Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4702—Regulators; Modulating activity
  • C07K14/4703—Inhibitors; Suppressors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2500/00—Screening for compounds of potential therapeutic value
  • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
  • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10S977/00—Nanotechnology
  • Y10S977/70—Nanostructure
  • Y10S977/788—Of specified organic or carbon-based composition
  • Y10S977/797—Lipid particle
  • Y10S977/798—Lipid particle having internalized material
  • Y10S977/799—Containing biological material
  • Y10S977/80—Nucleic acid, e.g. DNA or RNA
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
  • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10S977/00—Nanotechnology
  • Y10S977/902—Specified use of nanostructure
  • Y10S977/904—Specified use of nanostructure for medical, immunological, body treatment, or diagnosis
  • Y10S977/915—Therapeutic or pharmaceutical composition

Definitions

• the present invention relates to the therapeutic field. It relates more particularly to new therapeutic molecules and their use for the treatment of cardiovascular pathologies.
• Post-angioplasty restenosis is a localized hyperproliferative disorder that develops as a result of non-surgical intervention in the atherosclerotic plaque.
• the treatment of an atherosclerotic lesion by angioplasty very frequently (up to 50% of cases in some studies) results in restenosis following mechanical injury to the arterial wall.
• CML smooth muscle cells
• gax Growth-Arrest-Specific Homeobox
• the gax gene was initially identified from an aorta cDNA library. rat. It codes for a protein of 303 amino acids. His streak was characterized and his cDNA clone (Gorski et al., Mol.Cell.Biol. 1993, 6, 3722-3733). The human gax gene has also been cloned and sequenced (David F. Le Page et al., Genomics 1994,24,535-540). It codes for a protein of 302 amino acids.
• the gax gene has certain properties similar to the gas and Gadd genes since it also seems to control the G0 / G1 transition of the cell cycle.
• the levels of gax mRNA are reduced in rat LVMC by a factor of 10 after two hours of exposure to PDGF (Gorski et al., Mol.Cell.Biol. 1993, 6, 3722-3733).
• the expression of the gax gene is therefore repressed during the mitogenic response of CMLV.
• Another characteristic of the gax gene lies in its specificity of expression. Indeed, in the adult rat, the gax gene is mainly expressed in the cardiovascular system (aorta, heart). The presence of gax mRNA has not been demonstrated by Northern Blot in the liver, brain, stomach and skeletal muscle.
• the gax gene belongs to the family of homeotic genes. These genes code for transcriptional factors which contain consensus (or homeodomain) sequences recognizing specific regions of DNA (or homeoboxes) (review: Gehring et al. Cell, 78: 211-223, 1994). The homeodomain of the rat gax protein is between amino acids 185 and 245. Interestingly, the homeotic genes identified to date are involved in the control of cell differentiation / growth during embryogenesis, which reinforces the therapeutic potential of the gax gene (review: Lawrence and Morata Cell 78: 181-189, 1994; Krumlauf, Cell 78: 191-201, 1994).
• GAX One of the characteristics of GAX is that it undergoes down regulation as soon as CML proliferate, whether in vitro in response to growth factors or in vivo following damage to the endothelium of the vascular wall. This repression is reversible because when the SMCs are made quiescent by deprivation in serum, in vitro, the expression of GAX resumes.
• Work in our laboratory has recently shown that overexpression of GAX in SMCs by an adenoviral vector blocks their proliferation FR 95/04234 (ST95022).
• the Ki antigen is a protein of around 32 KDa. It was identified for the first time as a nuclear autoantigen recognized by sera from lupus erythematosus patients (Nikaido et al 1989, Clin. Exp. Immunol 1990, 79, 209-214) Recent work has shown that Ki is overexpressed in proliferating cells or transformed by an oncogene (Nikaido et al 1989, Exp .
• GAX acts essentially as a transcription repressor This repression activity is linked more particularly to the first 32 amino acids of GAX
• this repressor domain is localized in the region (1- 222) of GAX required for interaction with Ki in yeast.
• Another aspect of the invention relates to areas of GAX involved in the biological activity of GAX. These may include areas involved in the interaction of GAX with other molecules or areas responsible for biological activity.
• the invention also relates to chimeric molecules comprising a functional domain of GAX. It also relates to the use of GAX to suppress gene expression, as well as the use of compounds inhibiting the interaction of GAX with certain cellular partners to modulate the activity of GAX. It also relates to a method for screening and / or identifying GAX cellular partners
• the gax gene has particularly advantageous properties for gene therapy applications of hyperproliferative disorders, in particular restenosis or other pathologies associated with a proliferation of CML II was demonstrated in application FR95 / 04234 ( ST95022) that the transfer of the gax gene in vivo makes it possible to considerably reduce the proliferation of CMLs, and thus, to inhibit the reduction in luminal diameter II was also shown in application FR 95/12871 (ST95057) that the gax gene, expressed in tumor cells, allowed to oppose the cell transformation process
• the present application now describes the identification of functional domains of GAX, the construction of GAX derivatives exhibiting a biological activity, the identification of partners of the GAX protein and the development of methods allowing the search for other partners and the 'identification of compounds capable of interacting on the activity of these partners More specifically, the applicant has now shown that the GAX protein is endowed with transcription repressor activity. It also showed that this activity was carried by certain regions of the GAX protein, in particular the N-terminal region.
• Ki II is known in the literature Ki interacts with PCNA (Takeushi et al abstract 1995 Juntendo University, Tokyo, Japan) and that this is a cofactor essential for DNA polymerase for DNA replication (Fukuda et al. 1995, J. Biol. Chem. 270, 22527-22534). It has been demonstrated in the examples that Gax interacts with PCNA, thus it is conceivable that GAX can also be involved in replicative complexes in the cell.
• a first object of the invention relates more particularly to a polypeptide characterized in that it is all or part of a fragment of the GAX protein having an activity of repressor of transcription and / or positively or negatively affecting replication DNA.
• the polypeptide according to the invention comprises at least residues 1 to 32 of the human GAX protein.
• the polypeptide according to the invention comprises at least residues 104 to 230 of the human GAX protein.
• polypeptides comprising fragments 1-32, 33-302 and 1-104 of the human GAX protein.
• the examples presented below show that such polypeptides are capable of inhibiting the transcription of genes and therefore retain the transcriptional repressor properties of GAX.
• this polypeptide comprises, in addition to a fragment of the GAX protein in accordance with the present invention, a fragment of different origin.
• fragment of different origin is meant a polypeptide fragment not derived from the GAX protein. It can be a synthetic, artificial fragment, a protein fragment, etc. This fragment of different origin can have different functions.
• Such a marker can for example constitute a marker making it possible to detect the polypeptide and optionally to trace it in vivo.
• a marker can for example be an epitope recognized by a monoclonal antibody.
• various labeling sequences called Tag sequences, have been described in the literature and are usually used. We can mention the tag-myc sequence.
• This fragment can also be a fragment having the property of stabilizing the polypeptide.
• it may be all or part of a protein having a high plasma half-life.
• it can also be a targeting element, allowing the polypeptide to reach specific cellular compartments more quickly and / or more specifically.
• it is a nuclear localization signal (NLS), the polypeptide mainly exercising its activity in the nucleus of cells
• NLS signals have been described in the literature, for example that of the T antigen of the SV40 virus, that of p53, etc.
• the fragment of different origin can also confer on the polypeptide an additional biological function or promote the activity of the repressor domain.
• a protein domain capable of specifically binding DNA This type chimeric molecule thus makes it possible to bind DNA into particular regions and to inhibit the transcription of genes located at the level of these regions.
• the DNA binding domain of the GAL4 protein of yeast Such constructs are described in the examples. They can be used to regulate the expression of genes in yeast or of genes placed under the control of an expression signal comprising the binding site of the GAL4 protein.
• DNA binding proteins can be for example Lex A, the DNA binding domain of a nuclear receptor such as the estrogen receptor es or any other member of this family, etc.
• It may also be a peptide allowing on the one hand the secretion of all or part of GAX, as well as its targeting towards membrane receptors allowing its internalization and thus increasing the diffusibility and the field of activity of GAX by a "Bystander" type effect.
