MXPA99003470A - Polypeptides comprising gax protein domains, involved in repressing transcription and/or interacting with other proteins, corresponding nucleic acids and their use - Google Patents

Abstract

The invention concerns polynucleotides comprising GAX domains, involved in the biological activity of GAX. In particular it may concern domains involved in the interaction of GAX with other molecules or domains responsible for a biological activity. The invention also concerns the chimerical molecules comprising a functional domain of GAX. It further concerns the use of GAX for repressing the expression of genes, and the use of compounds inhibiting theinteraction of GAX with certain cell partners for modulating the activity of GAX, It also concerns a method for screening and/or identifying cell partners of GAX.

Description

POLYPEPTIDES THAT UNDERSTAND REGIONS OF THE GAX PROTEIN INVOLVED IN THE REPRESSION OF TRANSCRIPTION 7/0 INTERACTING WITH OTHER PROTEINS, CORRESPONDING NUCLEIC ACIDS AND THEIR USES.

The present invention concerns the therapeutic area. It concerns more particularly new therapeutic molecules and their use for the treatment of cardiovascular pathologies.

Post-angioplastic restenosis is a localized hyperproliferative disorder that develops consecutively in a non-surgical intervention at the level of the arteriosclerosis plaque. Thus, the treatment of an arteriosclerosis lesion by angioplasty is very frequent (up to 50% of cases in certain studies) in a consecutive restenosis in the mechanical wound of the arterial wall.

The proliferation of smooth muscle cells (MIS) in the vascular wall is a key event in the development of arteriosclerosis, in restenosis after angioplasty as well as in the failure of coronary stitches. The CML are usually quiescent in the vascular wall but, REF. 29957 after an injury that destroys the vascular endothelium, they are in contact with the blood growth factors. Contrary to cardiomyocytes and skeletal muscle cells, CML can, in response to various growth factors, de-differentiate and reinitiate their proliferative cycle. From these phenotypic modifications of the CML, deep changes occur at the level of the expression of numerous genes. By way of example, the expression of early genes, involved in cell proliferation such as c-fos or c-myc, is markedly increased when the expression of other structural genes such as the alpha-actin specific smooth muscle as well as certain isoforms of myosin suffer a negative regulation.

Although it is clearly established that the terminal differentiation of skeletal muscle cells is regulated by transcriptional factors called myogenic such as Myo-D, very few of the factors involved in the reversible differentiation of CML are known today. Recent studies have revealed the existence of transcriptional factors that have a bane-container in different tissues of the cardiovascular system. Such factors recognize, thanks to their bane-container, specific DNA sequences in the promoter regions of their target genes and also intervene in the regulation of differentiation, in the p r o l i f e r a c i n e or in cell migration. One of the gax factors ("Growth-Arrest-Specific Homeobox") is expressed in different cardiovascular tissues of which the CML of the vascular wall. The gax gene has been initially identified from a rat aortic cDNA library. It codes for a protein of 303 amino acids. its sequence has been characterized and its cloned cDNA (Gorski et al., Mol.Cell.Biol. 1993, 6, 3722-3733). The human gaux gene has also been cloned and sequenced (David F. Le Page et al., Genomics 1994,24,535-540). It codes for a protein of 302 amino acids. The gax gene has certain properties similar to the gas and gad genes since it seems to control the GO / GJ transition of the cell cycle as well. As well as gax mRNA levels are reduced in the rat CMVV by a factor of 10 after two hours of exposure to PDGF (Gorski et al., Mol.Cell Biol., 1993, 6,3722-3733). The expression of the gax gene is then repressed in the course of the mitogenic response of the VSMC. Another characteristic of the gax gene lies in the specificity of expression. Indeed, in the adult rat, the gax gene is essentially expressed in the cardiovascular system (aorta, heart). The presence of gax mRNA has not been evidenced by Northern Spotting in the liver, brain, stomach and skeletal muscle. On the other hand, the gax gene belongs to the family of homeotic genes. These genes code for transcriptional factors that contain consencuales sequences (or homoregiones) that recognize specific regions of the DNA (or homocajas) (magazine: Gehring and collaborators Cell, 78: 211-223, 1994). The homocaja of the. rat gax protein is comprised between amino acids 185 and • 245. Interestingly, the homotic genes identified to date are involved in the control of cell differentiation / growth during the course of embryogenesis which reinforces the therapeutic potential of the gen gax (magazine: Lawrence and Morata Cell 78: 181-189, 1994; Kru lauf, Cell 78: 191-201, 1994).

One of the characteristics of GAX is that it undergoes a negative regulation since CML proliferate either in vitro in response to growth factors or in vivo after an injury of the endothelium of the vascular wall. This repression is reversible because when CML are converted into quiescents by serum deprivation, in vitro, GAX expression continues. Works from our laboratory have recently shown that overexpression of GAX in CMLs by an adenoviral vector blocks its proliferation FR 95/04234 (ST95022).

Post-angioplastic restenosis after mechanical injury represents the most frequent failure factor (50% of cases in certain studies). The proliferation of CML that are a key element of this phenomenon, knowing its regulatory role of GAX proliferation, is the last one as a therapeutic selection gene for the preventive treatment of the vascular wall • after angioplasty FR 95/04234 ( ST95022).

However, the mechanism of action of GAX remains, however, very little documented. It remains to identify target DNA sequences from the GAX homocaja. In addition, a study of the function of the different GAX regions has not been carried out to date. The identification of functional pairs of GAX finally constitutes an important facet that will allow the molecular cascade on which GAX depends or of which it is a source.

The present invention has precisely for interest to provide information on these points.

In the course of this work, different analytical approaches have been adopted to identify interacting molecules with GAX, to determine the GAX region necessary for this interaction and to study the importance of the different regions in the GAX function. To do this, the double hybrid system has been used in order to characterize interacting proteins with GAX from a human lung bank.

This approach has allowed us to identify different molecules of which one, the Ki antigen, is particularly interesting. The Ki antigen is a protein of approximately 32 Kda. It has been identified for the first time as a nuclear autoantigen recognized by those that would come from patients afflicted with lupus erythematosus (Nikaido et al 1989, Clin.Exp. Immunol., 1990, 79, 209-214). Recent work has shown that Ki is overexpressed in proliferating cells or transformed by an oncogene (Nikaido et al 1989, Exp. Cell, Res. 1989, 182, 284-289). Experiences of co-immunoprecipitation (Takeushi and collaborators abstract 1995 Juntendo University, Tokyo, Japan) have shown that Ki exists in the form of a complex with PCNA as a marker of proliferation (Almendral et al 1987, Proc. Nati. Acad. Sci. USA, 84, 1575-1579).

The GAX function has also been studied in experiments of transient transfection of mammalian cells that use GAX fused to a heterologous DNA binding region and a reporter gene system that allows to report on the transcriptional activity of GAX after the suppression of different regions of the molecule. It has also been shown that GAX essentially functions as a repressor of transcription. This repression activity is related more particularly to the first 32 GAX amino acids. In addition, this repressor region is located in the region (1-222) of GAX required for interaction with Ki in the yeast. The potential applications of the repressive character of GAX and its interaction with Ki will be developed below.

A first aspect of the invention then concerns fragments of the GAX protein endowed with biological properties.

Another aspect of the invention concerns regions of GAX involved in the biological activity of GAX. They may be particularly regions involved in the interaction of GAX with other molecules or regions responsible for a biological activity. The invention also concerns the use of GAX to repress the expression of genes, as well as the use of compounds that inhibit the interaction I GAX with certain cellmates to modulate GAX activity. It also concerns a method for the screening and / or identification of GAX cellular partners.

As indicated above, the gax gene has particularly advantageous properties for applications in gene therapy of hyperproliferative disorders, particularly restenosis or other pathologies associated with a proliferation of CML. It has been demonstrated in the application FR95 / 04234 (ST95022) that the transport of the gax gene in vivo allows to considerably reduce the proliferation of the CML, and also, to inhibit the reduction of the luminal diameter. It has also been demonstrated in the application FR 95/12871 (ST95057) that the gax gene, expressed in the tumor cells, allowed to oppose the cell transformation process. These different elements demonstrate the potential of the gax gene for therapeutic approaches.

The present application now describes the identification of functional regions of GAX, the construction of GAX derivatives that exhibit a biological activity, the identification of GAX protein partners and the adjustment of methods that allow the search of other partners and the identification of compounds able to interact on these partners. More precisely, the Applicant has now shown that the GAX protein was endowed with repressor activity of transcription. It has also demonstrated that this activity was contained in certain regions of the GAX protein, in particular the N-final region.

The results presented in the examples further demonstrate that the functional regions of GAX are equally involved in the interaction of GAX with a cellular protein, Ki. It is known in the literature that Ki interacts with PCNA (Takeushi et al., Abstract 1995 Juntendo University, Tokyo, Japan) and that this is an indispensable co-factor for DNA polymerase for DNA replication (Fukuda et al., 1995, J. Biol. Chem. 270, 22527-22534). It has been demonstrated in the examples that Gax interacts with PCN, in this way, it is visualized that GAX can also be involved in replicative complexes in the cell.

A first object of the invention more particularly concerns a characterized polypeptide in that it is treated in whole or in part of a fragment of the GAX protein that possesses a transcription repression activity and / or that positively or negatively affects the DNA replication.

More preferably, the polypeptide according to the invention comprises at least residues 1 to 32 of the human GAX protein.

According to another embodiment, the polypeptide according to the invention comprises at least residues 104 to 230 of the human GAX protein.

By way of particular examples of polypeptides according to the invention, mention may be made of polypeptides comprising fragments 1-32, 33-302 and 1-104 of the human GAX protein. The examples presented below demonstrate that such polypeptides are capable of inhibiting gene transcription and thus retain the properties of GAX transcriptional repressor.

More preferably, this polypeptide comprises another fragment of the GAX protein according to the present invention, a fragment of different origin. A fragment of different origin is understood to be a polypeptide fragment not derived from the GAX protein. It can be a synthetic, artificial fragment, a fragment of protein, ... etc. This fragment of different origin can have different functions.

It can, for example, constitute a marker that allows detecting the polypeptide and eventually tracing it in vivo. Such a marker can be for example an epitope recognized by a monoclonal antibody. In this regard, different tagging sequences, said tag sequences, have been described in the literature and are commonly used. The tag-mye sequence can be mentioned.

This fragment can also be a fragment having the property of stabilizing the polypeptide. It can be treated, for this purpose, of all or part of a protein that has a high plasma half-life.

Finally, it can also be a screening element, which allows the polypeptide to reach more quickly and / or more specifically specific cellular compartments. Favorably, it is a nuclear localization indicator (NLS), the polypeptide that mainly exerts its activity in the nucleus of cells. Different NLS indicators have been described in the literature as for example that of the T antigen of the SV40 virus, that of p53 etc.

