sequence in the MESVR/EGFP*/TRESpacPro(ori) vector (SEQ ID NO: 1).
  • the entire N-CAM cDNA was generated by PCR using 5' and 3' primers having Afl III and Sal I restriction sites, respectively.
  • the selection system based on N-CAM uses an anti N-CAM antibody, which immunoreacts with eukaryotic cells that are expressing N-CAM under the control of an introduced synthetic oligonucleotide having transcriptional promoter activity. Selection can be performed, for example, by fluorescently labeling the anti-N-CAM antibody, contacting the cell with the antibody, and using a method such as FACS to select retroviral infected cells expressing the N-CAM marker.
  • the disclosed selection method also can be practiced using other expression vectors, including variants of the disclosed retroviral vectors.
  • the adeno virus major late promoter can be substituted with another minimal promoter such as the minimal enkephalin gene promoter (MEK).
  • MEK minimal enkephalin gene promoter
  • a nucleotide sequence encoding a reporter protein other than EGFP or puromycin can be used.
  • EGFP can be substituted with GFP or another fluorescent reporter, or with luciferase or other easily detectable reporter.
  • the nucleotide sequence encoding puromycin N-acetyltransferase can be substituted with one encoding hygromycin B phosphotransferase, which confers resistance to hygromycin B, the 73 provides a means to identify regulatory elements that function only when integrated in a genome. The possibility that some of the activities seen in the integrated state arose because of proximity to unknown enhancers raises the issue of false positive responses.
  • SPCM SPCM to cells in an organism in vivo, thus providing a means to identify regulatory elements that are active only during particular stages of development.
  • Variations to the present method include, for example, the screening of libraries constructed from different lengths of randomers to minimize potential biasing. Moreover, the use of larger cell sample can improve statistical analysis of the prevalence of particular motifs. In addition, application of the present method to screening in various cell types and species can elucidate evolutionary changes in regulatory elements that occur, for example, as a result of speciation events, thus providing a means to classify an unknown sample. Consistent application of the current and related SPCM approaches should allow the creation of databases of truly functional promoters and also include cognate information on various species and developmental states.
  • the method can be used to analyze combinations of a single known motifs such as an Octamer element with random sequences, thus providing a means to identify synergies between various cis acting regulatory elements and the modulation of interactions with corresponding transcription factors.
  • the deliberate assemblage of combinations of known elements in various lengths, orders, polarity, and spacings can provide a means to obtain regulatory elements having desirable characteristics.
  • Sh ble gene product which confers resistance to the antibiotic Zeocin ® (bleomycin), or neomycin (aminoglycoside) phosphotransferase, which confers resistance to the aminoglycoside antibiotic, G418.
  • Non-retroviral expression vectors also can be used, and similarly are designed to contain one or more polynucleotides encoding selectable markers such that cells containing an integrated form of the vector can be selected.
  • the pnZ-MEK vector (SEQ ID NO: 2; see, also, Figure 2 A) contains a MEK minimal promoter and nucleotide sequences encoding the prokaryotic Sh ble gene product and the neomycin (aminoglycoside) phosphotransferase, which confer resistance to antibiotics Zeocin ® and G418, respectively.
  • the pnZ-MEK vector also contains unique Pst I and Not I restriction sites, into which an oligonucleotide to be tested for transcriptional regulatory activity, for example, Rani 8 or Ranl2 cassettes or other putative regulatory elements can be inserted. Elements are cloned upstream of the MEK promoter upstream of the Zeocin (bleomycin) resistance gene.
  • the pnL-MEK vector (see Figure 2B) is similar to pnZ-MEK, except it contains a luciferase reporter gene substituted for the Sh ble gene, and can be used to corroborate the activity of regulatory elements that are selected in the procedure.
  • An additional vector, pnH-MEK was constructed by substituting the sequence encoding Sh ble (or luciferase) reporter gene of pnZ-MEK (or pnL-MEK) with one encoding hygromycin B phosphotransferase, which confers resistance to hygromycin B (SEQ ID NO: 3; see, also, Figure 2C).
  • Each of these vectors contain a gene encoding neomycin resistance (aminoglycoside) phosphotransferase, which is driven by the strong SV40 early promoter.
  • the neomycin resistance gene cassette allows selection for integration of a construct in the cellular genome using G418.
  • the vectors contain a sequence encoding ⁇ -lactamase (bla), which confers resistance to kanamycin and allows for selection of the vectors in bacterial cells.
  • a library of random 12mers was screened.
  • Single stranded oligonucleotides containing a core of twelve random bases (Ran 12) were synthesized using an Applied Biosystems DNA synthesizer, and annealed to two linkers forming a hemiduplex DNA with double stranded termini having Pst I and Not I compatible ends.
  • Rani 2 oligonucleotides two additional primers complementary to the Pst I and Not I portions of the single stranded oligonucleotide were synthesized and annealed to the Rani 2 oligonucleotides. The annealing forms a hemiduplex DNA molecule that contains double-stranded ends that are compatible with Pst I and Not I restriction sites and a single-stranded portion that corresponds to the Rani 2.
  • Annealing was performed with a 50-fold molar excess of the two primers relative to the Ranl2 oligonucleotide in a solution containing Tris-HCl (pH 7.5), lmM MgCl 2 at 75°C for 10 min, followed by slow cooling to room temperature.
  • the library of Rani 2 oligonucleotides was ligated into either the pnL-MEK or pnZ-MEK vectors in a 1:1 ratio of Ranl2 oligonucleotide to vector. Generally, 100 to 500 ng of vector was used in each ligation in a volume of 10 ⁇ l.
  • DNA was then purified using QiaQuick PCR purification columns (Qiagen) and 10% of the ligation mixture was used to transform frozen competent XL 10 Gold E. coli (Stratagene). DNA polymerase I in the bacteria fills-in the hemiduplex, thus producing a double stranded Rani 2 sequence. Equal portions of the transformation mix were plated on 150 mm LB plates containing kanamycin.
  • the PI 9 cell line is a model system for the study of neuronal and muscle cell differentiation. In the presence of retinoic acid, the embryonal PI 9 cells differentiate into glial cells and neurons, whereas in the presence of DMSO, PI 9 cells differentiate into skeletal and cardiac muscle cells. Furthermore, these cells differentially express genes that are important to these induction processes. Regulatory elements identified as active in the P19 differentiation system can be tested in other cell lines of known phenotype to further define the role of the element in a particular step of differentiation. Other cell lines that can also be induced to differentiate include NG108-15 and Neuro2A cells.
  • the Ranl2/pnZ-MEK constructs were introduced into P19 cells by electroporation using a BIORAD Gene Pulser, which results in the insertion of the expression constructs into one site within the genome. Electroporation was performed in either growth medium or Opti-MEM using 10 ⁇ g of linearized DNA in 15 x 10 6 cells. After electroporation, stably transfected cells were selected in 10 cm dishes in the presence of both G418 (0.2 mg/ml) and Zeocin ® (0.1 mg/ml). Cells were selected for 2 weeks and colonies that survive were transferred to 96 well plates. Once stable cell lines were established, cells were induced to differentiate within the 96 well plates. In the first set of isolated Ranl2 promoter elements, four million synthetic Ran 12 elements were screened, and one thousand Zeocin-resistant cell colonies were isolated.
  • Cell lines were analyzed to identify the combinations of known elements or novel regulatory elements that allowed sufficient Zeocin ® expression for survival.
