CN1417229A - Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition - Google Patents
Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition Download PDFInfo
- Publication number
- CN1417229A CN1417229A CN01132158A CN01132158A CN1417229A CN 1417229 A CN1417229 A CN 1417229A CN 01132158 A CN01132158 A CN 01132158A CN 01132158 A CN01132158 A CN 01132158A CN 1417229 A CN1417229 A CN 1417229A
- Authority
- CN
- China
- Prior art keywords
- dna
- human tumor
- inducing ligand
- death inducing
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The present invention discloses a human tumor necrosion relative death inducing ligand mutein with Ser52Asn and Trp82Gln mutation, the mutein encoding DNA sequence, expression vector containing the DNA sequence, host cell transformed by the expression vector, medicine composition containing the mutein, and the preparation process of the mutein. The mutein has affinity greatly higher than natural protein and has somewhat higher expression amountin host cell.
Description
Invention field
The present invention relates to biological technical field.Specifically, the present invention relates to the human tumor necrosin relative death inducing ligand mutein that a kind of avidity and expression amount increase.In addition, the pharmaceutical composition that the invention still further relates to the preparation method of this mutain and contain this mutain.
Background technology
At present clinically excision combination chemotherapy and radiotherapy are still adopted in the treatment of tumour patient mostly, though this traditional remedies can be removed the knurl body and kill the part cancer cells, but because its non-specific lethal effect, make a large amount of normal tissue cells of patient be killed, cause patient's body health to be subjected to great damage, also can't prevent the recurrence and the transfer of curing oncoma simultaneously.
The biotherapy of current rise and gene therapy have brought dawn for thoroughly effecting a radical cure tumour, recent research has been found a kind of albumen-TRAIL (TNF related apoptosis inducing ligand of energy specific killing tumour cell, tumor necrosin relative death inducing ligand), owing to its unique antitumous effect for catching people's attention.
People's trail dna is positioned at karyomit(e) 3q26, is at first found and in nineteen ninety-five clone, name by people such as U.S. scientist Wiley.TRAIL belongs to the tnf family cytokines member, be typical II type transmembrane protein, whole molecule is made up of 281 amino acid, C terminal cell exterior domain forms the substructure of homotrimer, and the N terminal amino acid is hydrophobic region and forms and to stride membrane structure, and its acceptor is divided into five kinds, and wherein R1, R2 are downright bad acceptor (necrosisreceptor), R3, R4 are for inveigling acceptor (seduction receptor), and R5 is a kind of secretion acceptor.TRAIL combines with death receptor R1, R2 will cause apoptosis, and combine with inveigling acceptor R3, R4, then can make cell escape TRAIL inductive apoptosis.
Experiment now shows that normal cell can express death receptor simultaneously and inveigle acceptor, and tumour and transformant only can be expressed death receptor or be approximately higher than the death receptor of 100 times of normal cells and be lower than the trick acceptor of 10 times of normal cells.Therefore TRAIL can induce kinds of tumor cells death specifically, and normal tissue cell is not had influence.Many experiments have confirmed that the people TRAIL energy leukemogenesis 9D cell of purifying and the human B cell quantity that Epstein-Barr virus transforms obviously reduce; In 2 hours, can induce the dna fragmentationization of people's acute leukemia Jurkat cell, 9D cell and cause necrocytosis.Same TRAIL has identical lethal effect to Burkitt ' s lymphoma B clone, acute human leukemia T clone.TRAIL strengthens according to remarkable the lethal effect comparison of human tumor cells such as Hela, U937, A549 and ME180 human cervical carcinoma cell simultaneously.In vivo, the T Lymphocyte Apoptosis that TRAIL can induced mutation, as the T cell that infects of the T cell that cancerates, HIV (HIV (human immunodeficiency virus)) etc.In sum, because TRAIL has the function of specific killing tumour cell significantly, many scientists estimate that its social benefit and economic benefit are inestimable.
Yet present TRAIL still exists the not high enough problem of avidity.In process of production, its expression amount is also very low, have only 5% (referring to Wiley SR, wait the people, 1995, " the apoptosis-induced newcomer's of TNF family evaluation and specificity analysis ", Immunity, 3 (6): 673-682).
Therefore, still press for the TRAIL that provides a kind of avidity and expression amount to make moderate progress in this area.
Summary of the invention
In order to satisfy the foregoing invention purpose, one aspect of the present invention provides a kind of isolating human tumor necrosin relative death inducing ligand mutein, and this mutain has Ser52Asn and Trp82Gln sudden change.
In a preferable example, this mutain has the aminoacid sequence shown in SEQ ID NO:1.
The present invention provides a kind of code book invention said mutation proteic dna sequence dna on the other hand.In a preferable example, this dna sequence dna has the nucleotide sequence shown in SEQ ID NO:2.
Third aspect present invention provides the expression vector that contains dna sequence dna of the present invention.