The fragment of different origin can also give the polypeptide a supplementary biological function or favor the activity of the repressor region. As a very particularly favorable example, a protein region capable of relating the DNA in a specific manner can be mentioned. This type of chimeric molecule also allows to relate the DNA in particular regions and to inhibit the transcription of gens located at the level of these regions. By way of specific examples, mention may be made of the DNA binding region of the yeast GAL4 protein. Such constructions are described in the examples. They can be used to regulate the expression of genes in the yeast or of genes placed under the control of an expression indicator comprising the binding site of the GAL4 protein. Other protein binding regions of DNA may be for example Lex A, the DNA binding region of a nuclear receptor such as the estrogen receptor or another member of this family, etc. It can also be a peptide that allows, on the one hand, the secretion of all or part of GAX, as well as its screening towards membrane receptors that allow its internalization and that also increases the diffusibility and the GAX activity region by an effect of type "Bystander" To this title it may be more particularly used all or part of the transferrin or molecule fragments of the extracellular matrix that can recognize integrins on the surface of the CML.

The polypeptides according to the invention are particularly interesting in the therapeutic field and that of applied research.

The therapeutic activity of the claimed polypeptides is related more particularly to their ability to repress transcription or to affect DNA replication, by analogy with the GAX protein and then to confer a power to regulate the expression of other proteins.

In this perspective, the present invention also focuses on the use of the GAX protein or a fragment as claimed to repress gene transcription and / or positively or negatively affect the DNA replication.

Because of this behavioral analogy with the GAX protein, these fragments can advantageously be substituted in their function as transcription repressors. On the other hand, taking into account the fact that they do not contain the GAX protein that all or part of their region involved in the repression of transcription, it can be thought that they will be less sensitive to the different alterations to which the GAX protein is subject. . These polypeptides as such or derivatives can then manifest a repressor character of the transcription enhanced comparatively to that of the natural GAX protein.

One can also contemplate using them in order to identify new partners of the GAX protein. In this regard, the subject of the present invention is also a method for the screening and / or identification of interacting polypeptides with the GAX protein or a GAX region characterized in which a polypeptide is applied according to the invention. More preferably, this polypeptide is selected from fragments 1 to 32 and 33 to 302 of the GAX protein.

In this title, the applicant has unexpectedly demonstrated that one region of the GAX protein could interact in a specific manner with another cellular protein, the Ki protein. As previously stated, Ki is a self-antigen that appears when auto-immune diseases such as lupus erythematosus. It is described as a nuclear molecule whose expression increases during the course of cell proliferation as well as in fibroblasts transformed by an oncogene.

We have been able to show that, in yeast, the N-final part of GAX is necessary for interaction with Ki. the recombinant protein Ki specifically recognizes GAX transferred on a nitrocellulose filter from a denaturing polyacrylamide gel.

The present invention also focuses precisely on a polypeptide characterized in that it is a fragment of the GAX protein capable of interacting with the Ki protein.

More preferably, it is fragment I to 32 or 104 to 223 of the GAX protein.

The applicant also demonstrated very unexpectedly that a region of the GAX protein could interact in a specific manner with the PCNA proliferation marker ("Proliferating Cell Nuclear Antigen"). This factor is indispensable for DNA replication and also plays a role in DNA repair phenomena.

The present invention then concerns a polypeptide characterized in that it is a fragment of the GAX protein, capable of interacting with PCNA.

On the other hand, it has been described in the literature that Ki existed in the form of a complex with PCNA. Ki can then interact with both GAX and PCNA by forming a complex at least bipartite with one or other of these proteins and preferably a tripartite complex. The formation of these complexes has an important role in the progression of the cell cycle (activation or inhibition).

Likewise, the present invention also approaches a polypeptide characterized in that it is a fragment of the GAX protein capable of interacting with Ki and / or PCNA and of forming a complex at least tripartite with these proteins.

Another object of the present invention concerns any nucleic acid encoding a polypeptide as defined above. It can be sequences of natural or artificial origin, and particularly of genomic DNA, of cDNA, of mRNA, of hybrid sequences or of synthetic or semi-synthetic sequences. This nucleic acid can be of human, animal, plant, bacterial, viral, etc. origin. It can be obtained by any technique known to the person skilled in the art, and particularly by screening of banks, by chemical synthesis, or even by mixed methods that include the chemical or enzymatic modification of sequences obtained by screening of banks. They can, on the other hand, be incorporated into vectors, such as plasmid vectors.

Favorably, the nucleic acid according to the invention is a cDNA.

The nucleic acids of the invention can be used for the production of probes or antisense molecules that allow, by hybridization, to detect the presence or expression of nucleic acids encoding polypeptides containing a repressor region according to the invention, or to inhibit the expression of such polypeptides. In the case of probes, these preferentially contain more than 10 bases and, favorably, from 10 to 300 bases.

The nucleic acids of the invention can be used for the expression and / or production of polypeptides in vitro, in vivo or ex vivo, in gene or cell therapy approaches.

For this purpose, the present invention concerns expression cartridges containing a nucleic acid such as defined above, under the control of a promoter that allows its expression.

Different promoters can be used in the framework of the invention. These are sequences that allow the expression of a nucleic acid in a mammalian cell.

The promoter is favorably selected among the functional promoters in human cells. More preferably, it is a promoter that allows the expression of a nucleic acid sequence in a hyperproliferative cell (cancerous, impaired, etc.). In this regard, different promoters can be used. It can also be any promoter or sequence that stimulates or represses the transcription of a gene in a specific way or not, inducible or not, strong or weak. Particular mention may be made of the promoter sequences of eukaryotic or viral genes. For example, it can be promoter sequences from the genome of the target cell, among eukaryotic promoters, it is possible to use in particular ubiquitous promoters (gene promoter HPRT, PGK, alpha-actin, tubulin, DFAP, etc.), promoters of the filaments (promoter of the genes GFAP, desmin, vimentin, neurofilaments, keratin, etc.), of promoters of the therapeutic genes (for example the promoter of the genes MDR, CFTR, Factor VIII, ApoAI, etc.), of promoters tissue-specific (promoter of the pyruvatokinase gene, villin, intestinal protein of binding of fatty acids, alpha-actin of smooth muscle, etc.), cell-specific promoters of dividing cells such as cancer cells or even promoters that respond to a stimulus (steroid hormone receptor, retinoic acid receptor, glucocorticoid receptor, etc.) or called inducible. Likewise, it can be promoter sequences from the genome of a virus, such as, for example, the promoters of the adenovirus ElA and MLP genes, the early CMV promoter, or even the RSV LTR promoter, etc. In addition, these promoter regions can be modified by the addition of activation sequences,. of regulation, or that allow a tissue-specific or majority expression.

The present invention now provides new therapeutic agents that allow, due to its ability to repress transcription, interfere with numerous cellular malfunctions. For this purpose, the nucleic acids or cartridges according to the invention can be injected as such at the level of the site to be treated, or directly incubated with the cells to be destroyed or treated. It has been in effect described that nucleic acids could not penetrate cells without a particular vector. However, it is preferred within the framework of the present invention to use an administration vector, which makes it possible to improve (i) the efficiency of cell penetration, (ii) the screening and (iii) the extra- and intracellular stability.

In one embodiment of the particularly preferred application of the present invention the nucleic acid or the cartridge is incorporated into an expression vector. The vector used may be of chemical origin (liposome, nanoparticle, peptide complex, lipid or cationic polymers, etc.) viral (retrovirus, Adenovirus, herpes virus, AAV, vaccinia virus, etc.) or plasmidic.

The use of viral vectors rests on the natural properties of virus transfection. It is also possible to use, for example, adenoviruses, herpes viruses, retorvirus and adeno associated viruses. These vectors are particularly effective on the plane of transfection. In this regard, a preferred object according to the invention resides in a defective recombinant retrovirus whose genome comprises a nucleic acid as defined above. Another particular object of the invention resides in a defective recombinant adenovirus whose genome comprises a nucleic acid as defined above.

The vector according to the invention can also be a non-viral agent capable of promoting the transport and expression of nucleic acids in eukaryotic cells. The chemical or biochemical, synthetic or natural vectors represent an interesting alternative in natural viruses in particular for reasons of comfort, safety and also due to the absence of theoretical limits regarding the size of the DNA to be transfected. These synthetic vectors have two main functions, to compact the nucleic acid to be transfected and to promote its cellular fixation as well as its passage through the plasmic membrane and, if not, the two nuclear membranes. To scale to the polyanionic nature of nucleic acids, non-viral vectors have all polycationic charges.

The nucleic acid or the vector used in the present invention can be formulated in view of topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, trans dermal administration, etc. Preferably, the nucleic acid or the vector is used in an injectable form. It can then be mixed with any pharmaceutically acceptable carrier for an injectable formulation, particularly for a direct injection at the site level to be treated. It can be, in particular, sterile, isotonic, or dry, particularly lyophilized, solutions which, by addition according to the case of sterilized water or physiological saline, allow the constitution of injectable solutes. The doses of nucleic acid used can be adapted according to different parameters, and particularly depending on the gene, the vector, the mode of administration used, the pathology concerned or even the duration of the investigated treatment.

The invention also concerns any pharmaceutical composition comprising at least one nucleic acid as defined above.

It also concerns any pharmaceutical composition comprising at least one vector as defined above.

Because of their antiproliferative properties, the pharmaceutical compositions according to the invention are very particularly adapted for the treatment of hyperproliferative disorders, such as, in particular, cancers and restenosis. The present invention also provides a particularly effective method for the destruction of cells, particularly hyperproliferative cells. It is also applicable to the destruction of tumor cells or smooth muscle cells of the vascular wall (restenosis). It is particularly appropriate to the treatment of cancers. By way of example, mention may be made of adenocarcinomas of the colon, thyroid cancers, carcinomas of the lung, leukemias, myeloid tumors, colon rectal cancers, breast cancers, lung cancers, gastric cancers, cancers, cancers of the esophagus, B-lymphomas, ovarian cancers, bladder cancers, glioblastomas, hepatocarcinomas, cancers of the bones, skin, pancreas or even cancers of the kidney and prostate, cancers of the esophagus, cancers of the larynx, cancers of the head and neck, HPV positive ano-genital cancers, EBV-positive nasopharyngeal cancers, etc.

On the other hand, the present invention also extends to any use of compounds that inhibit the activity of the PCNA protein to inhibit the proliferation of smooth muscle cells.

The present invention also concerns the use of compounds according to the invention for the formation of a bi- or tri-partite complex with the protein Ki and / or PCNA to positively or negatively affect the progression of the cell cycle.

The present invention will be more fully described with the help of the examples and figures that follow, which should be considered as illustrative and not limiting.

SUBTITLES OF THE FIGURES Figure 1: Analysis by northern spotting of Ki protein expression from mRNAs extracted from different tissues.

Figure 2: Nuclear localization of KiHA in cells transfected by the immunofluorescence method.

Figure 3: In vitro interaction between Ki and GAX A proteins) coomasie blue B) spotting Far Western Figure 4: A) Representation of the reporter gene construction expressing bacterial chloramphenicol acetyl transferase (CAT) under the control of an artificial promoter.

B) Dosage of the CAT enzyme activity in cell extracts after transfection with expression vectors that respectively incorporate ER, GAL VP16 and ER-GAL VP 16.

Figure 5: Comparison of constructs of different GAX deletion mutants in relation to the whole GAX protein 1-302.