  • Cells were cultured in 96 well plates and genomic DNA was isolated using a Chelex lysis procedure and purified using the QiaAmp Tissue Kit (Qiagen). Regulatory elements were amplified by PCR (two rounds of 25 cycles) using primers that flank the regulatory element cassette. The amplified regulatory cassette was sequenced directly using the automated DNA sequencer. To independently assay the activity of elements selected in stable lines, each cassette was cloned into the pnL-MEK vector in order confirm and quantitate the activity of individual elements.
  • luciferase reporter containing an element was transiently transfected into cells using Lipofectamine (Life Technologies) and luciferase activity was assayed 48 hr later using an enzymatic assay and detected on a luminometer.
  • GGTTGGGTCCCC (66) CAATbox TTGGGTCATTGT (67) TTGGGTCGTTGT (68)
  • TTACTGGGTGTT CTAGTGGGAGCT (73) AGGGTGAAGGTC (46) TGGGCGAGTGGG (74) GGTGGGTGTGTC (47) c-myb TGCTTCAATGCC CGCCTCGATGCC
  • HRE Hormone response elements
  • TGTGTCTTTGCA GR (50) TGTGTCTTTGCA (79) CACGGGGACAGC GR (51) CGAACTTTGCAA (80) AAGCTGTACATG GR PR (52) GATGGGGGCACA GR (53) ATATGTGCCCTT GR (54) TCCTTCTGGGTC ER fos/jun (55) GGTGGGTGTGTC GR AP1 (56) Elements found more than once
  • GAATGGATGGGG AP-2 found twice (81) TATGTAAGAACG CATGTGATATTC USF (58) found twiC8(82) AGGAGGGTTTGT CEBP aJpha (59) TCGGTTATTGTT found twice (42) TGGGCGAGTGGG Zeste (60) CGGCTCACCAGT Zeste (61) GGTTTCTATAAC TBP (62) sites for known transcriptional regulatory proteins, including homeodomain binding sites, CCAAT boxes, CACCC boxes, binding sites for c-myb, hormone response elements (glucocorticoid receptor, progesterone receptor and estrogen receptor), binding sites for the products of immediate-early genes such as fos and jun and Ap-2, and other factors including C/EBP, USF, Zeste, and TBP are indicated. Elements that were selected by this procedure, but that do not contain otherwise identifiable known binding sites for transcription factors, also are indicated. Remarkably, several different core motifs were identified, including TTGGGT (SEQ ID NO: 83)
  • REGULATORY ELEMENTS This example describes the preparation of a vector useful for selecting oligonucleotide sequences having internal ribosome entry site (IRES) activity and the identification and characterization of such selected elements.
  • IRS internal ribosome entry site
  • the disclosed synthetic IRES methodology provides a means for selecting functional IRES elements. Similar to the transcriptional regulatory element selection method disclosed above (Examples 1 to 3), the IRES selection method allows the parallel screening of 1 x 10 6 to 1 x 10 10 or more random oligonucleotide elements or combinations of elements for activity in mammalian cells. Selection of synthetic IRES elements in mammalian cells is facilitated if 1) each cell receives a single unique cassette to avoid selection of inactive elements that are fortuitously present in the same cell as an active element; 2) the delivery system is efficient so that a complex library can be readily screened; and 3) the selection process is stringent and is based on a reporter gene assay that is highly sensitive and faithfully reports the activity of the IRES elements.
  • a library of oligonucleotides was ligated immediately upstream of the second nucleotide sequence of a dicistronic reporter cassette comprising two reporter genes by insertion into a cloning site in the intercistronic spacer sequence.
  • the exemplified reporter cassette contained nucleotide sequences encoding enhanced green fluorescent protein (EGFP) and enhanced cyan fluorescent protein (ECFP), which were arranged in a dicistronic construct that allows two separate gene products to be made from a single mRNA that is driven by a single promoter.
  • EGFP enhanced green fluorescent protein
  • ECFP enhanced cyan fluorescent protein
  • each IRES was scored for its translational activity by examining the activity of the ECFP reporter gene relative that of EGFP. After 2 to 3 days of infection, uninfected cells were selected by FACS to obtain cells expressing both EGFP and ECFP; the level of ECFP expression in each cell reflected the strength of an individual synthetic IRES element cassette, such that highly fluorescent cells are likely to contain highly active IRES elements. After multiple rounds of selection, the IRES sequences were amplified from the cellular genome by PCR and sequenced using an automated DNA sequencer to determine the identity of each of the synthetic IRES elements.
  • each selected IRES element was confirmed by amplifying the entire IRES element, inserting the amplified element into a dicistronic luciferase reporter vector, and screening for the second luciferase reporter protein under translational control of the inserted IRES. This method allowed the testing of the regulatory cassette in a different reporter system, which was more amenable to quantitation of IRES activity levels.
  • the benefits of using a retroviral delivery system for identifying synthetic IRES elements are similar to those described in Example 1 for identifying transcriptional regulatory elements.
  • the recombinant retroviral vector designed for the IRES selection procedure was designated MESVR/EGFP/ECFP/RSVPro (SEQ ID NO: 1
  • MESVR/EGFP/ECFP RSVPro vector include that 1) a multiple cloning site was introduced into the downstream LTR for insertion of the exogenous sequences that can regulate transcriptional activity of a transgene encoded by the recombinant retrovirus, and the endogenous viral core promoter was replaced with a strong basal promoter to potentiate transcription promoting activity of inserted sequences; 2) a mutated EGFP encoding sequence followed by a multiple cloning site to allow insertion of elements to be tested sequences and a sequence encoding ECFP to allow assay of translational activity on a single cell basis was introduced; 3) enhancer elements in the upstream LTR were replaced with those from RSV to drive higher levels of RNA genome production in the packaging cells; and 4) an SV40 origin of replication was inserted in order to increase the copy number of the retroviral plasmids in the packaging cells.
  • the EGFP and ECFP reporter genes are expressed as a single transcript, in which the mRNAs are linked by an oligonucleotide to be examined for IRES activity. Expression of both reporter genes is controlled by a strong RSV promoter to ensure efficient transcription of the RNA viral genome and, therefore, a high viral titer.
  • the multiple cloning site between the EGFP and ECFP coding sequences facilitates the insertion of an oligonucleotide to be examined for translational activity.
  • a library of recombinant retroviruses was made by transiently transfecting COSl cells together with plasmids encoding the MLV gag/pol genes and the VSV G glycoprotein gene.
  • the library was introduced into B104 cells, then 48 hr later, the cells were subjected to FACS and cells expressing high levels of EGFP and
  • ECFP were collected. The selected cells were replated, then sorted again for EGFP and ECFP expression. Genomic DNA was extracted from the twice-selected cells, and the 18mers were isolated by PCR using primers complementary to the sequences flanking the Mlu I cloning site in the vector.
  • IRES activity of the PCR amplified sequences was confirmed by cloning the fragments into the intercistronic region of the dicistronic reporter vector, RPh (Chappell et al., Proc. Natl. Acad. Sci.. USA 97:1536-1541, 2000, which is incorporated herein by reference).
  • Individual plasmid clones were transfected into B104 cells and the luciferase activities of the first cistron (Renilla luciferase) and the second cistron (Photinus luciferase) were assayed.
  • an increase in the translation of the second cistron relative to the first cistron and normalized to the empty vector indicated that the 18mer functioned as an IRES element.
  • IRES has a modular structure similar to IRES elements contained within some cellular mRNAs of higher eukaryotes. Both YAPl and pi 50 leaders contained several complementary sequence matches to yeast 18S rRNA.
  • the plasmid pMyr (Stratagene) was used as backbone for both dicistronic and monocistronic constructs.
  • Nhe I, Eco RI, Nco I, and Xba I was introduced into the pMyr vector immediately downstream of the GAL1 promoter, using Hind III and Xba I as cloning sites.
  • the Pstl and Xbal sites were used as cloning sites for a fragment from the RPh dicistromc reporter vector (Stoneley et al., Oncogene 16:423-428, 1998, which is incorporated herein by reference; Chappell et al., supra, 2000).
  • pMyr-RP encodes a dicistronic mRNA that encodes Renilla (sea pansy) and Photinus (firefly) luciferase proteins as the first (upstream) and second (downstream) cistrons, respectively.
