EP0395731A1 - Sondes d'oligonucleotides servant a la detection de pathogenes du periodonte - Google Patents

Sondes d'oligonucleotides servant a la detection de pathogenes du periodonte

Info

Publication number
EP0395731A1
EP0395731A1 EP89901912A EP89901912A EP0395731A1 EP 0395731 A1 EP0395731 A1 EP 0395731A1 EP 89901912 A EP89901912 A EP 89901912A EP 89901912 A EP89901912 A EP 89901912A EP 0395731 A1 EP0395731 A1 EP 0395731A1
Authority
EP
European Patent Office
Prior art keywords
bacteria
composition according
probes
nucleic acid
ribosomal rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP89901912A
Other languages
German (de)
English (en)
Other versions
EP0395731A4 (en
Inventor
Dennis E. Schwartz
Roy H. Kanemoto
Susan M. Watanabe
Kim Dix
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanogen Inc
Original Assignee
MicroProbe Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MicroProbe Corp filed Critical MicroProbe Corp
Publication of EP0395731A1 publication Critical patent/EP0395731A1/fr
Publication of EP0395731A4 publication Critical patent/EP0395731A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • This invention relates to compositions of oligonucleotide probes for use in the detection of bac ⁇ teria associated with medical disorders of the human mouth, wherein said probes consist essentially of a segment of nucleic acid capable of selectively hybrid ⁇ izing under hybridizing conditions, to the 16S or 23S ribosomal RNA [rRNA] of said bacteria.
  • rRNA ribosomal RNA
  • 25 periodontal pocket site are, by current methods, both time-consuming and expensive (e.g., microscopic, cultural, gas chromatographic and . metabolic product analysis) . Furthermore, highly trained individuals, with sophisticated laboratory equipment, are required. Most
  • genomic DNA have been cloned into the pSP64 transcription vector. Chen, M. , et al., Development Of DNA Probes For Oral Microorganisms, Assoc. Adv. Dental Res. Meetings, Wash., D.C. (1986); Savitt, E., et al., Detection of A. actino ycetencomitans In Plaque By RNA Probes, Assoc. Adv. Dental Res. Meetings, Wash., D.C. (1986).
  • the pSP64 vector is used to produce A.a, B.g., or B.i. RNA transcripts.
  • a pSP64-A.a. probe was reported to be specific when tested against pure cultures or plaque samples.
  • each of the above methods of detecting perio ⁇ dontal pathogens lacks one or more of the following criteria necessary for a routine diagnostic assay: 1) cost (inexpensive) ; 2) batch capability; 3) speed (hours, not days or weeks) ; 4) sensitivity; 5) specificity; 6) multiple pathogen identification in one test; 7) sim ⁇ plicity; and 8) ability to detect both viable and non- viable organisms. Consequently, there is a need in the art for alternate detection methodologies.
  • the present invention is directed to compositions of oligonucleotide probes for the detection of bacteria associated with human oral medical disorders, wherein said probes comprise a segment of nucleic acid capable of selectively hybridizing, under hybridizing conditions, to hypervariable regions of ribosomal RNA of the bacteria with the provision that any additional nucleotides covalently bound to said segment do not hybridize under said conditions to nucleic acids of bacteria commonly found in the human mouth.
  • these probes are able to hybridize to unique portions of the bacterial rRNA or corresponding genomic DNA permitting ready detection and identification of such bacteria without cross-reacting with other bacterial species.
  • compositions of oligonuleotide probes directed to conserved regions of 16S and 23S ribosomal RNA are described, wherein said probes can be utilized as specific probes for ribosomal RNA or the corresponding genomic sequence, and can be used for sequencing of ribosomal nucleic acids.
  • This invention is also directed to a probe of the formula:
  • X is a sequence of 0 to 100 nucleotides or nucleotide analogs that are non-homologous to conserved or non-conserved regions of bacterial nucleic acid found in bacteria inhabiting human mouths
  • Y is a sequence of 10 to 100 nucleotides or nucleotide analogs that are capable of hybridizing under hybridizing conditions to hypervariable regions of-the ribosomal RNA of bacteria inhabiting human mouths, such that Y may also comprise subseguences that are capable of hybridizing under hybridizing conditions to only one species of said bacteria, to two species of said bacteria or to three species of said bacteria
  • Z is a sequence of nucleotides the same as or different from X, such that nucleotides or nucleotide analogs are non-homologous to conserved or non-conserved regions of nucleic acid of bacteria found inhabiting human mouths
  • the following bacteria are of particular interest, because they have been found in association with periodontal disease: Actinobacillus (ex. Haemophilus) actinomycetemcomitans; Bacteroides gingivalis; Bacteroides intermedius Type 1; Bacteroides inter edius Type 2; Eikenella corrodens; Bacteroides forsythus; Fusobacterium nucleatum; Fusobacterium perio- donticum; Streptococcus intermedius; Wolinella recta.
  • This invention discloses compositions comprising poly- nucleotide probes able to hybridize to rRNA of these bacteria, especially the hypervariable regions of the 16S and 23S rRNA.
  • each specific probe hybridize to the rRNA of only one microbial species or type.
  • sequences complementary to the hypervariable regions of the 16S rRNA as offered in Table 1, but these are not intended to be limiting.
  • Alternative sequences are readily,ascertainable using the sequencing methods disclosed herein.
  • sequences for the hypervariable regions from the 23S ribosomal RNA could be determined using the sequencing primers shown in Table 2.
  • sequences for the hypervariable regions from the 23S ribosomal RNA could be determined using the sequencing primers shown in Table 2.
  • one of skill in the art could readily obtain alternative rRNA sequences with suitable specificity for use in this invention.
  • nucleic acid sequence of the claimed probes include synthetically derived or recombinant nucleic acid sequences which have sufficient identity with the claimed sequences that they substantially hybridize with regions complimentary to the claimed probes.
  • substantially it is meant that under standard hybridization conditions of moderate stringency, percent hybridization can be shown to exceed 50% of the hybridization between perfectly complimentary nucleic acid fragments.
  • compositions it is meant that probes com ⁇ plementary to bacterial rRNA may be in a pure state or in combination with other probes.
  • the probes may be in combination with salts or buffers, and may be in a dried state, in an alcohol solution as a precipitate, or in an aqueous solution.
  • the probes may be a mixture of different probes capable of detecting a single species or two or more species, a mixture of different probes wherein the probes are each able to detect one or more species, or a homogeneous composition of a single probe.
  • the phrase "and combinations thereof" refers to a composition of copies of a single probe that may contain as a part of the probe one or more copies of a single oligonucleotide sequence or a mixture of the given sequences, or a mixture of probes that may contain as a part of the probes single or multiple copies of the given oligonucleotide sequences.
  • oligonucleotide or polynucleotide probes are meant to include both double stranded and single stranded DNA or RNA.
  • the terms also refer to synthetically or recombinantly derived sequences essentially free of non-nucleic acid contamination.
  • composition claims methods for the detection of a microbial cell associated with a medical disorder, in a sample obtained from the mouth of a human patient. These methods com ⁇ prise the steps of: lysing the microbial cells to free the ribosomal RNA; contacting said ribosomal RNA, under hybridizing conditions, with polynucleotide probes ca ⁇ pable of selectively hybridizing to the hypervariable regions of the ribosomal RNA of said microbial cell; and detecting hybridization complexes as an indication of the presence of the microbial cell in the sample. More specifically, there is disclosed herein the above method, where the bacteria detected are selected from the above list.
  • diagnostic kits for use in determining the presence of bacteria which com ⁇ prise a synthetic oligonucleotide probe complementary to hypervariable regions of the ribosomal RNA of a microbial cell associated with a human oral medical disorder.
  • the taxonomy of these bacteria is not static.
  • Type cultures are available from the American Type Cul ⁇ ture Collection (ATCC) , Rockville, Maryland. As other bacteria are identified or other subtypes are differen ⁇ tiated from the above list, the disclosed invention readily provides methods for preparing probes of suffi ⁇ cient specificity for use in the detection and identi ⁇ fication of these bacteria.
  • ATCC American Type Cul ⁇ ture Collection