Figure 6: Dosage of CAT enzymatic activity with different GAL-GAX chimeras A) without activator ER B) in the presence of the ER activator Figure 7: Interaction between GST-GAX and PCNA.

MATERIAL AND METHODS A) MATERIAL 1) Yeast strain used.

The YCM79 strain of the S. cerevisiae gene (MATa, ura3-52, his3-200, ade2-101, lys2-801, trpl-901, leu2-3, 112, canl, gal4-542, gal80-538, metl 6: : URA3-pGall / 10-LacZ, HIS3:: GAL7BLE) has been used as a screening tool for the lung fusion bench by the two-hybrid system. < It is cultivated on the following culture media: Complete YPD medium: - Yeast extract (10 g./l) (Difco) - Bactopeptone (20 g./l) (Difco) - Glucose (20 g./l) (Merck) This medium has been solidified by the addition of 20 g./l of agar (Difco).

Medium YNB minimum: - Fungus Nitrogen Base - Glucose (20 g./l.) (Merck) This medium can be solidified by addition of 20 g./l. of agar (Difco).

To allow the growth of autotrophic yeasts on this medium, it is necessary to add the amino acids or nitrogenous bases, for which they are dependent on 50 mg./ml. 2) Bacterial strains used: The TG1 strain of Escherichia coli of genotype supE, hsdD5, thi, D (lac-proAB), F '[traD36 pro A + B + laclq lacZDM15] has been used as a means of amplification and isolation of recombinant plasmids used.

For the production of recombinant proteins, the E.coli bacteria used are the BL-21 obtained in Pharmacia. E. coli. They possess the genotype F 'omp T hsdSt BL-21 is a strain of selection for the production of recombinant proteins since it does not have protease and its membrane is fragile, easy to break by simple sonication. E. coli BL-21 possesses a repression system of T7 RNA polymerase. this repression can be perceived by the IPTG which allows the control of genes placed upwards of the binding site of the T7 RNA polymerase. The bacteria are placed in culture in 2 ml. of the LB medium (NaCl 5 g./l, Tryptone 10 g./l, Yeast extract 5 g./l.) in a shaker at 37 ° C overnight, 1 ml. of this preculture is put back into culture in 50 ml. of medium 2xYT (NaCl 5 g./l., Triptona 16 g./l., yeast extract 10 g./l.) at 37 ° C until the bacteria reach an optical density (OD) of 0.4 to 600 nm (exponential phase of growth). The culture of the bacteria is cooled on ice. They are centrifuged at 3300 rpm for 20 min.

The E. coli bacteria, competent for the production of recombinant proteins, are prepared by the calcium chloride method. To do this, the bacteria are placed in solution in 5 ml. of 0.1 M CaCl2 (1/10 of the culture). They are centrifuged again at 3300 rpm for 10 mins. They are put back in solution in 1 ml. of 0.1 M CaC12 containing 17.5% glycerol. They are aliquoted and. stored at -80 ° C. 3) Applied plasmids: The plasmids applied are: The vectors of the pGBT and pAS series, of the vehicle plasmids that have a bacterial and yeast replication origin, allowing them to replicate in high numbers of copies in these two microorganisms. These plasmids contain a multiple cloning site located upstream of the coding sequence for the Gal4 DNA binding region and down a terminator to form a fusion protein. They also contain the TRP1 gene of S cerevisiae, which makes it possible to supplement the yeasts of the trpl genotype in order to select them on a minimum medium that does not contain tryptophan. These vectors carry the ampicillin resistance gene that allows to select the bacteria that possess them on a medium that contains ampicillin.

The vectors of the pGAD (Clontech) series of the vectors that allow the expression in the yeast of fusion proteins between the transactivator region of GAL4 and a protein of interest or encoded by the cDNA that comes from a lung bank, inserted at the level of an EcoRI Xhol site.

Vectors of the pET29 series (Novagen) vectors that allow the expression of recombinant proteins in coli in fusion with the tagS.

Vectors of the pGEX series (Pharmacia) vectors that allow the expression of recombinant proteins in coli in fusion with glutathione S transferase (GST).

The vectors of the Bluescript series (Strata gene) vectors that allow the cloning to be carried out in the same way as the pIC series (J. Lawrence Marsh et al. Gene, 1984, 32, 481-485) and pMTL (Steve P. Chambers et al., Gene, 1998, 68, 139-149).

Plasmid pGEX-2T-hGAX is the plasmid applied for the transformation of E. coli BL-21. This plasmid has been obtained from plasmid pGEX-2T and has been provided by Dr. K. Walsh of St. Elizabeth's Medical Center in Boston. the base pGEX-2T plasmid (Pharmacia) allows to produce the GAX protein fused to the Glutathione-S-Transferase (GST), a protein that has a strong affinity for Glutathione. The GST-GAX fusion will facilitate the GAX purification by affinity on agarose beads coupled to Glutathione. In addition, there is a cut-off site for thrombin that allows the chimera to be cleaved between GST and GAX. The hGAX cDNA is inserted on the control of the tac hybrid promoter and the lac oppressor. the lacl repressor that is fixed on the lac operator, prevents the RNA polymerase from advancing. This repression is perceived by an analog of the lactoda, isopropyl-β-D-thiogalactoside (IPTG) that is associated with lacl. The lacI-IPTG complex can no longer be fixed on the lac operator, the RNA polymeres have no further obstacle then. 4) Protein Ki Production and Purification We have cloned the protein Ki gene fused to an epitome myc in the plasmid pET-29 (Novagen) from the plasmid pGAD contained in the yeast, the plasmid pET-29 produces the protein fused to the epitope called S-Tag that allows the purification of Kl by affinity on agarose beads coupled to the S-protein. The SmycKI chimera is under the control of the T7 promoter and the lac operator. The BL-21 are transformed by the plasmid pET-29-mycKI. As for the GST-GAX protein, they are placed in culture until a D.O. from 0.7 to 600 nm. Then, AmycKI expression is induced by 0.1 mM of IPTG and by the T7 RNA polymerase produced by BL-21. The bacteria are sonicated. The supernatant is then purified by the following method. The purification of SmycKI is done by affinity on agarose beads coupled to the S-protein. The method is the same as for GST-GAX except that the resin is washed in a solution containing 20 mM Tris pH 7.5, 0.15 M NaCl and 0.1% Triton X-100. Elution and dialysis are the same as for GST-GAX.

B. METHODS The methods conventionally used in molecular biology are well known to those skilled in the art and are abundantly described in the literature [Manniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 1982; Ausubel F. M. et al. (Eds.), "Currents Protocols in Molecular Biology". Jhon Wiley F sons, New York, 1987]. 1) The double-hybrid system This system is a method of cloning by in vivo interaction in Saccharomyces cerevisiae whose principle is based on the modular structure of the yeast transcriptional factor GAL4 (7). The GAL4 transcriptional activator has two independent regions that have different functions. The DNA binding region (GALDB for GAL DNA Binding) allows Gal4 to bind to a specific DNA sequence at the level of the promoter region of a gene. GAL 4 is then spherically close to the transcriptional machinery and, thanks to its transactivating region (GALTA), increases the frequency with which transcription is initiated on the adjacent gene, probably by interactions with the RNA polymerase or associated proteins. The principle of the double-hybrid system is to separately fuse GALDB and GALTA to two different X and Y proteins that, when they interact, reconstitute an active transcriptional complex. 2) Yeast screen by PCR technique ('' Chaine Reaction Polymerase ").

The screening or selection has been done directly on the yeasts. Each yeast colony is placed in solution in 10 μl of water containing 0.08% Tween 20. Tween is a non-ionic detergent that increases the lysis of yeasts in the first stage of heating to 95%.

° C. For the subsequent steps, Tween 20 acts as a protective agent for the Taq DNA polymerase. The yeast suspension is completed to a final volume of 20 μl containing the following quantities or final concentrations: 10 picomoles of primer 1, 10 picomoles of primer 2, 1 unit of Taq DNA polymerase, 75 mM of Tris ph 9, 20 mM of (NH4) 2S04, 0.01% Tween 20, 2.5 mM MgC12 and 125 μM each of 4 deoxyribonucleotides (dATP, dTTP, dGTP, and dCTP). At the PCR exit, a portion of the mixture is analyzed on an agarose gel. It can also be known, for a given pair of primers and for each yeast clone, if it is a DNA sequence already identified. 3) Preparation of plasmidic DNA.

Large amounts of DNA are prepared using the Prómega DNA Rapid Preparation Kit.

The small amounts of DNA are prepared in the following manner: the bacteria containing the plasmid are cultured for at least 4 hours in 2 ml. of medium I.B. in a stir plate. They are then centrifuged for 2 minutes at 14,000 rpm in Ependorf tubes, then the cartridge is resuspended in 100 μl of solution 1. (50 mM glucose, 25 mM regulator Tris HCL pH 8, 10 mM EDTA pH 8), lysates per 200 μl of solution II (0.2 M NaOH, 1% SDS). The solution of lysate is then neutralized by 150 μl of solution III (3M of potassium acetate, 11.5% (v./v.) Of glacial acetic acid). After stirring the tubes until obtaining a precipitate in flakes, 150 μl of a mixture of phenol / chloroform (50% of phenol and 50% of chloroform saturated in water) are added, and the whole is stirred for 30 seconds. The aqueous phase containing the DNA is recovered after centrifugation for 2 minutes at 14,000 rpm. The DNA is then precipitated by addition of 0.5 (volume) of isopropanol then centrifuged 5 minutes at 14,000 rpm and air drying to finally be placed in 20 μl of TE RNAse (solution of 10 mM Tris-HCL and 1 mM EDTA with 50 μg / ml of RNAse). 4) Synthesis and Enzymatic Amplification of DNA or PCR ("Polymerase Chain Reaction").

The PCR reactions are carried out in a final volume of 100 μl in the presence of the DNA matrix, dNTP (0.2 mM), PCR buffer (Tris-HCl pH 8.5 10 mM, 1 mM MgC12, 5 mM Kcl, 0.01 gelatin). %), 0.5 μg of each of the oligonucleotides and 2.5 μl of Ampli Taq DNA polymerase (perkin-Elmer) with or without formamide (5%). The mixture is coated with 2 drops of paraffin oil to limit the evaporation of the sample. the device used is the "Crocodile II" of Appli gene.

We have used a matrix denaturation temperature of 90 ° C, a hybridization temperature of the oligonucleotides in the lower matrix of 5 to 10 degrees at the separation temperature of the oligonucleotides and an elongation temperature for the enzyme at 72 ° C .

The obtained fragments, which serve for cloning * are systematically resected once cloned, in order to verify the absence of eventual mutation appeared due to the amplification.

Oligonucleotides are chemically synthesized according to the phosphoramidite method using β-cyanoethyl proteg groups (Sinha 1984). After synthesis, the protee groups are eliminated by treatment to the ammonia and two butanol precipitations allow to purify and concentrate the oligonucleotides (Sawadogo, 1991). The concentration in DNA is determined by measuring the optical density at 260 nm.

) Ligatures.