  • the pl50, YAPl, and CLN3 leader sequences were PCR amplified using yeast genomic DNA as a template. These leader sequences were cloned into the intercistronic region of the pMyr-RP vector using Eco RI and Nco I restriction sites that were introduced at the 5' and 3' ends of the leader sequences to generate constructs designated as pMyr-pl50/RP, ⁇ Myr-YAPl/#J J , and pMyr-CLN3 RP.
  • a hairpin structure with a predicted stability of -50 kcal mol "1 (Stoneley et al., supra, 1998) was introduced into the 5' UTR of the dicistronic constructs to generate pMyr- pl50/RPh, pMyr-YAPl/RPh, and pMyr-CLN3/RPh.
  • Deletions and fragments of the pi 50 leader were generated by PCR amplification of the pi 50 sequence, again using Eco RI and Nco I as cloning sites.
  • Monocistronic constructs containing the Photinus luciferase gene were generated in the modified pMyr vector.
  • the Photinus luciferase gene was obtained from the pGL3 control vector (Promega) as an Nco I/Xba I fragment and cloned using these same sites to generate construct pMyr/P.
  • the leader sequences from YAPl, pi 50, and CLN3 mRNAs, as well as the hairpin structure were cloned into the pMyr/P vector using the same restriction sites used for the dicistronic constructs.
  • Constructs containing the chloramphenicol acetyl transferase (CAT) gene were cloned into the pGADIO vector (CLONTECH).
  • the pGADIO vector was digested with Hind III and an adaptor containing restriction sites Hind III, Pst I, Nhe I, Eco RI, Nco I, and Xba I was introduced into this site, which is immediately downstream of the ADH promoter.
  • the CAT gene was obtained from the pCAT3 control vector (Promega) and cloned into the modified pGAD 10 vector using Ncol and Xbal restriction sites.
  • the pi 50 leader sequence was introduced into this vector as an EcoRI/NcoI fragment to generate the construct designated pl50/CAT.
  • the hairpin structure described above was introduced 5' of this leader sequence to generate the construct designated pl50/CATh.
  • the yeast strain EGY48 (MATa, his3, trpl, ura3, LexA opri ⁇ 6 s-LEU2; CLONTECH) was used throughout the study.
  • Yeast strains harboring the pMyr based plasmids were grown overnight in 4 ml synthetic defined medium (SD) with uracil and glucose. The following morning, cells were harvested, washed with 4 ml H 2 O, and grown for 3 hr in 4 ml SD medium without uracil with the addition of 2% galactose and 1% raffinose. Cells harboring the pGADlO-based constructs did not require induction and were cultured in 4 ml SD/Ura glucose medium overnight.
  • SD synthetic defined medium
  • Cells were lysed with lx lysis buffer (diluted freshly from 5x stock; Promega) in tubes with glass beads. Tubes were vortexed twice for 30 sec and recovered in a microfuge spun at top speed for 3 min at 4°C. The supernatant was recovered and 20 ⁇ l of the lysate was used to assay luciferase activities using the dual reporter assay system (Promega). CAT activity was measured using N-butyl CoA according to technical bulletin no. 84 (Promega).
  • RNA antisense probe that was labeled with 32 P.
  • the 164 nucleotide YAPl leader sequence (SEQ ID NO: 88) was examined for translational regulatory activity in the 5' UTR of a firefly (Photinus) luciferase reporter mRNA (YAP1/P).
  • YAP1/P a firefly luciferase reporter mRNA
  • Cells were transformed with constructs expressing the parent Photinus (-/P) mRNA, the YAP1/P mRNA, or the 364 nucleotide 5' leader of the CLN3/P mRNA as a spacer control.
  • the leader sequence of YAPl mRNA was placed in the intercistronic region of a dual luciferase dicistronic mRNA and examined for IRES activity.
  • the upstream cistron encodes Renilla (sea pansy) luciferase and the downstream cistron encodes Photinus luciferase.
  • Cells were transformed with constructs encoding the parent RP mRNA, or with constructs containing the YAPl or CLN3 leaders in the intercistronic region of the RP mRNA.
  • the YAPl leader sequence enhanced the translation of the downstream Photinus luciferase cistron approximately 5-fold relative to that of the RP mRNA.
  • the CLN3 leader had almost no effect on the expression of the second cistron relative to that of the RP mRNA.
  • Hairpin structures were inserted in the discistronic constructs upstream of the Renilla luciferase gene to block scanning and, thereby, reduce the translation of this reporter molecule.
  • the hairpin structures blocked Renilla luciferase expression by greater than 90%).
  • the YAPl leader permitted translation of the Photinus luciferase gene, even when translation of the Renilla luciferase gene was blocked. This result demonstrates that the YAPl leader did not increase expression of the second cistron by reinitiation or leaky scanning.
  • the yeast pl50 5' UTR also was examined for translational regulatory activity.
  • the 5' leader of the mRNA encoding the pi 50 protein was determined by primer extension analysis to contain 508 nucleotides (SEQ ID NO: 89; see, also, Goyer et al., Mol. Cell, biol. 13:4860-4874, 1993, which is incorporated herein by reference).
  • This sequence contains 11 open reading frames (ORFs) and does not appear to contain or be part of an intron (Costanzo et al., Nucl. Acids Res. 28:73-76, 2000, which is incorporated herein by reference), consistent with the observation that only 4% of yeast genes contain introns, 90% of which encode ribosomal proteins.
  • the presence of the upstream ORFs in the pi 50 leader might be expected to inhibit translation by a scanning mechanism.
  • the pi 50 sequence was tested in the 5' UTR of a monocistronic reporter mRNA. Constructs containing this sequence enhanced the translation efficiency of the reporter gene up to 10-fold. However, the analysis was complicated by the appearance of a second band approximately 1 kb, which may be a partial degradation product of the luciferase mRNA; this RNA was too short to encode a functional
  • the pi 50 leader was tested in the 5' UTR of the CAT reporter gene to further evaluate whether it was functioning as a translational enhancer.
  • the results obtained using the CAT reporter construct were similar to those obtained with the Photinus luciferase reporter gene; the pi 50 leader sequence enhanced the translation efficiency of the CAT reporter gene 9-fold.
  • the p 150 leader was tested in the intercistronic region of the dual luciferase RP dicistronic mRNA.
  • the pi 50 leader functioned as a potent IRES, enhancing translation of the downstream Photinus luciferase cistron approximately 200-fold relative to that of the RP parent vector.
  • This increase in Photinus luciferase activity in the pl50 £P mRNA resulted in Photinus luciferase protein levels that were approximately twice those of Renilla protein levels.
  • RNA fragmentation or unusual splicing events RNA fragmentation or unusual splicing events.
  • the pi 50 leader sequence was sequentially deleted from the 5' end and fragmented into shorter segments, including fragments consisting of nucleotides 100 to 508, 160 to 508, 250 to 508, 375 to 508, 429 to 508, 481 to 508, 250 to 390, and 1 to 250 of SEQ ID NO: 89, each of which was tested for IRES activity. Most of the IRES activity was associated with nucleotides 160 to 508. However, all of the fragments examined demonstrated some level of IRES activity. Furthermore, deletion of nucleotides 1 to 100 or nucleotides 100 to 160 increased translation by internal initiation, indicating that this 160 nucleotide region contains translational inhibitory sequences, which can inhibit IRES activity.
  • the leader sequence in construct pi 50(250-508) corresponds to that of a shorter leader sequence that occurs naturally (Goyer et al., supra, 1993). This shorter leader sequence has a level of IRES activity that is similar to that of the entire 508 nucleotide leader.
  • the complementary match at nucleotides 130 to 142 of the ⁇ l 50 IRES (SEQ ID NO: 94; see Figure 5) is correlated with a 60 nucleotide segment of the IRES that can inhibit IRES activity.
  • Another complementary match of the ⁇ l50 IRES at nucleotides 165 to 183 is correlated with a
  • nucleotide segment of the IRES that contributes to internal initiation.
  • Two other complementary matches of the pi 50 IRES at nucleotides 423 to 437 (SEQ ID NO: 98) and nucleotides 437 to 461 (SEQ ID NO: 100) are partially or fully contained within a 52 nucleotide segment with IRES activity (see Figure 5).
  • yeast translation machinery may be capable of mediating internal initiation (Iizuka et al., Mol. Cell. Biol. 14:7322- 7330, 1994; Paz et al., J. Biol. Chem. 274:21741-21745, 1999, each of which is incorporated herein by reference), the present example demonstrates unequivocally that yeast IRES sequences contained within the YAPl and pi 50 leader sequences can function in vegetatively growing cells. In addition, numerous sequences sharing complementarity with yeast 18S rRNA were identified within both leader sequences.
