CN104761631A - P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha - Google Patents
P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha Download PDFInfo
- Publication number
- CN104761631A CN104761631A CN201510184139.0A CN201510184139A CN104761631A CN 104761631 A CN104761631 A CN 104761631A CN 201510184139 A CN201510184139 A CN 201510184139A CN 104761631 A CN104761631 A CN 104761631A
- Authority
- CN
- China
- Prior art keywords
- htnf
- alpha
- phe
- pno
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a human tumor necrosis factor-alpha (hTNF-alpha) mutant protein, and discloses the characteristic of generating or enhancing the immune response aiming at TNF-alpha molecules in an organism. With a genetic code expansion technology, a non-natural amino acid p-nitrophenylalanine (pNO2Phe) is introduced to the 11 and/or 87 locus in hTNF-alpha, such that hTNF-alpha mutant protein is obtained. Through immunizing animals, the mutant protein can stimulate an organism to produce cross antibodies to react with the disease-related natural inflammatory factor TNF-alpha, such that the immune tolerance of hTNF-alpha as an autologous protein vaccine is broken through. Compared with prototype hTNF-alpha and a single-locus mutant, the immunogenicity of the two-locus mutant protein is enhanced. The mutant protein can be used as a candidate molecule for treating autoimmune diseases.
Description
Technical field
The invention belongs to bio-pharmaceuticals and field of immunology, relate to a kind of preparation of the hTNF-alpha-mutant albumen containing alpha-non-natural amino acid p-nitrophenyl L-Ala, this albumen can break autoimmune tolerance, strengthen the immunogenicity of hTNF-α, stimulate body to produce cross-reacting antibody, become the candidate vaccine molecule for the treatment of autoimmune disease.
Background technology
TNF-α is a kind of cytokine with complex biological activity.But when TNF-α overexpression, pathology damage can be caused together with other inflammatory factor, as autoimmune disorder, cachexy and infectious diseases etc.Therefore, above-mentioned disease can be treated with the TNF-α of overexpression in body in.The TNF-alpha-2 antagonists used clinically at present has TNF-alpha monoclonal antibodies and TNF-α soluble receptors, but these medicines exist dosage greatly, easily causes allergy and need the defects such as prolonged and repeated use.Vaccine only needs a small amount of injection just can bring out generation antibody, can overcome above-mentioned defect, and therefore TNF-α vaccine is the potential approach of this type of disease for the treatment of.TNF-α is autologous protein, there is autoimmune tolerance phenomenon, is difficult to the formation bringing out corresponding antibodies.Therefore, how to break through immunological tolerance, inducing immune system produces the antibody for TNF-α, is vaccine design and problem demanding prompt solution in exploitation.
At present, autovaccine mainly contains three classes for the strategy breaking through immunological tolerance in building.Amalgamation protein vaccine: this type of vaccine is by the albumen of general for external source Th epi-position or energy activating immune system and antigen molecule amalgamation and expression being formed.The key that Vaccine molecules builds is: the reasonable construction of fusion protein molecule and purifying, can keep rational space conformation to make it; There is the advantage that production process is easy, cost is low.Albumen coupling vaccine: by the antigen changing structure or the epitope filtered out and carrier protein couplet, albumen coupling vaccine can be built.This type of vaccine is without the need to immunological adjuvant, and a carrier molecule can connect multiple epitope.The carrier molecule of coupling conventional at present has keyhole limpet hemocyanin (keyhole limpethemocyanin, KLH), bovine serum albumin (bovine serus albumin, BSA), virus-like particle (Virus like particles, VLPs) and Toxoid,tetanus etc.Nucleic acid vaccine: the cytokine DNA carrying antigen gene can be absorbed by body cell, express corresponding antigen protein subsequently, these albumen are offered to CD8+T cell or CD4+T cell, inducing cellular immune or humoral immunization through MHC-I or MHC-II quasi-molecule approach by APC.
Large quantity research confirms, introduced by the method for chemically modified and have immunogenic chemical group, effectively can break through the immunological tolerance of autologous protein, induction body produces immune response.Pi system due to electron deficiency is tending towards Tyr and the Trp side chain common with antagonist binding site and interacts, and nitroaryl can be used as high immunogenicity haptens.