  • a composition of polynucleotide probes is also claimed wherein said probes comprise a segment of nucleic acid capable of selectively hybridizing to regions of ribosomal RNA of the bacteria having minimal secondary or tertiary interactions with adjacent nucleotides (open regions) , said probes substantially binding only to open regions.
  • substantially binding it is meant that the probes do not comprise significant sequences that bind to regions that are available for hybridization only after heating, that is, regions with significant secondary and tertiary structure (closed regions) . In practical terms, such probes will generally not comprise any more than 10 flanking nucleotides (either 5' or 3 f ) which would bind to closed regions.
  • compositions of polynucleotide probes complementary to open regions are claimed that are complementary to both hypervariable and conserved regions of bacterial rRNA.
  • a compostion of polynucleotide probes is also claimed that hybridize to closed, conserved regions of bacterial rRNA.
  • methods for the detection of microbial cells in a sample obtained from the mouth of a human patient.
  • the method comprising the steps of: lysing the microbial cells to free the ribosomal RNA; contacting said ribosomal RNA, under hybridizing conditions, with polynucleotide probes capable of selectively hybridizing to open regions of the ribosomal RNA of said microbial cell; and detecting hybridization complexes as an indication of the presence of the microbial cell in the sample. More specifically, there is disclosed herein the above method, where the bacteria detected are selected from the above list.
  • This invention relates to the development of species specific nucleic acid probes complementary to the rRNA of species of oral bacteria associated with periodontal disease and other bacterial mediated diseases of the mouth. These probes are superior to probes com- plementary to genomic sequences because of their speci ⁇ ficity and sensitivity. These probes have been selected for their ability to avoid cross-hybridizing with non- pathogenic bacterial species. Their superior properties are due to the ability to hybridize exclusively to hype- rvariable sequences of rRNA, which appear in hundreds to thousands of copies throughout each bacterial cell. The hypervariable regions of rRNA are sequences which are peculiar to a particular bacterial species or type.
  • probes to rRNA are advantageously sensitive and specific in their ability to detect low numbers of bacteria and to distinguish between bacterial species, types, and subtypes. It is preferred that the assays comprise capture oligonulceotides to two different hypervariable regions of. the same bacterial ribosomal RNA. Such a format dramatically reduces the incidence of false negative results due to heterogeneity in the selected target regions.
  • the methods disclosed herein have the advantage of being rapid assays. The disclosed methods are relatively simple to conduct, and they have a degree of reproducibility and accuracy that has heretofore not been achieved for bacterial pathogens of the mouth.
  • Sample Collection Microbial specimens for use in this invention can be obtained from the ATCC for any of the bacteria listed in Table 1.
  • samples are obtained from teeth scrapings of subgingival plaque or from fluid taken from periodontal pockets with paper points of human patients suspected of having periodontal disease.
  • the samples are dispersed in a buffer, which provides a biologically compatible solution, such as : 150mM NaCl, 20mM Tris-HCl (pH 7.5), lO M EDTA, lOmM EGTA, or 150mM NaCl, 20mM ' NaP0 4 (pH 7.5), lOmM EDTA, lOmM EGTA, and frozen until use.
  • the cells Prior to assay, the cells are optionally cultured in accordance with standard microbiological techniques, such as those described by Dzink, et al., J. Clin. Micro., 19:599, 1984.
  • the bacteria are lysed in a lysis buffer containing N-acetyl- uramidase (lysozyme) .
  • Lysing buffers are known in the art. EP 199,439; Potts, T.V. and Berry, Em. Internat. J. Sys. Bacter., 33:765-771 (1983); Bonta, Y. , et al., J. Dent. Res., 64:793-798 (1985).
  • these bu fers are between pH 7.0 and 8.0, containing both ' chelating agents and surfactants. Heat denaturing is optional.
  • samples are dispersed and collected directly in a lysing solution that also functions as a hybridization solution, such as 3M guanidinium thiocyanate (GuSCN) , 50mM Tris (pH 7.6) , lOmM EDTA, 0.1% sodium dodecylsulfate (SDS) , and 1% mercaptoethanol (Mahiatis, T. et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1982) . Lysis is performed at 65°C for 10 min.
  • a lysing solution that also functions as a hybridization solution, such as 3M guanidinium thiocyanate (GuSCN) , 50mM Tris (pH 7.6) , lOmM EDTA, 0.1% sodium dodecylsulfate (SDS) , and 1% mercaptoethanol (Mahiatis, T. et al. Molecular Cloning: A Laboratory Manual
  • Probes Complementary to the rRNA of Orally Pathogenic Bacteria This invention is directed to probes comple ⁇ mentary to hypervariable regions of the rRNA sequence that are not conserved between bacterial species or types, and these probes can thus distinguish between species or types.
  • Five sequences within 16S rRNA were derived using three universal oligonucleotide primers described by Lane et al., Proc. Natl. Acad.
  • nucleotides designated R are interchangeable with guanosine, adenosine, or their analogs; nucleotides designated N means any of the natural nucleosides or their analogs may be interchanged at this position.
  • Nucleotides designated Y are interchangeable with cytosine or thymine
  • nucleotides designated W are interchangeable with adenosine or thymine
  • nucleotides designated M are interchangeable with adenosine or cytosine.
  • These oligonucleotide primers are specific for conserved regions of the prokaryote 16S rRNA, and can be used to prime whole nucleic acid preparations without pretreatment with DNase or physical separations of RNA from DNA.
  • Commercial preparations of reverse transcriptase, along with appropriate primer extension reactants for sequencing on electrophoretic gels are used to obtain transcripts of cDNA complementary to the hypervariable regions of each pathogenic bacteria.
  • the preferred sequencing methodology will use dideoxynucleo- tide chain termination.
  • oligonucleotide primers specific for conserved regions of the prokaryote 23S rRNA (Table 2) have been used to sequence nucleic acid preparations using known sequencing methodology.
  • the oligonucleotide probes shown in Table 2 are complementary to conserved regions of the prokaryote 16S and 23S ribosomal RNA, and will hybridize under hybridizing conditions to ribosomal RNA and its corresponding genomic DNA sequence. These universal oligonucleotide probes are also ideally suited to be utilized as signal oligonucleotides to DNA and especially RNA of a-J.1 bacteria. In the multiple dipstick format (see later) the target nucleic acids are captured by probes specific for hypervariable regions while only one universal signal probe derived from the conserved regions of ribosomal RNA can be used to detect the nucleic acid from all the different pathogenic bateria. In addition, it is possible to increase the strength of the signal by using more than one universal signal oligonucleotide probe.
  • sequences can be compared by commercially available computer programs, such as the MicroGenie Program, sold by Beckman Instru ⁇ ments (Palo Alto, California) . Present programs are limited in that only two sequences can be compared at a time and all nucleotides are given equal importance. A more complex comparison can be made, but a more powerful computer (e.g., a Cray computer) is required. Waterman, M.S. Multiple Sequence Alignment by Consensus. Nuc. Acids. Res. 14 (1986), 9095-9102. The preferred method for selection requires alignment of multiple sequences and the identification of conserved blocks. Probes are then chosen to include maximum diversity (e.g., insertions or deletions instead of transitions) . The probes may be either DNA or RNA, although DNA probes are preferred because they can be chemically synthesized.
  • the degree of complementarity (homology) required for detectable binding with the rRNA of pathogenic bacteria will vary in accordance with the stringency of the hybridization medium and/or wash medium.
  • the degree of complementarity will optimally be 100 percent; however, it should be understood that minor variations in the rRNA may be compensated for by reducing the stringency of the hybridization and/or wash medium as described below.
  • functional probes having minor base differences from their rRNA targets are possible. Therefore, under hybridization conditions of reduced stringency, it may be possible to modify up to 60% of a given oligonucleotide probe while maintaining an acceptable degree of specificity.