• it is more particularly possible to use all or part of the transferrin or fragments of the molecule of the extracellular matrix capable of recognizing integrins on the surface of CML
• polypeptides according to the invention are particularly advantageous from the therapeutic point of view and from that of applied research.
• the therapeutic activity of the claimed polypeptides is linked more particularly to their ability to repress transcription or to affect DNA replication, by analogy with the GAX protein and therefore to give them a power to regulate the expression of other proteins.
• the present invention also relates to the use of the GAX protein or of a fragment as claimed for suppressing gene transcription and / or positively or negatively affecting DNA replication.
• these fragments can advantageously be substituted for it in its function of transcription repressor. Furthermore, taking into account the fact that they only comprise the GAX protein that all or part of its domain involved in repression of transcription, it is possible to think that they will be less sensitive to the various alterations to which the GAX protein is subject. These polypeptides as such or derivatives can therefore manifest a repressor character of the increased transcription compared to that of the natural GAX protein.
• the present invention also relates to a method for the screening and / or identification of polypeptides interacting with the GAX protein or a GAX domain characterized in that it implements a polypeptide according to the invention. More preferentially, this polypeptide is chosen from there fragments 32 and 33 to 302 of the GAX protein.
• Ki is an autoantigen that appears in autoimmune diseases such as lupus erythematosus. It is described as a nuclear molecule whose expression increases during cell proliferation as well as in fibroblasts transformed by an oncogene.
• the recombinant protein Ki specifically recognizes GAX transferred to a nitrocellulose filter from a denaturing polyacrylamide gel.
• the present invention also specifically relates to a polypeptide characterized in that it is a fragment of the GAX protein capable of interacting with the Ki protein. More preferably, it is fragment 1 to 32 or 104 to 223 of the GAX protein.
• the Applicant has also very unexpectedly shown that a domain of the GAX protein can interact in a specific manner with the proliferation marker PCNA (Proliferating Cell Nuclear Antigen). This factor is essential for DNA replication and also plays a role in DNA repair phenomena.
• the present invention therefore relates to a polypeptide characterized in that it is a fragment of the GAX protein, capable of interacting with PCNA.
• Ki exists in the form of a complex with PCNA. Ki can therefore interact with both GAX and PCNA by forming an at least bipartite complex with one or other of these proteins and preferably a tripartite complex. The formation of these complexes has an important role in the progression of the cell cycle (activation or inhibition).
• the present invention also relates to a polypeptide characterized in that it is a fragment of the GAX protein capable of interacting with Ki and / or PCNA and of forming an at least bipartite or at least tripartite complex with these proteins.
• nucleic acid coding for a polypeptide may be sequences of natural or artificial origin, and in particular genomic DNA, cDNA, mRNA, hybrid sequences or synthetic or semi-synthetic sequences.
• This nucleic acid can be of human, animal, plant, bacterial, viral, etc. origin. It can be obtained by any technique known to those skilled in the art, and in particular by screening of banks, by chemical synthesis, or also by mixed methods including chemical or enzymatic modification of sequences obtained by screening of banks. They can also be incorporated into vectors, such as plasmid vectors.
• the nucleic acid according to the invention is a cDNA.
• nucleic acids of the invention can be used for the production of probes or antisense molecules making it possible, by hybridization, to detect the presence or the expression of nucleic acids coding for polypeptides carrying a repressor domain according to the invention, or of inhibiting the expression of such polypeptides.
• probes these preferably comprise more than 10 bases and, advantageously, from 10 to 300 bases.
• nucleic acids of the invention can be used for the expression and / or production of polypeptides in vitro, in vivo or ex vivo, in gene or cell therapy approaches.
• the present invention relates to expression cassettes containing a nucleic acid as defined above, under the control of a promoter allowing its expression.
• Different promoters can be used in the context of the invention. These are sequences allowing the expression of a nucleic acid in a mammalian cell.
• the promoter is advantageously chosen from functional promoters in human cells. More preferably, it is a promoter allowing the expression of a nucleic acid sequence in a hyperproliferative cell (cancerous, restenosis, etc.). In this regard, different promoters can be used. It can thus be any promoter or derived sequence stimulating or repressing the transcription of a gene in a specific way or not, inducible or not, strong or weak. Mention may in particular be made of the promoter sequences of eukaryotic or viral genes. For example, they may be promoter sequences derived from the genome of the target cell.
• ubiquitous promoters can be used in particular (promoter of the ITPRT, PGK genes, alpha-actin, tubulin, DFfFR, etc.), promoters of intermediate filaments (promoter of the GFAP genes, desmin, vimentin, neurofilaments, keratin, etc), promoters of therapeutic genes (for example the promoter of the MDR, CFTR genes, Factor VIII, ApoAI, etc.), tissue-specific promoters (promoter of the pyruvate kinase gene, villin, intestinal fatty acid binding protein, alpha smooth muscle actin, etc.), promoters of specific cells of the dividing cell type such as cancer cells or of promoters responding to a stimulus (steroid hormone receptor, retinoic acid receptor, glucocorticoid receptor, etc.) or so-called inducible.
• promoters of specific cells of the dividing cell type such as cancer cells or of promoters responding to a stimulus (steroid hormone receptor, retinoi
• promoter sequences originating from the genome of a virus such as for example the promoters of the El A and MLP genes of adenovirus, the early promoter of CMV, or the promoter of the LTR of RSV, etc.
• these promoter regions can be modified by adding activation or regulatory sequences, or allowing tissue-specific or majority expression.
• the present invention now provides new therapeutic agents making it possible, by their ability to repress transcription, to interfere with numerous cellular dysfunctions.
• the nucleic acids or cassettes according to the invention can be injected as such at the site to treat or incubate directly with the cells to be destroyed or treat It has in fact been described that naked nucleic acids can penetrate cells without any particular vector Nevertheless, it is preferred in the context of the present invention to use an administration vector, allowing improve (i) the efficiency of cell penetration, (ii) targeting and (iii) extra- and intracellular stability
• the nucleic acid or the cassette is incorporated into an expression vector.
• the vector used can be of chemical origin (liposome, nanoparticle, peptide complex, lipids or cationic polymers, etc. retrovirus, adenovirus, herpes virus, AAV, vaccinia virus, etc.) or plasmid
• viral vectors are based on the natural properties of transfection of viruses. It is thus possible to use, for example, adenoviruses, herpes viruses, retroviruses and associated adeno viruses. These vectors prove to be particularly effective in terms of transfection
• a preferred object according to the invention resides in a defective recombinant retrovirus whose genome comprises a nucleic acid as defined above.
• Another particular object of the invention resides in a defective recombinant adenovirus whose genome comprises a nucleic acid as defined above
• the vector according to the invention may also be a non-viral agent capable of promoting the transfer and expression of nucleic acids in eukaryotic cells.
• the chemical or biochemical vectors, synthetic or natural represent an interesting alternative to natural viruses, in particular for for reasons of convenience, safety and also by the absence of a theoretical limit as regards the size of the DNA to be transfected.
• These synthetic vectors have two main functions, compacting the nucleic acid to be transfected and promoting its cellular fixation as well as its passage through the plasma membrane and, where appropriate, the two nuclear membranes To compensate for the polyanionic nature of nucleic acids, the non-viral vectors all have polycationic charges
• the nucleic acid or vector used in the present invention can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. administration.
• the nucleic acid or the vector is used in an injectable form II can therefore be mixed with any pharmaceutically acceptable vehicle for an injectable formulation, in particular for a direct injection at the site to be treated II can be in particular sterile, isotonic solutions, or dry compositions, in particular lyophilized, which, by addition as the case may be of sterilized water or physiological saline, allow the constitution of injectable solutes
• the doses of nucleic acid used can be adapted according to different parameters, and in particular according to the gene , the vector, the method of administration used, the pathology concerned or the duration of u treatment sought
• the invention also relates to any pharmaceutical composition comprising at least one nucleic acid as defined above
• composition comprising at least one vector as defined above
• the pharmaceutical compositions according to the invention are very particularly suitable for the treatment of hyperproliferative disorders, such as in particular cancers and restenosis.