Application genetic code extended technology can to fixedpoint introduction of non-natural amino acid in protein.This technology comprises three key ingredients: (1) orthogonality aminoacyl-tRNA/RS; (2) orthogonality tRNA; (3) containing the mRNA of the sub-UAG of special password.TRNA loads alpha-non-natural amino acid under the katalysis of orthogonality aminoacyl-tRNA synthetase, identifies the sub-UAG of special password, makes alpha-non-natural amino acid be inserted into this site.This technology achieves the pointed decoration of protein, to reach the object changing its biochemical property and pharmacological action.
The mTNF-α that the people such as Grunewald prepare in US8318172B2 or hTNF-alpha-mutant albumen, successfully produce or enhance the immunogenicity of TNF-α.These mutains are the mutant that Single locus introduces p-nitrophenyl L-Ala, the present invention on this basis, further improve hTNF-alpha-mutant, realize the preparation that the hTNF-α of p-nitrophenyl L-Ala is introduced in two sites simultaneously, pass through immune animal, this mutant protein can stimulate body to produce cross-reacting antibody, with disease-related natural inflammatory factor TNF-α, immune response occurs, thus breaks the immunological tolerance of hTNF-α as a kind of autologous protein vaccine.Compare with single-point mutants with prototype hTNF-α, its immunogenicity strengthens all to some extent.This mutant protein can as the candidate molecules for the treatment of autoimmune disease.
Summary of the invention
The present invention selects TNF-α to be target molecule, build and have expressed a kind of hTNF-alpha-mutant of similar with it, the unnatural immunogen of meaning, it can as vaccine in passive immunization, body is stimulated to produce a kind of TNF-α cross-reacting antibody, thus be combined with target molecule TNF-α, immune response occurs, and the treatment for autoimmune disorder provides new selection.
The first problem that the present invention solves is by codon-optimization techniques, and designing and build can at the hTNF-α not comprising signal peptide of E. coli and mutant gene thereof, and mutant comprises: a pNO
2phe
11-hTNF-α, b pNO
2phe
87-hTNF-α, cpNO
2phe
11,87-hTNF-α, is connected to prokaryotic expression carrier pBAD/Myc-His A, obtains hTNF-α and mutant expression plasmid thereof.
The Second Problem that the present invention solves is by mutant hTNF-alpha expression plasmid and orthogonality pNO
2phe-tRNA/RS translation system corotation dissolves expressive host bacterium DH10B.
The 3rd problem that the present invention solves utilizes genetic code extended technology, realizes fixedpoint introduction of non-natural amino acid.By the expression plasmid containing mutant hTNF-α and pNO
2dH10B bacterial strain enlarged culturing in M9 substratum of Phe-tRNA/RS translation system, add or do not add alpha-non-natural amino acid p-nitrophenyl L-Ala, after L-arabinose abduction delivering 20h, collecting thalline, carrying out ultrasonic bacteria breaking supernatant liquor through Ni column purification, and is identified by SDS-PAGE and WB.
The four problems that the present invention solves is that unnatural immunogen hTNF-alpha-mutant is administered to experimental subjects mouse, stimulates the antibody produced for unnatural immunogen, and two Point mutonts produce antibody titers higher than single-point mutants or prototype hTNF-α.
Accompanying drawing explanation
Fig. 1 prototype hTNF-α gene Overlap-PCR result
M：250bp DNA Ladder；
1: prototype hTNF-α gene Overlap-PCR
Fig. 2 prototype hTNF-α double digestion electrophoresis result
M：250bp DNA Ladder；
1: prototype hTNF-α gene double digestion (Nco I and BamH I)
Fig. 3 pBAD/Myc-His A double digestion electrophoresis result
1:pBAD/Myc-His A plasmid;
2:pBAD/Myc-His A double digestion result;
M： 250bp DNA Ladder
Fig. 4 pNO
2phe
11-hTNF-α point mutation result
M： 250bp DNA Ladder；
1:pNO
2phe
11-hTNF-α point mutation plasmid PCR increases
Fig. 5 pNO
2phe
87-hTNF-α point mutation result
M： 250bp DNA Ladder；
1:pNO
2phe
87-hTNF-α point mutation plasmid PCR increases
Fig. 6 pNO
2phe
11,87-hTNF-α point mutation result
1:pNO
2phe
11,87-hTNF-α point mutation plasmid PCR increases;
M： 250bp DNA Ladder
Fig. 7 hTNF-alpha-mutant expresses Western Blot figure
1:pNO
2phe
11-hTNF-α does not add inductor;
2:pNO
2phe
11-hTNF-α abduction delivering sample;
3:pNO
2phe
11,87-hTNF-α does not add inductor;
4:pNO
2phe
11,87-hTNF-α abduction delivering sample;
M: molecular weight of albumen pre-dyed Marker
SDS-PAGE figure after Fig. 8 hTNF-alpha-mutant purifying
M: molecular weight of albumen Marker;
1:pNO
2phe
87result after-hTNF-α purifying;
2:pNO
2phe
11,87result after-hTNF-α purifying
Embodiment
Set forth the present invention further below in conjunction with embodiment, these embodiments are only for illustration of the present invention instead of limitation of the present invention.