  • analogs of nucleosides may be substituted within the probe for naturally occurring nucleosides. This invention is intended to embrace these species when referring to polynucleic acid probes.
  • RNA probes can either clone the desired sequence using traditional cloning methods, such as described in Maniatis, T. , et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1982, or one can produce the probes by chemical synthesis using commercially available DNA synthesizers.
  • An example of cloning would involve insertion of the cDNA for the ribosomal RNA into a replication vector, such as pBR322, M13, or into a vector containing the SP6 promotor (e.g., generation of • single-stranded RNA using SP6 RNA polymerase) , and transformation of a bacterial host.
  • the DNA probes can be purified from the host cell by lysis and nucleic acid extraction, treatment with selected restriction enzymes, and further isolation by gel electrophoresis.
  • DNA probes may be chemically synthesized using commercially available methods and equipment.
  • the solid phase phosphoramidite method can be used to produce short probes of between 15 and 50 bases.
  • Probes may be comprised of the natural nucleotide bases or known analogs of the natural nucleotide bases, including those modified to bind labeling moieties.
  • the oligonucleotide sequences in Table 1 are representative of probes that hybridize with and detect specific regions of specific 16S rRNAs.
  • the oligonucleotide sequences in Table 3 are representative of probes that hybridize with and detect hypervariable regions of specific 23S rRNAs, and should not be viewed as limiting. Probes may consist of these sequences or equivalent sequences, by " themselves as a single unit for binding, or may be comprised of additional sequences not having the capacity to bind to non-pathogenic associated bacteria.
  • Probes comprising more than the short sequences, as offered in Table 1, may have repeating units of the same sequence (e.g., concatemers of a sequence) , a mixture of different sequences specific to one species of bacteria, and even a mixture of sequences that may be specific to one or more bacterial species associated with oral diseases. If such probes are to contain concatemers of short sequences, said long probes will display the high hybridization specificity inherent in a "short" probe containing, for example, only 20 nucleotides.
  • This con- catemeric probe sequence could be contained within the cloning vector sequences and would have the structure given by the formula below. Alternatively, the con- catemer having the formula [X-Y-Z]n as previously defined could be excised from the cloning vector with the appropriate restriction endonuclease.
  • Probes may be labeled by any one of several methods typically used to detect the presence of hybrid polynucleotides. The most common method of detection is the use of autoradiography with 3H, 125I, 35S, 14C, or
  • radio ⁇ active isotope depends on research preferences due to ease of synthesis, stability and half lives of the se- lected isotopes.
  • Other labels include ligands which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes.
  • probes can be conjugated directly with labels such as fluorophores, chemiluminescent agents or enzymes. The choice of label depends on sensitivity required, ease of conjugation with the probe, stability requirements, and available instrumentation.
  • Radioactive probes are typically made using commercially available nucleotides containing the desired radioactive isotope.
  • the radioactive nucleotides can be incorporated into probes, for example, by using DNA synthesizers, by nick translation with DNA poly erase I, by tailing radioactive DNA bases to the 3 ' end of probes with terminal deoxynuc- leotidyl transferase, by treating single-stranded M13 plasmids having specific inserts with the Klenow fragment of DNA polymerase in the .presence of radioactive deoxynucleotides, dNTP, by transcribing from RNA templates using reverse transcriptase in the presence of radioactive deoxynucleotides, dNTP, or by transcribing RNA from vectors containing specific RNA viral promoters (e.g., SP6 promoter) using the corresponding RNA polymerase (e.g., SP6 RNA
  • the probes can be labeled using radioactive nucleotides in which the isotope resides as a part of the nucleotide molecule, or in which the radioactive component is attached to the nucleotide via a terminal hydroxyl group that has been esterified to a radioactive component such as inorganic acids, e. ⁇ . f 32P phosphate or
  • Base analogs having nucleophilic linking groups, such as primary amino groups, can also be linked to a label.
  • Non-radioactive probes are often labeled by indirect means.
  • a ligand molecule is co- valently bound to the probe.
  • the ligand then binds to an anti-ligand molecule which is either inherently de ⁇ tectable or covalently bound to a detectable signal system, such as an enzyme, a fluorophore, or a chemilu i- nescent compound.
  • Ligands and anti-ligands may be varied widely. Where a ligand has a natural anti-ligand, namely ligands such as biotin, thyroxine, and cortisol, it can be used in conjunction with its labeled, naturally occur ⁇ ring anti-ligands. Alternatively, any haptenic or anti- genie compound can be used in combination with an anti ⁇ body.
  • Probes can also be labeled by direct conjugation with a label.
  • cloned DNA probes have been coupled directly to horseradish peroxidase or alkaline phosphotase, (Renz. M. , and Kurz, K. A Colorimetric Method for DNA Hybridization. Nuc. Acids Res. 12:3435- 3444, 1984) and synthetic olignucleotides have been coupled directly with alkaline phosphatase (Jablonski, E., et al.. Preparation of Oligodeoxynucleotide-Alkaline Phosphaatase Conjugates and Their Use as Hybridization Probes. Nuc. Acids. Res.
  • Enzymes of interest as labels will primarily be hydrolases, such as phosphatases, esterases and glyco- sidases, or oxidoreductases, particularly peroxidases.
  • Fluorescent compounds include fluorescein and its deriva ⁇ tives, rhodamine and its derivatives, dansyl, umbelli- ferone, etc.
  • Che iluminescers include luciferin, and 2,3-dihydrophthalazinediones, e.g. , luminol.
  • hybridization solutions comprising from about 20 to 60% volume, preferably 30%, of a polar organic solvent.
  • a common hybridization solution employs about 50% v/v formamide, about 0.5 to 1M sodium chloride, about 0.05 to 0.1M buffers, such as sodium citrate, Tris-HCl, PIPES or HEPES (pH range about 6-9), about 0.05 to 0.2% detergent, such as sodium do- decylsulfate, or between 0.5-20mM EDTA, ficoll (about 300-500 kilodaltons) , polyvinylpyrroliodone (about 250- 500 kdal) , and serum albumin.
  • unlabeled carrier nucleic acids from about 0.1 to 5 mg/ml, fragmented nucleic DNA, e.g. f calf thymus or salmon sperm DNA, or yeast RNA, and optionally from about 0.5 to 2% wt./vol. glycine.
  • Other additives may also be included, such as volume exclusion agents which include a variety of polar water-soluble or swellable agents, such as polyethylene glycol, anionic polymers such as polyacrylate or poly- methylaerylate, and anionic saccharidic polymers, such as dextran sulfate.
  • An ' alternative hybridization solution may be employed comprising about 2 to 4M GuSCN, preferably 3M, about 0.01 to 0.1M Tris (pH range about 6.0 to 8.5), a detergent such as sodium dodecyl sulfate in concentrations of about 0.1 to 5% (w/v) , and about 0.01 * to 0.1M EDTA.
  • Other additives may also be included such as carrier DNA or RNA, or protein such as bovine serum albumin or gelatin.
  • Stringency of the hybridization solution can be adjusted by the addition of about 0 to 10% formamide, usually 5%.
  • the particular hybridization technique is not essential to the invention. Hybridization techniques are generally described in Nucleic Acid Hybridization:. A Practical Approach, Ed. Hames, B.D.
  • the amount of labeled probe which is present in the hybridization solution may vary widely, depending upon the nature of the label, the amount of the labeled probe which can reasonably bind to the cellular target nucleic acid, and the stringency of the hybridization medium and/or wash medium. Generally, substantial ex ⁇ Waits of probe over the stoichiometric amount of the target nucleic acid will be employed to enhance the rate of binding of the probe to the target DNA.
  • the degree of stringency of hybridization can be controlled by temperature, ionic strength, pH and the presence of a partially denaturing solvent such as formamide.
  • __ the stringency of hybridization is conveniently varied by changing the polarity of the reactant solution through manipulation of the concen ⁇ tration of formamide within the range of 0% to 50%. Temperatures employed will normally be in the range of about 20" to 80"C, usually 30° to 75°C. For probes of 15-50 nucleotides in 50% formamide, the optimal temper- ature range can vary from 22° to 65°C.