• the present invention thus provides a particularly effective method for the destruction of cells, in particular of hyperproliferative cells It is thus applicable to the destruction of tumor cells or smooth muscle cells of the vascular wall (restenosis) It is very particularly suitable for the treatment of cancers
• colon adenocarcinomas cancers thyroid, lung carcinoma, myeloid leukemia, colorectal cancer, breast cancer, lung cancer, gastric cancer, esophageal cancer, B lymphoma, ovarian cancer, cancer bladder, glioblastomas, hepatocarcinomas, bone cancer, skin, pancreas or again kidney and prostate cancer, esophageal cancer, larynx cancer, head and neck cancer, HPV positive anogenital cancer, EBV positive nasopharyngeal cancer, etc.
• the present invention further extends to any use of compounds which inhibit the activity of the Ki protein and or of PCNA for inhibiting the proliferation of smooth muscle cells.
• the present invention also relates to the use of compounds according to the invention for the formation of a two- or three-partite complex with the proteins Ki and / or PCNA to positively or negatively affect the progression of the cell cycle
• FIG. 1 Northern blotting analysis of Ki protein expression from mRNAs extracted from different tissues
• Figure 4 A Representation of the construction of the Reporter gene expressing bacterial chloramphenicol acetyl transferase (CAT) under the control of an artificial promoter
• strain YCM79 of the genus S.cerevisiae (MATa, ⁇ ra3-52, h ⁇ s3-200, ade2-101, lys 2- 801, trpl-901, Ieu2-3, 112, canl, gal-f-542, ga / 80- 538, metI6 :: URA3-pGALl 10- LacZ, HIS3:: GAL7BLE) was used as a screening tool for the lung fusion bank by the two hybrid system
• This medium was made solid by the addition of 20 g / l of agar (Difco)
• This medium can be made solid by adding 20g / l of agar (Difco)
• the Escheriehia coli strain TG1 of genotype supE, hsdD5, thi, D (lac-proAB), F'ftra D36 pro AB lacP lacZDM15] was used as a means of amplification and isolation of the recombinant plasmids used
• the E coli bacteria used are BL-21 obtained from Pharmacia E coli They have the F " ompT hsdS b (r h .m h ) gai dcm (DE3) genotype.
• BL-21 is a strain of choice for the production of recombinant proteins because it has no protease and its membrane is fragile, easy to break by simple sonication
• E coli BL-21 has a repression system for T7 RNA polymerase This repression can be raised by IPTG which allows the control of genes placed downstream of the T7 RNA polymerase binding site
• the bacteria are cultured in 2 ml of LB medium (NaCl 5 g / 1, Tryptone 10 g / 1 , Yeast extract 5 g / 1) in a shaker at 37 ° C overnight 1 ml of this preculture is re-cultured in 50 ml of 2xYT medium (NaCl 5 g / 1, Tryptone 16 g / 1, Yeast extract 10 g 1) at 37 ° C until the bacteria reach an optical density (OD) of 0.4 to 600 nm (exponential growth phase)
• the culture of the bacteria is cooled on ice They are centrifuge
• the E Coli bacteria competent for the production of recombinant proteins, are prepared by the calcium chloride method. To do this, the bacteria are dissolved in 5 ml of 0.1 M CaCL2 (1/10 of the culture). They are centrifuged again at 3300 rpm for 10 min. They are redissolved in 1 ml of 0.1 M CaCl 2 containing 17.5% glycerol They are aliquoted and stored at -80 ° C.
• the plasmids used are
• the vectors of the pGBT and pAS series (Clontech), shuttle plasmids which have an origin of bacterial and yeast replication allowing them to replicate at high copy number in these two microorganisms
• These plasmids contain a multiple cloning site located downstream of the sequence coding for the DNA binding domain of GAL4 and upstream of a eur terminal to form a fusion protein They also contain the TRP 1 gene of S. cerevisiae which makes it possible to complement the yeasts of trpl genotype in order to select them on a minimum medium containing no tryptophan
• These vectors carry the resistance gene with ampicillin which makes it possible to select the bacteria possessing them on a medium containing ampicillin.
• the vectors of the pGAD series, (Clontech) vectors which allow the expression in yeast of fusion proteins between the GAL4 transactivating domain and a protein of interest or encoded by the cDNA originating from a lung bank, inserted at an EcoRI Xhol site.
• the vectors of the Bluescript series (Strata gene) of the vectors making it possible to carry out cloning as well as the series of pIC (J Lawrence Marsh et al Gene, 1984, 32, 481-485) and pMTL (Steve P Chambers et al, Gene, 1998, 68, 139-149)
• the plasmid pGEX-2T-hGAX is the plasmid used for the transformation of E Coli BL-21 This plasmid was obtained from the plasmid pGEX-2T and was supplied by the Doctor K Walsh of St Elizabeth's Medical Center in Boston
• the basic plasmid pGEX-2T (Pharmacia) makes it possible to produce the protein GAX fused with Glutathione-S-Transferase (GST), protein which has a strong affinity for Glutathione GST fusion -GAX will facilitate the purification of GAX by affinity on agarose beads coupled to Gluthation
• GST Glutathione-S-Transferas
• IPTG isopropyl- ⁇ -D- thiogalactoside
• the piasmid pET-29 produces the protein fused to the epitope called S-Tag which allows the purification of KI by affinity on agarose beads coupled to S-protein.
• the SmycKI chimera is under the control of the T7 promoter and 1 lac operator.
• the BL-21s are transformed by the plasmid pET-29-mycKI As for the GST-GAX protein, they are cultured up to an OD of 0.7 at 600 nm. Then, the expression of SmycKI is induced by 0.1 mM IPTG and by T7 RNA polymerase produced by BL-21.
• the bacteria are sonicated.
• the supernatant is then purified by the following method.
• the purification of SmycKI is done by affinity on agarose beads coupled to the S-protein.
• the method is the same as for GST-GAX except that the resin is washed in a solution containing 20 mM Tris pH 7.5, 0.15 M NaCl and 0.1% Triton X-100 Elution and dialysis are the same as for GST-GAX
• This system is a method of cloning by interaction in vivo in Saccharomyces cerevisiae, the principle of which is based on the modular structure of the yeast transcription factor GAL4 (7)
• the GAL4 transcription activator has two independent domains with different functions
• the binding domain DNA (GALDB for GAL DNA Binding) allows GAL4 to bind to a specific DNA sequence at the promoter region of a GAL4 gene is then sterically close to the transcriptional machinery and thanks to its transactivator domain (GALTA), it increases the frequency with which transcription is initiated on the adjacent gene, probably by interactions with RNA polymerase or associated proteins.
• GALTA transactivator domain
• the principle of the double-hybrid system consists in fusing GALDB and GALTA separately with two X proteins. and different Y which, when they interact, reconstitute an active transcriptional complex 2) Screening of yeasts by the PCR (Polymerase Chain Reaction) technique
• Tween 20 acts as a protective agent for Taq DNA polymerase.
• the yeast suspension is completed to a final volume of 20 ⁇ l containing the following final quantities or concentrations: 10 picomoles of primer 1, 10 picomoles of primer 2, 1 unit of Taq DNA polymerase, 75 mM of Tris pH9, 20 mM of (NH4) 2SO4, 0.01% of Tween 20, 2.5 mM of MgC12 and 125 ⁇ M of each of the 4 deoxyribonucleotides (dATP, dTTP, dGTP and dCTP).
• dATP, dTTP, dGTP and dCTP deoxyribonucleotides
• DNA Small amounts of DNA are prepared as follows: the bacteria containing the plasmid are cultured for at least 4 hours in 2 ml of LB medium in a shaker shaker. They are then centrifuged for 2 minutes at 14,000 rpm in Ependorf tubes, then the pellet is resuspended in 100 ⁇ l of solution I (50 mM of glucose, 25 mM of Tris HCl buffer pH8, 10 mM EDTA pH8), lysed with 200 ⁇ l of the solution II (0.2M NaOH, 1% SDS). The lysis solution is then neutralized with 150 ⁇ l of solution III (3M of potassium acetate, 1 1.5% (v / v) of glacial acetic acid).