A huge challenge of Immunology Today finds a kind of method to carry out the strong immune response of selective induction for autologous protein, or strengthen the immunogenicity of exogenous antigen specific epitopes, thus produce neutralizing antibody.For this problem, some strategies add adjuvant, introduces external source and assist peptide or use DNA vaccination in chimeric antigen.Although the antigen height heterogeneity that these earlier trials produce, the immunogen epi-position of chemically modified really can the cross reaction of induced high titers.Further, T cell tolerance can break by B cell autoimmunity, namely by exogenous antigen generation cross-immune reaction.
Compared to the chemical method modified protein of non-selectivity, genetic code extended technology can highly precisely be modified protein specific site.The wherein derivative p-nitrophenyl L-Ala of phenylalanine, can utilize amber to suppress codon high-fidelity to introduce the albumen specific site of expression in escherichia coli efficiently.Nitryl group was once used as the haptens of high immunogenicity, because it has electron deficiency π system thus interacts with Tyr and Trp side chain, and this two seed amino acid normally antibody combining site.Just because of this, Phe or Tyr of protein is sported pNO by our guess
2phe, may cause immune response, thus with autologous protein generation cross reaction.
We select hTNF-α main because following reason: 1.TNF-α is the cytokine of a kind of typical participation infection, inflammation, autoimmune phenomena; 2. the biological characteristic research of this albumen is more deep, comprises expression, structure, function and signal transduction mechanism.
87 Tyr are the sites of a high conservative in different Mammals TNF-α, and the sudden change in this site does not affect for the formation of protein folding and tertiary structure, and significantly can reduce cytotoxicity.
In this example, alpha-non-natural amino acid pNO
2phe is fixed a point to introduce in hTNF-α, substitutes original Tyr87.With this mutain immune mouse, result creates the neutralizing antibody of higher titre, and it with wild-type TNF-α, cross reaction can occur.These results show, containing specific groups NO
2autologous protein, as a kind of molecule of high immunogenicity, by immune system recognition.Owing to containing NO
2albumen and the native protein of group have highly similar structure, and the antibody that after modifying, albumen produces also can with corresponding autologous protein generation cross reaction.Therefore this strategy provides new thinking for the immunological tolerance breaking autologous protein and vaccine.
The structure of embodiment one: hTNF-α and mutant expression plasmid thereof
1) structure of prototype hTNF-α gene
The design of Overlap PCR primer is as follows:
1 AGCATGCCATGGTGCGTAGCAG 22
2 CGACAACATGCGCCACCGGCTAATCCGACGGGGTACGCGAGCTGCTACGCACCATGGC 58
3 GGTGGCGCATGTTGTCGCGAATCCGCAAGCGGAAGGCCAACTTCAGTGGCTGAATCGT 58
4 CGCAGTTCCACGCCATTCGCCAGCAGCGCATTCGCACGACGATTCAGCCACTGAAGTT 58
5 AATGGCGTGGAACTGCGTGATAATCAGCTGGTGGTGCCGTCTGAAGGCCTGTATCTGA 58
6 TGGACAGCCCTGACCTTTGAACAGCACCTGGCTATAAATCAGATACAGGCCTTCAGAC 58
7 AAAGGTCAGGGCTGTCCAAGTACCCATGTGCTGCTGACCCATACCATTAGTCGTATTG 58
8 GCTAAGCAGATTCACTTTGGTCTGCTAGCTCACCGCAATACGACTAATGGTATGGGTC 58
9 GACCAAAGTGAATCTGCTTAGCGCGATTAAAAGCCCGTGCCAGCGTGAAACCCCGGAA 58
10 CCAAGATAAATCGGTTCATACCACGGTTTCGCTTCCGCACCTTCCGGGGTTTCACGCT 58
11 TGGTATGAACCGATTTATCTTGGCGGCGTGTTTCAGTTGGAAAAAGGCGATCGTTTGA 58
12 CGCAAAATCCAGATAATCCGGACGATTGATTTCTGCGCTCAAACGATCGCCTTTTTCC 58
13 CCGGATTATCTGGATTTTGCGGAAAGCGGCCAGGTCTATTTCGGCATTATTGCGCTGT 58
14 TGACGCGGATCCTGTTACAGCGCAATAATGCCGA 34
First round PCR system: in table 1.