  • Assay test protocols for use in this invention are those of convention in the field of nucleic acid hybridization, and include both single phase, where the target and probe polynucleic acids are both in solution, and mixed phase hybridizations, where either the target 0 or probe polynucleotides are fixed to an immobile sup ⁇ port.
  • the assay test protocols are varied and are riot to be considered a limitation of this invention.
  • a general review of single phase hybridization can be had from a reading of Nucleic Acid Hybridization: A Practical 5 Approach, Ed. Hames, B.D.
  • the colonies may also be identified by electrophoretically separating the nucleic acid and exposing the separated species to those probes designed to distinguish between species of pathogenic oral bacteria.
  • Ribosomal RNA may be detected using the methods of Alwine, J.C., et al., Proc. Natl. Acad. Sci. U.S.A., Vol. 74(12): 5350-5354 (1977). Techniques for the electrophoretic separation of DNA, including ribosomal genomic regions, are described in WO 83/01073. Methods for in situ hybridization are also applicable to this invention.
  • In situ hybridization refers to the identification of bacterial cells using polynucleotide probes, wherein the intact cell is immo- bilized and provided as a target.
  • Haase, Al, et al.. Methods in Virology, Vol. VII, pp. 189-226 (1984) and are incor- porated by reference herein.
  • Nucleic acids from GuSCN-lysed bacteria can be immobilized directly on to nitrocellulose or Nytran, and hybridized with the appropriate probe.
  • the GuSCN-lysate is diluted with buffer containing formaldehyde, slotted to nitrocellulose and heated at 80°C to denature the nucleic acids.
  • the bacterial cells are to remain in contact with a hybridization solution at a moderate temperature for an extended period of time.
  • the double-stranded duplexes may be separated from single- stranded nucleic acid by S. nuclease digestion followed by precipitation of duplex molecules, or by selective binding to hydroxyapatite.
  • the support-immobilized nucleic acids is introduced into a wash solution having analogous concentrations of sodium chloride, buffers, and detergent, as provided in the hybridization solution. The time period for which the support is maintained in the wash solution may vary from -several minutes to three hours or more.
  • Either the hybridization or the wash medium can be stringent. Typically, for mixed phase assays, it is the wash solution that most often determines the stringency and facilitates dissociation of mismatched duplexes. After rinsing the support at room temperature with a dilute buffered sodium chloride solution, the support may now be assayed for the presence of duplexes in accordance with the nature of the label.
  • the presence of probe can be detected in a scintillation counter. More conveniently, in mixed phase assays, the substrate can be dried and exposed to X-ray film in any number of conventional autoradiographic protocols.
  • the sample is detected by first irradiating it with light of a partic ⁇ ular wavelength.
  • the sample absorbs this light and then emits light of a different wavelength which is picked up by a detector (Physical Biochemistry, Freifelder, D. , W.H. Freeman & Co., pp. 537-542, 1982).
  • the sample can be detected by using antibodies.
  • a signal is generated by attaching fluorescent or enzyme molecules to the antibodies; in some cases the antibody is labeled with a radioactive probe.
  • One method of detection is enzymatic detection in conjunction with biotin.
  • fluorescence is an alternative label
  • enzymatic labels in combination with avidin or streptavidin such as biotinylated peroxidase or alkaline phosphatase, are preferred.
  • Enzyme-conjugated avidin or streptavidin can also be used to directly bind the enzyme to the probe (Haase, et al., supra).
  • Preferred enzymes are peroxidase or alkaline phosphatase.
  • An especially preferred method utilizes enzymes directly conjugated to probes.
  • the preferred enzymes are alkaline phosphatase and peroxidase. Methods for conjugating enzymes to oligonucleotides are known. Nucleic Acid Res., 14:6115-6128 (1986) and Nucl. Acid Res., 15:5275- 5287 (1987) .
  • the preferred assay protocol involves direct testing of samples without culturing. These protocols demand additional sensitivity for which the invention has particular application.
  • Samples suspected of containing oral pathogenic bacteria are first subjected to a lysing solution, such as a buffered solution of detergent and a divalent metal chelator or a buffered chaotrophic salt solution containing a detergent, a reducing agent and a divalent metal chelator.
  • the sample may be directly fixed to a support or further processed to extract nucleic acids. Released or extracted bacterial nucleic acid (including target nucleic acid) are fixed to a solid support, such as cellulose, nylon, nitrocellulose, diazobenzyloxymethyl cellulose, and the like.
  • the assay protocol is a sandwich-type assay.
  • a primary component of a sandwich-type assay is a solid support.
  • the solid sup ⁇ port has adsorbed to it or covalently coupled to it immobilized nucleic acid probe that is unlabeled and complementary to one portion of the rRNA sequence.
  • Preferred are those probes that hybridize to regions of the ribosomal RNA with minimal secondary and tertiary interactions, such as those listed in Table 4.
  • the advantage of such probes is that the hybridization can be carried out without the additional step of heat denaturing the sample nucleic acid.
  • the test sample suspected of containing oral pathogenic bacteria is then contacted with the solid support in a hybridization medium.
  • a second soluble-labeled probe complementary to a different sequence of the rRNA of the pathogenic bacteria is hybridized to the rRNA that has formed a hybridization duplex with the immobilized nucleic acid probe on the solid support.
  • the second probe can be added simultaneously with the test sample to the hybridization assay.
  • the second probe can hybridize to either a conserved or to a hypervariable region of the rRNA.
  • Preferred are the probes derived from conserved regions of the ribosomal RNA with minimal secondary and tertiary interactions (Table 4) , such as UP7B or UP9A for 16S ribosomal RNA, and UP12B or 23UPB for 23S ribosomal RNA.
  • Table 4 the probes derived from conserved regions of the ribosomal RNA with minimal secondary and tertiary interactions
  • the advantage of such probes is that the hybridization can be carried out without the additional step of heat denaturing the nucleic acid.
  • the oligonucleotide or polynucleotide acid probes of this invention can be included in a kit which can be used to-rapidly determine the presence or absence of oral pathogenic bacteria, especially the species disclosed in Table 1.
  • the kit includes all components necessary to assay for the presence of these bacteria.
  • the kit includes a stable preparation . of labeled probes to rRNA, hybridization solution in either dry or liquid form for the hybridization of target and probe polynucleotides, as well as a solution for washing and removing undesireable and nonduplexed poly ⁇ nucleotides, a substrate for detecting the labeled du-
  • a more specific embodiment of this invention embraces a kit that utilizes the concept of the sandwich assay.
  • This kit would include a first component for the collection of samples from the mouths of patients, such as a scraping device or paper points, vials for containment, and buffers for the dispersement and lysis of the sample.
  • a second component would include media in either dry or liquid form for the hybridization of target and probe polynucleotides, as well as for the removal of undesireable and nonduplexed forms by washing.
  • a third component includes a solid support upon which is fixed or to which is conjugated unlabeled nucleic acid probe(s) that is(are) complementary to a part of either the 16S or 23S rRNA of the species of bacteria being tested.
  • a fourth component would contain labeled probe that is complementary to a second and different region of the same rRNA strand to which the immobilized, unlabeled nucleic acid probe of the third component is hybridized.
  • the probe components described herein include combinations of probes in dry form, such as lyophylized nucleic acid or in precipitated form, such as alcohol precipitated nucleic acid or in buffered solutions.
  • the label may be any of the labels described above.
  • the probe can be biotinylated using conventional means and the presence of a biotinylated probe can be detected by adding avidin conjugated to an enzyme, such as horseradish peroxidase, which can then be contacted with a substrate which, when reacted with peroxidase, can be monitored visually or by instrumentation using by a colorimeter or spectrophotometer.
  • an enzyme such as horseradish peroxidase
  • This labeling method and other enzyme-type labels have the advantage of being economical, highly sensitive, and relatively safe compared to radioactive labeling methods.