• solution I 50 mM of glucose, 25 mM of Tris HCl buffer pH8, 10 mM EDTA pH8
• the lysis solution is then neutralized with 150 ⁇ l of solution III (3M of potassium acetate, 1 1.5% (v / v) of glacial acetic
• RNAse 10mM Tris-HCl solution and EDTA ImM with 50 ⁇ g / ml RNAse).
• PCR reactions are carried out in a final volume of 100 ⁇ l in the presence of the DNA matrix, dNTP (0.2 mM), PCR buffer (Tris-HCL pH 8.5 10 mM, MgCl2 ImM, KC1 5 mM, 0.01% gelatin), 0.5 ⁇ g of each of the oligonucleotides and 2.5 IU of Amplifier Taq DNA polymerase (Perkin Elmer) with or without formamide (5%) The mixture is covered with 2 drops of oil of paraffin to limit evaporation of the sample The device used is the "Crocodile II" from App gene
• the fragments obtained by PCR, used for cloning are systematically resequenced once cloned, so as to verify the absence of any mutation which appeared during amplification.
• the oligodeoxynucleotides are chemically synthesized according to the phosphoramidite method using ⁇ -cyanoethyl protective groups (Sinha 1984) After synthesis, the protective groups are removed by treatment with ammonia and two precipitations with butanol make it possible to purify and concentrate the oligodeoxynucleotides ( Sawadogo, 1991)
• the DNA concentration is determined by measuring the optical density at 260 nm
• All ligation reactions are carried out at + 14 ° C overnight in a final volume of 10 ⁇ l in the presence of 100 to 200 ng of vector, 0 5 to 2 ⁇ g of insert, 40 IU of T4 DNA ligase enzyme ( Biolabs) and a ligation buffer (50 mM Tris-HCl pH 7.8, 10 mM MgC * i2, 10 mM DTT, 1 mM ATP)
• the negative control consists of ligation of the vector in the absence of insert
• the filling of the prominent 5 ′ ends is carried out if necessary before ligation with the Klenow fragment of the DNA Polymerase I of £. coli (Biolabs) according to the supplier's specifications
• the destruction of the protruding 3 'ends is carried out in the presence of DNA polymerase from phage T4 (Biolabs) used according to the manufacturer's recommendations
• the transformation of the bacteria with a plasmid is carried out according to the following protocol.
• the entire volume of ligation (10 ⁇ l) is used to transform the TGl bacteria made competent by the method of Chung et al, (PNAS, 1988 86, 2172-2175).
• the TGl bacteria are cultured in a liquid LB medium for a few hours in a stirring oven at 37 ° C., until an OD of 0.6 to 600 nm is obtained. The medium is then centrifuged at 6000 rpm for 10 min.
• the bacteria are made competent by taking up the bacterial pellet with a volume of TSB (LB medium + 100 g / 1 of PEG 4000, 5% of DMSO, 10 mM of MgCl2, 10 mM of MgSO / Q corresponding to 1/10 of the volume of the medium of the initial culture After incubation at 4 ° C for 30 to 60 minutes, 200 ⁇ l of bacteria are brought into contact with the ligation products for 15 minutes on ice After adding 200 ⁇ l of LB, the bacteria are incubated for 30 minutes at 37 ° C. then spread on LB + ampicillin medium
• the DNA is separated according to their size by electrophoresis. To do this, different gels are used depending on the size of the fragments to be separated.
• Any migration on agarose gel or on polyacrylamide gel is carried out in a TBE buffer and in the presence of a molecular weight marker (1Kb ladder, Gibco BRL)
• the DNA is mixed with 1/10 of the volume of the deposition blue (200g / l of Ficoll,
• the extraction of DNA from the band of an agarose gel is carried out by electroelution as follows:
• the piece of gel containing the DNA fragment is cut with a scalpel and placed in a dialysis rod closed by two forceps and containing 100 to 500 ⁇ l of TBE.
• the whole is placed in an electrophoresis tank where it undergoes an electric field of 100 volts.
• the DNA after having left the gel, is then purified by two extractions with phenol / chloroform followed by two extractions with chloroform, then precipitated in the presence 0.3M sodium acetate and 2.5 volumes of absolute ethanol After centrifugation (5 min at 14,000 rpm) the DNA pellet is dried and then taken up in 20 ⁇ l of water
• the sequencing is done according to the Sanger method using 4 dideoxyribonucleotides having a different fluorescent marker The incorporation of one of these dideoxyribonucleotides produces a stop in the replication by Taq polymerase of the DNA to be sequenced This reaction will give fragments of 'DNA of different sizes, all terminated in 3' by one of the 4 dideoxyribonucleotides
• One ⁇ g of a plasmid and 4 picomoles of a primer are added to 9.5 ⁇ l of a "premix" supplied by Applied Biosystems under the name Prism
• the final volume must be 20 ⁇ l to carry out a PCR for 25 cycles, decomposing into a denaturation step at 96 ° C for 30 seconds, a hybridization step at 50 ° C for 15 seconds and an elongation step at 60 ° C for 4 minutes
• the DNA fragments, obtained after amplification, are purified on an exclusion column (Chromaspin-30 from Clontech), and are then dried with Speed Vac. The whole is taken up in 5 ⁇ l of a mixture formed of 24 ⁇ l of EDTA ( 50mM) and 120 ⁇ l of deionized formamide After denaturation at 96 ° C for 3 minutes, 3 to 5 ⁇ l are deposited on an electrophoresis gel.
• the different DNA fragments are separated according to their size and will pass successively in front of a laser reader of the 370 DNA sequencer device (Applied Biosystems) where the different fluorescences will be detected
• the lung cDNA fusion library is sold as bacteria. This library comes from the cloning, at the EcoRI-Xhol site of the plasmid pGAD424 (Materials and Methods), of cDNA corresponding to the total RNA of human lung cells.
• the yeasts previously cultivated in 100 ml of liquid medium are harvested after centrifugation at 3000 rpm for 3 minutes and suspended in 1 ml of sterile water. After centrifugation at 3000 rpm for 3 minutes, the cell pellet is resuspended in 1 ml of sterile water and then centrifuged again. This operation is repeated again in order to eliminate all traces of the culture medium.
• the yeasts are then taken up in 1 ml of the transformation solution I (0.1A LiAc, Tris-HCl pH 7.5 lOmM, EDTA ImM). then centrifuged at 3000 rpm for 3 minutes. The cell pellet is taken up again in 1 ml of the transformation solution I.
• a transformation solution II 0.1 M LiAc, Tris-HCl pH 7.5 10 mM, EDTA ImM in 40% PEG40OO
• a thermal shock is then applied to the transformation mixture in a water bath at 40 ° C for 15 minutes and then the whole is centrifuged at 15,000 rpm for 1 minute in order to collect the cell pellet.
• This pellet is taken up in 200 ⁇ l of water and then spread over a minimum agar medium which does not contain the amino acids corresponding to the markers provided by the transforming plasmid.
• the yeasts are then placed in culture for 72 hours at 28 ° C.
• the procedure is as follows.
• the yeast used contains the plasmid pGAL4DB-GAX expressing the GAX protein in the form fused to the DNA binding domain of GAL4. It is cultivated in
• a thermal shock is carried out on this transformation mixture at 42 ° C for 20 minutes. Centrifugation (3000 rpm for 5 minutes) is repeated 3 times in succession, each time taking up the pellet with 10 ml of sterile water. The third time the pellet is taken up with 2.5 ml of PB S. Thus the toxic PEG for the cells has been eliminated.
• 2.4 ml of this suspension are used to inoculate 250 ml of minimum medium containing the amino acids His, Lys, Met and the bases Ura and Ade and cultured overnight in a shaker at 28 ° C. The remaining 100 ⁇ l of this suspension is used to verify the efficiency of the transformation; for this dilutions of 10 -2, 10 -3 and 10 -4 of this suspcffsion were made.