Table 1 first round PCR system
With first round PCR primer for template, carry out second and take turns PCR, reaction system is in table 2.
PCR system taken turns by table 2 second
Condition:
PCR primer is cut glue through agarose gel electrophoresis and is reclaimed purifying, for subsequent use.
Goal gene and pBAD/Myc-His A carrier double digestion, reaction system is in table 3.
Endonuclease reaction condition: 37 DEG C, more than 4h.
Table 3 enzyme cuts system
Digestion products connects, and reaction system is in table 4.
Ligation condition: 16 DEG C, reaction is spent the night.
Table 4 linked system
Get full dose connexon Transformed E .coli DH5 α competence; Converted product coating amicillin resistance is dull and stereotyped, 37 DEG C of quiescent culture; Screening positive clone carries out order-checking qualification (Nanjing Genscript Biotechnology Co., Ltd.), and correct plasmid is designated as hTNF-α-pBAD.His6-tag label is inserted in Nco I site to this recombinant vectors, facilitates follow-up purification process.
2) pNO
2phe
11the structure of-hTNF-α gene
Utilize point mutation test kit Mut Express
tM11 of hTNF-α corresponding codon mutations of Lys, with hTNF-α-pBAD for template, are TAG, for introducing p-nitrophenyl L-Ala by II Fast Mutagenesis Kit.Mutant primer design is as follows:
hTNF11-s：5'-ATtagCCGGTGGCGCATGTTGTC-3’
hTNF11-a：5'-ATGCGCCACCGGctaATCCGACGGGGTACGCGA-3’
3) pNO
2phe
87the structure of-hTNF-α gene
Utilize point mutation test kit Mut Express
tM87 of hTNF-α corresponding codon mutations of Tyr, with hTNF-α-pBAD for template, are TAG, for introducing p-nitrophenyl L-Ala by II Fast Mutagenesis Kit.Mutant primer design is as follows:
hTNF87-s：5'-TGCGGTGAGCtagCAGACCAAAGTGAATCTGCTTAGCG-3’
hTNF87-a：5'-ACTTTGGTCTGctaGCTCACCGCAATACGACTAATGGTA-3’
4) pNO
2phe
11,87the structure of-hTNF-α gene
Utilize point mutation test kit Mut Express
tMiI Fast Mutagenesis Kit, with pNO
2phe
11-hTNF-α-pBAD is template, is TAG, for introducing p-nitrophenyl L-Ala by its 87 corresponding codon mutations of Tyr.The same hTNF87-s/a of mutant primer.
The expression of embodiment two: hTNF-α and mutant thereof
1) containing the acquisition of the bacterial classification of hTNF-alpha-mutant expression plasmid.
By pNO
2phe
11-hTNF-α, pNO
2phe
87-hTNF-α and pNO
2phe
11,87-hTNF-alpha expression plasmid (amicillin resistance) respectively with pNO
2phe-tRNA/RS plasmid (chlorampenicol resistant) corotation dissolves in E.coli DH10B competent cell, and coating penbritin and the Double flat board of paraxin, with screening positive clone.
2) expression of hTNF-alpha-mutant.