  • the leader sequence of the YAPl mRNA contained an IRES element that contributed to the efficient translation of this mRNA. Sequence features of this leader previously have been shown to affect translation and mRNA stability (Vilela et al., Nucl. Acids Res. 26:1 150-1159. 1998; Ruiz-Echevarria and Peltz, £eU 101:741-751, 2000, each of which is incorporated herein by reference). One of these features, a short upstream open reading frame (uORF) did not inhibit translation of the main ORF, even though it was recognized by a large fraction of the scanning ribosome.
  • uORF short upstream open reading frame
  • the modular composition of cellular IRESes contrasts with those found in viruses.
  • the IRESes comprise several hundred nucleotides and contain RNA conformations that appear to be highly conserved and that are important for activity.
  • the inactivity of some mammalian IRESes in yeast may also reflect trans factor requirements that are not provided by yeast cells or differences related to the ability of a sequence to bind a component of the translation machinery that is not identical to that in yeast.
  • pi 50 is the yeast homologue of mammalian translation initiation factor eIF4G, but the two are not functionally interchangeable.
  • IRESes are used by some mRNAs during the G2/M phase of the cell cycle and under conditions that reduce cap-dependent translation, as seen, for example, during different types of stress.
  • internal initiation may also be used to facilitate the translation of essential genes under similar conditions, including the condition of nutritional deficiency.
  • IRESes were identified within the YAPl and pi 50 leader sequences given that overexpression of YAPl confers general resistance to many compounds.
  • expression of pi 50 when cap-dependent translation is reduced may contribute to the translation of other mRNAs under these conditions.
  • yeast IRESes that function in vegetatively growing cells suggests that yeast and higher eukaryotes use similar mechanisms to initiate translation.
  • the analysis of these mechanisms should be facilitated in yeast, since many strains of yeast exist with mutations in genes involved in translation.
  • the ability to easily manipulate this organism genetically may also enable the identification of specific factors involved in internal initiation and should enable us to critically test the hypothesis that base pairing between certain IRES sequences and 18S rRNA is important for recruitment of ribosomes at these sites.
  • yeast IRESes that function as translational enhancers in monocistronic mRNAs also provides numerous applications for bioengineering.
  • translational regulatory elements including IRES elements, can be identified by screening libraries of random oligonucleotides.
  • Gtx IRES module 9 nucleotide Gtx IRES module (CCGGCGGGT; SEQ ID NO: 102)
  • B104 cells were infected with two retroviral libraries that contained random sequences of 9 or 18 nucleotides in the intercistronic region.
  • Cells expressing both cistrons were sorted and sequences recovered from selected cells were examined for IRES activity using a dual luciferase dicistronic mRNA.
  • Two novel IRES elements were identified, each of which contained a sequence with complementarity to 18S rRNA. When multiple copies of either element were linked together, IRES activities were dramatically enhanced.
  • the synthetic IRESes were differentially active in various cell types. The similarity of these properties to those of the Gtx IRES module (SEQ ID NO: 102)
  • nucleotide sequences can function as translational regulatory elements.
  • the MESVR EGFP/ECFP/RSVPro retroviral vector (SEQ ID NO: 109; see Example 4) was used to generate two libraries.
  • an oligonucleotide containing 18 random nucleotides (N) 18 was cloned into the Mlu I site of the polylinker.
  • the sequence of this oligonucleotide is: acgcgtgatcca(N) 18 cgagcgacgcgt (SEQ ID NO: 103; see Edelman et al., supra, 2000).
  • an oligonucleotide containing two segments of 9 random nucleotides (N) 9 was cloned into the Pac I and Mlu I sites of the polylinker.
  • the sequence of this oligonucleotide was ttaattaagaattcttctgacat(a) 9 ttctgacat(a) 9 ttctgacat(a) 9 (N) 9 (a) 9 (N') 9 (a) 9 - gactcacaaccccagaaacagacatacgcgt (SEQ ID NO: 104), where N and ' are different random nucleotide sequences.
  • this oligonucleotide was based on another previously described oligonucleotide (S m /S ⁇ ) 5 ⁇ (Chappell et al., supra, 2000). This oligonucleotide did not have IRES activity and was used as a spacer control.
  • the first library consisted of about 2.5 x 10 5 bacterial clones and the second consisted of about 1.5 x 10 5 bacterial clones. As such; each library represented only a small fraction of the potential sequence complexity of the random oligonucleotides
  • the retroviral libraries were packaged in COSl cells. Subconfluent cells were triply-transfected using the FuGENE 6 reagent (Roche Molecular Chemicals; Indianapolis IN) with plasmids encoding 1) the retroviral library, 2) MoMuLV gag and pol genes (pCMV-GP (Sal) ) and 3) the VSV G glycoprotein (see Tranque et al., supra, 1998). After 48 hr, retroviral particles were recovered from culture supernatant, filtered through a 0.45 ⁇ m membrane, and then used to infect B104 rat neural tumor cells (Bottenstein and Sato, Proc. Natl. Acad. Sci.. USA 76:514-517,
  • COSl cells Approximately 2 x 10 6 COSl cells were transfected, and approximately the same number of B 104 cells were subsequently infected. After 72 hr, cells were harvested and sorted by FACS on a FACSVantage SE (Becton Dickinson; San Jose CA). EGFP was excited with an argon laser tuned to 488 nm and fluorescence was recorded through a 530 nm bandpass filter. ECFP was excited with a krypton/argon laser tuned to 457 nm, and fluorescence was measured through a 495 nm bandpass filter.
  • B104 cells were infected with the following reference viruses: the parent vector (MESV/EGFP/ECFP/RSVPro), a virus encoding EGFP, a virus encoding ECFP, and a virus that contains the IRES from the encephalomyocarditis virus (EMCV) in the intercistronic region of the parent vector.
  • the parent vector (MESV/EGFP/ECFP/RSVPro)
  • EMCV encephalomyocarditis virus
  • Genomic DNA was prepared using a QIA amp DNA miniprep kit (Qiagen). Intercistronic sequences were amplified by PCR using flanking primers, and cloned into the intercistronic region of RPh, which is a dicistronic vector that encodes Renilla luciferase protein as the first cistron and Photinus luciferase protein as the second cistron (Example 1).
  • B104 cells were transiently co-transfected with the dual luciferase vector and with a vector expressing ⁇ -galactosidase, and luciferase and ⁇ -galactosidase assays were performed (see Example 1). Photinus luciferase activity values were normalized for transfection efficiency by means of ⁇ -galactosidase activity, and were then normalized to the activity of the RPh parent vector (first library) or of RPh containing the (Sm/S ⁇ oligonucleotide as a spacer control (second library).
  • Sequences of the oligonucleotide inserts were determined using an ABI system sequencer (PE Biosystems, Foster City, CA), and were compared using the Clustal X multiple sequence alignment program (Thompson et al., Nucl. Acids Res. 25:4876- 4882, 1997), and with the BestFit program from the Genetics Computer Group software package (Devereux et al., Nucl. Acids Res. 12:387-395, 1984). Sequence matches were evaluated by comparing BestFit quality scores to those obtained when the selected sequences were randomly shuffled 10 times and compared to 18S rRNA. Secondary structure predictions were made using mfold version 3.0 (Zuker et al., in
  • the retroviral library containing the random 18 nucleotide inserts was examined.
  • This library derived from 2.5 xlO 5 retroviral plasmids was used to infect approximately 2 x 10 6 rat B104 neural tumor cells.
  • the twice sorted cells were compared to cells that had been infected with the virus that contained the EMCV IRES between the EGFP and ECFP genes. Both cell populations showed variable expression suggesting that IRES activity can vary among individual cells, perhaps reflecting cell cycle differences in the population.
  • Intercistronic sequences contained within the population of twice sorted cells were isolated by genomic PCR, and cloned into the intercistronic polylinker of the RPh vector (see Example 1).