All ligation reans are carried out at + 14 ° C overnight in a final volume of 10 μl in the presence of 100 to 200 ng. of vector, 0.5 to 2 μg of insertion, 40 IU of enzyme T4 DNA ligase (Biolabs) and a binding regulator (50 mM Tris-HCl pH 7.8, 10 mM MgC12, 10 mM DTT, 1 mM ATP). The negative control is constituted by the ligation of the vector in the absence of insertion.

Filling of the prominent 5 'ends is otherwise effected prior to ligation by the Klenow fragment of E. coli DNA polymerase Y (Biolabs) according to the supplier's specifications. The destrun of the prominent 3 'ends is effected in the presence of the DNA polymerase of phage T4 (Biolabs) used according to the manufacturer's recommendations. 6) Transformation of the bacteria The transformation of the bacteria by a plasmid is carried out according to the following protocol: The total volume of ligature (10 μl) is used to transform the TG1 bacteria converted into competent by the method of Chung et al., ( PNAS, 1988 86, 2172-2175).

The TG1 bacteria are placed in culture in a liquid LB medium for a few hours in an incubator with shaking at 37 ° C, until obtaining an OD of 0.6 to 600 nm. The medium is then centrifuged at 6,000 rpm for 10 min. The bacteria are made competent by taking the cartridge with a volume of TSB (medium LB + 100 g / 1 PEG 4000, 5% DMSO, 10 mM MgC12, 10 mM MgSO4) corresponding to 1/10 the volume of the medium of the initial culture. After incubation at 4 ° C for 30 to 60 minutes, 200 μl of bacteria are placed in contact with the ligation products for 15 minutes on ice. After addition of 200 μl of LB, the bacteria are incubated 30 minutes at 37 ° C then spread on LB medium + ampicillin. • 7) Separation and extran of DNA The separation of the DNA is carried out according to its size by electrophoresis. To do this, different gels are used depending on the size of the fragments to be separated: - 1% agarose gel (Gibco BRL) in a TBE regulator (90 mM Tris base, 90 mM Borate, 2 mM EDTA) for separation of large DNA fragments (greater than 500 pdb). - 2% NuSieve agarose gel (FMC Bioproducts) in a TBE regulator for the separation of small fragments (less than 500 pdb).

All migration on agarose gel or on polyacrylamide gel is performed in a TBE regulator and in the presence of a molecular weight marker (1 Kb scale, Gibco BRL). The DNA is mixed with 1/10 of the volume of the deposit blue (200 g / l of Ficoll, 0.5 g / l of bromophenol blue, 50 mM of EDTA) before being deposited on gel. After migration to 100 Volts and staining to etidium bromide (concentration 0.5 μg / ml of gel), the bands are visualized on the UV lamp.

The extran of the DNA from the band of an agarose gel is performed by electroelution as follows: The piece of gel containing the DNA fragment is trimmed with the scalpel and placed in a dialysis puddle closed by two forceps and containing 100 to 500 μl of TBE. The whole is placed in an electrophoresis tank where it suffers an electric field of 100 Volts, the DNA, after having left the gel, is then purified by two phenol / chloroform extractions followed by two extractions to the chloroform, then precipitated in the presence of 0.3 M sodium acetate and 2.5 (volume) of absolute ethanol. After centrifugation (5 nm at 14,000 rpm) the DNA cartridge is dried then put back in 20 μl of water. 8) Fluorescent sequencing of plasmid DNA.

Sequencing is done following the Sanger method using 4 dideoxyribonucleotides that have a different fluorescent marker. The incorporation of one of these dideoxyribonucleotides produces a stop in the replication by the Taq polymerase of the DNA to be sequenced. This reaction will give DNA fragments of different sizes, all terminated at 3 'by one of the 4 dideoxyribonucleotides.

One μg of a plasmid and 4 picomoles of a primer are added to 9.5 μl of a "premix" provided by Applied Biosystems under the name of Prism ©. The final volume should be 20 μl to perform a PCR during 25 cycles of decomposition in a denaturation stage of 90 ° C for.30 seconds, a hybridization stage at 50 ° C for 15 seconds and a stage of annealing, at 60 ° C for 4 minutes.

The DNA fragments, obtained after amplification, are purified on exclusion column (Chromaspin-30 from Clontech); and are then dried in the Speed Vac. the whole is taken up again by 5 μl of a mixture formed of 24 μl of EDTA (50 mM) and 120 μl of deionized formamide. After denaturation at 96 ° C for 3 minutes, 3 to 5 μl are deposited on an electrophoresis gel. The different DNA fragments are separated according to their size and will pass successively in front of a lasser reader of the Sequencing Apparatus 370 DNA (Applied Biosystems) where the different fluorescence will be detected. 9) Preparation of plasmids from the lung bank (Clontech®) The lung cDNA fusion library is sold in the form of bacteria. This bank comes from the cloning, at the level of the EcoRI-Xhol site of the plasmid pGAD424 (Material y Methods), cDNA corresponding to the total RNAs of human lung cells.

After verification of the bank's title, 2 μl of bacteria from the lung fusion pool, previously placed in 8 ml. of LB, are extended in a non-confluent manner on a solid medium in order to save the representativeness of this bank. We have extended in this way 16 boxes of 770 cm2 containing an LB + ampicillin medium. The appeared colonies are taken again and then put in an Erlen and put to incubate in a stirring plate at 37 ° C for 3 hours. The DNA is then extracted from these strains by the Maxiprep technique. The concentration in DNA will be determined at 260 nm.

) Transformation of the yeast by a plasmid.

Yeasts previously cultured in 100 ml. of liquid medium are collected after centrifugation at 3,000 rpm for 3 minutes and suspended in 1 ml. of sterile water. After centrifugation at 3,000 rpm for 3 minutes the cell cartridge is resuspended in 1 ml. of sterile water then centrifuged again. This operation is repeated again in order to eliminate all traces of the culture medium. The yeasts are then put back in 1 ml. of the transformation solution Y (0.1 M LiAc, 10 mM Tris-HCl pH 7.5, 1 mM EDTA). then centrifuged at 3,000 rpm for 3 minutes. The cell cartridge is put back in 1 ml. of the transformation solution Y 50 μl of this yeast suspension is placed in the presence of 50 μg. of salmon wait DNA and 1 to 5 μg. of plasmid DNA 300 μl of a transformation II solution (0.1 M liAc, 10 mM Tris-HCl pH 7.5, 1 mM EDTA in 40% PEG4000) are then added, then the whole is put to incubate at 28 ° C for 30 minutes. A heat shock is then applied on the transformation mixture in a water bath at 40 ° C for 15 minutes then the whole is centrifuged at 15,000 rpm for 1 minute in order to collect the cell cartridge.

This cartridge is placed in 200 μl of water then spread on a minimum gelled medium that does not contain the amino acids corresponding to the markers provided by the transforming plasmid. The yeasts are then put to cultivate for 72 hours at 28 ° C.

In the particular case of the transformation of the yeast by the lung cDNA bank, the procedure is as follows: The yeast used contains the plasmid pGL4DB-GAX which expresses the GAX protein in a fused form in the binding region of GAL4 DNA. It is cultivated in 250 ml. of minimum YPG medium at 28 ° C under agitation to a density of 107 cells / ml. The cells are harvested by centrifugation at 3,000 rpm for 10 minutes and put back into 250 ml. of water .. After a new centrifugation the cell cartridge is put back in 100 ml. of water and again centrifuged. The cartridge is then put back in 10 ml. of the Y solution of transfusion and incubated for 1 hour at 28 ° C under agitation. After centrifugation the cells are again taken in 2.5 ml. of the transforming Y solution, 100 μl of the lung cDNA library and 20 ml. of the transformation solution II, then incubated for 1 hour at 28 ° C under agitation. A thermal shock is effected on this transformation mixture at 42 ° C for 20 minutes. A centrifugation (3,000 rpm for 5 minutes) is repeated 3 times in succession each time with 10 ml of cartridge. of sterile water. The third time the cartridge is taken with 2.5 ml. of PBS. Also the toxic PEG for the cells has been eliminated. 2.4 ml. of this suspension are used to seed 250 ml. of minimal medium containing the His, Lys, Met amino acids and the Ura and Ade bases and cultured overnight in a shaking plate at 28 ° C. The 100 μl of this remaining suspension serves to verify the efficiency of the transformation; for this dilutions of 10-2, 10-3 and 10- of this suspension have been made. The overnight culture is centrifuged (3,000 rpm for 5 minutes) and washed with sterile water twice in a row. The cartridge is then taken in 2.5 ml. of water, 2.4 ml. of which the volume is brought to 10 ml. with sterile water, they are used to plant 10 boxes of 435 cm2 containing a medium YNB + Lvs + Met + His + Ade, and put to incubate for 3 days. The remaining 100 μl are used to perform the same operations as when determining the transformation index, in order to determine the amplification index of the number of colonies during the course of a night of culture. 11) Preparation of yeast (genomic and plasmidic) DNA The value of an average hoe of a yeast clone is placed in 200 μl of a TELT solution (Triton X100 2%, SDS 1%, NaCl 100 mM, Tris pH 8 10 mM, EDTA 1 mM), in the presence of 3 g . of glass beads of 450 μm in diameter and 200 μl of phenol / chloroform. This mixture is then vortexed for 15 minutes, then centrifuged for 2 minutes at 14,000 rpm. The supernatant is collected without sampling the protein cake and the DNA contained in this phase is precipitated with 2.5 volumes of absolute ethanol. After centrifugation for 2 minutes at 14,000 rpm, the DNA cartridge is dried and put back into 20 μl of TE-RNAse. This DNA solution, which corresponds to a mixture of genomic and plasmid DNA, directly serves to transform bacteria. Only plasmid DNA is able to replicate in bacteria and can be analyzed by the miniprep technique. 12) Examination of ß-galactosidase activity A sheet of nitrocellulose is previously deposited on the Petri dish containing the individualized yeast clones. Thanks to the phenomenon of adsorption, a faithful image of the placement of the clones is obtained. This leaf is then immersed in the liquid nitrogen for 30 seconds in order to make the yeasts sprout and thus release the β-galactosidase activity. After thawing, the nitrocellulose sheet is deposited, colonies upwards, in another Petri dish containing a previously wet whatman r of 1.5 ml. of PBS solution (60 mM Na2HP04, 40 mM NaH2P04, 10 mM Kcl, 1 mM MgSO4, pH 7) and 10 to 30 μL of X-Gal (5-bromo-4-chloro-3-indoyl-bD-galactoside) in 50 mg./ml. in N, N-dimethylformamide. The box is then placed in an incubator at 37 ° C closed cover to prevent dryness. The time of appearance of the blue color can be very variable, from a few minutes to several hours. This examination should always be done in the presence of a positive witness whose interaction is known and quickly change to blue. 13) Construction of the expression vectors and the reporter gene. a) Expression vectors The receptor cDNA in estrogen (ER) is obtained by reverse transcription (RT) with the help of a commercial kit ("first strand cDNA Synthesis Kit from Pharmacia"), from total RNA extracted from mouse uterus, followed by an amplification by PCR. We have used a pair of specific primers that hybridize 5 'to the 20 nucleotide primers of ER and introduce an EcoR site just upstream of the first codon (5' gagcgaattcATGACCATGACCCTTCACAC SEQ ID No. 6, the nucleotides in italics represent the site EcoR I and in capitals underlined the first codon), from the 3 'side the primer returns to the beginning of the codon parador of ER and also introduces an EcoE I site (5' - gagcgaattc ACTGATCGTGTTGGGGAAGC SEQ ID No. 7, the nucleotides in italics represent the EcoR I site and in capitals underlined the stop codon). The obtained PCR fragment has been purified, digested by EcoRI then cloned in the same site in the pCDNA 3 expression vector (Invitrogen). This vector is called pCMV-ER. The different GAX deletion mutants fused to the GAL4 DNA binding region (pCMV-GALDB / GAX, see example 9) have also been cloned into the vector pCDNA 3. b) Gen Reporter The reporter gene has been constructed according to the strategy described by Martínez et al (Martínez et al 1991, Mol.Cell. Biol. 11.2937-2945) except that the cloning vector used is pG5CAT (Clontech, CAT = Chloramphenicol Acetyl Transferase ). We have synthesized a double filamentous oligonucleotide (below) containing two specific sites (in bold) one of them recognized by the binding region in GAL4 DNA (Gal-17mer, Carey et al. 1989, J. Mol. Biol. 209, 433-432) and the other is a consensual sequence of the "Estrogen Responsive Element" (ERE, Beato M. 1989, Cell 56.335-344) that binds the receptor to estrogen. This adapter oligonucleotide possesses at 5 'a protrusive Xhol site and at 3' an Xbal site that has allowed cloning at the Xho I and Xba I sites of pG5CAT.