The seed liquor of the above-mentioned bacterial classification of incubated overnight in LB substratum, spreads cultivation to by 1: 100 and add alpha-non-natural amino acid pNO next day
2m9 substratum (the Na of Phe
2hPO
4h
2o 0.35% (w/v), KH
2pO
40.34% (w/v), NH
4cl0.27% (w/v), Na
2sO
40.07% (w/v), glycerol1.5% (v/v), sodium succinate 0.57% (w/v), 0.1M CaCl
2solution 0.1% (v/v), 0.2M MgSO
4solution 0.5% (v/v)) in, work as OD
600when reaching 0.6, sample for subsequent use, and add the L-arabinose abduction delivering that final concentration is 10mM, then 37 DEG C are continued to cultivate 20h, sampling.8000rpm, 10min collected by centrifugation bacterial sediment ,-20 DEG C of preservations.
3) detection of hTNF-alpha-mutant expression.
Aforementioned institute sample thief detects protein expression situation by Western Blot, and primary antibodie is little mouse-anti His monoclonal antibody, and two resist the goat anti-mouse monoclonal antibody for horseradish peroxidase HRP marks, and result is as Fig. 7.
The purifying of embodiment three: hTNF-α and mutant thereof
1) sample pretreatment.
Gained bacterial sediment adds Ni-NTA binding buffer liquid (20mM Tris-HCl in the ratio of 1: 10 (m/v), 0.5M NaCl, 10mMimidazole, pH 8.0) resuspended, utilize ultrasonic cell disruption instrument (NingBo XinZhi Biology Science Co., Ltd) to break bacterium, ultrasound condition is power 60%, total time 15min, 3 times, each 5s, interval 5s.Carry out 12000rpm, 30min collected by centrifugation supernatant liquor after broken bacterium, and use 0.45 μm of membrane filtration.
2) affinity column Ni Sepharose 6Fast Flow purifying.
Ni post is in advance by binding buffer liquid balance, after loading, use the unconjugated foreign protein of binding buffer liquid wash-out of 10 times of column volumes successively, the foreign protein of wash buffer (the binding buffer liquid containing 50mM imidazole) the wash-out weak binding of 6 times of column volumes, elution buffer (the binding buffer liquid containing 500mM imidazole) the wash-out target protein of 6 times of column volumes.Collect final purification of samples, utilize SDS-PAGE to detect (result is as Fig. 8).
Claims (4)
1. new tumor necrosin-α (hTNF-α) mutain, namely fixed point introduces p-nitrophenyl L-Ala (p-nitrophenylalanine, pNO
2phe) hTNF-alpha muteins.
2. hTNF-alpha muteins according to claim 1, is characterized by: the 11st or/and the 87th sports p-nitrophenyl L-Ala: apNO
2phe
11-hTNF-α, b pNO
2phe
87-hTNF-α, c pNO
2phe
11,87-hTNF-α; There is aminoacid sequence SEQ ID.2 respectively, SEQ ID.4, SEQ ID.6; Unnatural amino acid residues pNO
2the numbering of Phe names according to ripe hTNF-α polypeptide.
3. the gene of coding hTNF alpha-mutant albumen, has as SEQ ID.1, SEQ ID.3, gene order shown in SEQ ID.5 respectively.
4. hTNF alpha-mutant albumen according to claim 1 is for strengthening the immunoreactive method for natural TNF α, that is: after injecting mutant protein in experimental subjects body, body produces the antibody for natural TNF α, in this antibody capable and body there is cross reaction in natural hTNF-α, thus produce or strengthen the immune response for hTNF-α.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510184139.0A CN104761631A (en) | 2015-04-15 | 2015-04-15 | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510184139.0A CN104761631A (en) | 2015-04-15 | 2015-04-15 | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104761631A true CN104761631A (en) | 2015-07-08 |
Family
ID=53643763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510184139.0A Pending CN104761631A (en) | 2015-04-15 | 2015-04-15 | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104761631A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106540252A (en) * | 2016-12-07 | 2017-03-29 | 四川大学 | Protein vaccine for tumor necrosis factor α and application thereof |
| CN107033232A (en) * | 2016-02-04 | 2017-08-11 | 上海亨臻实业有限公司 | The tumor necrosis factor α mutain and its preparation method and purposes of a kind of low bioactivity |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1274729A (en) * | 1999-05-20 | 2000-11-29 | 中国科学院上海生物工程研究中心 | New tumor necrosin mutein and its preparation and application |
| WO2002040675A1 (en) * | 2000-11-15 | 2002-05-23 | Shanghai Research Center Of Biotechnology, Chinese Academy Of Sciences | Novel human tumor necrosis factor mutant proteins and their preparing methods and uses |