  • This dual luciferase vector has a stable hai in-forming sequence in the transcribed leader region upstream of the Renilla open reading frame.
  • the hairpin structure blocks scanning ribosomes and therefore suppresses translation of the first cistron.
  • Fifty clones were picked at random and plasmid DNA was prepared, sequenced, and transiently transfected into B104 cells. Of the 45 clones that were successfully sequenced, 39 contained unique 18 nucleotide inserts. The sequences of the other 6 clones were each represented more than once, which may reflect the relatively low complexity of selected sequences in these twice sorted cells. The sequenced clones were tested in transfected cells and most activities were weak or at a background level. However, one sequence, designated intercistronic sequence 1-23 (ICS1-23; SEQ ID NO: 105) demonstrated enhanced Photinus luciferase activity approximately 8-fold greater than the control constructs. This level of activity was similar to that observed for one copy of the Gtx IRES module
  • the 30 nucleotide ICS 1-23 sequence which includes the 18 nucleotide random sequence together with 12 nucleotides of flanking sequence, was divided into two segments of 15 nucleotides each (see Figure 4).
  • the first 15 nucleotide segment lacked any complementarity to 18S rRNA, (ICSl-23a), while the second segment contained the complementary match to 18S rRNA (ICSl-23b; CAGCGGAAACGAGCG; SEQ ID NO: 106).
  • ICS-23b did not enhance Photinus luciferase activity by other mechanisms such as alternative splicing or by functioning as a promoter.
  • the second retroviral library which contained random 9 nucleotide segments separated by a poly(A) 9 spacer in the intercistronic region of the encoded dicistronic mRNA, was examined in order to identify smaller translational regulatory elements. Incorporation of the spacer sequence was based on the determination that 9 nucleotide Gtx IRES module (SEQ ID NO: 102), when present in multiple copies separated by the poly(A) 9 spacer, exhibited greater IRES activity than a single copy of the module.
  • B104 cells were transduced with the second retroviral library, which was derived from 1.5 xl 0 5 retroviral plasmids. Approximately 0.3% of the cells were selected by FACS, and cultured and sorted a second time. Approximately 3% of the latter cells were high co-expressors.
  • the oligonucleotide inserts were recovered by genomic PCR and shotgun cloned into the intercistronic region of the RPh. One hundred clones were picked at random and 84 were successfully sequenced, yielding 37 different sequences. Fifteen of the sequences were represented two or more times, indicating that the complexity of the sequences represented in these twice sorted cells was somewhat lower than that of the first library. When tested by transient transfection in B 104 cells, most sequences enhanced Photinus luciferase activity weakly (about 2-fold or less above background), and none were as active as ICS 1 -23 (SEQ ID NO: 105).
  • the activity of the selected ICSl-23b (SEQ ID NO: 106) and ICS2-17.2 (SEQ ID NO: 108) IRES modules was examined in additional cell lines to determine whether they were active in cell types other than the B 104 neuroblastoma cells.
  • a construct of five linked copies of each module was active in each of the cells line tested, including rat glioma C6 cells, human neuroblastoma SK cells, mouse neuroblastoma N2a cells, mouse NIH-3T3 fibroblasts, human cervical carcinoma HeLa cells, normal rat kidney NRK cells, and mouse muscle myoblast C2C12 cells.
  • the activities of these synthetic IRESes varied as much as ten-fold between cell lines, and also varied with respect to each other.
  • the pattern of activity of the ICS-23b (SEQ ID NO: 106) module in the different cell lines tested was similar to that observed for ten-linked copies of the Gtx IRES module (SEQ ID NO: 102).
  • IRES or other translational regulatory activity. It is remarkable that each of the short IRES element disclosed herein, including the Gtx IRES (SEQ ID NO: 102), the ICS 1 -23b IRES (SEQ ID NO: 106), and the ICS2-17.2 IRES (SEQ ID NO: 108) can promote internal initiation. Each of these three IRES modules contain a complementary match to different segments of 18S rRNA, suggesting that a direct interaction occurs between the IRES module and the 40S ribosomal subunit via base pairing to 18S rRNA.
  • one or more of the IRES modules may recruits 40S ribosomal subunits by interacting with a protein component of the translational machinery, for example, a ribosomal protein, an initiation factor, or some other bridging protein.
  • a protein component of the translational machinery for example, a ribosomal protein, an initiation factor, or some other bridging protein.
  • the ability to initiate translation internally by binding to an initiation factor has been reported, wherein an iron response element (IRE) and the bacteriophage ⁇ transcriptional anti-terminator box B element were both demonstrated to function as IRESes in the presence of fusion proteins between the appropriate binding protein for these RNA elements and eIF4G (DeGregorio et al., EMBO J. 18:4865-4874, 1999).
  • IRE iron response element
  • bacteriophage ⁇ transcriptional anti-terminator box B element were both demonstrated to function as IRESes in the presence of fusion proteins between the appropriate binding protein for these RNA elements and
  • IRES module show enhanced IRES activity as compared to the corresponding monomers suggest that multiple copies of the IRES module may increase the probability of recruiting 40S ribosomal subunits.
  • eIF4G tethered to the IRE-binding protein where there was an approximately linear increase in translation when the number of IRE binding sites was increased from one site to three (DeGregorio et al., supra, 1999).
  • An arresting feature of cellular IRESes, as well as of the disclosed IRES modules, is their variable potency in different cell types. As such, selection for
  • IRESes in a variety of cell types can provide a means to identify additional elements having cell-specific and tissue-specific activities. If ribosomal recruitment requires direct interaction of IRESes with 18S rRNA, variations in efficiency may reflect differences in the accessibility of particular segments of 18S rRNA in different cell types. Alternatively, some IRES modules may require or be blocked by binding proteins that are differentially expressed in various cell types. Such possibilities can be distinguished by determining which proteins or components of the translation machinery bind to particular IRES sequences in various differentiated cells. In view of the modular nature of cellular IRES, combinations of synthetic IRESes can be constructed and elements having desirable regulatory actions can be selected. Such a combinatorial approach can be used to construct synthetic IRESes having variable translational regulatory activity, for example, highly restricted or widespread translational activity.
  • EXAMPLE 7 DESIGN OF IRES MODULES BASED ON rRNA STRUCTURE This example demonstrates that synthetic oligonucleotides having IRES activity can be designed based on the structure of ribosomal RNA molecules.
  • IRESes exist as modular structures composed of short, independent oligonucleotides, including oligonucleotide that are complementary to 18S rRNA, and synthetic IRESes have been identified that also are complementary to rRNA oligonucleotide sequences. These results indicate that recruitment of ribosomal subunits by IRES modules is directed by base pairing of the IRES element to the rRNA within the ribosomal subunit.
  • the 9 nucleotide Gtx IRES module (SEQ ID NO: 102) is 100% complementary to an oligonucleotide sequence of 18S rRNA, and was tested as an IRES module based on this observation. In addition, the ability of the Gtx IRES module (SEQ ID NO: 102) to recruit 40S ribosomal subunits by base pairing to 18S rRNA was examined. Nitrocellulose filter-binding and electrophoretic mobility gel shift assays established a physical link between the 9 nucleotide Gtx IRES module
  • Methods of predicting secondary structure for rRNA include, for example, methods using the mfold version 3.0 software (Zuker et al., in "RNA Biochemistry and Biotechnology” (ed. Clark; Kluwer academic publishers 1999), pages 11-43; Mathews et al., J. Mol. Biol. 288:911-940, 1999).
EP01903383A 2000-01-28 2001-01-26 Methoden zur identifizierung von regulatorischen elementen der transkription und translation und damit verwandte verbindungen Withdrawn EP1259602A1 (de)