  • the various reagents for the detection of labeled probes and other miscellaneous materials for the kit such as instruc ⁇ tions, positive and negative controls, and containers for conducting, mixing, and reacting the various components, would complete the assay kit.
  • rRNA Bacterial cells are resuspended in a lysis solution (20 mg/ml lysozyme, 25% sucrose, 50mM Tris, pH 8, lOmM EDTA), and incubated at 37°C for 30 in.
  • a lysis solution (20 mg/ml lysozyme, 25% sucrose, 50mM Tris, pH 8, lOmM EDTA)
  • Sodium dodecylsulfate (1-2% w/v) and pronase E (1 mg/ml) or proteinase K (200 ⁇ g/ml) are added, and the solution is incubated 30 min at 37°C.
  • the lysates are extracted twice with phenol:chloroform (1:1, v/v) and then precipitated with ethanol.
  • Nucleic acid is pelleted, washed with 70% v/v ethanol, and resuspended to approximately 1 mg/ml in IX TE buffer (lOmM Tris, pH 8, ImM EDTA). Resuspended nucleic acid is stored at -70°C.
  • UP4B GCTGGCACGGAGTTAGCCG
  • UP8B CACGARCTGACGACARCCATGC
  • UP6B TACGGNTACCTTGTTACGAC
  • the protocol for sequencing is a modification of the dideoxynucleotide-terminated chain elongated method described by Sanger, F. , et al., Proc. Natl. Acad. Sci. U.S.A., 74, 5463-5467 (1977), as adapted for rRNA templates by Lane, et al. Proc. Natl. Acad. Sci. U.S.A., 82, 6955-6959 (1985). Sequencing primers were radioactively labeled with 32P-ATP using T4 polynucleo ⁇ tide kinase (50uCi 32P-ATP, 3000Ci/mMol, per 300 ng oligo and 10 units of kinase) . The radioactively labeled primers were ethanol precipitated and resuspended in water to 30ng/ml.
  • a standard sequencing reaction is set up as follows. Two ⁇ l of primer are added to 3 ⁇ l of a solu ⁇ tion of bacterial nucleic acid (0.5-25 mg/ml), 2 ⁇ l 5X HYB buffer (500mM KC1, 250mM Tris-HCl, pH 8.5), and 3 ⁇ l of H-O. The mix is heated at 100°C for 2 min, then cooled to room temperature.
  • 5X RT buffer 250mM Tris-Hcl, pH 8.3, 250mM KC1, 50mM dithiothreitol, 50mM MgCl 2
  • 5 ⁇ l H 2 0 and 2 ⁇ l reverse transcriptase 200 U/ ⁇ l, Bethesda Research Laboratories, Gaithersburg, Maryland
  • Three ⁇ l aliquots are pipetted into 2 ⁇ l deoxynucleotide/dideoxynucleotide mixes (A: 17 ⁇ M dATP, 300 ⁇ M dCTP, 330 ⁇ M dGTP, 330 ⁇ M TTP, 125 ⁇ M ddATP; C: 330 ⁇ M dATP, 17 ⁇ M dCTP, 330um dGTP, 330 ⁇ M TTP, 125 ⁇ M ddCTP; G: 330 ⁇ M dATP, 330 ⁇ M dCTP, 17 ⁇ M dGTP, 330 ⁇ M TTP, 250 ⁇ M ddGTP; T: 330 ⁇ M dATP, 330. ⁇ M dCTP, 330 ⁇ M dGTP, 17 ⁇ M -TTP, 125 . ⁇ M ddTTP) .
  • the reactions are incubated at 3 ⁇ C for 15 min.
  • Two ⁇ l of chase (330 ⁇ M dATP, dCTP, dGTP, TTP, plus 400 units of reverse transcriptase) are added to each reaction.
  • the reactions are incubated for an additional 15 min at 43"C, and terminated by the addition of 6 ⁇ l loading solution (95% formamide, 2.5% xylene cyanol, 2.5% bromphenol blue) .
  • Reaction products were electrophoresed on 8% polyacrylamide- denaturing gels and visualized by autoradiography.
  • the sequencing reactions can also be performed using unlabeled sequencing primer and [ 3 5S]dATP under reaction conditions similar to those described above.
  • Oligonucleotides were synthesized . on an Applied Biosystems DNA synthesizer Model 380B via ⁇ -cyanoethyl- phosphoramidite chemistry. The oligonucleotides were " purified by preparative polyacrylamide gel electropho- resis or by high pressure liquid chromatography and eluted as detailed in Applied Biosystems User Bulletin No. 13: "Evaluation and Purification of Synthetic Oligo ⁇ nucleotides," November 9, 1984. See Table 1 for preferred sequences. E. Isolation of Nucleic Acid from Bacterial Culture or Subgingival Plague Samples
  • lysozyme 10 mg/ml in 0.25X bacterial sucrose lysis buffer; Sigma Chemical
  • 75 ⁇ l of 10% SDS is then added and the sample vortexed briefly.
  • 75 ⁇ l of Pronase E (10 mg/ml, Sigma Chemical; self-digested as per Maniatis, et al., Molecular Cloning: A Laboratory Man ⁇ ual) is added, the sample vortexed briefly and incubated at 37°C for 30 min.
  • the sample is extracted two times with ' phenol:chloroform:isoamyl alcohol (24:24:1, v/v/v) , saving the aqueous phase.
  • the interphase is not clear, it can be extracted again with chloroform and the aqueous phase saved.
  • the sample is then concentrated by lyophilization to 300 ⁇ l, to which 150 ⁇ l of a sterile 7.5M NH 4 0Ac solution is added, and followed by 1.12 ml of 95% ethanol.
  • the sample is then mixed and stored at - 70 ⁇ C for 30 min or longer to precipitate the nucleic acid, and the pellet is recovered by centrifugation for 10 min at 4°C.
  • the nucleic acid pellet is washed once with 1.5 ml of 95% ethanol, dried briefly, and then resuspended in 400 ⁇ l.of sterile TE buffer (lOmM Tris-HCl pH 7.5, 0.ImM EDTA) .
  • the slots are washed with 200 ⁇ l of 10X SSC (1.5M NaCl, 0.15M sodium citrate pH 7.0), the Nytran membrane with immobilized nucleic acid baked at 80"C for 1 hour, and the Nytran membrane stored at room temperature between blotting paper.
  • 10X SSC 1.5M NaCl, 0.15M sodium citrate pH 7.0
  • F.b) Direct immobilization of cell Ivsates to - nitrocellulose membranes A cell pellet of cultured bacteria or a plaque sample is resuspended in lOOul of 3M GuSCN, 2% sarkosyl w/v, 50mM Tris-HCl (pH 7.6), lOmM EDTA,and 1% v/v mercaptoethanol and incubated at room temperature for 10 min. To this solution is added 0.3 volumes of 20X SSC, followed by 0.2 volumes of 37% formaldehyde, and incubation at 55°C for 15 min.
  • Serial dilutions are made in 15X SSC and the nucleic acid solutions slotted onto nitrocellulose (prewetted with water and soaked in 6X SSC for 10 min).
  • the filters are baked at 80 " C under vacuum for 2 hours and stored at room temperature between blotting paper.
  • Probes are labeled with 32P by polynucleotide kinase as per Maniatis, T. et al. Molecular Cloning: A
  • probes are synthesized with an ethylamine group at the 5• end, biotinylated with NHS-LC-biotin (Pierce Chemical Co., Rockford, Illinois), and purified by Elutip-D chromatography.
  • Nucleic acids immobilized on Nytran or nitrocellulose membranes, are hybridized with 5 ng/ml of oligonucleotide probe in 0.6M NaCl, 90mM Tris-HCl (pH 8.0), lOmM EDTA, 5X Denhardt's solution, 30% deionized formamide, 0.1% SDS, and 100' ⁇ l/ml fragmented yeast RNA at 42°C, or in 0.9M NaCl, 90mM Tris-HCl (pH 8.0), lOmM EDTA, 5X Denhardt's solution, 0.1% SDS, and 100 ⁇ g/ml fragmented yeast RNA at 50°C.
  • the hybridizations are carried out in 50 ml polypropylene tubes or with sealed "Micro-Seal" plastic bags (Dazey Corp., Industrial Air ⁇ port, Kansas) on a rotary shaker at the appropriate temperature for 1 hour or longer.
  • An alternate stringent wash can be conducted with 3.1M tetraethylammonium bromide, 50mM Tris-HCl (pH 8.0), 2miM EDTA, and 0.1% SDS at 29°C (this procedure requires a 0.9M NaCl, 90mM Tris-HCl (pH 8.0), lOmM EDTA pre-wash prior to the tetraethylammonium bromide wash) .
  • Procedure B Nucleic acids immobilized on membranes are hybridized with 5ng/ml oligonucleotide probe in 3M GuSCN, 5% formamide, 50mM Tris(pH 7.6), lOmM EDTA, 2% sarkosyl for 0.5 to 24 hours as described in procedure A.
  • the membrane is washed twice for 2 min with a solution containing 0.09M NaCl, 9mM Tris-HCl (pH 8.0), ImM EDTA, and 0.1% SDS at room temperature.
  • 32P labeled probes were used, nucleic acids were visualized by autoradiography.
  • biotinylated probes required the incubation with streptavidine-alkaline phosphatase or streptavidine-peroxidase followed by color development as described in Example 2.
  • H. Detection of Hybridized Probe Hybridized probe labelled with 32P was detected by autoradiography. Biotinylated probes were detected by the Detek-alk kit (avidin-alkaline phosphatase; Enzo Biochem, New York, New York) or the DNA detection kit
  • ribosomal RNA (1-5 ug) was hybridized with 32 P-labelled complementary oligonucleotide probes (5-10 ng) , such as those in Table 1 or Table 2, in 0.09M NaCl, 9mM Tris-HCl (pH 8.0), and ImM EDTA, or 3M GuSCN, 2% sarkosyl, 50mM Tris-HCl (pH 7.6), lOmM EDTA, 1% mercaptoethanol, and 5% formamide.
  • oligonucleotide probe:rRNA hybrids visualized by autoradiography. Oligonucleotide probes which showed hybridization specific to their respective ribosomal RNA subunit were further tested in the sandwich assay format. In this format the test oligonucleotide probe was covalently attached to a solid support.
  • Target ribosomal RNA was hybridized in the presence of the test oligonucleotide and 32 P-labelled signal oligonucleotide probes, such as UP7B or UP9A for 16S ribosomal RNA, or UP12B or 23UPB for 23S ribosomal RNA, using the GuSCN hybridization solution described above in Procedure B. After hybridization for 2-15 hours, the solid support was washed of unhybridized nucleic acid, and the amount of ribosomal RNA captured by the test oligonucleotide probe quantitated by liquid scintillation counting.
  • 32 P-labelled signal oligonucleotide probes such as UP7B or UP9A for 16S ribosomal RNA, or UP12B or 23UPB for 23S ribosomal RNA
