CN105602915A - Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof - Google Patents
Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof Download PDFInfo
- Publication number
- CN105602915A CN105602915A CN201511027007.3A CN201511027007A CN105602915A CN 105602915 A CN105602915 A CN 105602915A CN 201511027007 A CN201511027007 A CN 201511027007A CN 105602915 A CN105602915 A CN 105602915A
- Authority
- CN
- China
- Prior art keywords
- ezh2
- associated antigen
- multivalence
- tumor associated
- antigen peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides multi-valence EZH2 tumor-associated antigen peptide and relates to the field of immunology. Particularly, the multi-valence EZH2 tumor-associated antigen peptide comprises four EZH2 tumor-associated antigen peptides. The invention further relates to separated nucleic acid for encoding the multi-valence EZH2 tumor-associated antigen peptide. A constructor and a carrier of nucleic acid are included and host cells of nucleic acid are included. The invention further relates to a preparation method of the multi-valence EZH2 tumor-associated antigen peptide and an application of the multi-valence EZH2 tumor-associated antigen peptide to preparing a medicinal composition or a vaccine.
Description
Technical field
The present invention relates to field of immunology. Particularly, the present invention relates to multivalence EZH2 tumor associated antigen peptide. The present inventionAlso relate to the nucleic acid of the separation of the described Antigenic Peptide of encoding, the construct that comprises described nucleic acid and carrier, and comprise described nucleic acidHost cell. The invention still further relates to preparation method and its use in pharmaceutical compositions or vaccine of described Antigenic PeptideOn the way.
Background technology
EZH2 is the important members of many comb protein families, it and other 3 subunits (EED, SUZ12 and RbAp46/48) oneThe many combs of the common composition in road albumen inhibition complex 2 (polycombrepressivecomplex2, PRC2). As PRC2Core subunit, EZH2 has ZNFN3A1 activity, is maintaining cell proliferation, stem cell self and is regulating thinBorn of the same parents play a significant role in the cycle, and by assisting with histon deacetylase (HDAC) (HDACs) and dnmt rna (DNMTs)Same-action makes expression of tumor suppressor gene silence, promotes thus tumour to occur and invasion and attack transfer. People EZH2 gene is by 20 extronsForm with 19 intrones, protein molecular that 746 amino acid residues of coding form (people such as MargueronR, Nature,469 (7330): 343-349 (2011); The people such as VireE, Nature, 439 (7078): 871 – 874 (2006)). Recent studyFind, EZH2 is a kind of tumor associated antigen, can serve as tumor markers high expressed in different tumor tissues, and its expressionThe grade malignancy high-positive correlation of level and tumour, EZH2 is becoming the novel targets of anti-tumor immunotherapy thus(people such as BenetatosL, CellMolLifeSci, 71 (2): 257-269 (2014); The people such as ChangCJ, BrJCancer, 106 (2): 243-247 (2012); The people such as CreaF, CritRevOncolHematol, 83 (2): 184-193(2012); The people such as WanL, ClinTranslOncol, 15 (2): 132-138 (2013); The people such as GoeBP, PlosOne, 8(8): e71670 (2013); The people such as Hajosi-KalcakoszS, Diagnpathol, 7:86 (2012)). At EZH2 eggIn white primary structure, identify multiple peptide sections that can be used as tumor associated antigen, comprise Aa120-128, Aa165-174, Aa243-245, Aa291-299, Aa666-674, Aa699-708, Aa735-742 etc. Importantly these tumor associated antigen peptides are at bodyInterior can induction generation anti-tumour antibody and activate the killing activity of T lymphocyte specific to tumour cell, prompting EZH2 is anti-Significant application value (people such as OgataR, Prostate, 60 (4): 273-281 (2004) in immunotherapy of tumors; SteeleThe people such as JC, BriJCancer, 95 (9): 1202 – 1211 (2006); The people such as KomoharaY, JUrol, 177 (3): 1157-1162 (2007); The people such as ItohY, OncolRep, 18 (5): 1231-1237 (2007)).