Fourth aspect present invention provides through above-mentioned expression vector transformed host cells.In a preferable example, described host cell is intestinal bacteria, Bacillus subtilus or yeast cell.
Fifth aspect present invention provides a kind of pharmaceutical composition, and this pharmaceutical composition contains the pharmaceutically above-mentioned human tumor necrosin relative death inducing ligand mutein and the pharmaceutically acceptable carrier of significant quantity.
Sixth aspect present invention provides the preparation method of human tumor necrosin relative death inducing ligand mutein of the present invention, and this method comprises:
A) provide an expression vector, the expression regulation sequence that this expression vector contains the coding proteic dna sequence dna of said mutation and links to each other with this dna sequence dna operability;
B) with the expression vector transformed host cell in the step a);
C) host cell of gained culturing step b under the proteic condition of suitable expression said mutation); With
D) the expressed mutain that goes out of separation and purification.
The avidity that the invention has the advantages that above-mentioned people TRAIL mutain is higher than natural trail protein, and its expression amount in host cell also increases.Other purpose of the present invention and advantage can be learnt by following detailed.
Detailed Description Of The Invention
The invention provides the isolating human tumor necrosin relative death inducing ligand mutein of a kind of Ser52Asn of having and Trp82Gln sudden change.Term used herein " apoptosis induction ligand related to human tumor necrosis factor albumen (TRAIL) " can be the people's trail protein with natural wild-type sequence, also can be derivative type or recombinant human trail protein, as long as do not comprise Ser52Asn and Trp82Gln sudden change in this mutant nucleotide sequence with mutant nucleotide sequence.Proteic aminoacid sequence of natural apoptosis induction ligand related to human tumor necrosis factor and encoding sequence thereof are shown in SEQ ID NO:3 and SEQ ID NO:4.
The present inventor is by discovering, be mutated into l-asparagine (Asp) and glutamine (Gln) respectively by 52 Serines (Ser) and 82 tryptophanes (Trp), proteic avidity and the expression amount in the host thereof after the sudden change are all improved greatly this protein amino acid sequence.Term used herein " Ser52Asn " and " Trp82Gln " represent that promptly 52 amino acids become Asn by Ser, and 82 amino acids become Gln by Trp.Be not wishing to be bound by theory, think that above-mentioned two place's amino acid have constituted this activity of proteins center probably, therefore, become the strong amino acid of hydrophobicity to cause this proteic avidity to improve this two places amino acid mutation.In addition, find that also the expression amount of said mutation albumen in host cell also is greatly enhanced.In a preferred embodiments of the present invention, mutain of the present invention has the aminoacid sequence shown in the SEQ ID NO:1.
Term used herein " isolating " is when being used for nucleic acid or protein, and expression nucleic acid or protein are gone up substantially and do not contained other cellular constituent relevant under native state, and it preferably is homogeneous state, but also can be do or the aqueous solution.Common available analyses chemical process of purity and homogeneity such as polyacrylamide gel electrophoresis or high performance liquid chromatography are measured.
The present invention also provides a kind of code book to invent the dna sequence dna of above-mentioned tumor necrosin relative death inducing ligand mutein.In a preferable example, described dna sequence dna has the nucleotide sequence shown in the SEQ ID NO:2, and wherein 154-156 bit base TCT and 244-246 bit base TGG have substituted base AAT and GAT in the dna sequence dna of the natural trail protein of encoding respectively in the nucleotide sequence.Certainly, those skilled in the art also can utilize the degeneracy of the genetic code of knowing in this area to obtain all other nucleotide sequences of the above-mentioned aminoacid sequence of coding.
Mutain of the present invention can be prepared by the following method.At first, provide nucleotide sequence that contains code book invention mutain and the expression vector of the expression regulation sequence that links to each other with this series of operations.
Term used herein " expression regulation sequence " is often referred to and participates in the sequence that the control nucleotide sequence is expressed.Expression regulation sequence comprises promotor and the termination signal that links to each other with target nucleotide sequence operability.They also comprise the suitably required sequence of translation of nucleotide sequence usually." operability links to each other " is meant that some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if promotor or enhanser have increased transcribing of encoding sequence, then it is that operability links to each other with encoding sequence.
The dna sequence dna of above-mentioned encoding mutant type trail protein can obtain with conventional means well known to those skilled in the art, for example, come synthetic primer to carry out the amplification of PCR method according to the dna sequence dna of disclosed people's trail protein, or use such as methods such as site-directed mutagenesis, cassette mutagenesis and polymerase chain reaction (PCR) mutagenesis and carry out mutagenesis.
Behind the dna sequence dna after having obtained to have rite-directed mutagenesis, just can it be connected in the suitable expression vector by the whole bag of tricks well known in the art.Used expression vector is a various commercially available expression vector well known by persons skilled in the art among the present invention, for example available from the expression vector of Qiagen and Promega company.