SEC Id No. 8 tj ^ aaAGGTCATATTGACCTaagcttCGGGTCGGAGTACTGTCCTCCGACTGCcatatgt ^ cTCCAGTATAACTGGAttcgaaGCCCAGCCTCATGACAGGAGGCTGACGgtaracaaatc Xtisl ERE Ga.l ~ 17max? £, ax The principle of this reporter gene (pEGEGICAT, Fig. 4, example 11) rests on the fact that ER is a transcriptional activator that it possesses in the case of ER murine, a constitutive activity that increases in response to its natural ligand, 17-ß-estradiol. This system has been used by Martínez and colleagues to study the synergy between ER and a second transcriptional factor, NF1, whose transcriptional activating region has been fused to the DNA binding region of the GAL4 yeast protein (GALDB). This reporter also allows taking into account the transcription index due solely to one or the other of the transcriptional factors or their cooperation without interference due to endogenous molecules. This system then allows us to study the transcriptional activity of all or part of the GAX protein fused to GALDB (Fig. 5, 6 and examples 12, 13).

A plasmid expressing the luciferase gene under the control of the CMV promoter (pCMV-Luc) has been constructed, this construction has been obtained after cloning of a PCR fragment (flanked at 5 'and 3' of a BamHI site). ) containing the CMV promoter of the vector pCDNA3 (Invitrogen) in the BglII site of the pGL3-Basic vector (Promega) This plasmid will serve as an internal standard in all transient transfection experiences that follow. 14) Experiences of Transitory Transfection All studies have been performed on murine embryonic fibroblasts NIH-3T3 (ATCC). These cells have been maintained routinely in DMEM (GIBCO) supplemented with 100 U / ml. of penicillin (GIBCO), 100 μg / ml streptomycin (GBCO), 2 mM L-glutamine (GBCO) and 10% fetal calf serum (SVF, GIBCO). This means will be designated by the abbreviation DMEM-GPS / SVF.

For the transient transfection experiences, the NIH-3T3 are seeded at a density of 100,000 cells per deposit of a 24-well culture plate (Falcon), in a volume of 1 ml. of DMEM-GPS / SVF, 16 to 20 hours later, after fixation and spread of the cells, the cells are washed with 0.5 ml. of DMEM-GPS (without SVF) then put back in 0.5 ml. of DMEM-GPS, 50 μl of a transfection mixture are then added per culture reservoir. This mixture is obtained as summarized in table 3 below.

TABLE 3 * The different mixtures, numbered from 1 to 4, are designed to study, respectively, the basal activity of the EREG1CAT promoter, the activity of ER or GADB / GAX alone and finally the simultaneous effect of ER and GALDB / GAX. ** pCDNA3 is used to complete each mixture to 10 μl total *** Lipofectamine in 2 μg / μl (gibco) is used in a ratio of 8/1 (lipofectamine / DNA).

The cells put in contact with the different transfection mixtures for 4 hours at 37 ° C under culture conditions. The DMEM-GPS, with the transfection mixture, is then replaced by 1 ml. of DMEM-GPS / SVF then the cells are maintained in duranet culture 24 hours. Each transfection is carried out on a minimum of 4 tanks.

At the end of the 24 hour period, the cells are washed with 0.5 ml. of Dulbecco's PBS (GIBCO) deposits collected in 0.5 ml. of a 0.2% trypsin solution in PBS (GIBCO). The trypsin is neutralized by 10 μl of SVF. This cell suspension is centrifuged for 2 minutes at 10,000 g. the supernatant is removed then the cells are resuspended in 150 μl of 0.25 M Tris-HCl at pH 7.8. 50 μl of this suspension are used to dose the luciferase activity according to the "luciferase Assay System" (promising) and with the help of the luminometer LUMAT LB 9501 (EG &G Berthold). The cystosolic proteins of the cells in the remaining 150 μl are extracted by 5 freeze / thaw cycles (liquid nitrogen / 37jC). These extracts, normalized in relation to the luciferase activity, are then used to dose the CAT activity according to the method previously described by Gorman et al. (Gorman et al 1982, Mol.Cell. Biol.5.1044-1051).

) In vitro interaction between Ki and GAX proteins It is done by the Far-Western Spotting method.

Since Western blotting consists of an electrophoretic separation of proteins on a denaturing gel followed by a direct or indirect electrotransfer, Far-Western spotting is a Western blot to which is added a protein-protein interaction step between an unmobilized target on the nitrocellulose membrane and a factor in solution. a) Electrophoresis The samples are heated 10 minutes at 95 ° C in a protein denaturation buffer containing 50 mM Tris pH 6.8, 2% SDS (Sodium Dodecyl Sulfate), 10% glycerol, 300 mM b-mercaptoethanol and 0.1% of bromophenol blue. 10 ml. of samples are deposited on a gel Tris-glycine 14% Acrylamide (Tris-glycina Gels, Novex). The migration is done for 1 hour at a constant voltage of 120 V in a separation buffer for proteins (35 mM SDS, 1.92 M glycine and 85 mM Tris pH 8.3). The molecular weight of the proteins will be determined by the parallel migration of a colored and transferable molecular weight standard (MultiMarkTM Multi-Colored Standard, Novex). This gel is made in double to be able in parallel to color one of the two to the blue of Coomassie (methanol 30%, water 60%, acetic acid 10%, blue of Coomasie 0.1%). The coloring is 1 hour. The discoloration is carried out, for several hours, by changing the decolorizing solution several times (30% methanol, 10% acetic acid, 60% water). The limit of detcción of this method is 50 ng. of proteins. This colored gel allows us to visualize all the proteins deposited, the other gel is used for the "Far-Estern Spotting". b) Semi-dry transport on a nitrocellulose membrane.

The nitrocellulose membrane (Hybond C from Amersham) and the gel are taken from 3 thicknesses of whatman paper previously immersed in the transport regulator (150 mM glycine, 25 mM Tris, 20% methanol, 1 liter water b.p., pH 8.3). the transport is carried out for 40 minutes at 2.5 mA / cm 2 gel (MilliblotTM-Graphite electroblotter II, Millipore). c) Protein-protein interaction The membrane is saturated for 30 minutes under agitation and at room temperature in PBS containing 5% (p / v) of milk described in powder (Gloria) and 0.2% (v / v) of Tween 20. Then, it is immersed for 1 hour under agitation and at room temperature in 5 ml. of PBS containing 5% of skimmed milk powder (Gloria), 0.2% (v / v) of Tween 20 and 75 μg. of Kl. The finished incubation, the membrane is washed three times for 10 minutes in PBS containing 0.2% (v / v) of Tween 20. In order to visualize the interaction between immobilized GST-GAX on the nitrocellulose membrane and mycKi, it is revealed as for GST-GAX with the help of a mouse monoclonal antibody directed against the myc epitope (Santa Cruz) and a polyclonal rabbit antibody coupled to peroxidase, directed against mouse IgG (Nordic Immunology).

EXAMPLES EXAMPLE 1: Construction of a vector that allows the expression of a fusion protein between GAX and the binding region of GAL4 DNA.

The screening of a bank using the double hybrid system requires that the GAX protein be fused to the DNA binding region of the GAL4 transactivator protein. The expression of this fusion protein is carried out thanks to the pGBTIO vector (see materials and methods), in which we have introduced, in the same reading frame as the sequence corresponding to the GAL4 DNA binding region (GAL4DB), a coding fragment for all or part of the Gax protein. A particular fragment comprises the EcoRl-SalI fragment from phGAX, which is inserted at the level of the EcoRI-Sall site of pGBTIO to give the plasmid pCM199.

The construction has been sequenced which allows to verify that the GAX protein is well in the same open reading phase as that of the GAL4DB fragment.

EXAMPLE 2: Screening of the Lung Fusion Bank.

The screening of a fusion bank allows to identify clones that produce protein fused in the transactivator region of GAL4, that can interact with the GAX protein or regions of it. This interaction allows reconstituting a transactivator that will then be able to induce the expression of the URA3, BLE and LacZ reporter genes in strain YCM79.

To carry out this screening, we have selected a fusion bench made from cDNA that provides human lung. As this bank has been provided to us in the form of bacteria, the plasmid DNA of the bank must first be purified. 2. 1) Preparation of the plasmid DNA of a fusion bank.

The plasmid DNA of the lung cDNA library has been extracted following the Clontec® protocol (see materials and methods, section 10). After this preparation it would be important to preserve the representativeness of the bank, that is, to preserve the number of independent plasmids that constitute it and that are in number of 7 X lOß plasmids.

In order to avoid the loss of plasmids from the bank in the course of this preparation, the batch of plasmid DNA that we have constituted has been obtained from a number of isolated bacterial colonies corresponding to a little more than three times the representativeness of the bank or be 25 X 106 olonies. 2. 2) Transformation by lung bank and selection by the β-galactosidase activity test.

After screening, it is necessary to preserve the probability that each plasmid independent of the fusion library is present in at least one yeast at the same time as the GAL4DB-GAX plasmid. To preserve this possibility it is important to have a good transformation efficiency of the yeast, for this we have selected a transformation protocol for the yeast that gives an efficiency of the transformed cells per μg of DNA. In addition, as the cotransformation of the yeast by two different plasmids reduces this efficiency, we preferred to use a yeast previously transformed by the plasmid pGAL4DB-GAX. This yeast strain has been transformed by 100 μg of plasmid DNA from the fusion bench. This amount of DNA allows us to obtain after estimation (see materials and methods) 4.2 X IO7 transformed cells, which corresponds to a number greater than the number of independent plasmids that make up the bank. According to these results we have been able to think that almost all the plasmids of the bank have served to transform the yeasts. The selection of the transformed cells, capable of reconstituting a functional GAL4 transactivator, has been done on a medium YNB + Lys + Met + His + Ade. From this selection 190 clones with μn phenotype Ura + and bGal + have been obtained.