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
US17881600P 2000-01-28 2000-01-28
US178816P 2000-01-28
US18649600P 2000-03-02 2000-03-02
US186496P 2000-03-02
US20780400P 2000-05-30 2000-05-30
US207804P 2000-05-30
US23085200P 2000-09-07 2000-09-07
US23095600P 2000-09-07 2000-09-07
US230956P 2000-09-07
US230852P 2000-09-07
US26131201P 2001-01-12 2001-01-12
US261312P 2001-01-12
PCT/US2001/002733 WO2001055371A1 (en) 2000-01-28 2001-01-26 Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same

Publications (1)

Publication Number Publication Date
EP1259602A1 true EP1259602A1 (de) 2002-11-27

Family

ID=27558689

Family Applications (2)

Application Number Title Priority Date Filing Date
EP01903343A Withdrawn EP1274838A1 (de) 2000-01-28 2001-01-26 Synthetische ribosomale eintrittsseiten und methoden um diese zu identifizieren
EP01903383A Withdrawn EP1259602A1 (de) 2000-01-28 2001-01-26 Methoden zur identifizierung von regulatorischen elementen der transkription und translation und damit verwandte verbindungen

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP01903343A Withdrawn EP1274838A1 (de) 2000-01-28 2001-01-26 Synthetische ribosomale eintrittsseiten und methoden um diese zu identifizieren

Country Status (6)

Country Link
US (3) US7183395B2 (de)
EP (2) EP1274838A1 (de)
AU (4) AU3117101A (de)
BR (2) BR0107930A (de)
CA (2) CA2398541A1 (de)
WO (2) WO2001055369A1 (de)