Then, the expression vector with above-mentioned acquisition transforms proper host cell.In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is intestinal bacteria, Bacillus subtilus or yeast cell.
At last, under the condition that is fit to mutain expression of the present invention, cultivate the host cell that transforms gained, obtain new mutain of the present invention with conventional separation and purification means purifying well known to those skilled in the art such as ion exchange chromatography, hydrophobic chromatography and sieve chromatographies then.
The present invention also provides a kind of pharmaceutical composition, and said composition contains the pharmaceutically mutain of the present invention and the pharmaceutically acceptable carrier of significant quantity.Term used herein " pharmaceutically acceptable " is meant that they can not produce disadvantageous, hypersensitive or other untoward reaction when molecule body and composition suitably give the animal or human." pharmaceutically acceptable carrier " used herein should be compatible with mutain of the present invention, can not reduce the effect of pharmaceutical composition with its blend under normal conditions significantly.The object lesson that can be used as some materials of pharmaceutically acceptable carrier or its component is a carbohydrate, as lactose, dextrose plus saccharose; Starch is as W-Gum and potato starch; Mierocrystalline cellulose and derivative thereof are as Xylo-Mucine, ethyl cellulose and methylcellulose gum; The tragakanta powder; Fructus Hordei Germinatus; Gelatin; Talcum; Solid lubricant is as stearic acid and Magnesium Stearate; Calcium sulfate; Vegetables oil is as peanut oil, Oleum Gossypii semen, sesame oil, sweet oil, Semen Maydis oil and theobroma oil; Polyvalent alcohol is as propylene glycol, glycerine, Sorbitol Powder, mannitol and polyoxyethylene glycol; Lalgine; Emulsifying agent is as Tween ; Wetting agent is as Sodium Lauryl Sulphate BP/USP; Tinting material; Seasonings; Tablet agent, stablizer; Antioxidant; Sanitas; Apirogen water; Deng oozing salts solution; With phosphate buffered saline buffer etc.
Pharmaceutical composition of the present invention can be made various formulations as required, and can by the doctor according to patient's kind, age, body weight and roughly factor such as disease condition, administering mode determine the useful dosage of patient is used.
Below in conjunction with embodiment the present invention is described in further detail.Yet should be appreciated that and enumerate these embodiment, and be not to be used for limiting the present invention just for an illustration.
The synthetic of embodiment 1 soluble fragments encoding gene
Sequence and complementary strand thereof shown in SEQ ID NO:2 are split into the oligonucleotide fragment that 26 length are about 83～88 base length, synthetic then.Then, utilize PCR method to obtain TRAIL solubility gene fragment, concrete operations are as follows:
(1) reaction system: each material below in 0.2 milliliter of PCR pipe, adding.
10 * PCR damping fluid, 5 microlitres
Each 1 microlitre of oligonucleotide fragment (100 nanogram(ng)s/microlitre) (every kind)
50 * dNTP mixture, 1 microlitre
50 * TaqDNA polymkeric substance, 1 microlitre
PCP-level water to 40 microlitre
Reaction volume is 50 microlitres
(2) reaction conditions
Pre-sex change: 94 ℃ 2 minutes;
Major cycle: 95 ℃ 1 minute, 60 ℃ 40 seconds, 72 ℃ 1 minute, circulate 35 times;
Extend the back: 72 ℃ 10 minutes.
Observe electrophoresis result, and gel reclaims TRAIL full-length gene fragment.(Promega company, Madison WI) upward and with American AB I automatic sequencer mensuration carry out gene sequencing to the gene fragment clone that recovery is obtained in plasmid pGEM-T Easy.Identify a right-on clone of sequence according to sequencing result, note is made TRAIL/N.
Following mutant primer is synthesized in design in addition:
5’-TGCAGGACAAATACTCTAAAAACGGTATCGCTTGCTTCCTGAAAGAAGACGACTCTTACTGGGACCCGAACGACGAAGAATCTATGAACTCTCCGTGCTGGCAGGTTAAACAGCAGCTGCGTCAGCTGGTTCG-3’(SEQ?ID?NO：5)
Mutation method adopts conventional T7 DNA polymeric membrane/Dpn I scheme of suddenling change, and detailed method of operation is seen the operation instruction of " molecular cloning laboratory manual " or Promega company.Mutation process adopts the site-directed point mutation test kit of Promega company to carry out.Identify through order-checking, obtain correct mutant clon, note is made TRAIL/M.
The structure of embodiment 2 expression vectors
The dna sequence dna of above-mentioned TRAIL/N and TRAIL/M after cutting, BamHI and HindIII enzyme is connected on the prokaryotic expression carrier pET32a (Qiagen company).