Because the prokaryotic expression of small peptide (if length amino acid sequence is below 30aa) exists expression low conventionally, purifying is tiredDifficulty, the problem such as immunogenicity is poor, in order to obtain high-purity EZH2 tumor associated antigen peptide, the present invention chooses 4 and has identifiedEZH2 tumor associated antigen peptide (Aa120-128, Aa165-174, Aa291-299, Aa735-742), utilizes gene recombination technologyIn prokaryotic expression system, manually design and synthesized the little molecule fusion protein (title that contains above-mentioned 4 kinds of EZH2 tumor antigen peptidesBe multivalence EZH2 tumor associated antigen peptide), it has retained the antigen property of EZH2, in animal body inducing specific antibodyGenerate.
Summary of the invention
In the present invention, except as otherwise noted, otherwise Science and Technology noun used herein has art technologyThe implication that personnel understand conventionally. And, cell cultivation used herein, molecular genetics, nucleic acid chemistry, biochemistry,Immunology Lab operating procedure is widely used conventional steps in corresponding field. Meanwhile, in order to understand better thisBright, definition and the explanation of relational language are provided below.
According to the present invention, term " immunogenicity (immunogenicity) " refers to, can stimulate body to form special anti-The ability of body or sensitized lymphocyte. It both referred to, antigen can stimulate specific immunocyte, make activated immune cell, propagation, pointChange, finally produce immunologic effector substance as the characteristic of antibody and sensitized lymphocyte, also refer to after antigenic stimulus body immunity of organismSystem can form the specific immune response of antibody or sensitized T lymphocyte. Immunogenicity is the most important character of antigen, oneInduction host in antigen success ground produces the factor that immune response depends on three aspects:: the character of antigen, host's reactivityAnd immunization ways.
According to the present invention, term " immunogenic fragments " refers to such polypeptide fragment, and it has retained institute at least in partThe immunogenicity of the albumen being derived from.
According to the present invention, 4 EZH2 tumor associated antigen peptides are Aa120-128, Aa165-174, Aa291-299 andAa735-742. The amino acid sequence of Aa120-128 is as shown in SEQIDNO.1, and its corresponding coding nucleotide sequence is as SEQShown in IDNO.2; The amino acid sequence of Aa165-174 as shown in SEQIDNO.3, its corresponding coding nucleotide sequence asShown in SEQIDNO.4; The amino acid sequence of Aa291-299 as shown in SEQIDNO.5, the coding nucleotide sequence that it is correspondingAs shown in SEQIDNO.6; The amino acid sequence of Aa735-742 as shown in SEQIDNO.7, the coding nucleotide order that it is correspondingRow are as shown in SEQIDNO.8.
In the present invention, term " polypeptide " and " protein " have identical implication, are used interchangeably. And in the present inventionIn, amino acid abridges to represent with single-letter well known in the art and trigram conventionally. For example, alanine can be shown with A or AlaShow.
According to the present invention, term " escherichia expression system " refers to the expression being made up of Escherichia coli (bacterial strain) and carrierSystem, wherein Escherichia coli (bacterial strain) derive from bacterial strain available on the market, such as but not limited to: GI698, ER2566,BL21(DE3),B834(DE3),BLR(DE3)。
According to the present invention, term " carrier (vector) " refers to, polynucleotide can be inserted to a kind of nucleic acid fortune whereinThe instrument of carrying. In the time that carrier can make the albumen of the polynucleotide encoding inserting obtain expression, carrier is called expression vector. Carrier canBy transforming, transduction or transfection import host cell, make its inhereditary material element carrying in host cell, obtain expression.Carrier is well known to a person skilled in the art, includes but not limited to: plasmid; Bacteriophage; Coemid etc.
According to the present invention, term " pharmaceutically acceptable carrier and/or excipient " refers on pharmacology and/or physiologyCarrier and/or the excipient compatible with active component with experimenter, it is well known in the art (referring to for example Remington'sPharmaceuticalSciences.EditedbyGennaroAR,19thed.Pennsylvania:MackPublishingCompany, 1995), and include but not limited to: pH adjusting agent, surfactant, adjuvant, ionic strength increasesStrong agent. For example, pH adjusting agent includes but not limited to phosphate buffer; Surfactant includes but not limited to cation, cloudy fromSon or nonionic surface active agent, for example Tween-80; Ionic strength reinforcing agent includes but not limited to sodium chloride.