Families Citing this family (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7183395B2 (en) * 2000-01-28 2007-02-27 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
DE10049587A1 (de) 2000-10-06 2002-05-02 Icon Genetics Ag Vektorsystem für Pflanzen
US7575924B2 (en) 2000-11-13 2009-08-18 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
CA2439312A1 (en) * 2001-03-01 2002-09-12 Cistem Molecular Corporation Methods for global profiling gene regulatory element activity
JP2004537280A (ja) * 2001-03-07 2004-12-16 ゼノジェン コーポレイション 標的細胞中へのdnaの導入についてのスクリーニング方法
CA2442024A1 (en) * 2001-03-29 2002-10-10 Evogene Ltd. Methods, platforms and kits useful for identifying, isolating and utilizing nucleotide sequences which regulate gene expression in an organism
DE10121283B4 (de) 2001-04-30 2011-08-11 Icon Genetics GmbH, 80333 Verfahren und Vektoren zur Amplifikation oder Expression von gewünschten Nucleinsäuresequenzen in Pflanzen
EP1412493B1 (de) 2001-08-02 2011-10-05 Institut Clayton De La Recherche Verfahren und zusammensetzungen im zusammenhang mit verbesserten lentivirusvektor-produktionssystemen
DE10143238A1 (de) 2001-09-04 2003-03-20 Icon Genetics Ag Identifizierung eukaryotischer interner Ribosomen-Eingangsstellen (IRES)-Elemente
DE10143237A1 (de) 2001-09-04 2003-03-20 Icon Genetics Ag Herstellung künstlicher interner ribosomaler Eingangsstellenelemente (Ires-Elemente)
KR20040054699A (ko) 2001-10-02 2004-06-25 엥스띠뛰 끌레이톤 드 라 러쉐르쉬 제한된 발현의 렌티바이러스 벡터 및 이의 적용과 관련된방법 및 조성물
US20080076678A1 (en) 2005-06-15 2008-03-27 Philippe Soucaille Method of creating a library of bacterial clones with varying levels of gene expression
EP1565559B1 (de) * 2002-11-12 2011-05-18 Zakrytoe Aktsionernoe Obschestvo " Evrogen" Fluoreszenzproteine und chromoproteine aus nicht-aequorea-hydrozoa-spezies sowie verfahren zur verwendung davon
CN101386855A (zh) 2003-03-12 2009-03-18 伊沃基因有限公司 调节基因表达的核苷酸序列和构建体及其使用方法
US20050037409A1 (en) * 2003-07-29 2005-02-17 Kauvar Lawrence M. Translocation tagging
US8293503B2 (en) 2003-10-03 2012-10-23 Promega Corporation Vectors for directional cloning
ATE442445T1 (de) * 2003-10-03 2009-09-15 Promega Corp Rhamnose-induzierbares expressionssystem
CA2562893A1 (en) * 2004-04-28 2005-11-10 The Trustees Of The University Of Pennsylvania Polyvalent viral vectors and a system for production thereof
US7709625B2 (en) * 2004-06-10 2010-05-04 The Board Of Regents Of The University Of Texas Methods and compositions for bone marrow stem cell-derived macrophage delivery of genes for gene therapy
US9068197B2 (en) 2005-08-24 2015-06-30 The Scripps Research Institute Translation enhancer-element dependent vector systems
US20090143240A1 (en) * 2005-08-25 2009-06-04 Harbison Christopher T Novel Methods for Genome-Wide Location Analysis
WO2007038757A2 (en) * 2005-09-28 2007-04-05 Attagene Inc. Methods and compositions for non-invasive assessment of gene expression
US7951536B2 (en) * 2006-02-20 2011-05-31 National University Corporation Hokkaido University Method for determining base sequence of DNA
CN101512016B (zh) * 2006-06-30 2016-08-03 迪斯卡沃雷克斯公司 可检测的核酸标签
EP2185711B1 (de) 2007-08-10 2017-05-10 Wayne State University Zusammensetzungen und verfahren zur erkennung und modulierung von zelltod anhand eines translationsregulierten genexpressionssystems
EP2535419A3 (de) * 2007-09-26 2013-05-29 Intrexon Corporation Synthetische 5'UTRs, Expressionsvektoren und Verfahren zur Erhöhung der Transgenexpression
SG10201408165WA (en) * 2007-12-11 2015-01-29 Scripps Research Inst Compositions and methods related to mrna translational enhancer elements
US9388405B2 (en) 2009-02-18 2016-07-12 Wayne State University Method for identifying a subpopulation of mammalian cells with distinctive ribosome translation profiles
US8741559B2 (en) 2009-04-24 2014-06-03 Discoverx Corporation Cellular assay employing detectable protein
US20130230884A1 (en) * 2010-07-16 2013-09-05 John Chaput Methods to Identify Synthetic and Natural RNA Elements that Enhance Protein Translation
WO2012063799A1 (ja) * 2010-11-08 2012-05-18 日本ケミカルリサーチ株式会社 新規発現ベクター
EP2705152B1 (de) * 2011-05-04 2017-10-25 The Broad Institute, Inc. Multiplexierte genetische reporterassays und zusammensetzungen dafür
CN102517282B (zh) * 2011-12-30 2013-10-30 中国人民解放军军事医学科学院放射与辐射医学研究所 一种富集分离内源转录因子及其复合物的方法及其专用转录因子串联结合序列
US20150307542A1 (en) 2012-10-03 2015-10-29 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
US20140107589A1 (en) * 2012-10-17 2014-04-17 Farid Amirouche Electromagnetically actuated valve and related methods of use
PL2922554T3 (pl) 2012-11-26 2022-06-20 Modernatx, Inc. Na zmodyfikowany na końcach
EP2946014A2 (de) 2013-01-17 2015-11-25 Moderna Therapeutics, Inc. Signal-sensor-polynukleotide zur veränderung zellulärer phänotypen
EP2801622A1 (de) * 2013-05-08 2014-11-12 DeltaCell B.V. Multi-Tag-Reportersystem
JP6625521B2 (ja) 2013-05-15 2020-01-08 リボカイン,エルエルシー 環状rnaの細胞内翻訳
WO2015071295A1 (en) * 2013-11-12 2015-05-21 Vrije Universiteit Brussel Rna transcription vector and uses thereof
GB201406006D0 (en) * 2014-04-03 2014-05-21 Norwegian Univ Sci & Tech Ntnu Synthetic mRNA leaders
EP3461904A1 (de) 2014-11-10 2019-04-03 ModernaTX, Inc. Alternative nukleinsäuremoleküle mit reduziertem uracilgehalt und verwendungen davon
EP4101930A1 (de) 2015-09-17 2022-12-14 ModernaTX, Inc. Polynukleotide mit stabilisierendem schwanzbereich
AU2016324310B2 (en) 2015-09-17 2021-04-08 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
WO2017066789A1 (en) 2015-10-16 2017-04-20 Modernatx, Inc. Mrna cap analogs with modified sugar
WO2017066791A1 (en) 2015-10-16 2017-04-20 Modernatx, Inc. Sugar substituted mrna cap analogs
US20190225644A1 (en) 2015-10-16 2019-07-25 Modernatx, Inc. Mrna cap analogs and methods of mrna capping
WO2017066782A1 (en) 2015-10-16 2017-04-20 Modernatx, Inc. Hydrophobic mrna cap analogs
US20190218546A1 (en) 2015-10-16 2019-07-18 Modernatx, Inc. Mrna cap analogs with modified phosphate linkage
DK3394030T3 (da) 2015-12-22 2022-03-28 Modernatx Inc Forbindelser og sammensætninger til intracellulær afgivelse af midler
US10689689B2 (en) * 2015-12-28 2020-06-23 Roche Molecular Systems, Inc. Generic method for the stabilization of specific RNA
WO2017127750A1 (en) 2016-01-22 2017-07-27 Modernatx, Inc. Messenger ribonucleic acids for the production of intracellular binding polypeptides and methods of use thereof
US20190167811A1 (en) 2016-04-13 2019-06-06 Modernatx, Inc. Lipid compositions and their uses for intratumoral polynucleotide delivery
JP7246930B2 (ja) 2016-05-18 2023-03-28 モデルナティエックス インコーポレイテッド インターロイキン-12(il12)をコードするポリヌクレオチドおよびその使用
US20190275170A1 (en) 2016-05-18 2019-09-12 Modernatx, Inc. Polynucleotides encoding jagged1 for the treatment of alagille syndrome
EP3468537A1 (de) 2016-06-14 2019-04-17 Modernatx, Inc. Stabilisierte formulierungen von lipidnanopartikeln
WO2018089540A1 (en) 2016-11-08 2018-05-17 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
DE102017103383A1 (de) * 2017-02-20 2018-08-23 aReNA-Bio GbR (vertretungsberechtigter Gesellschafter: Dr. Heribert Bohlen, 50733 Köln) System und Verfahren zur Zelltyp-spezifischen Translation von RNA-Molekülen in Eukaryoten
CA3055653A1 (en) 2017-03-15 2018-09-20 Modernatx, Inc. Lipid nanoparticle formulation
HUE060693T2 (hu) 2017-03-15 2023-04-28 Modernatx Inc Vegyület és készítmények terápiás szerek intracelluláris bejuttatására
WO2018231990A2 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase
WO2018232120A1 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
WO2019036638A1 (en) 2017-08-18 2019-02-21 Modernatx, Inc. METHODS FOR PREPARING MODIFIED RNA
JP7275111B2 (ja) 2017-08-31 2023-05-17 モデルナティエックス インコーポレイテッド 脂質ナノ粒子の生成方法
CN109553686A (zh) * 2017-09-26 2019-04-02 南京安吉生物科技有限公司 一种新型可调控的双嵌合抗原受体t细胞及其构建方法和应用
US20190330591A1 (en) 2018-01-10 2019-10-31 Rubius Therapeutics, Inc. Amplifiable rnas for therapeutic cell systems
US11875876B2 (en) 2018-06-15 2024-01-16 Massachusetts Institute Of Technology Synthetic 5' UTR sequences, and high-throughput engineering and screening thereof
WO2020061367A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
JP2022501367A (ja) 2018-09-20 2022-01-06 モデルナティエックス インコーポレイテッドModernaTX, Inc. 脂質ナノ粒子の調製及びその投与方法
JP2022523117A (ja) 2019-01-31 2022-04-21 モデルナティエックス インコーポレイテッド ボルテックスミキサならびにその関連する方法、システム、及び装置
KR20210135494A (ko) 2019-01-31 2021-11-15 모더나티엑스, 인크. 지질 나노입자의 제조 방법
US20230008266A1 (en) * 2019-11-07 2023-01-12 Icahn School Of Medicine At Mount Sinai Synthetic modified rna and uses thereof
CN110819707B (zh) * 2019-11-24 2023-07-18 中南大学湘雅医院 一种针对多种来源细胞样本中内部核糖体结合位点元件的高通量鉴定方法
TW202204622A (zh) 2020-04-09 2022-02-01 大陸商蘇州艾博生物科技有限公司 針對冠狀病毒之核酸疫苗
AU2021254312B2 (en) 2020-04-09 2024-01-11 Suzhou Abogen Biosciences Co., Ltd. Lipid nanoparticle composition
KR20230030588A (ko) 2020-06-30 2023-03-06 쑤저우 아보젠 바이오사이언시스 컴퍼니 리미티드 지질 화합물 및 지질 나노입자 조성물
WO2022020811A1 (en) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Lipidnanoparticle comprising modified nucleotides
KR20230054672A (ko) 2020-08-20 2023-04-25 쑤저우 아보젠 바이오사이언시스 컴퍼니 리미티드 지질 화합물 및 지질 나노입자 조성물
KR20230129479A (ko) 2021-01-08 2023-09-08 스트랜드 세러퓨틱스 인코포레이티드 발현 구성체 및 이의 용도
WO2022152109A2 (en) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Lipid compounds and lipid nanoparticle compositions
WO2022152141A2 (en) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Polymer conjugated lipid compounds and lipid nanoparticle compositions
AU2022281746A1 (en) 2021-05-24 2023-09-14 Suzhou Abogen Biosciences Co., Ltd. Lipid compounds and lipid nanoparticle compositions
CA3234127A1 (en) 2021-10-08 2023-04-13 Suzhou Abogen Biosciences Co., Ltd. Lipid compounds and lipid nanoparticle compositions
CN116064598B (zh) 2021-10-08 2024-03-12 苏州艾博生物科技有限公司 冠状病毒的核酸疫苗
AR127312A1 (es) 2021-10-08 2024-01-10 Suzhou Abogen Biosciences Co Ltd Compuestos lipídicos ycomposiciones de nanopartículas lipídicas
WO2023212618A1 (en) 2022-04-26 2023-11-02 Strand Therapeutics Inc. Lipid nanoparticles comprising venezuelan equine encephalitis (vee) replicon and uses thereof
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
WO2024026490A1 (en) 2022-07-28 2024-02-01 Sqz Biotechnologies Company Polynucleotides encoding linked antigens and uses thereof
WO2024037578A1 (en) 2022-08-18 2024-02-22 Suzhou Abogen Biosciences Co., Ltd. Composition of lipid nanoparticles