At first, cut expression plasmid pET32a with BamHI and HindIII enzyme.Each material below adding in Eppendorf tube: pET32a plasmid (3 microgram), 10 * Restriction Enzyme damping fluid (3 microlitre), BamHI and HindIII be 15 units, 1 mg/ml acetylize BSA (3 microlitre) respectively, adds water to 40 microlitre of nuclease free then.Hatched 4 hours for 37 ℃, carry out electrophoresis in contrast with the dna marker thing, gel reclaims the plasmid pET32a that enzyme is cut, and places-20 ℃ of preservations stand-by.
Then, cut the plasmid pGEM-TEasy that carries goal gene with BamHI and HindIII enzyme, downcut goal gene and reclaim with gel, method is the same.
Subsequently, ligase enzyme is cut expression plasmid pET32a and target gene fragment.Each thing below in 0.2 milliliter of PCR pipe, adding: 10 * ligase enzyme damping fluid (2 microlitre), 100mM DTT (2 microlitre), 10mM ATP (1 microlitre), the above-mentioned pET32a carrier that makes of 50 nanogram(ng)s/microlitre (2 microlitre), T4 ligase enzyme (0.2-0.4 Weise unit/microlitre, 1 microlitre), the water of the above-mentioned goal gene that makes (0.2pmol) and nuclease free, the reaction cumulative volume is 20 microlitres.Connect under 4 ℃ and spend the night.
Subsequently, the plasmid pET32a that connection is built is transformed into respectively among e. coli bl21 (DE3) and the AD494 (DE3) (Promega company).
Following mode enzyme is cut and is identified the conversion plasmid.Single expression engineering bacteria bacterium colony carries out amplification cultivation on the picking penbritin culture dish.The extracting plasmid is cut evaluation with BamHI and HindIII enzyme, and method is the same.Enzyme is cut product and is identified on 1% agarose electrophoresis, determines that tentatively TRAIL/N has 11 clones, TRAIL/M to have 8 clones to have the purpose insertion sequence.Every kind of gene chooses wherein that 2 correct clones check order, and confirms that according to sequencing result it is right-on that two kinds of genes respectively have 1 clone's insertion sequence, and note is made pTRAIL/N and pTRAIL/M respectively.
Embodiment 3 induces destination gene expression and biological activity assay thereof
A) expression of goal gene
Bacterium liquid 100 microlitres of getting correct clone pTrail/N and pTRAIL/M are inoculated into respectively in 5 milliliters of LB liquid nutrient mediums that contain penbritin (100 mcg/ml), and 37 ℃, 300rpm shaking culture to OD value reach 0.4-1.0.Add isopropylthiogalactoside (IPTG) to final concentration 1 mmole/liter.Cultivated 3 hours for 37 ℃, from every kind of culture, take out 1 milliliter and transfer in the centrifuge tube the centrifugal supernatant that goes; The cracking thalline carries out the SDS protein electrophoresis, sds polyacrylamide is dyeed the proteic expression of testing goal with Xylene Brilliant Cyanine G.
B) target protein purifying
In the LB substratum, induce this genetic expression and process ion exchange chromatography, hydrophobic chromatography and sieve chromatography purifying according to the method described above, through the ordinary method renaturation, obtain purity at the recombinant soluble human TRAIL mutain more than 92%.
C) evaluation of expression amount
As follows, utilize the ELISA method to identify expression amount.On 96 orifice plates, add the trail protein of 50 microgram purifying in every hole according to ordinary method bag quilt, add 0.1 milliliter of mouse-anti TRAIL monoclonal antibody (available from crystalline substance U.S. company) (being diluted to 1: 100 in advance) then, handle after 30 minutes under the room temperature, with PBS washing 5 times, the rabbit anti-mouse antibody (1: 5000 dilution) that adds 1 microlitre horseradish peroxidase-labeled then, 37 ℃ of incubations 30 minutes.Add DAB colour developing liquid 200 microlitres, handle the photoabsorption of on microplate reader, reading the 495nm place after 45 minutes, calculation expression amount in view of the above under the room temperature.
Found that its expression amount up to more than 30% of thalline soluble proteins, than Wiley SR, waits the people, 1995, " the apoptosis-induced newcomer's of TNF family evaluation and specificity analysis ", Immunity, 3 (6): the expression amount of reporting among the 673-682 (5%) exceeds at least 6 times.
D) the active detection
In the present embodiment, used TRAIL survey viable cell strain is the Jarket cell to the TRAIL sensitivity with self duplication ability.Every hole adds 1 * 10 on 96 orifice plates
6Cell, substratum are FCS RPMI-1640.Add above-mentioned recombinant human trail protein to 200 millimicro grams per milliliter in every hole, carry out following detection sampling in the 2nd, 4,6,8,10 and 12 hour then:
1) cell counting.Take out 0.2 milliliter and carry out cell counting from above-mentioned sample, the result represents with survivaling cell percentage ratio, the results are shown in the following table 1.