• the overnight culture is centrifuged (30 ° -pm for 5 min) and washed with sterile water twice in succession. The residue is then taken up in 2.5 ml of water. 2.4 ml, the volume of which is brought to 10 ml in sterile water, are used to inoculate 10 boxes of 435 cm 2 containing a medium
• the value of an average loop of a yeast clone is put in 200 ⁇ l of a TELT solution (Triton XI 00 2%, SDS 1%, NaCl lOOmM, Tris pH8 lOmM, EDTA ImM), in the presence of 3g of beads of glass 450 ⁇ m in diameter and 200 ⁇ l of phenol / chloroform. This mixture is vorified for 15 minutes, then centrifuged for 2 minutes at 14,000 rpm. The supernatant is collected without removing the protein cake and the DNA contained in this phase is precipitated with 2.5 volumes of absolute ethanol.
• a TELT solution Triton XI 00 2%, SDS 1%, NaCl lOOmM, Tris pH8 lOmM, EDTA ImM
• a nitrocellulose sheet is previously deposited on the Petri dish containing the individualized yeast clones. Thanks to the adsorption phenomenon, a faithful image of the location of the clones is obtained.
• This sheet is then immersed in liquid nitrogen for 30 seconds in order to burst the yeasts and thus release the ⁇ -galactosidase activity After thawing, the nitrocellulose sheet is deposited, colonies upwards, in another petri dish containing Whatman paper previously soaked in 1.5 ml of PB S solution ( Na2HPO4 60mM, NaH2P ⁇ 4 40mM, KC1 10MM, MgS ⁇ 4 ImM, pH7) and from 10 to 30 ⁇ l of X-Gal (5-bromo-4-chloro-3-indoyl-bD- galactoside) at 50mg / ml in N, N- dimethylformamide
• the box is then placed in an oven at 37 ° C with the lid closed to prevent drying.
• the time of appearance of the blue color
• the estrogen receptor (ER) cDNA is obtained by reverse transcription (RT) using a commercial kit (first strand cDNA synthesis Kit from Pharmacia), from total RNA extracted from mouse uterus, followed PCR amplification
• RT reverse transcription
• a commercial kit first strand cDNA synthesis Kit from Pharmacia
• PCR amplification We used a pair of specific primers which hybridize, in 5 'with the first 20 nucleotides of ER and introducing an EcoR I site just upstream of the first codon (5'- gagcg ⁇ t / cATGACCATGACCCTTCACAC SEQ ID N ° 6, the nucleotides in italics represent the EcoR I site and in capitals underlined the first codon), on the 3 ′ side the back primer begins at the stop codon of ER and also introducing an EcoR I site (5′- gagcgaattc ACTGATCGTGTTGGGGAAGC SEQ ID No.
• pG5CAT Chloramphenicol Acetyl Transferase
• This adapter oligonucleotide has in 5 'a protruding Xhol site and 3 'an Xbal site which allowed cloning into the Xho I and Xba I sites of pG5CAT
• This reporter gene (pEREGICAT, Fig 4, example 1 1)) is based on the fact that ER is a transcriptional activator possessing, in the case of murine ER, a constitutive activity which increases in response to its natural ligand, the oestradiol 17- ⁇
• This system was used by Matinez et al to study the synergy between ER and a second transcriptional factor, NFl, whose transcription activating domain has been fused to the DNA binding domain of the yeast protein GAL4 (GALDB)
• GAL4 yeast protein GAL4
• This system therefore allows us to study the transcriptional activity of all or part of the GAX protein fused to GALDB (Fig 5,6 and examples 12, 13)
• a plasmid expressing the luciferase gene under the control of the CMV promoter (pCMV-Luc) was constructed. This construction was obtained after cloning of a PCR fragment (flanked in 5 'and 3' from a BamHI site) containing the CMV promoter of the vector pCDNA3 (Invitrogen), in the BglII site of the vector pGL3 -Basic (Promega ). This plasmid will serve as an internal standard in all of the transient transfection experiments that follow.
• DMEM murine embryonic fibroblasts NIH-3T3
• ATCC murine embryonic fibroblasts NIH-3T3
• DMEM fetal calf serum
• the NIH-3T3 are seeded at a density of 100,000 cells per well of a 24-well culture plate (Falcon), in a volume of 1 ml of DMEM-GPS / SVF 16 at 20 hours later. , after attaching and spreading the cells, the cells are washed with 0.5 ml of DMEM-GPS (without SVF) and then put back into 0.5 ml of DMEM-GPS 50 ⁇ l of a transfection mixture are then added per well. Culture This mixture is obtained as summarized in Table 3 below
• the cells are brought into contact with the various transfection mixtures for 4 hours at 37 ° C. under standard culture conditions.
• the DMEM-GPS, with the transfection mixture, is then replaced with 1 ml of DMEM-GPS / SVF then the cells are kept in culture for 24 hours
• Each transfection is carried out on at least 4 wells
• the cells are washed with 0.5 ml of Dulbecco's PBS (GIBCO) and then harvested in 0.5 ml of a 0.2% trypsin solution in PBS (GIBCO) Trypsin is neutralized with 10 ⁇ l of FCS
• This cell suspension is centrifuged for 2 min at 10,000 g, the supernatant is removed and the cells are resuspended in 150 ⁇ l of 0.25 M Tris-HCl at pH 7.8 50 ⁇ l of this suspension are used to assay luciferase activity according to the Kit "luciferase Assay System" (Promega) and using the luminometer LUMAT LB 9501 (EG&G Berthold)
• the cytosolic proteins of the cells in the remaining 150 ⁇ l are extracted by 5 cycles of freezing / thawing (liquid nitrogen / 37
• the Far Western Blotting method While Western Blotting consists of an electrophoretic separation of proteins on a denaturing gel followed by an electrotransfer of proteins on a nitrocellulose membrane and a direct or indirect immunodetection, the Far - Western Blotting is a Western Blotting to which is added a protein-protein interaction step between a target immobilized on the nitrocellulose membrane and a factor in solution a) Electrophoresis
• the samples are heated for 10 minutes at 95 ° C. in a protein denaturation buffer containing 50 mM Tris pH 6.8, 2% SDS (Sodium Dodecyl Sulfate), 10%> glycerol, 300 mM b-mercaptoethanol and 0 , 1% bromophenol blue 10 ml of the samples are deposited on a Tris-Glycine 14% Acrylamide gel (Tris-Glycine Gels, Novex) Migration takes place for 1 hour at a constant voltage of 120 V in a separation buffer for proteins (35 mM SDS, 1.92 M Glycine and 85 mM Tris pH 8.3) The molecular weight of proteins will be determined by the parallel migration of a colored and transferable molecular weight standard (MultiMarkTM Multi-Colored Standard , Novex) This gel is made in duplicate to be able to color one of the two with Coomassie blue (Methanol 30%, water 60%, Acetic acid 10%, Coomassie blue 0, 1%) The color is 1 hour Discoloration
• the membrane is saturated for 30 minutes with stirring and at room temperature in PBS containing 5% (w / v) of skimmed milk powder (Gloria) and 0.2% (v / v) of Tween 20 Then it is immersed for 1 hour with stirring and at room temperature in 5 ml of PBS containing 5% (w / v) of skimmed milk powder (Gloria), 0.2% (v / v) of Tween 20 and 75 ⁇ g of KI L ' Incubation completed, the membrane is washed 3 times for 10 minutes in PBS containing 0.2% (v / v) of Tween 20 In order to visualize the interaction between GST-GAX immobilized on the nitrocellulose membrane and mycKi, this is reveal as for GST-GAX using a monoclonal antibody mouse directed against the myc epitope (Santa Cruz) and a polyclonal rabbit antibody coupled, with peroxidase, directed against mouse IgG (Nordic Immunology)
• EXAMPLE 1 Construction of a vector allowing the expression of a fusion protein between GAX and the DNA-binding domain of GAL4
• the screening of a library using the double hybrid system requires that the GAX protein be fused to the DNA binding domain of the GAL4 transactivating protein.