  • oligonucleotide probes e.g., biotinylated probes
  • Direct conjugation of alkaline phosphatase to a short probe involves conjugation via heterobifunctional reagents.
  • the synthetic probe is synthesized as described herein with a linker arm reagent attached to the terminal 5'-hydroxyl.
  • An aminohexyl linker arm with a terminal amino group is attached to the 5*-hydroxyl of the synthetic oligodeoxynucleotide as the last step in its synthesis on an automated DNA synthesizer.
  • the reagent used for linker arm introduction is 6-(methoxytritylamino)hexyl 2- cyanoethyl N,N-diisopropylphosphoramidite, prepared from 6-aminohexanol in a manner similar to the synthesis of the 3-(methoxytritylamino)propyl methyl N,N-diisopro- pylphosphoramidite, as described by B.A. Connolly, Nucl. Acids Res., 15:3131 (1987).
  • the linker arm is attached to the probe, and the deprotected probe purified in a method similar to the methods described in the Connolly reference. -
  • the oligonucleotide first is derivatized with the thiol-reactive agent N-succinimidyl(4-iodoacetyl)am- inobenzoate ("SIAB") through the amino linker arm.
  • SIAB N-succinimidyl(4-iodoacetyl)am- inobenzoate
  • the SIAB-oligonucleotide is prepared by adding 1.2 mg S ⁇ AB to 300 ⁇ g of the oligonucleotide, incubating for one hour at room temperature, and desalting over a G-25 column equilibrated with 20mM sodium phosphate (pH 6.0), 5mM EDTA.
  • This probe derivative can be coupled to alkaline phosphatase which is modified as described below.
  • Alkaline phosphatase is thiolated with dithio- bis(succinimidylpropionate) ("DSP") by adding 800 ⁇ g DSP to 4 mg alkaline phosphatase. The reaction is allowed to proceed for 30 min at room temperature. The reaction mixture then is treated with dithiothreitol for 15 min at room temperature to reduce the disulfide, and desalted over a G-25 column equilibrated with 20mM sodium phosphate (pH 6.0). The SIAB-oligonucleotide is mixed with the DSP- alkaline phosphatase at a oligonucleotide:alkaline phosphatase ratio of 4:1.
  • DSP dithio- bis(succinimidylpropionate)
  • HRP Horseradish peroxidase
  • NalO. I04:HRP, 160:1
  • the concentrated HRP is then used to resuspend a pellet of oligonucleotide with a 5'-hexylaminelinker arm.
  • the pH of the reaction mix is adjusted to 9.5 with carbonate buffer and NaBH-CN is added to 50mM.
  • the reaction is allowed to proceed for 16 to 20 hours at room temperature and the products separated by HPLC using a GF-250 column (Dupont) .
  • the probe-enzyme conjugates are tested in the following ways. Fusobacterium nucleatum or Bacteroides gingivalis genomic DNA was serially diluted into human placental DNA, heat denatured, and applied to slots on a Nytran membrane.
  • Bg-1B:HRP (100 ng/ml in 30% formamide, 0.6M NaCl, 90mM Tris-HCl (pH 8.0), lOmM EDTA, and 0.1% SDS) was hybridized to the immobilized DNA for 1 hour at room temperature, and washed in 0.45M NaCl, 45mM Tris-HCl pH 8.0, 5mM EDTA pH 8.0, and 0.1% SDS for 20 min at 50°C. The wash solution was removed, and substrate solution (lOOmM HEPES Citrate-phosphate buffer (pH 6.5), 90 ⁇ M 3- methyl-2-benzothiazolinone hydrazone, 6mM 4- methoxynaphthol, and 4mM H 2 0 ?
  • Hybridized probe was detected as a blue or brown precipitate, respectively, on the Bacteroides gingivalis DNA slots.
  • Fn-IB:alkaline phosphatase or Bg-IB:alkaline phosphatase were hybridized for 1 hour at room tempera- ture to the Nytran membranes as above.
  • the membranes were washed as above and substrate solution (0.6mM nitro- blue tetrazolium in 70% dimethylformamide, 0.6mM 5-bromo- 4-chloro-3-indolyl phosphate in 0.1M Tris-HCl pH 9.5, 0.1M NaCl, 50mM MgCl ) was added.
  • Hybridized probe was detected as a blue precipitate on F. nucleatum or B. gingivalis DNA slots, respectively.
  • Sandwich hybridizations with the Bg-1B:HRP probe was performed as follows. Varying concentrations of Bg- 5B:SIAB probe in PBS (150mM NaCl, lOmM sodium phosphate pH 7.01) were immobilized to cysteamine-derivatized Pall Immunoaffinity membranes (Pall Corporation, East Hills, N.Y.). The membranes were made by conjugating Pall Immunoaffinity membranes (0.2 ⁇ pore size) with lOmM cystamine in PBS and then washing and treating the cystamine-derivatized membranes with DTT (lOmM for 30 min at 25°C) to produce a cysteamine-derivatized membrane.
  • DTT lOmM for 30 min at 25°C
  • Non-covalently immobilized probe was removed from these membranes by heating at 90°C in PBS.
  • the Pall:Bg-5B membranes were hybridized with a DNA target (complementary to Bg-5B) and Bg-lB:HRP(Bg- 1B:5•GAATAACGGGCGATACGAGTATTGATTGAATGTACCGTAAGAATAAGCAT CGG 3') for 30 min in 0.6M NaCl, 30% formamide, 90mM Tris-HCl (pH 8.0), lOmM EDTA, 0.1% SDS at 42 ⁇ C.
  • the complex was washed in 0.09M NaCl, 9mM Tris (pH 8.0), ImM EDTA at 50°C for 20 min.
  • the wash solution was decanted and the 4-chloro-methoxynapthol substrate added. After a 15 min incubation, at room temperature, the hybridized Bg-1B:HRP probe was detected as a blue precipitate on the Pall:Bg5B membrane. Purified Bg 16S rRNA hybridized in a like manner also was detected by sandwich hybridization with Bg-1B:HRP and Pall:Bg5B.
  • Pall membranes with 0.1 ⁇ g of immobilized Bg-5B oligonucleotide were immersed into the lysate and hybridized for 0.5 to 24 hours at room temperature.
  • the membranes were washed with a solution containing 0.09M NaCl, 9 mM Tris-HCl (pH 8.0), ImM EDTA, and 0.1% SDS.
  • the Pall:Bg-5B:rRNA membranes were hybridized again in the GuSCN/formamide lysis solution containing 10-lOOng/ml biotinylated signal oligonucleotide and hybridized from 0.5 to 24 hours.
  • the biotinylated signal oligonucleotides used were UP7B, UP9A, and UP3A.
  • the membranes were washed with a solution containing 0.09 M NaCl, 9 mM Tris-HCl (pH 8.0), ImM EDTA, and 0.5% SDS.
  • the membranes were then incubated with the strepavidin conjugate of alkaline phosphatase (or horse-radish peroxidase) " in 0.18M NaCl, 18mM Tris-HCl (pH 8.0), 2mM EDTA, 0.5% SDS, and 0.1% gelatin at room temperature for 15 to 60 min.
  • a test kit for the detection of oral pathogenic bacteria will contain all of the required components for the collection, processing, and evaluation of several samples, as well as the associated instructions and patient data collection cards.
  • the Product Insert will contain complete written instructions for patient sampling and evaluation.
  • a Data Card will be included for the record ⁇ ing of minimal baseline data for each patient, such as patient identification, site of collection, and test results.
  • Endodontic Points Endodontic points (paper points) for collection of each sample to be tested are also included. After cleansing the supragingival surfaces by wiping with gauze, the point will be used to rub the bacteria from the subgingival surface of the tooth to be sampled and to collect bacteria by absorption of saliva, gingival fluid, and gingival plaque.
  • Lysing Reagent Each point with the collected sample will be placed immediately into a numbered tube of Lysing Reagent which will lyse the bacteria and release the bacterial nucleic acids.
  • Probe/Enzyme Reagent A standard aliquot of Probe la ⁇ beled by a ligand with or directly conjugated to an Enzyme Reagent is added to each tube of Lysing Reagent to initiate the hybridization reaction between the pathogen nucleic acid targets and the signal oligonucleotide probes derived from conserved regions of the ribosomal RNA sequences.
  • Dipstick Device An individual Dipstick Device containing site(s) with pathogen-specific DNA probes covalently immobilized to the solid support and having space for marking and identifying each site tooth sam ⁇ pled, is inserted immediately into each tube containing the hybridization mixture and incubated at room temper- ature.
  • Each Dipstick Device is removed from the hybridization mixture and washed with the Wash Reagent, using the bottle provided.
  • the Dipstick Devices are placed collectively into the Enzyme Substrate Reagent bottle and developed for several minutes to 1 hour at room temperature. Each Dipstick Device is washed again with the Wash Reagent to remove excess background color.
  • Actinobacillus (ex. Haemophilus) actinomycetemcomitans
  • Aa-3B 5'ATTTAACGTCAATTTGGCATGCTA3 • UP4B/1B
  • Aa-2B 5'CTTCGGGCACYAGGGCTAAACCCC3 • UP2B
  • Aa-4B 5 'ACCCATCTCTGAGTTCTTCTTCGG3 ⁇ UP8B
  • Aa-5B 5•GTGGTAAACGCCCCCCTCTCGGTT3 » UP6B
  • Aa-IOB 5'TGGCATGCTATTAACACACCAACC3 ' UP4B/1B
  • Bi-IB 5 •GGTCCTTATTCGAAGGGTAAATGC3 • UP4B/1B Bi-3B 5 •CACGTGCCCCACTTTACTCCCCAA3 ' UP4B/1B Bi-6B 5 'TAGCCGCTAACGCCAGGCGCTAAC3 • UP2B Bi-2B 5 •CCCTAGGYGCGCTCCTCGCGGTTA3 » UP6B Bi-5B 5'GAGTCAACATCTCTGTATCCTGCG3 ' UP8B Bi-4B*5'TTGCCCTAGGTCGCTCCTCGCGGT3 • UP6B
  • Wr-IB 5 GTACCGTCATAATTCTTTCCCAAG3' UP4B Wr-2B 5 » GGACCATAACCGGTTTGGTATTTG3 ' UP6B Wr-3B 5•GCATTACTGCCTCGACTAGCGAAG3 ' UP2B Wr-6B 5•CTTGGGTACCGTCATAATTCTTTCC3 r UP4B Streptococcus intermedius Si-IB 5 « GTACCGTCACAGTATGAACTTTCC3' UP4B Si-2B 5•TTCTCACACTCGTTCTTCCTTAAC3• UP4B Si-3B 5'TTTCCATTCTCACACTCGTTCTTC3• UP4B