Table 1
| Sample time (hour) | ??0 | ?2 | ?4 | ?6 | ?8 | ?10 | ?12 |
| ??TRAIL/N | ??100.0 | ?81.4 | ?72.1 | ?54.3 | ?41.6 | ?33.7 | ?25.6 |
| ??TRAIL/M | ??99.7 | ?80.1 | ?43.6 | ?22.7 | ?10.9 | ?0.0 | ?0.0 |
As can be seen from Table 1, TRAIL has the effect that significantly kills and wounds the Jarket cell, and the TRAIL of sudden change has stronger lethality than natural product.This explanation sudden change has obviously caused the raising of product avidity.
2) dna fragmentation detects.Take out 0.5 ml sample extracting DNA, and to add 10% (volume) concentration be the MTT of 5 mg/ml, on 2% agarose gel electrophoresis, detect.Found that obvious fragmentation takes place its DNA, most of dna molecular concentrates on 3～5kb magnitude range in the sample that natural type TRAIL handles, and most of dna molecular concentrates in the scope of 2～4.5kb in the sample that mutant is handled.(dna molecular mainly concentrates on 20～22kb) and compares, and two kinds of processing have all caused the obvious reduction of dna molecular amount with the contrast of handling without TRAIL.The The above results explanation, after the TRAIL processing, tangible dna fragmentationization can take place in the Jarket cell.The dna molecular weight range that mutant TRAIL handles gained is lower than the dna molecular weight range of natural type processing gained, illustrates that the effect of mutant is more strong.
3) MTT detects.0.2 milliliter in the cell that natural type TRAIL and mutant TRAIL handle of learning from else's experience, the concentration that adds 1/10 volume is the MTT solution of 5 mg/ml, cultivates the photoabsorption of reading the 570nm place after 30 minutes on microplate reader for 37 ℃.Found that the photoabsorption of the cell that process TRAIL handles is starkly lower than the photoabsorption of undressed contrast.After 8 hours, the reading of handling through natural type TRAIL has only 30.6% of contrast; And the ratio of handling through mutant TRAIL through natural type TRAIL handle lower, the reading after 8 hours has only 11.1% of contrast.This illustrates that the avidity of TRAIL mutain of the present invention has greatly and improves, thereby makes on the optics reading lower.
Although the invention describes concrete example, having a bit is significantly to those skilled in the art, promptly can do various variations and change to the present invention under the premise without departing from the spirit and scope of the present invention.Therefore, claims have covered all these changes within the scope of the present invention.
Sequence table＜110〉Lansheng Guojian Pharmaceutic Ind. Co., Ltd., Shanghai＜120〉human tumor necrosin relative death inducing ligand mutein, its method for making and pharmaceutical composition＜130 thereof〉016016＜160〉5＜170〉PatentIn version 3.0＜210〉1＜211〉281＜212〉PRT＜213〉homo sapiens (Homo sapiens)＜400〉1Met Ala Met Met Glu Val Gln Gly Gly Pro Ser Leu Gly Gln Thr Cys1,5 10 15Val Leu Ile Val Ile Phe Thr Val Leu Leu Gln Ser Leu Cys Val Ala
20??????????????????25??????????????????30Val?Thr?Tyr?Val?Tyr?Phe?Thr?Asn?Glu?Leu?Lys?Gln?Met?Gln?Asp?Lys
35??????????????????40??????????????????45Tyr?Ser?Lys?Asn?Gly?Ile?Ala?Cys?Phe?Leu?Lys?Glu?Asp?Asp?Ser?Tyr
50??????????????????55??????????????????60Trp?Asp?Pro?Asn?Asp?Glu?Glu?Ser?Met?Asn?Ser?Pro?Cys?Trp?Gln?Val65??????????????????70??????????????????75??????????????????80Lys?Gln?Gln?Leu?Arg?Gln?Leu?Val?Arg?Lys?Met?Ile?Leu?Arg?Thr?Ser
85??????????????????90??????????????????95Glu?Glu?Thr?Ile?Ser?Thr?Val?Gln?Glu?Lys?Gln?Gln?Asn?Ile?Ser?Pro