EXAMPLE 3: Identification of the insertions of the plasmids: Evidence of an interaction with Ki.

The plasmids are extracted from the yeast, introduced into the bacterium then prepared as described in the Materials and Methods part, the sequencing has been performed from the oligonucleotide CTATTCGATGATGAAGATACCC (SEQ ID No. 1) complementary to the GAL4 TA region in proximity of the insertion site of the lung cDNA bank, at 52 pdb from the EcoRI site.

The comparison of the sequences with the sequences contained in the GENBank and EMBL data banks (European Molecular Biology Lab) has shown that one of the plasmids thus identified contains a cDNA identical to the factor Ki, identified in afflicted patients, of lupus as an autoantigen. This plasmid is christened pCM282. This plasmid, when co-transformed in yeast with pCM199, is very capable of activating the reporter genes of that one as shown by the Table 1 below. This Table also shows that the activation is specific, which indicates that Ki is able to interact specifically with GAX.

Table 1.

Vectors: ß-gal activity EXAMPLE 4: Construction of vectors that allow expression in the yeast of a fusion protein between different GAX scavengers and the DNA binding region of GAL4 This example describes the construction of vectors that code for different variants of the Gax protein, which can be used to determine the structure / function of this protein and, in particular, to highlight the active regions and the regions responsible for the interaction with the Ki protein.

The elimination of 153 C-final amino acids is obtained by directing the plasmid pCM199 by Eagl-Sall, then the small fragment is removed, the ends are blunted by klenow treatment and re-ligated. the plasmid thus obtained is called pCM238. It codes for a protein that contains residues 1-104 of GAX.

The total digestion by Bgl2 and Sali of pCM199 then the re-ligating of the vector after treatment to the klenow allows to conserve the first 32 amino acids of GAX. The plasmid thus obtained is called pCM244. It codes for a protein that contains residues 1-32 of GAX.

The total digestion by Bgl2 and Sali of pCM199 allows isolating a fragment of approximately 270 bp and 572 bp. The first fragment is cloned in pGBTII at the Baml-Sall site to obtain the plasmid pCM2 5 that allows the fusion of 79 C-terminal amino acids with the GAL4DB. the second fragment is cloned into pGBTIO at the Baml site to obtain plasmid pCM246 which allows the fusion of amino acids 33 to 222 'with GAL4DB.

Plasmid pCM280 is obtained by digesting pCM246 by Dra3 and pstl. After treatment at T4 polymerase the plasmid is enclosed on itself. It codes for a protein that contains residues 33-63 of GAX.

Plasmid pCM199 is digested by Ndel and pstl. The insert is cloned into plasmid pASI to give plasmid pCM301. This plasmid allows the expression of the GAX protein eliminated from these first 32 amino acids fused to GAL4DB. codes for a protein containing the residues 33-302 of GAX.

The structure of the fusion protein expressed by these different vectors is represented on figure 1.

EXAMPLE 5: Location of the interaction zone of GAX with Kl.

The yeast strain yCM79 is transformed by the different vectors described in Examples 1 and 4 at the same time as pCM282 or that pGAD424. Beta-gal activity is revealed as described in the material and methods. The results obtained are presented in Table 2 below.

Table 2 Vectors: Beta-gal activity These results reveal the GAX region that interacts with the Ki factor (Table 2). in effect, the regions that make activity lose by their absence allow us to conclude that they are necessary for interaction but not sufficient. Thus, regions 1 to 32 and 104 to 223 appear important for interaction with Ki. The fact that pCM238 does not give a positive indication in Beta-gal, suggests that there is a C-final region 104-302 of Gax necessary for the interaction in yeast.

EXAMPLE 6: Expression profile of the mRNA in different tissues and nuclear localization of the transiently expressed protein: In order to identify GAX partners, we have transformed our double hybrid yeast strain, which already has the plasmid that allows the expression of the GAL-GAX (1-302) fusion as a bait, by a lung cDNA bank fused to the GAL4 TA , available in the laboratory (example 2). we were able to obtain more than 41 million independent clones before amplification and only 190 clones in which the three selection genes (for example, the URA3 gene, the LacZ gene and the BLE gene) are expressed, 9 cDNAs that code for different proteins have been identified among these 190 clones. We have become particularly interested in the one that codes for the Ki antigen.

The Ki gene seems ubiquitous as the analysis suggests I by Northern staining (Figure 1) of its expression from the mRNA extracted from different tissues ("Multiple Tissu Northern Blots "human, Clontech) that reveals an mRNA of approximately 3 kb. The presence of a form of mRNA that undergoes a different maturation (1.4 kb) in the heart and skeletal muscles can be noted.

The construction of a vector that allows the expression of the Ki protein fused to the HA tag in the mammalian cells has been carried out in the following manner: the Ncoll-Xhol fragment of the pCM282 plasmid is inserted in the pASl plasmid at the site level Ncol-Nhol to obtain the plasmid pCM322. Then the EcoRl-Dral fragments of the plasmid pCM322 is inserted into the pCDNA3 expression vector at the level of the EcoRl-EcoRV sites. the obtained plasmid pCM323 allows the expression of the ki protein fused to the HA tag in the mammalian cells.

By indirect immunofluorescence, it has been shown that KiHA has a nuclear localization in the cells transfected by this chimera (Figure 2).

EXAMPLE 7: Expression and purification of the Ki protein fused to the S tag and myc tag.

The following oligos are hybridized together, phosphorylated then ligated with pET29B previously digested by Ncol.

CATCAAGCTTATGGAGCAGAAGCTGATCTCCGAGGAGGACCTGCAGCTTC (SEQ ID No. 2) and CATGGATCCACGTGCAGGTCCTCCTCGGAGATCAGCTTCTGCTCCATAAGCTT (SEQ ID No. 3) The obtained plasmid is called pCM320. The gene coding for the Ki protein is amplified by PCR with the oligos CGCGGATCCCATGGCCTCGTTGCTG (SEQ ID No. 4) and GTAGAGCTCGAGTCAGTACAGAGTCTCTGC (SEQ ID No. 5). The obtained fragment is digested by Bamhl Xhol then introduced, after binding, into the hH-Xhol sites of plasmid pBCks to give plasmid pCM305. The latter is then digested by Bamhl Xhol. The insertion released in this manner is linked to the Bamhl and Xhol site of pCM320 to give the plasmid pCM321. The expression and purification of the recombinant protein are carried out following the indications of the supplier (Novagen) from pCM321.

EXAMPLE 8: Expression and purification of the GAX protein fused to the GST Colonies of BL-21 transformed by the plasmid pGEX-2T-h-GAX are placed in preculture in 30 ml. of LB with ampicillin (50 μg / ml) at 37 ° C overnight, 5 ml. of this preculture are put back into culture in 500 ml. of LB with ampicillin at 37 ° C up to an optical density of 0.7 to 600 n. GST-GAX expression is induced by 0.1 mM of IPTG for 2 hours at 30 ° C. The culture is centrifuged at 6,000 rpm for 10 minutes. The bacteria cartridges are put back into solution in 10 ml. of cold PBS then divided into 10 eppendorf tubes. Bacterial proteins are extracted by sonication for 10 minutes with cycles of 12 seconds and pauses of 24 seconds followed by a centrifugation of 15,000 rpm for 15 minutes. The supernatants are regrouped and constitute the soluble fraction that will be used for the purification. The remaining cartridges represent the insoluble fraction.

The purification of GAX is done by affinity of GST on agarose beads coupled to Glutathione.

The supernatant obtained after sonication of the bacteria is incubated with the resin for one hour on a rotary shaker at room temperature. Then, the resin on which the protein has been put together is centrifuged at 1,000 rpm for 10 minutes. The supernatant removed, the resin is washed 3 times by 50 ml. of PBS containing 1% Triton X-100 for 20 minutes on the rotary shaker. GST-GAX can be eluted from the resin by the guanidine thiocyanate. Elution is done by 1.5 times the volume of 2M guanidine thiocyanate resin, 20 mM Tris pH 7.5, 0.15 M NaCl and 0.1% Triton X-100 on a rotary shaker for 30 minutes, the eluant is dialyzed against PBS overnight to eliminate the thiocyanate guanidine. The protein is stored in PBS at 4 ° C. A cocktail of protease inhibitors in equal quantity (Leupeptin, 1 mg./ml, Pepstatin 1 mg./l, Aprotinin 1 mg./ml., Benzamidine 500 mM) is added to 1/200th in the protein preparation.

EXAMPLE 9: In vitro interaction between Ki and GAX proteins To study the interaction of GAX and Ki in vitro, we have produced two chimeric recombinant proteins in Escherichia Coli, GST-GAX has been purified on a resin bound to glutathione thanks to the catalytic site of glutathione S-transferase (GST); SmycKi containing a myc epitope and the S epitope that allows purification on a resin bound to the S protein.

The indicated amounts of bovine albumin, GST protein or GST-GAX after digestion by thrombin (site created between GST and GAX), as well as increasing amounts of GST-GAX, have been separated on a denaturing polyacrylamide gel. colored to coomasie blue (Figure 3A).

The proteins have been transferred on a nitrocellulose membrane from a gel identical to this in a. The membrane was successively incubated in the presence of AmycKi, in a solution containing a mouse monoclonal antibody directed against the myc epitope (Santa Cruz) and finally in a solution for the detection of the anti-myc antibody.

Our results clearly show that Ki specifically recognizes GST-GAX and in a dose-dependent manner, since no reaction is observed with bovine albumin or GST Note that after digestion by thrombin Ki always interacts with GAX (Figure 3 B).

EXAMPLE 10: Construction of vectors that allow the expression in mammalian cells of a fusion protein between different GAX eliminators and the binding region to GAL4 DNA. . 1. Construction of plasmid vectors Plasmids pCM199 and pCM301 are digested by HindIII.

The insertions are cloned in the correct orientation in pCDNA3 (Invitrogen) in the HindIII site to respectively give the plasmids pCM291 and pCM327, which allow the expression of the fusions of the mammalian cells.

The plasmids pCM238, pCM244, pCM301, pCM246, and pCM280 are directed by HindIII and Nael. The insertions are cloned in the correct orientation in pCDNA3 (invitrogen) in the HindIII-EcoRV site to give respectively the plasmids pCM292, pCM326, pCM327, pCM294 and pCM295, which allow the expression of the fusions in mammalian cells. . 2 construction of viral vectors.

According to a particular mode, the invention resides in the construction and use of viral vectors that allow the transfer and in vivo expression of the nucleic acids as defined above.