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4228458A1 (de) * 1992-08-27 1994-06-01 Beiersdorf Ag Multicistronische Expressionseinheiten und deren Verwendung

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2162056A1 (en) * 1993-01-20 1994-11-10 Christian A. Le Guern Retroviral vectors capable of expressing multimeric proteins from multiple translational initiation sites
US5686120A (en) * 1995-05-22 1997-11-11 Wisconsin Alumni Research Foundation Pre-mRNA processing enhancer and method for intron-independent gene expression
CA2205888A1 (en) 1997-07-11 1999-01-11 John J. Priatel Complementation trap
CA2309000A1 (en) * 1997-11-13 1999-05-27 Regents Of The University Of Minnesota Tc1-based transposon vectors
US7183395B2 (en) * 2000-01-28 2007-02-27 The Scripps Research Institute Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4228458A1 (de) * 1992-08-27 1994-06-01 Beiersdorf Ag Multicistronische Expressionseinheiten und deren Verwendung

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BELL P.J.L. ET AL: "Yeast functional analysis report/FACILITATING FUNCTIONAL ANALYSIS OF THE SACCHAROMYCES CEREVISIAE GENOME USING AN EGFP-BASED PROMOTER LIBRARY AND FLOW CYTOMETRY", YEAST, vol. 15, 31 July 1999 (1999-07-31), pages 1747 - 1759, XP002954866 *
GROSS ET AL: "Selection of ten base-pair sequences which enhance the response of the Gal1 minimal promoter to murine Hoxa-7 in yeast.", JMB, vol. 247, 1995, pages 173 - 190 *
REBATCHOUK D. ET AL: "NOMAD: A versatile strategy for in vitro DNA manipulation applied to promoter analysis and vector design", PNAS, vol. 93, 1996, pages 10891 - 10896, XP002482732, DOI: doi:10.1073/pnas.93.20.10891 *
See also references of WO0155371A1 *
VALDIVIA R.H. ET AL: "BACTERIAL GENETICS BY FLOW CYTOMETRY: RAPID ISOLATION OF SALMONELLA TYPHIMURIUM ACID-INDUCIBLE PROMOTERS BY DIFFERENTIAL FLUORESCENCE INDUCTION", MOLECULAR MICROBIOLOGY, vol. 22, 1996, pages 367 - 378, XP001119818 *

Also Published As

Publication number Publication date
AU2001231171B2 (en) 2007-01-04
CA2398790A1 (en) 2001-08-02
US7183395B2 (en) 2007-02-27
US7456273B2 (en) 2008-11-25
EP1274838A1 (de) 2003-01-15
AU3120601A (en) 2001-08-07
BR0107943A (pt) 2003-01-28
US20070270580A1 (en) 2007-11-22
AU2001231171B8 (en) 2001-08-07
CA2398541A1 (en) 2001-08-02
WO2001055371A1 (en) 2001-08-02
WO2001055369A1 (en) 2001-08-02
WO2001055369A9 (en) 2002-10-31
US20090093049A1 (en) 2009-04-09
BR0107930A (pt) 2004-06-15
US20040005564A1 (en) 2004-01-08
AU2007202122A1 (en) 2007-05-31
AU3117101A (en) 2001-08-07

Similar Documents

Publication Publication Date Title
US7456273B2 (en) Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
US7468275B2 (en) Synthetic internal ribosome entry sites and methods of identifying same
US9493768B2 (en) Translational enhancer-element dependent vector systems
AU738156B2 (en) Viral vectors and their uses
US6025192A (en) Modified retroviral vectors
AU2001231171A1 (en) Synthetic internal ribosome entry sites and methods of identifying same
WO1998012339A9 (en) Viral vectors and their uses
AU736267B2 (en) Vectors and methods for the mutagenesis of mammalian genes
AU2001231206B2 (en) Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
AU2001231206A1 (en) Methods of identifying synthetic transcriptional and translational regulatory elements, and compositions relating to same
US20050074889A1 (en) Methods for gene function analysis
AU773277B2 (en) Viral vectors and their uses
US20020076688A1 (en) Compositions and methods for the discovery and selection of biological information
AU778904B2 (en) Vectors and methods for the mutagenesis of mammalian genes
US20030059858A1 (en) Functional screening for transcription factors
MANUAL ViraPort XR Plasmid cDNA Library

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020828

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: MEECH, ROBYN

Inventor name: EDELMAN, GERALD, M.

Inventor name: JONES, FREDERICK, S.

Inventor name: OWENS, GEOFFREY

Inventor name: MAURO, VINCENT, P.

Inventor name: CHAPPELL, STEPHEN, A.

17Q First examination report despatched

Effective date: 20060619

17Q First examination report despatched

Effective date: 20060619

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090415