• the expression of this fusion protein is carried out using the vector pGBTIO (cf. materials and methods ), in which we have introduced, in the same reading frame as the sequence corresponding to the DNA binding domain of GAL4 (GAL4DB), a fragment coding for all or part of the GAX protein A particular fragment comprises the EcoRl fragment -Sall from phGAX, which is inserted at the EcoRl-Sall site of pGBTIO to give the plasmid pCM199
• the screening of a fusion library makes it possible to identify clones producing proteins fused to the GAL4 transactivating domain, which can interact with the GAX protein or domains thereof. This interaction makes it possible to reconstitute a transactivator which will then be capable of induce the expression of the reporter genes URA3, BLE and LacZ in the strain YCM79
• a fusion library produced from cDNA originating from human lung
• this library was supplied to us in the form of bacteria, the plasmid DNA of the bank was first purified
• the batch of plasmid DNA that we have assembled was obtained from a number of isolated bacterial colonies corresponding to a little more than three times the representativeness of the bank, i.e. 25 10 colonies
• yeast For this we have chosen a yeast transformation protocol giving an efficiency of 10 cells transformed by ⁇ g of DNA
• yeast transformation protocol giving an efficiency of 10 cells transformed by ⁇ g of DNA
• EXAMPLE 3 Identification of the inserts of the selected plasmids: Demonstration of an interaction with Ki
• the plasmids are extracted from the yeast, introduced into the bacteria and then prepared as described in the materials and methods section.
• the sequencing was carried out from 1 oligonucleotide CTATTCGATGATGAAGATACCCC (SEQ ID No. 1) complementary to the GAL4TA region near the insertion site of the lung cDNA bank, at 52 bpd from the EcoRI site.
• EXAMPLE 4 Construction of Vectors allowing the Expression in Yeast of a Fusion Protein Between Different Deletants of GAX and the DNA Binding Domain of GAL4
• This example describes the construction of vectors coding for different variants of the Gax protein, which can be used to determine the structure / function of this protein and in particular, to highlight the active domains and the domains responsible for the interaction with the Ki protein.
• the deletion of the 153 C-terminal amino acids is obtained by digesting the plasmid pCM199 by Eagl-Sall, then the small fragment is eliminated, the ends are made blunt by treatment with klenow and religated
• the plasmid thus obtained is called pCM238 II code for a protein with residues 1-104 of GAX
• Total digestion with Bgl2 and SalI of pCM199 makes it possible to isolate a fragment of approximately 270 bp and 572 bp.
• the first fragment is cloned in pGBTl 1 at the Bamhl-SalI site to obtain the plasmid pCM245 which allows the fusion of the 79 amino acids C-ter GAL4DB
• the second fragment is cloned into pGBTIO at the Bamhl site to obtain the plasmid pCM246 which allows the fusion of amino acids 33 to 222 with GAL4DB
• the plasmid pCM280 is obtained by digesting pCM246 with Dra3 and pstl After treatment with T4 polymerase the plasmid is closed on itself II codes for a protein comprising residues 33-63 of GAX
• the plasmid pCM199 is digested with NdeI and Pst1
• the insert is cloned into the plasmid pAS 1 to give the plasmids pCM301
• This plasmid allows the expression of the GAX protein deleted from these first 32 amino acids fused to GAL4DB II codes for a protein comprising the GAX residues 33-302
• the yeast strain yCM79 is transformed by the different vectors described in examples 1 and 4 at the same time as pCM282 or that pGAD424
• the Betalgal activity is revealed as described in the material and methods The results obtained are presented in Table 2 below
• Ki gene seems to be ubiquitous as suggested by the analysis by northern blotting (Figure 1) of its expression from mRNA extracted from different tissues (human Multiple Tissue Northern Blots, Clontech) entertaining an mRNA of approximately 3 kb
• Figure 1 of its expression from mRNA extracted from different tissues (human Multiple Tissue Northern Blots, Clontech) entertaining an mRNA of approximately 3 kb
• the construction of a vector allowing the expression of the Ki protein fused to the HA tag in mammalian cells was carried out as follows: the Nco l -Xho l fragment of the plasmid pCM282 is inserted into the plasmid pAS l at the level of Nco l -Xho l sites to obtain the plasmid pCM322 Then the EcoRl -Dra l fragment of the plasmid pCM322 is inserted into the expression vector pCDNA3 at the EcoRl-EcoRV sites The plasmid obtained, pCM323 allows the expression of the protein ki fused to the HA tag in mammalian cells
• KiHA has a nuclear localization in cells transfected with this chimera ( Figure 2)
• EXAMPLE 7 Expression and purification of the Ki protein fused to the S tag and yc tag The following oligos are hybridized together, phospho ⁇ les then ligated with pET29B previously digested with Nco 1
• the plasmid obtained is named pCM320
• the gene coding for the protein Ki is amplified by PCR with the oligos CGCGGATCCCATGGCCTCGTTGCTG (SEQ ID No. 4) and GTAGAGCTCGAGTCAGTACAGAGTCTCTGC (SEQ ID No.
• Colonies of BL-21 transformed with the plasmid pGEX-2T-h-GAX are placed in preculture in 30 ml of LB with ampicillin (50 ⁇ g / ml) at 37 ° C overnight 5 ml of this preculture are returned to culture in 500 ml of LB with ampicillin at 37 ° C up to an optical density of 0.7 at 600 nm
• the expression of GST-GAX is induced by 0.1 mM IPTG for 2 hours at 30 ° C.
• the culture is centrifuged at 6000 rpm for 10 min
• the bacteria pellets are redissolved in 10 ml of cold PBS and then distributed in 10 eppendorf tubes
• the bacterial proteins are extracted by sonication for 10 minutes with 12-second cycles and 24-second breaks followed centrifugation at 15,000 rpm for 15 minutes
• the supernatants are combined and constitute the soluble fraction which will be used for purification
• the remaining pellets represent the insoluble fraction up to an optical density of 0.7 to 600 nm.
• the expression of GST-GAX is induced by 0.1 mM IPTG for 2 hours at 30 ° C.
• the culture is centrifuged at 6000 rpm for 10 min.
• the bacteria pellets are redissolved in 10 ml of cold PBS and then distributed in 10 eppendorf tubes. Bacterial proteins are extracted by sonication for 10 minutes with 12-second cycles and 24-second pauses followed by centrifugation at 15,000 rpm for 15 minutes. The supernatants are combined and constitute the soluble fraction which will be used for the purification. The remaining pellets represent the insoluble fraction.
• the purification of GAX is done by affinity of GST on agarose beads coupled to Glutathione.
• the supernatant obtained after sonication of the bacteria is incubated with the resin for one hour on a rotary shaker at room temperature. Then, the resin on which the protein is bound is centrifuged at 1000 rpm for 10 minutes. The supernatant removed, the resin is washed 3 times with 50 ml of PBS containing 1% Triton X-100 for 20 minutes on 1 rotary shaker. GST-GAX can be eluted from the resin with guanidine thiocyanate. Elution is carried out by 1.5 times the volume of resin of 2M guanidine thiocyanate, 20 mM Tris pH 7.5, 0.15 M NaCl and 0.1% Triton X-100 on a rotary shaker during 30 minutes.
• the eluate is dialyzed against PBS overnight to remove the guanidine thiocyanate.
• the protein is stored in PBS at 4 ° C.
• a cocktail of protease inhibitors of equal quantity (Leupeptine lmg / ml, Pepstatin lmg / ml, Aprotinin l mg / ml. Benzamidine 500 mM) is added to the 1/200 th to the protein preparation.
• GST-GAX was purified on a resin coupled to glutathione thanks to the catalytic site of glutathione S-transferase (GST); SmycKi carrying a myc epitope and the S epitope allowing purification on a resin coupled to protein S.
• the proteins were transferred to a nitrocellulose membrane from a gel identical to that at A.
• the membrane was successively incubated in the presence of SmycKi, in a solution containing a mouse monoclonal antibody directed against the myc epitope (Santa Cruz) and finally in a solution for the detection of the anti-myc antibody.
• EXAMPLE 10 Construction of Vectors Permitting the Expression in Mammalian Cells of a Fusion Protein Between Different Deletants of GAX and the DNA Binding Domain of GAL4
• the plasmids pCM199 and pCM301 are digested with HindIII.
• the inserts are cloned in the correct orientation into pCDNA3 (invitrogen) at the HindIII site to give the plasmids pCM291 and pCM327 respectively, allowing expression of fusions in mammalian cells.
• the plasmids pCM238, pCM244, pCM301, pCM246, and pCM280 are digested with HindIII and Nael.