100?????????????????105?????????????????110Leu?Val?Arg?Glu?Arg?Gly?Pro?Gln?Arg?Val?Ala?Ala?His?Ile?Thr?Gly
115?????????????????120?????????????????125Thr?Arg?Gly?Arg?Ser?Asn?Thr?Leu?Ser?Ser?Pro?Asn?Ser?Lys?Asn?Glu
130?????????????????135?????????????????140Lys?Ala?Leu?Gly?Arg?Lys?Ile?Asn?Ser?Trp?Glu?Ser?Ser?Arg?Ser?Gly145?????????????????150?????????????????155?????????????????160His?Ser?Phe?Leu?Ser?Asn?Leu?His?Leu?Arg?Asn?Gly?Glu?Leu?Val?Ile
165?????????????????170?????????????????175His?Glu?Lys?Gly?Phe?Tyr?Tyr?Ile?Tyr?Ser?Gln?Thr?Tyr?Phe?Arg?Phe
180?????????????????185?????????????????190Gln?Glu?Glu?Ile?Lys?Glu?Asn?Thr?Lys?Asn?Asp?Lys?Gln?Met?Val?Gln
195?????????????????200?????????????????205Tyr?Ile?Tyr?Lys?Tyr?Thr?Ser?Tyr?Pro?Asp?Pro?Ile?Leu?Leu?Met?Lys
210?????????????????215?????????????????220Ser?Ala?Arg?Asn?Ser?Cys?Trp?Ser?Lys?Asp?Ala?Glu?Tyr?Gly?Leu?Tyr225?????????????????230?????????????????235?????????????????240Ser?Ile?Tyr?Gln?Gly?Gly?Ile?Phe?Glu?Leu?Lys?Glu?Asn?Asp?Arg?Ile
245?????????????????250?????????????????255Phe?Val?Ser?Val?Thr?Asn?Glu?His?Leu?Ile?Asp?Met?Asp?His?Glu?Ala
260?????????????????265?????????????????270Ser?Phe?Phe?Gly?Ala?Phe?Leu?Val?Gly
275 280＜210〉2＜211〉846＜212〉DNA＜213〉 ( Homo sapiens )＜400〉2atggctatga tggaagttca gggtggtccg tctctgggtc agacctgcgt tctgatcgtt 60atcttcaccg ttctgctgca gtctctgtgc gttgctgtta cctacgttta cttcaccaac 120gaactgaaac agatgcagga caaatactct aaatctggta tcgcttgctt cctgaaagaa 180gacgactctt actgggaccc gaacgacgaa gaatctatga actctccgtg ctggcaggtt 240aaatggcagc tgcgtcagct ggttcgtaaa atgatcctgc gtacctctga agaaaccatc 300tctaccgttc aggaaaaaca gcagaacatc tctccgctgg ttcgtgaacg tggtccgcag 360cgtgttgctg ctcacatcac cggtacccgt ggtcgttcta acaccctgtc ttctccgaac 420tctaaaaacg aaaaagctct gggtcgtaaa atcaactctt gggaatcttc tcgttctggt 480cactctttcc tgtctaacct gcacctgcgt aacggtgaac tggttatcca cgaaaaaggt 540ttctactaca tctactctca gacctacttc cgtttccagg aagaaatcaa agaaaacacc 600aaaaacgaca aacagatggt tcagtacatc tacaaataca cctcttaccc ggacccgatc 660ctgctgatga aatctgctcg taactcttgc tggtctaaag acgctgaata cggtctgtac 720tctatctacc agggtggtat cttcgaactg aaagaaaacg accgtatctt cgtttctgtt 780accaacgaac acctgatcga catggaccac gaagcttctt tcttcggtgc tttcctggtt 840ggttag 846＜210〉3＜211〉281＜212〉PRT＜213〉 ( Homo sapiens )＜400〉3Met Ala Met Met Glu Val Gln Gly Gly Pro Ser Leu Gly Gln Thr Cys1 5 10 15Val Leu Ile Val Ile Phe Thr Val Leu Leu Gln Ser Leu Cys Val Ala
20??????????????????25??????????????????30Val?Thr?Tyr?Val?Tyr?Phe?Thr?Asn?Glu?Leu?Lys?Gln?Met?Gln?Asp?Lys
35??????????????????40??????????????????45Tyr?Ser?Lys?Ser?Gly?Ile?Ala?Cys?Phe?Leu?Lys?Glu?Asp?Asp?Ser?Tyr
50??????????????????55??????????????????60Trp?Asp?Pro?Asn?Asp?Glu?Glu?Ser?Met?Asn?Ser?Pro?Cys?Trp?Gln?Val65??????????????????70??????????????????75??????????????????80Lys?Trp?Gln?Leu?Arg?Gln?Leu?Val?Arg?Lys?Met?Ile?Leu?Arg?Thr?Ser
85??????????????????90??????????????????95Glu?Glu?Thr?Ile?Ser?Thr?Val?Gln?Glu?Lys?Gln?Gln?Asn?Ile?Ser?Pro
100?????????????????105?????????????????110Leu?Val?Arg?Glu?Arg?Gly?Pro?Gln?Arg?Val?Ala?Ala?His?Ile?Thr?Gly
115?????????????????120?????????????????125Thr?Arg?Gly?Arg?Ser?Asn?Thr?Leu?Ser?Ser?Pro?Asn?Ser?Lys?Asn?Glu
130?????????????????135?????????????????140Lys?Ala?Leu?Gly?Arg?Lys?Ile?Asn?Ser?Trp?Glu?Ser?Ser?Arg?Ser?Gly145?????????????????150?????????????????155?????????????????160His?Ser?Phe?Leu?Ser?Asn?Leu?His?Leu?Arg?Asn?Gly?Glu?Leu?Val?Ile
165?????????????????170?????????????????175His?Glu?Lys?Gly?Phe?Tyr?Tyr?Ile?Tyr?Ser?Gln?Thr?Tyr?Phe?Arg?Phe
180?????????????????185?????????????????190Gln?Glu?Glu?Ile?Lys?Glu?Asn?Thr?Lys?Asn?Asp?Lys?Gln?Met?Val?Gln