Treating more particularly adenoviruses, different I serotypes, whose structure and properties vary a little, have been characterized. among these serotypes, it is preferred to use human adenovirus type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin within the framework of the present invention (see application W094 / 26914). Among the adenoviruses of animal origin which can be used in the context of the present invention, we can mention the adenoviruses of canine, bovine, murine origin (example: Mavl, Beard et al., Virology 75 (1990) 81), sheep, swine, avian or still simian (example: SAV). Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Preferably, adenovirus of human or canine or mixed origin is used within the framework of the invention.

Preferably, the defective adenoviruses comprise the ITRs, a sequence allowing encapsulation and a nucleic acid according to the invention. Even more preferably, in the genome of the adenoviruses of the invention, the El region is at least non-functional. The considered viral gene can be rendered non-functional by any technique known to the person skilled in the art, and particularly by total suppression, substitution, partial elimination, or addition of one or more bases in the gene (s) considered. Such modifications can be obtained in vitro (on isolated DNA) or in situ, for example, by means of genetic engineering techniques, or even by treatment by means of mutagenic agents. Other regions can also be modified, and particularly the region E3 (WO95 / 02697), E2 (W094 / 28938), E4 (W094 / 28152, W094 / 12649, WO95 / 02697) and L5 (WO95 / 02697). According to a preferred embodiment, the adenovirus according to the invention comprises a deletion in the region El and E4. According to another preferred embodiment, it comprises a deletion in the El region at which the E4 region and the nucleic sequence of the invention are inserted (see FR94 13355). In the viruses of the invention, the deletion in the El region preferentially extends from nucleotides 455 to 3329 over the Ad5 adenovirus sequence.

The defective recombinant adenoviruses according to the invention can be prepared by any technique known to those skilled in the art (Levrero et al., Gene 101). (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917). in particular, they can be prepared by homologous recombination between an adenovirus and a plasmid carrying among others a nucleic sequence or combination of nucleic sequences of the invention. Homologous recombination occurs after co-transfection of the aforementioned adenoviruses and plasmid into an appropriate cell line. The cell line used must preferably (i) be transformable by said elements, and (ii) contain the sequences capable of complementing the defective adenovirus genome part, preferably in an integrated manner to avoid the risks of recombination. As an example of a cell line, mention may be made of the human embryonic kidney cell line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which. they contain particularly, integrated in their genome, the left part of the genome of an adenovirus Ad5 (12%) or cell lines capable of complementing the functions El and E4 such as those described particularly in the applications no. WO 94/26914 and WO95 / 02697 or in Yeh et al., J. Virol. 70 81996) 559.

Then, the adenoviruses that multiplied are recovered and purified according to the classical techniques of molecular biology.

Concerning the adeno-associated virus (AAV), it is DNA virus of relatively small size, which are integrated into the genome of the cells that infect, in a stable and site-specific manner. They are capable of infecting a broad spectrum of cells, without inducing an effect on cell growth, morphology or differentiation. On the other hand, they do not seem involved in pathologies in man. The genome of AAV has been cloned, sequenced and characterized. It comprises approximately 4700 bases, and contains in each extremity an inverted repeat region (ITR) of approximately 145 bases, which serves as a replication source for the virus. The rest of the genome is divided into two essential regions that contain the encapsulation functions: the left part of the genome, which contains the rep gene involved in the viral replication and the expression of the viral genes; the right part of the genome, which contains the cap gene that codes for the capsule proteins of the virus.

The use of vectors derived from AAV for the transfer of genes in vitro and in vivo has been described in the literature (see particularly WO 91/18088, WO 93/09239, US 4,797,368, US 5,139,941, EP 488 528). These applications describe different constructs derived from AAV, in which the rep and / or cap genes are eliminated and replaced by a gene of interest, and their use to transfer in vitro (on cells in culture) or in vivo (directly in an organism). ) said gene of interest.

Defective recombinant AAVs according to the invention can be prepared by co-transfection, in a cell line infected by a human helper virus (for example an adenovirus), a plasmid containing a nucleic sequence or a combination of nucleic sequences of the invention of two inverted repeat regions (ITR) of AAV, and of a plasmid containing the encapsulation genes (rep genes and cap genes) of AAV. A usable cell line is for example cell line 293. Other production systems are described for example in applications W095 / 14771; W097 / 13365; W095 / 13392 or WO95 / 06743. The recombinant AAV products are then purified by classical techniques.

As far as herpes viruses and retroviruses are concerned, the construction of recombinant vectors has been widely described in the literature: see particularly Breakfield et al., New Biologist 3 (1991) 203; EP 453242, EP178220, Bernstein et al., Génet. Eng. 7 (1985) 235; MacCormickk, BioTechnology 3 (1985) 689, etc. in particular, retroviruses are integrating viruses, which selectively infect dividing cells. They are then vectors of interest for cancer applications. The genome of retroviruses essentially comprises two LTRs, one encapsulation sequence and three coding regions (gag, poi, and env). In recombinant vectors derived from retroviruses, the gag, pol and env genes are generally deleted, in whole or in part, and replaced by a heterologous nucleic acid sequence of interest. These vectors can be made from different types of retroviruses such as MoMuLV ("urine Moloney leukemia virus", still designated MoMLV), the MSV ("murine Moloney sarcoma virus"), the HaSV ("Harvey sarcoma virus"); the SNV ("spleen necrosis virus"); the RSV ("Rous sarcoma virus") or even the Friend virus.

To construct recombinant retroviruses according to the invention containing a nucleic sequence or a combination of nucleic sequences according to the invention, a plasmid containing particularly the LTRs, the encapsulation sequence and said nucleic sequence are constructed, then used to transfect a cell line called of encapsulation, able to carry in trans the deficient retroviral functions in the plasmid. Generally, the encapsulation lines have been described in the above specialty, and particularly the cell line PA317 (US4, 861, 719); the PsiCRIP cell line (WO90 / 02806) and the cell line GP + envAm-12 (WO89 / 07150). On the other hand, recombinant retroviruses can contain modifications at the level of LTRs to suppress transcriptional activity, as well as extended encapsulation sequences, which contain a part of the gag gene (Bender et al., J. Virol 61 (1987) 1639). Retroviruses I produced recombinants are then purified by classical techniques. . 3 Chemical vectors Nucleic acids or plasmid expression vectors described in the preceding examples can be administered as they are in vivo or ex vivo. It has indeed been shown that naked nucleic acids could transfect cells. However, to improve the efficiency of the transfer, it is preferred to use a transfer vector within the framework of the invention. It can be a viral vector (example 9.2) or a synthetic transfection agent.

Among the developed synthetic vectors, it is preferred to use in the framework of the invention cationic polymers of the polylysine type, (LKLK) n, (LKKL) n, (PCT / FR / 00098) polyethylene imine (WO96 / 02655) and DEAE dextran or even the cationic or lipofectant lipids. They have the property of condensing the DNA and promoting its association with the cell membrane, among the latter, we can mention the lipopolyamines (lipofectamine, transfectam, etc.) different cationic or neutral lipids (DOTMA, DOGS, DOPE, etc) as well as peptides of nuclear origin. In addition, the concept of successful transfection has been developed, mediated by a receiver, which takes advantage of the principle of condensing the DNA thanks to the cationic polymer, always directing the fixation of the complex to the membrane thanks to a chemical coupling between the cationic polymer and the ligand of a receptor between the cationic polymer and the ligand of a membranar receptor, present on the surface of the cell type that you want to graft. The target of the transferrin receptor, in the insulin or the receptor of the asialoligoproteins of the hepatocytes, has also been described. The preparation of a composition according to the invention using such a chemical vector is carried out according to any technique known to the person skilled in the art, generally by simple contacting of the different components.

EXAMPLE 11: Adjustment of a method that allows the study of GAX transcriptional activity We have used a transient transfection system to study the transcriptional activity of GALDB-GAX fusions as well as its effect on transcriptional activators such as the estrogen receptor (ER) or the acid activation region of the virus VP16 protein.

Herpes simplex fused to GALDB. In order to quantify the transcriptional activity of each one or of the combination of several factors, we have constructed an objective gene (Report) that expresses the bacterial chloramphenicol acetyl transferase (CAT) under the control of an artificial promoter. This promoter contains a TATA vessel, which comes from the ElB gene of Ad2 adenovirus (ElB TATA), upstream of the TBP protein site of the TFIID complex, recognizes the TATA vessel and positions the pre-initiation complex (TFIID + TFII A, B , E, F) which recruits the type II RNA polymerase (PolII) that will initiate transcription of the CAT gene. Upstream of this basal promoter we have inserted a GALDB binding site (17mer) that will be recognized by the GALDB-GAX or GALDB-VP16 chimeras. We have also cloned upwards of 17 mer an estrogen response element (ERE) on which ER is related to activate transcription. This reporter will allow us to study the different schematized combinations, an activation or a repression of the transcription will be translated by a measurement of the amount of CAT in a cell. The dosage of CAT enzyme activity in cell extracts after transfection is used to measure the transcriptional effect.

ER and GAL4-VP16 are very strong transcriptional activators. The CAT activity is increased more than 100 times by ER and approximately 85 times by GAL4-VP16. The coexpression of ER and GAL4-VP16 results in a CAD activity of more than 300 times that of the non-activated reporter and higher than the sum of the two activators expressed individually. This suggests that ER and GAL4-VP16, despite the spherical agglomeration, can occupy and activate the same promoter (Figure 4B).

EXAMPLE 12: Study of the transcriptional activity of GALDB-GAX fusions and identification of a repressor region of transcription The GAX gene codes for a protein of 302 amino acids in man. The primary structure of this protein has different regions whose function remains unknown. GAX belongs to a family of genes called homocaja (HOMEOBOX). The Homocaja is necessary for the recognition and binding of these proteins on specific DNA sequences present on the promoter of the target genes that control the expression. Currently no DNA sequence recognized by GAX has been identified. GAX has a region rich in histidine (HIS) residues in its N-final part whose function is unknown.

To understand the function of GAX different regions of the human GAX gene have been eliminated to produce truncated proteins as well in their N-final part as in the C-final, the numbers indicate the position of the first and the last amino acid of each mutant of elimination in relation to whole GAX 1-302 (Figure 5). Not knowing DNA sequence recognized naturally by GAX, we have created chimeras between the different elimination mutants and a heterologous DNA binding region (fused to its N-final part) that comes from the yeast transcriptional factor GAL4 (GALDB). Expression vectors have been constructed to transiently express the different chimeras in mammalian cells in culture.

The different GAL-GAX chimeras have been expressed alone or in the presence of ER to study their effect respectively on basal transcription or on the transcriptional activity of ER.

GAX integer, in the context of the GAL-GAX1-302 fusion, decreases the CAT activity more than 8 times in relation to the non-activated reporter. This repression is weakly affected when the 32 N-late GAX amino acids are absent. (GAL-GAX33-302) but it is completely removed when a supplementary deletion deletes the C-end part of GAX (GAX-GAX33-222). these 32 amino acids are sufficient in the context of GAL-GAX1-32 to decrease CAT activity (Figure 6A).