| CN1417229A (en) * | 2001-11-09 | 2003-05-14 | 上海中信国健药业有限公司 | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition |
| CN101970005A (en) * | 2008-02-08 | 2011-02-09 | 斯克利普斯研究院 | Breaking immunological tolerance with a genetically encoded unnatural amino acid |
-
2015
- 2015-04-15 CN CN201510184139.0A patent/CN104761631A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1274729A (en) * | 1999-05-20 | 2000-11-29 | 中国科学院上海生物工程研究中心 | New tumor necrosin mutein and its preparation and application |
| WO2002040675A1 (en) * | 2000-11-15 | 2002-05-23 | Shanghai Research Center Of Biotechnology, Chinese Academy Of Sciences | Novel human tumor necrosis factor mutant proteins and their preparing methods and uses |
| CN1417229A (en) * | 2001-11-09 | 2003-05-14 | 上海中信国健药业有限公司 | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition |
| CN101970005A (en) * | 2008-02-08 | 2011-02-09 | 斯克利普斯研究院 | Breaking immunological tolerance with a genetically encoded unnatural amino acid |
Non-Patent Citations (1)
| Title |
|---|
| 张巍: "人肿瘤坏死因子-α突变蛋白与活性部位分析", 《国外医学免疫学分册》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107033232A (en) * | 2016-02-04 | 2017-08-11 | 上海亨臻实业有限公司 | The tumor necrosis factor α mutain and its preparation method and purposes of a kind of low bioactivity |
| CN106540252A (en) * | 2016-12-07 | 2017-03-29 | 四川大学 | Protein vaccine for tumor necrosis factor α and application thereof |
| CN106540252B (en) * | 2016-12-07 | 2020-04-28 | 四川大学 | Protein vaccine against tumor necrosis factor α and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110862435A (en) | African swine fever CTL epitope polypeptide and application thereof | |
| CN103160530B (en) | A kind of fusion and its application | |
| CN109966484B (en) | Immunopotentiator, preparation method, avian influenza vaccine and application | |
| CN109575142B (en) | CD4 helper T cell epitope fusion peptide and vaccine thereof | |
| CN102370979B (en) | Building method for autovaccine by aiming at human TNF(Tumor Necrosis Factor)-alpha molecule | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN113603754B (en) | Waterfowl H5N8 subtype influenza virus HA recombinant protein and preparation method and application thereof | |
| CN112142851B (en) | Subunit fusion protein tG on rabies virus surface and preparation method and application thereof | |
| CN104761631A (en) | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha | |
| CN106554965B (en) | It is used to prepare the nucleic acid construct and method of EV71 virus-like particle | |
| CN101376887B (en) | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide | |
| CN107090426A (en) | Restructuring mGM-CSF and the genetic engineering bacterium of GnRH fusion proteins a kind of structure | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN105602915A (en) | Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof | |
| CN105949320A (en) | Preparation and application of echovirus type 1 VP1 protein specific antigen epitope and fusion protein thereof | |
| CN105924501B (en) | Target the affinity peptide WH peptide of Clec9a | |
| CN105418767B (en) | A kind of fusion protein and its preparation method and application being used to prepare A β epiposition vaccine | |
| CN114829608A (en) | Fusion gene, recombinant novel coronavirus high-efficiency immune DNA vaccine, and construction method and application thereof | |
| CN102690342B (en) | Anti-cancer analgesic peptide VKVR, its preparation method and application | |
| CN111057154A (en) | Preparation and application of immunogen based on camel-derived Fc fragment | |
| CN105176897A (en) | Recombinant engineering strain expressing GnRH/M2 fusion polypeptide and construction and application thereof | |
| CN103626869B (en) | A kind of method preparing sheep MSTN gene monoclonal antibody vaccine | |
| CN103740736B (en) | The HSV2 virus gE glucoprotein extracellular region gene fragment of chemosynthesis and expression, application | |
| CN107653254A (en) | A kind of porcine reproductive and respiratory syndrome virus restructuring ORF5 genes and preparation method thereof | |
| CN109942718B (en) | Non-toxic tetanus toxin and clostridium perfringens beta toxin recombinant fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150708 |
|
| WD01 | Invention patent application deemed withdrawn after publication |