195?????????????????200?????????????????205Tyr?IIe?Tyr?Lys?Tyr?Thr?Ser?Tyr?Pro?Asp?Pro?Ile?Leu?Leu?Met?Lys
210?????????????????215?????????????????220Ser?Ala?Arg?Asn?Ser?Cys?Trp?Ser?Lys?Asp?Ala?Glu?Tyr?Gly?Leu?Tyr225?????????????????230?????????????????235?????????????????240Ser?Ile?Tyr?Gln?Gly?Gly?Ile?Phe?Glu?Leu?Lys?Glu?Asn?Asp?Arg?Ile
245?????????????????250?????????????????255Phe?Val?Ser?Val?Thr?Asn?Glu?His?Leu?Ile?Asp?Met?Asp?His?Glu?Ala
260?????????????????265?????????????????270Ser?Phe?Phe?Gly?Ala?Phe?Leu?Val?Gly
275 280＜210〉4＜211〉846＜212〉DNA＜213〉 ( Homo sapiens )＜400〉4atggctatga tggaagttca gggtggtccg tctctgggtc agacctgcgt tctgatcgtt 60atcttcaccg ttctgctgca gtctctgtgc gttgctgtta cctacgttta cttcaccaac 120gaactgaaac agatgcagga caaatactct aaaaatggta tcgcttgctt cctgaaagaa 180gacgactctt actgggaccc gaacgacgaa gaatctatga actctccgtg ctggcaggtt 240aaagatcagc tgcgtcagct ggttcgtaaa atgatcctgc gtacctctga agaaaccatc 300tctaccgttc aggaaaaaca gcagaacatc tctccgctgg ttcgtgaacg tggtccgcag 360cgtgttgctg ctcacatcac cggtacccgt ggtcgttcta acaccctgtc ttctccgaac 420tctaaaaacg aaaaagctct gggtcgtaaa atcaactctt gggaatcttc tcgttctggt 480cactctttcc tgtctaacct gcacctgcgt aacggtgaac tggttatcca cgaaaaaggt 540ttctactaca tctactctca gacctacttc cgtttccagg aagaaatcaa agaaaacacc 600aaaaacgaca aacagatggt tcagtacatc tacaaataca cctcttaccc ggacccgatc 660ctgctgatga aatctgctcg taactcttgc tggtctaaag acgctgaata cggtctgtac 720tctatctacc agggtggtat cttcgaactg aaagaaaacg accgtatctt cgtttctgtt 780accaacgaac acctgatcga catggaccac gaagcttctt tcttcggtgc tttcctggtt 840ggttag 846＜210〉5＜211〉133＜212〉DNA＜213〉＜400〉5tgcaggacaa atactctaaa aacggtatcg cttgcttcct gaaagaagac gactcttact 60gggacccgaa cgacgaagaa tctatgaact ctccgtgctg gcaggttaaa cagcagctgc 120gtcagctggt tcg 133
Claims (10)
1. an isolating human tumor necrosin relative death inducing ligand mutein is characterized in that, it contains Ser52Asn and Trp82Gln sudden change.
2. mutain according to claim 1 is characterized in that described mutain has the aminoacid sequence shown in the SEQ IDNO:1.
3. a separated DNA sequence is characterized in that, the described human tumor necrosin relative death inducing ligand mutein of its coding claim 1.
4. separated DNA sequence according to claim 3 is characterized in that, it has the nucleotide sequence shown in the SEQ ID NO:2.
5. an expression vector is characterized in that, it contains the described dna sequence dna of claim 3.
6. a host cell is characterized in that, it is transformed by the described expression vector of claim 5.
7. host cell according to claim 6 is characterized in that, described host cell is intestinal bacteria, Bacillus subtilus or yeast cell.
8. a pharmaceutical composition is characterized in that, it contains the pharmaceutically described human tumor necrosin relative death inducing ligand mutein of claim 1 and the pharmaceutically acceptable carrier of significant quantity.
9. a method for preparing the described human tumor necrosin relative death inducing ligand mutein of claim 1 is characterized in that, this method comprises:
A) provide an expression vector, this expression vector contains the dna sequence dna of the described human tumor necrosin relative death inducing ligand mutein of coding claim 1 and the expression regulation sequence that links to each other with this dna sequence dna operability;
B) with the expression vector transformed host cell in the step a);
C) host cell of gained culturing step b under the condition that is fit to the described mutain of expression); With
D) separation and purification obtains the expressed mutain that goes out.