• the inserts are cloned in the correct orientation in pCDNA3 (invitrogen) at the HindIII-EcoRV site to give the plasmids pCM292, pCM326, pCM327, pCM294 and ⁇ CM295, respectively, allowing the expression of fusions in mammalian cells.
• the invention resides in the construction and the use of viral vectors allowing the transfer and the expression in vivo of nucleic acids as defined above.
• adenoviruses various serotypes, whose structure and properties vary somewhat, have been characterized.
• serotypes it is preferred to use, in the context of the present invention, human adenoviruses of type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin (see application WO94 / 26914).
• adenoviruses of animal origin which can be used in the context of the present invention, mention may be made of adenoviruses of canine, bovine, murine origin (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine , avian or even simian (example: after-sales service).
• the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan strain or A26 / 61 (ATCC VR-800) for example].
• adenoviruses of human or canine or mixed origin are used.
• the defective adenoviruses of the invention comprise ITRs, a sequence allowing the packaging and a nucleic acid according to the invention.
• the region E 1 at least is non-functional.
• the viral gene considered can be made non-functional by any technique known to those skilled in the art, and in particular by total suppression, substitution, partial deletion, or addition of one or more bases in the gene or genes considered. Such modifications can be obtained in vitro (on isolated DNA) or in situ, for example, by means of genetic engineering techniques, or by treatment with mutagenic agents.
• the adenovirus according to the invention comprises a deletion in the regions E1 and E4.
• it comprises a deletion in region E1 at the level of which the region E4 and the nucleic sequence of the invention are inserted (Cf FR94 13355).
• the deletion in the E1 region preferably extends from nucleotides 455 to 3329 on the sequence of the adenovirus Ad5.
• the defective recombinant adenoviruses according to the invention can be prepared by any technique known to a person skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185,573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid carrying inter alia a nucleic sequence or a combination of nucleic sequences of the invention. Homologous recombination occurs after co-transfection of said adenovirus and plasmid in an appropriate cell line.
• the cell line used must preferably (i) be transformable by said elements, and (ii), contain the sequences capable of complementing the part of the genome of the defective adenovirus, preferably in integrated form to avoid the risks of recombination.
• a line mention may be made of the human embryonic kidney line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains in particular, integrated into its genome, the left part of the genome an Ad5 adenovirus (12%) or lines capable of complementing the E1 and E4 functions as described in particular in applications No. WO 94/26914 and WO95 / 02697 or in Yeh et al., J. Virol. 70 (1996) 559. Then, the adenoviruses which have multiplied are recovered and purified according to conventional techniques of molecular biology.
• AAV adeno-associated viruses
• the rest of the genome is divided into 2 essential regions carrying the packaging functions: the left part of the genome, which contains the rep gene involved in viral replication and the expression of viral genes; the right part of the genome, which contains the cap gene coding for the capsid proteins of the virus.
• the use of vectors derived from AAVs for gene transfer in vitro and in vivo has been described in the literature (see in particular WO 91/18088; WO 93/09239; US 4,797,368, US5, 139,941, EP 488,528).
• AAVs in which the rep and / or cap genes are deleted and replaced by a gene of interest, and their use for transferring in vitro (onto cells in culture) or in vivo (directly into an organism ) said gene of interest.
• the defective recombinant AAVs according to the invention can be prepared by cotransfection, in a cell line infected with a human helper virus (for example an adenovirus), of a plasmid containing a nucleic sequence or a combination of nucleic sequences of the invention bordered by two inverted repeat regions (ITRs) of AAV, and of a plasmid carrying the packaging genes (rep and cap genes) of AAV.
• a human helper virus for example an adenovirus
• a usable cell line is, for example, line 293.
• Other production systems are described, for example, in applications WO95 / 14771; W095 / 13365; WO95 / 13392 or WO95 / 06743.
• the recombinant AAVs produced are then purified by conventional techniques.
• retroviruses are integrative viruses, selectively infecting dividing cells. They therefore constitute vectors of interest for cancer applications.
• the genome of retroviruses essentially comprises two LTRs, an encapsidation sequence and three coding regions (gag, pol and env).
• vectors derived from retroviruses the gag, pol and env genes are generally deleted, in whole or in part, and replaced by a heterologous nucleic acid sequence of interest.
• retroviruses can be produced from different types of retroviruses such as in particular MoMuLV ("murine Moloney leukemia virus”; also designated MoMLV), MSV ("murine Moloney sarcoma virus”), HaSV ("Harvey sarcoma virus”) ; SNV (“spleen necrosis virus”); RSV (“Rous sarcoma virus”) or the Friend virus.
• a plasmid comprising in particular the LTRs
• the packaging sequence and said nucleic sequence is constructed, then used to transfect a line so-called packaging cell, capable of providing trans retroviral functions deficient in the plasmid.
• the packaging lines are therefore capable of expressing the gag, pol and env genes.
• Such packaging lines have been described in the prior art, and in particular the line PA317 (US4,861,719); the PsiCRIP line (WO90 / 02806) and the GP + envAm-12 line (WO89 / 07150).
• recombinant retroviruses may include modifications to the LTRs to suppress transcriptional activity, as well as packaging sequences. extended, comprising part of the gag gene (Bender et al., J. Virol. 61 (1987) 1639). The recombinant retroviruses produced are then purified by conventional techniques.
• nucleic acids or the plasmid expression vectors described in the preceding examples can be administered as they are in vivo or ex vivo. It has indeed been shown that naked nucleic acids can transfect cells. However, to improve the transfer efficiency, it is preferred to use, within the framework of the invention, a transfer vector. It can be a viral vector (example 9.2.) Or a synthetic transfection agent.
• cationic polymers of polylysine type (LKLK) n, (LKKL) n, (PCT / FR / 00098) polyethylene imine (WO96 / 02655) and DEAE dextran or cationic or lipofectant lipids. They have the property of condensing DNA and promoting its association with the cell membrane. Among these, mention may be made of lipopolyamines (lipofectamine, transfectam, etc.), different cationic or neutral lipids (DOTMA, DOGS, DOPE, etc.) as well as peptides of nuclear origin.
• lipopolyamines lipofectamine, transfectam, etc.
• DOTMA cationic or neutral lipids
• DOGS DOGS
• DOPE DOPE
• the concept of targeted transfection has been developed, mediated by a receptor, which takes advantage of the principle of condensing DNA thanks to the cationic polymer while directing the binding of the complex to the membrane thanks to a chemical coupling between the cationic polymer and the ligand of a membrane receptor, present on the surface of the cell type that is to be grafted.
• the targeting of the transferrin, insulin receptor or the hepatocyte asialoglycoprotein receptor has thus been described.
• the preparation of a composition according to the invention using such a chemical vector is carried out according to any technique known to those skilled in the art, generally by simple contacting of the various components.
• a transient transfection system to study the transcriptional activity specific to GALDB-GAX fusions as well as their effect on transcriptional activators such as the estrogen receptor (ER) or the domain. activation of protein VP16 from the Herpes simplex virus fused to GALDB.
• a target gene Reporter
• CAT bacterial chloramphenicol acetyl transferase
• This promoter contains a TATA box, originating from the E1B gene of the adenovirus Ad2 (E1B TATA), upstream from the site of initiation of the transcription of the CAT gene (FIG. 4 A).
• a TBP protein from the TFIID complex recognizes the TATA box and positions the preinitiation complex (TFIID + TFII A, B, E, F) which recruits RNA polymerase type II (PolII) which will initiate the transcription of the CAT gene.
• TFIID + TFII A, B, E, F preinitiation complex
• PolyII RNA polymerase type II
• Upstream of this basic promoter we have inserted a GALDB binding site (17 mer) which will be recognized by the chimeras GALDB-GAX or GALDB-VP16.
• GALDB binding site 17 mer
• GALDB-GAX GALDB-VP16
• EAE estrogen response element upstream of the 17th sea on which ER binds to activate transcription.
• This reporter will allow us to study the different schematic combinations, activation or repression of transcription will result in a change in the amount of CAT in a cell.
• the " assay of CAT enzyme activity in cell extracts after transfection is used to measure
• ER and GAL4-VPÎ6 s ⁇ nLdes ⁇ very strong transcriptional activators.