The co-expression of GAL-GAX1-302 and ER results from CAT activity more than 25 times lower than that obtained with ER alone. This repression, as in A, is due to the first 32 amino acids of GAX (compare GAL-GAX1-302, GAL-GAX33-302 and GAL-GAX33-222). These N-terminal amino acids (GAL-GAX1-32) decrease ER activity only 2-fold (compare GAL-GAX1-32, GAL-GAX1-104) and require at least the presence of residues 33 to 222 for a maximum activity (Figure 6 B).

The sequences that cause the activity to be lost when they are absent are investigated, allowing to conclude that they are necessary to the interaction but not sufficient.

The results presented show that GAX represses the transcription of the reporter gene used. This repression is essentially due to an N-final peptide (1 to 32) whose optimal activity requires the presence of the 33 to 222 region of GAX and preferably the presence of the 33-104 Gax region.

Using the different GAX deletions fused to the DNA binding region of GAL4, we have been able to identify in the yeast (by the double hybrid system, Example 5) the GAX regions important for the interaction with Ki. It is the N-final part up to residue 222. This region comprises, as we have shown previously, the repressive region of GAX.

EXAMPLE 13: In vitro interaction between GAX and PCNA 13. 1 Cloning of human "Proliferating Nuclear Antigen" (PCNA) cDNA and production of a recombinant protein The cloning of the PCNA cDNA is carried out by reverse transcription and PCR. The first stage of reverse transcription (RT) is performed with the "First Strand cDNA synthesis" equipment of Pharmacia, the total RNA is extracted from human smooth muscle cells in primary culture (Clonetics) according to the method described by P. Chomczynski and N.

Sacchi (anal Biochem 1987, 162: 156-159). 10 μg of this total RNA is put back into 20 μl of water, heated 10 minutes at 65 ° C, cooled on ice, then mixed with 11 μl of "Bulk First Strand reaction ix" from the RT team (Cloned, FPLCpure ®, Murine Reverse Transcriptase, RNase / DNase-Free BSA, dATP, dCTP, dGTP, and dTTP =, 1 μl of DTT and 1 μl of primers pD (N) e.The RT reaction is incubated 1 hour at 37 ° C The reaction is stopped by heating 5 minutes at 90 ° C then cooled on ice.

The second stage consists of a PCR amplification of the PCNA cDNA. The primers used for the PCR reaction are the following: 1 5 '-CGCGaaaikcTGTTCGAGGCGCGCCTGGTCCAGG- 3' F E A R L V Q G 2 5 '-GGTCaaattcTAAGATCCTTCTTCATCCTCGATC- 3' * S G5 E D E I K The two primers introduce an EcoRl site (lowercase underlined). The amino acids of PCNA contained in the primers are represented by their code (upper case) below the corresponding codons. * represents the stop codon of PCNA. 8 μl of the reaction, described above, are completed to a final volume of 50 μl containing the following quantities or final concentrations: 50 picomoles of primer 1, 50 picomoles of primer 2, one unit of Taq DNA polymerase (perkin elmer) , 5 μl of MgC12 (25 mM), 2 μl of a mixture of 200 mM of the 4 deoxynucleotides (dATP, dTTP, dGTP and dCTP) and 5 μl of the 10-fold concentrated PCR regulator (Perkin Elmer).

PCR amplification is performed in Micoamp ™ tubes (Perkin Elmer) with the help of a PTC-100 ™ thermal cycler (MJ Research, Inc.). This amplification consists of a denaturation step of 15 seconds at 95 ° C, a hybridisation step of 30 seconds at 55 ° C and an extension step of 1 minute at 72 ° C. These thirty cycles are followed by a supplementary extension of 5 minutes then the PCR reactions are conserved at 10 ° C.

The practical realization of the cloning of PCNA in the PCRII vector (Invitrogen) is carried out with the "Original TA Cloning® Kit "(Invitrogen). 3 μl of PCR product, 1 μl of 10 X ligating buffer, 2 μl of pCRII vector (25 ng / μl), 3 μl of water and 1 μl of T4 DNA ligase are incubated 16 ° C for 16 hours.2 ml. of this ligation reaction are used to transform TGl bacteria into competent as described above. The bacteria are then cultured at 37 ° C for 16 hours on solid medium or LB containing 1.5% agar, 100 μg / ml ampicillin in the presence of X-gal for the blue-white selection of the recombinant clones (alpha complementation of the ß -galactosidase).

The recombinant clones (white colonies) are taken again in 10 μl of water and confirmed under the same conditions as the PCR after the RT reaction, described above except Triton X-100 at a final concentration of 0.01% v / v it is added to the reaction.

Several positive clones are used to make DNA inipreparations, those whose 5 'part of the PCNA insert is positioned downstream of the EcoRV site of PCRII are sequenced and retained for the next cloning step.

The cloning of PCNA in the pET29 plasmid is carried out in the following manner: the PCNA EcoRV-Hind III fragment from PCRII-PCNA is inserted at the EcoRV-HindIII site level of pET-29. this plasmid is then used for the production of the S-PCNA chimeric recombinant protein. The transformation, production and purification steps of S-PCNA are identical to those used for the production of the Ki antigen fused in the myc epitope. 13. 2 Study of the in vitro interaction of GAX with PCNA This study has been carried out following the same method used in example 9 to study the interaction between the recombinant proteins' GST-GAX and SmycKi.

Increasing amounts of recombinant GST and the GST-GAX chimera (50,250,500 and 750 ng) were separated on a denaturing 14% polyacrylamide gel (Novex). The proteins are transferred from the gel onto a nitrocellulose membrane, which is then incubated in a solution containing the recombinant protein S-PCNA followed by an immunolabeling of pCNA with the aid of an anti-PCNA monoclonal antibody (Santa Cruz).

Figure 7 shows a weak interaction between GST and PCNA only in the high doses of GST (500 and 750 ng). The affinity of GST-GAX for PCNA is much higher than that with GST.

This specific interaction between GAX and PCNA suggests that the antiproliferative activity of GAX is mediated by a sequestration of PCNA. The fact that Ki can interact both with GAX and with PCNA is in favor of the formation of bi or tripartite complexes that could play an important role (activation or inhibition) in the progression of the cell cycle.

LIST OF SEQUENCES (1. GENERAL INFORMATION': (i) APPLICANT: (A) NAME: RHONE-POULENC RORER, S.A. (B) STREET: 20, Raymond Aron Avenue (C) CITY: ANTONY (E) COUNTRY: FRANCE (F) POSTAL CODE: 92165 (ii) TITLE OF THE INVENTION: Polypeptides that comprise regions of the protein involved in the repression of transcription and / or that interact with proteins, corresponding nucleic acids and their uses. (iii) SEQUENCE NUMBER: 8 (iv) COMPUTER READING FORM: (A) TYPE OF SUPPORT: Tape (B) COMPUTER: PC Compatible with IBM (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFT WARE: Patentin Relay No. 1.0 Version No. 1.25 (OEB) (2) INFORMATION FOR SEQ ID NO. 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1 CTATTCGATG ATGAAGATAC CCC 23 (2) INFORMATION FOR SEQ ID NO. 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 50 base pairs (B) TYPE: nucleic acid (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 CATCAAGCTT .ATGGAGCAGA AGCTGATCTC CGAGGAGGAC CTGCAGCTTC fifty (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 CATGGATCCA CGTGCAGGTC CTCCTCGGAG ATCAGCTTCT GCTCCATAAG CTT 53 (2) INFORMATION FOR SEQ ID NO: 4 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 CGCGGATCCC ATGGCCTCGT TGCTG 25 (2) INFORMATION FOR SEQ ID NO: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5 GTAGAGCTCG AGTCAGTACA GAGTCTCTGC 30 (2) INFORMATION FOR SEQ ID NO: 6 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6 GAGCGAATTC ATGACCATGA CCCTTCACAC 30 (2) INFORMATION FOR SEQ ID NO: 7 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7 GAGCGAATTC ACTGATCGTG TTGGGGAAGC 30 (2) INFORMATION FOR SEQ ID NO: 8 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) NUMBER OF FILAMENTS: double (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iii) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8 TCGAGAGGTC ATATTGACCT AAGCTTCGGG TCGGAGTACT GTCCTCCGAC TGCCATATGT CTCCAG TATAACTGGA TTCGAAGCCC AGCCTCATGA CAGGAGGCTG ACGGTATACAGATC It is noted that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, it is claimed as property in the following,

Claims (21)

1. A polypeptide that is "characterized in that it is a fragment of the human GAX protein that comprises at least residues 1 to 32 of the GAX protein and that possesses a transcription repression activity and / or that positively or negatively affects the replication of the DNA

2. Polypeptide according to claim 1, characterized in that it also comprises at least the waste 140 to 230 of the human GAX protein.

3. A polypeptide which is characterized in that it comprises at least one fragment selected from the fragments 1-32, 33-302 and 1-104 of the human GAX protein and which possesses a transcription repression activity and / or which positively or negatively affects the replication of DNA

4. A polypeptide that is characterized in that it comprises at least one fragment selected from fragments 1 to 32 and 104 to 223 of the GAX protein and capable of interacting with the Ki protein.

5. A polypeptide according to any one of claims 1 to 3, characterized in that it is capable of interacting with PCNA.

6. A polypeptide according to any one of claims 1 to 3, characterized in that it is able to interact with Ki and / or PCNA and to form a complex at least bipartite or at least tripartite with these proteins.

7. A polypeptide that is characterized in that it comprises another fragment of the GAX protein that possesses a transcription repression activity, at least one fragment of different origin.

8. A polypeptide according to claim 7, characterized in that this fragment of different origin is endowed with a biological activity, is a marker or a screening element.

9. Nucleic acid that is characterized in that it encodes a polypeptide according to any of claims 1 to 7.

10. Nucleic acid according to claim 9, characterized in that it is a cDNA.

11. An expression cartridge that is characterized in that it comprises a nucleic acid according to claim 9 or 10 under the control of a promoter.

12. Expression vector that is characterized in that it comprises a nucleic acid according to claim 9 or 10 or an expression cartridge according to claim 11.

13. Vector according to claim 12, characterized in that it is a viral vector.

14. Vector according to claim 13, characterized in that it is an adenovirus.

15. Vector according to claim 13, characterized in that it is a retrovirus.

16. Use of a polypeptide according to any of claims 1 to 7 for repressing the transcription of genes and / or positively or negatively affecting the DNA replication.

17. Use of compounds that inhibit the activity of the protein Ki and / or PCNA for obtaining a medicament intended to inhibit the proliferation of smooth muscle cells.

18. Use of a polypeptide according to any of claims 1 to 7 for the formation of a bi or tripartite complex with the Ki and / or PCNA proteins and positively or negatively affect the progression of the cell cycle.

19. A pharmaceutical composition which is characterized in that it comprises at least one polypeptide according to any one of claims 1 to 7 or a vector according to any of claims 12 to 15.

20. A method of screening and / or identifying interacting polypeptides with the GAX protein or a region of GAX that is characterized in that it uses a polypeptide according to any of claims 1 to 7.

21. A method according to claim 20, characterized in that it is a polypeptide selected from fragments 1 to 32 and 33 to 302 of a GAX protein.