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention se rapporte à des compositions de sondes d'oligonucléotides, qui sont destinées à être utilisées dans la détection de bactéries associées à des troubles médicaux de la bouche chez l'homme. Ces sondes se composent essentiellement d'un segment d'acide nucléique capable de s'hybrider sélectivement, dans des conditions d'hybridation, avec l'ARN ribosomique [ARNr] 16S ou 23S desdites bactéries. Des procédés servant à la détection de telles bactéries ainsi que des kits diagnostiques servant à l'analyse de ces bactéries sont également décrits.
EP19890901912 1988-01-11 1989-01-09 Oligonucleotide probes for detection of periodontal pathogens Withdrawn EP0395731A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14210688A 1988-01-11 1988-01-11
US142106 1988-01-11

Publications (2)

Publication Number Publication Date
EP0395731A1 true EP0395731A1 (fr) 1990-11-07
EP0395731A4 EP0395731A4 (en) 1993-12-01

Family

ID=22498576

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19890901912 Withdrawn EP0395731A4 (en) 1988-01-11 1989-01-09 Oligonucleotide probes for detection of periodontal pathogens

Country Status (6)

Country Link
EP (1) EP0395731A4 (fr)
JP (1) JP2733700B2 (fr)
CA (1) CA1339728C (fr)
DK (1) DK162090A (fr)
FI (1) FI903485A0 (fr)
WO (1) WO1989006704A1 (fr)