• the CAT activity is increased by more than 100 times by ER and approximately 85 times by GAL4-VP16.
• the coexpression of ER and GAL4-VP16 results in a CAT activity of more than 300 times that of the unactivated reporter and greater than the sum of the two activators expressed individually. This suggests that ER and GAL4-VP16, despite steric hindrance, can occupy and activate the same promoter ( Figure 4B).
• the GAX gene codes for a protein of 302 amino acids in humans. The primary structure of this protein has different domains whose function remains unknown. GAX belongs to a family of genes called homeoboite (HOMEOBOX). Homeobox is necessary for the recognition and binding of these proteins on specific DNA sequences present on the promoter of the target genes whose control the expression. To date, no DNA sequence recognized by GAX has been identified. GAX has a region rich in Histidine residues (HIS) in its N-terminal part whose function is unknown.
• HES Histidine residues
• the different GAL-GAX chimeras were expressed alone or in the presence of ER to study their effect respectively on the basal transcription or on the transcriptional activity of ER.
• GAL-GAX 1 -302 and ER results in a CAT activity more than 25 times lower than that obtained with ER alone.
• This repression as in A is due to the first 32 amino acids of GAX (compare GAL-GAX1-302, GAL-GAX33-302 and GAL-GAX33-222).
• GAL-GAX 1-32 decrease the activity of ER only by 2 times (compare GAL-GAX 1-32, GAL-GAX 1 - 104) and require at least the presence of residues 33 to 222 for maximum activity (Figure 6B).
• the sequences making lose the activity when they are absent are sought, allowing to conclude that they are necessary for the interaction but not sufficient.
• results presented show that GAX represses transcription of the reporter gene used. This repression is essentially due to an N-terminal peptide (1 to 32) whose optimal activity requires the presence of the region 33 to 222 of GAX and preferably the presence of the region 33-104 of Gax.
• PCNA Human Proliferating Cell Nuclear Antigen
• the cloning of the PCNA cDNA is carried out by reverse transcription and PCR.
• the first reverse transcription (RT) step is carried out with the "First Strand cDNA synthesis" kit from Pharmacia.
• Total RNA is extracted from human smooth muscle cells in primary culture (Clonetics) according to the method described by P. Chomczynski and N. Sacchi (Anal. Biochem. 1987, 162: 156-159).
• RNA 10 ⁇ g of this total RNA is taken up in 20 ⁇ l of water are heated for 10 minutes to 65 ° C., cooled on ice and then mixed with 11 ⁇ l of "Bulk First Strand reaction mix" from the RT kit (Cloned, FPLCpwre®, Murine Reverse Transcriptase, RNase / DNase-Free BSA, dATP, dCTP, dGTP, and dTTP), 1 ⁇ l of DTT and 1 ⁇ l of pD (N) primers 6 .
• the RT reaction is incubated for 1 hour at 37 ° C.
• the reaction is stopped by heating for 5 minutes at 90 ° C. and then cooled on ice.
• the second step consists in PCR amplification of the PCNA cDNA.
• the primers used for the PCR reaction are the following:
• the two primers introduce an EcoRI site (lowercase underlined).
• the PCNA amino acids contained in the primers are represented by their code (capital letters) below the corresponding codons. * represents the stop codon of PCNA.
• 8 ⁇ l of the RT reaction, described above, are completed to a final volume of 50 ⁇ l containing the following final quantities or concentrations: 50 picomoles of primer 1, 50 picomoles of primer 2, one unit of Taq DNA polymerase (Perkin Elmer), 5 ⁇ l of MgC12 (25 mM), 2 ⁇ l of a 200 mM mixture of the 4 deoxynucleotides (dATP, dTTP, dGTP and dCTP) and 5 ⁇ l of the 10-fold concentrated PCR buffer (Perkin Elmer).
• the PCR amplification is carried out in Micoamp TM tubes (Perkin Elmer) using a PTC-100 TM thermocycler (MJ Research, Inc.).
• This amplification consists of a denaturation step at 95 ° C for 2 min followed by 30 cycles including a denaturation step of 15 sec at 95 ° C, a hybridization step of 30 sec at 55 ° C and an extension step 1 min at 72 ° C. These thirty cycles are followed by an additional extension of 5 min, then the PCR reactions are stored at 10 ° C.
• the recombinant clones (white colonies) are taken up in 10 ⁇ l of water and confirmed under the same conditions as the PCR after the RT reaction described above except that of triton X-100 at a final concentration of 0.01% v / v is added to the reaction.
• Several positive clones are used to make DNA mini-preparations, those in which the 5 ′ part of the PCNA insert is positioned downstream of the EcoRV site of pCRII are sequenced and selected for the next cloning step.
• PCNA EcoRV-Hind III fragment derived from PCRII-PCNA is inserted at the EcoRV-Hind III site of pET-29.
• This plasmid is then used for the production of the chimeric recombinant protein S-PCNA.
• the stages of transformation, production and purification of S-PCNA are identical to those used for the production of the Ki antigen fused to the myc epitope.
• Figure 7 shows a weak interaction between GST and PCNA only at high doses of GST (500 and 750 ng).
• the affinity of GST-GAX for PCNA is very much higher than that with GST.
• This specific interaction between GAX and PCNA suggests that the antiproliferative activity of GAX is mediated by PCNA sequestration.
• Ki can interact both with GAX and with PCNA is in favor of the formation of bi or tripartite complexes which could play an important role (activation or inhibition) in the progression of the cell cycle.
• CTCCAG TATAACTGGA TTCGAAGCCC AGCCTCATGA CAGGAGGCTG ACGGTATACAGATC

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Molecular Biology (AREA)
• Pharmacology & Pharmacy (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Animal Behavior & Ethology (AREA)
• Genetics & Genomics (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Toxicology (AREA)
• Engineering & Computer Science (AREA)
• Cardiology (AREA)
• Heart & Thoracic Surgery (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Investigating Or Analysing Biological Materials (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=9496803

Family Applications (1)

Country Status (22)

Families Citing this family (4)

Family Cites Families (5)

• 1996
  • 1996-10-18 FR FR9612730A patent/FR2754822B1/fr not_active Expired - Fee Related
• 1997
  • 1997-10-15 US US08/950,860 patent/US6121005A/en not_active Expired - Fee Related
  • 1997-10-16 IL IL12947897A patent/IL129478A0/xx unknown
  • 1997-10-16 BR BR9711947A patent/BR9711947A/pt not_active Application Discontinuation
  • 1997-10-16 CZ CZ991318A patent/CZ131899A3/cs unknown
  • 1997-10-16 KR KR1019990703354A patent/KR20000049249A/ko not_active Application Discontinuation
  • 1997-10-16 EA EA199900387A patent/EA003694B1/ru not_active IP Right Cessation
  • 1997-10-16 CA CA002268045A patent/CA2268045A1/fr not_active Abandoned
  • 1997-10-16 PL PL97332874A patent/PL332874A1/xx unknown
  • 1997-10-16 AP APAP/P/1999/001510A patent/AP9901510A0/en unknown
  • 1997-10-16 NZ NZ335283A patent/NZ335283A/en unknown
  • 1997-10-16 WO PCT/FR1997/001850 patent/WO1998017686A1/fr not_active Application Discontinuation
  • 1997-10-16 HU HU9903956A patent/HUP9903956A3/hu unknown
  • 1997-10-16 SK SK511-99A patent/SK51199A3/sk unknown
  • 1997-10-16 AU AU48713/97A patent/AU741586B2/en not_active Ceased
  • 1997-10-16 EP EP97911277A patent/EP0941243A1/fr not_active Withdrawn
  • 1997-10-16 CN CN97199823A patent/CN1237980A/zh active Pending
  • 1997-10-16 JP JP51902498A patent/JP2001503615A/ja active Pending
  • 1997-10-20 ZA ZA9709390A patent/ZA979390B/xx unknown
• 1999
  • 1999-04-16 BG BG103342A patent/BG63548B1/bg unknown
  • 1999-04-16 NO NO991830A patent/NO991830L/no not_active Application Discontinuation
  • 1999-04-16 OA OA9900083A patent/OA11034A/fr unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events