10. method according to claim 9 is characterized in that, described dna sequence dna has the nucleotide sequence shown in the SEQ ID NO:2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB01132158XA CN1184232C (en) | 2001-11-09 | 2001-11-09 | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB01132158XA CN1184232C (en) | 2001-11-09 | 2001-11-09 | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1417229A true CN1417229A (en) | 2003-05-14 |
| CN1184232C CN1184232C (en) | 2005-01-12 |
Family
ID=4671198
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB01132158XA Expired - Lifetime CN1184232C (en) | 2001-11-09 | 2001-11-09 | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1184232C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102370987A (en) * | 2010-08-26 | 2012-03-14 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| CN104761631A (en) * | 2015-04-15 | 2015-07-08 | 中国药科大学 | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha |
| CN105461801A (en) * | 2015-11-09 | 2016-04-06 | 中国药科大学 | High-activity mutant of TRAIL (TNF (tumor necrosis factor)-related apoptosis-inducing ligand) |
| CN110551205A (en) * | 2018-06-01 | 2019-12-10 | 云南大学 | mutant of soluble human tumor necrosis factor apoptosis-related inducing ligand and preparation method and application thereof |
-
2001
- 2001-11-09 CN CNB01132158XA patent/CN1184232C/en not_active Expired - Lifetime
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102370987A (en) * | 2010-08-26 | 2012-03-14 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| CN102370987B (en) * | 2010-08-26 | 2013-05-29 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| CN104761631A (en) * | 2015-04-15 | 2015-07-08 | 中国药科大学 | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha |
| CN105461801A (en) * | 2015-11-09 | 2016-04-06 | 中国药科大学 | High-activity mutant of TRAIL (TNF (tumor necrosis factor)-related apoptosis-inducing ligand) |
| CN105461801B (en) * | 2015-11-09 | 2019-03-05 | 中国药科大学 | The mutant of high activity tumor necrosin relative death inducing ligand |
| CN110551205A (en) * | 2018-06-01 | 2019-12-10 | 云南大学 | mutant of soluble human tumor necrosis factor apoptosis-related inducing ligand and preparation method and application thereof |
| CN110551205B (en) * | 2018-06-01 | 2023-07-28 | 云南大学 | Mutant of soluble human tumor necrosis factor apoptosis related inducing ligand, preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1184232C (en) | 2005-01-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1037844C (en) | Tnf-muteins | |
| JP2561255B2 (en) | Recombinant colony-stimulating factor ▲ below- ▼ 1 | |
| EP0192811A1 (en) | Cysteine-depleted muteins of biologically active proteins, their preparation, formulations containing them, and structural genes, vectors and organisms, and their production, suitable for use in the preparation of said muteins | |
| JP3009381B2 (en) | Mature human interleukin 1 | |
| CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
| JPH057996B2 (en) | ||
| CN108840952A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α | |
| CN108840946A (en) | Dog albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of dog long-acting interferon | |
| CN108794638A (en) | A kind of recombinant bovine long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon | |
| CN1417229A (en) | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition | |
| CN108840945A (en) | Pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a boar long-acting interferon | |
| CN107353347A (en) | A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof | |
| CN1810830A (en) | HIV-1 yesisting polypeptide C22, its coding sequence and prepn process | |
| CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
| CN108794645A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and Bov IFN α | |
| CN108864302A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 | |
| CN108864295A (en) | A kind of recombinant bovine long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
| CN108822221A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and recombinant chIL-2 | |
| CN107245110A (en) | A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interferon-tau and preparation method thereof | |
| CN108864298A (en) | A kind of canine recombinant long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
| CN1185261C (en) | Interleukin -2/granulocyte-macrophage colony stimulating factor fusion protein | |
| CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
| CN109053897A (en) | A kind of fusion protein and preparation method thereof being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α | |
| CN108864301A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and cattle interleukins-2 2 | |
| CN1445239A (en) | Mutain of human stem cell growth fcator as well as its preparing method and medicine combination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee after: Shanghai CP Guojian Pharmaceutical Co., Ltd. Address before: Pudong road 200120 Shanghai city Shanghai Stock Exchange Building No. 528 North Tower room 2304 Patentee before: Zhongxin Guojian Pharmaceutical Co., Ltd., Shanghai |
|
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee after: Three country Kin Pharmaceutical (Shanghai) Limited by Share Ltd Address before: Shanghai city 201203 libing road Zhangjiang High Tech Park No. 399 Patentee before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |
|
| CX01 | Expiry of patent term |
Granted publication date: 20050112 |
|
| CX01 | Expiry of patent term |