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5541308A (en) * 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US7172863B1 (en) 1988-12-09 2007-02-06 Gen-Probe Incorporated Nucleic acid probes and methods for detecting Neisseria gonorrhoeae
IE81145B1 (en) * 1989-04-20 2000-05-03 Thomas Gerard Barry Generation of specific probes for target nucleotide sequences
US5334501A (en) * 1989-07-11 1994-08-02 Microprobe Corporation Quantification of bacteria using a nucleic acid hybridization assay
AU6075490A (en) * 1989-07-11 1991-02-06 Microprobe Corporation Quantification of bacteria using a nucleic acid hybridization assay
CA2025181A1 (fr) * 1989-10-12 1991-04-13 William G. Weisburg Sondes a l'acide nucleique et methodes pour la detection des champignons
CA2025180A1 (fr) * 1989-10-12 1991-04-13 William G. Weisburg Sondes a l'acide nucleique et methodes pour la detection de levures pathogenes de candida
US5220014A (en) * 1989-11-13 1993-06-15 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Rrna specific oligonucleotides
GB9020621D0 (en) * 1990-09-21 1990-10-31 Imp Cancer Res Tech Identification of organisms
GB2262987A (en) * 1990-09-21 1993-07-07 Imp Cancer Res Tech Identification of organisms
FR2667079B1 (fr) * 1990-09-26 1993-08-13 Genset Sa Procedes, oligonucleotides amorces et oligonucleotides sondes pour la detection de bacteries pathogenes de la cavite buccale.
US5700636A (en) * 1990-10-19 1997-12-23 Becton Dickinson And Company Methods for selectively detecting microorganisms associated with vaginal infections in complex biological samples
AU4396793A (en) * 1992-05-29 1993-12-30 Microprobe Corporation Methods and pharmaceutical kits useful for detecting microorganisms associated with vaginal infections
WO1994028174A1 (fr) * 1993-05-24 1994-12-08 Amoco Corporation Sondes d'acides nucleiques destinees a des bacteries du genre legionella
DE69515652D1 (de) * 1994-03-30 2000-04-20 Univ Montreal Montreal Verwendung von dna oligomeren zur hemmung von hiv durch reduktion ribosomaler leserasterverschichtung
CA2150986C (fr) * 1994-06-17 1999-11-02 Mary Kathryn Meyer Amorces et sondes d'oligonucleotides pour la detection de bacteries
FR2723950B1 (fr) * 1994-08-24 1996-10-25 Bio Merieux Fragments nucleotidiques capables de s'hybrider specifiquemennt a l'adnr ou arnr des rickettsia et leur utilisation comme sondes ou amorces.
US5656427A (en) * 1994-08-29 1997-08-12 Gen-Probe Incorporated Nucleic acid hybridization assay probes, helper probes and amplification oligonucleotides targeted to Mycoplasma pneumoniae nucleic acid
US6204003B1 (en) * 1997-09-19 2001-03-20 Synbiotics Corporation Methods for the diagnosis of feline infectious anemia
US7108980B1 (en) 1998-08-07 2006-09-19 Boston Probes, Inc. Methods for the analysis of microcolonies of bacteria and yeast
US6280946B2 (en) 1998-08-07 2001-08-28 Boston Probes, Inc. PNA probes, probe sets, methods and kits pertaining to the universal detection of bacteria and eucarya
US6797817B1 (en) 1999-04-15 2004-09-28 E. I. Du Pont De Nemours And Company Nucleic acid fragments for the identification of dechlorinating bacteria
US6894156B2 (en) 1999-04-15 2005-05-17 E. I. Du Pont De Nemours And Company Nucleic acid fragments for the identification of dechlorinating bacteria
DE10106370B4 (de) * 2001-02-12 2005-01-27 Vermicon Ag Oligonukleotidsonden zur Detektion von parodontopathogenen Bakterien mittels in situ-Hybridisierung
AT411174B (de) * 2001-08-09 2003-10-27 Lambda Labor Fuer Molekularbio Verfahren und chip zur analyse von nukleinsäuren
JP2003189869A (ja) * 2001-12-27 2003-07-08 Nisshinbo Ind Inc 被検体中に含まれる生物種を判定する方法およびそれに用いるキット
US7482116B2 (en) 2002-06-07 2009-01-27 Dna Genotek Inc. Compositions and methods for obtaining nucleic acids from sputum
EP1859039A4 (fr) 2005-03-16 2009-06-03 Dna Genotek Inc Compositions et procédé destinés au stockage d'acide nucléique provenant de fluides corporels
TWI428119B (zh) 2005-12-09 2014-03-01 Dna Genotek Inc 用於可釋放儲存一物質之容器系統及使一物質與一生物樣本組合之方法
AT505850B1 (de) * 2007-10-10 2009-09-15 Greiner Bio One Gmbh Nachweis von mit parodontitis assoziierten keimen
EP3928715A1 (fr) 2011-06-19 2021-12-29 DNA Genotek, Inc. Dispositifs, solutions et procédés de collecte d'échantillons
EP3034618A1 (fr) * 2014-12-16 2016-06-22 Marcos Isamat Riviere Puce CMOS d'acide nucléique pour diagnostiquer une maladie infectieuse parodontale
US20180148769A1 (en) * 2016-11-25 2018-05-31 Mitsubishi Chemical Corporation Bacterial flora analysis method and bacterial flora analysis device
JP6652692B2 (ja) 2017-01-16 2020-02-26 スペクトラム・ソリューションズ・エルエルシーＳｐｅｃｔｒｕｍ Ｓｏｌｕｔｉｏｎｓ Ｌ．Ｌ．Ｃ． 核酸保存溶液ならびに製造方法および使用方法
CA3120708A1 (fr) 2018-11-20 2020-05-28 Spectrum Solutions, Llc Systeme de collecte d'echantillon comprenant un capuchon d'etancheite et une soupape
US11701094B2 (en) 2019-06-20 2023-07-18 Spectrum Solutions L.L.C. Sample collection system including valve and plug assemblies

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0199439A1 (fr) * 1985-03-01 1986-10-29 Omnigene Inc Procédé et sonde pour détecter des cellules Actinobacillus Actinomycetemcomitans
WO1988003957A1 (fr) * 1986-11-24 1988-06-02 Gen-Probe Incorporated Sondes d'acide nucleique pour la detection et/ou la quantification d'organismes non viraux

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0229442B1 (fr) * 1986-01-07 1993-01-27 Gen-Probe Incorporated Procédé de réassociation accélérée d'acide nucléique
EP0250662B1 (fr) * 1986-06-25 1994-08-24 The Regents Of The University Of California Détection de mycoplasma par hybridation d'ADN

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0199439A1 (fr) * 1985-03-01 1986-10-29 Omnigene Inc Procédé et sonde pour détecter des cellules Actinobacillus Actinomycetemcomitans
WO1988003957A1 (fr) * 1986-11-24 1988-06-02 Gen-Probe Incorporated Sondes d'acide nucleique pour la detection et/ou la quantification d'organismes non viraux

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FEMS MICROBIOLOGY LETTERS vol. 43, no. 2, August 1987, AMSTERDAM, THE NETHERLANDS pages 187 - 193 HAUN, G, ET AL. 'Oligonucleotide probes for genus-,species- and subspecies-specific identification of representatives of the genus Proteus' *
ORAL MICROBIOL. AND IMMUNOL. vol. 1, no. 1, October 1986, COPENHAGEN, DK pages 58 - 62 FRENCH, C.K ET AL. 'Dna probe detection of periodontal pathogens' *
See also references of WO8906704A1 *

Also Published As

Publication number Publication date
DK162090D0 (da) 1990-07-05
JPH03502640A (ja) 1991-06-20
EP0395731A4 (en) 1993-12-01
CA1339728C (fr) 1998-03-17
DK162090A (da) 1990-09-07
FI903485A0 (fi) 1990-07-10
JP2733700B2 (ja) 1998-03-30
WO1989006704A1 (fr) 1989-07-27

Similar Documents

Publication Publication Date Title
US5212059A (en) Oligonucleotide probes for the detection of periodontal pathogens
CA1339728C (fr) Sondes d'oligonucleotides pour la detection d'agents pthogenes periodontaux
Monteiro et al. Detection of Helicobacter pylori DNA in human feces by PCR: DNA stability and removal of inhibitors
JP2709256B2 (ja) マイコバクテリアプローブ
US5106730A (en) Lactam-containing compositions and methods useful for the hybridization of nucleic acids
EP0688873A2 (fr) Test DNA rapide pour la détection de staphylococcus aureus résistant à la chinolone dans du matériel clinique
US5334501A (en) Quantification of bacteria using a nucleic acid hybridization assay
JP2000502260A (ja) 多型遺伝子配列の評価方法およびｈｌａ型の同定におけるその使用
KR19990067080A (ko) 특정 뉴클레오티드 서열의 검출방법 및 조성물
JP3030034B2 (ja) カンピロバクターを検出するための核酸フラグメント、方法およびキット
Flemmig et al. Identification of Actinobacillus actinomycetemcomitans in subgingival plaque by PCR
JPH08510386A (ja) ポリメラーゼ鎖反応によるサルモネラ菌の同定
EP0484385A1 (fr) Quantification de bacteries au moyen d'un dosage d'hybridation d'acide nucleique
Rotimi et al. Prevalence of periodontal bacteria in saliva of Kuwaiti children at different age groups
AU627712B2 (en) Oligonucleotide probes for detection of periodontal pathogens
US5283175A (en) Genus-specific oligomers of Borrelia and methods of using same
JPH05276999A (ja) カンピロバクター属細菌検出用オリゴヌクレオチド、カンピロバクター属細菌の検出法及び検出用試薬キット
Paiva et al. Microbial diagnosis by nucleic acid sandwich hybridization
US5352580A (en) Selective detection of mycobacteria by nucleicacid probes derived from Mycobacterium kansasii
US5432055A (en) Detection of Porphyromonas gingivalis
McGuire et al. Detection of Borrelia burgdorferi in human blood and urine using the polymerase chain reaction
WO1993003184A1 (fr) Procede et composition permettant de detecter la maladie de lyme
JPH06165681A (ja) メチシリン耐性ブドウ球菌検出用オリゴヌクレオチド、メチシリン耐性ブドウ球菌の検出法および検出用試薬キット
JP2004525626A (ja) ｉｎｓｉｔｕハイブリダイゼーションにより歯周病原性細菌を検出するためのオリゴヌクレオチド・プローブ
Alleman Molecular tools for the diagnosis of animal diseases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19900711

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

A4 Supplementary search report drawn up and despatched

Effective date: 19931015

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

17Q First examination report despatched

Effective date: 19951215

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19991026