According to the present invention, term " adjuvant " refers to nonspecific immunity strengthening agent, when it sends together with antigen or in advanceWhile entering body, it can strengthen body and resist former immune response or change type of immune response. Adjuvant has a variety of, comprises but notBe limited to aluminium adjuvant (for example aluminium hydroxide), Freund's adjuvant (for example complete Freund's adjuvant and incomplete Freund's adjuvant), short and small bar-shapedBacillus, lipopolysaccharides, cell factor etc. Freund's adjuvant is adjuvant the most frequently used in current animal experiment. Aluminum hydroxide adjuvant existsIn clinical trial, use more.
Well known in the art (referring to example by two or more protein fusion expressions with the technology that forms fusionAs, the people such as J.Sambrook, molecular cloning: laboratory manual, the 2nd edition, publishing house of cold spring harbor laboratory, 1989, andThe people such as F.M.Ausubel, fine works molecular biology experiment guide, the 3rd edition, john wiley & sons, Inc., 1995). Conventionally,Link together by using recombinant DNA technology that the DNA fragmentation of two or more albumen of coding is met to frame, and carry outProtein expression obtains fusion. Optionally, can with or not with joint by two or more protein fusion tablesReach.
According to the present invention, term " joint " refers to for example, small peptide for connecting two molecules (albumen). Conventionally, by inciting somebody to actionEncode this small peptide polynucleotide sequence introduce (for example,, by pcr amplification or ligase) encode respectively two kinds that will connectBetween two DNA fragmentations of destination protein, and carry out protein expression and obtain fusion, for example destination protein 1-joint-Destination protein 2. As known to the skilled person, joint includes but not limited to flexible peptide linker, for example Gly-Gly-Gly-Gly, Gly-Gly-Gly-Gly-Ser, Gly-Gly-Ser-Ser and (Gly-Gly-Gly-Gly-Ser)3Etc..
According to the present invention, term " effective dose " refers to the amount that is enough to obtain or obtain at least partly the effect of expecting. For example,Prevent disease (for example tumour) effective dose refers to, is enough to prevention, stops, or postpones the amount of the generation of disease (for example tumour); ControlTreat disease effective dose and refer to, be enough to patient's disease and the amount of its complication of curing or prevention has suffered from disease at least partly.Measure such effective dose completely within those skilled in the art's limit of power. For example, effectively measure for therapeutical usesBy depend on disease to be treated severity, patient oneself immune overall status, patient ordinary circumstance for exampleAge, body weight and sex, the method for application of medicine, and the other treatment of simultaneously using etc.
The present invention finds as follows based on inventor at least partly: successfully design and prepared a kind of multivalence EZH2 Tumor-assaciatedAntigenic Peptide, and set up the efficiently method of synthetic and effective this kind of Antigenic Peptide of separation and purification.
Therefore, in one aspect, the present invention relates to a kind of multivalence EZH2 tumor associated antigen peptide, it is by 4 kinds of EZH2 tumoursAssociated antigen polypeptide Aa120-128, Aa165-174, Aa291-299 and Aa735-742, and optional label, optional jointWith optional signal peptide composition; Wherein the amino acid sequence of Aa120-128 is as shown in SEQIDNO.1; The amino of Aa165-174Acid sequence is as shown in SEQIDNO.3; The amino acid sequence of Aa291-299 is as shown in SEQIDNO.5; The ammonia of Aa735-742Base acid sequence is as shown in SEQIDNO.7. Preferably, described multivalence EZH2 tumor associated antigen peptide is by as SEQIDNO.9 instituteThe amino acid sequence showing and label composition. Preferably, described label is 6 × His label. Preferably, described multivalence EZH2 tumourThe amino acid sequence of associated antigen polypeptide is as shown in SEQIDNO.9.
In yet another aspect, the invention provides the multinuclear of multivalence EZH2 tumor associated antigen peptide as defined above of encodingThuja acid; Preferably, the nucleotide sequence of described polynucleotides is as shown in SEQIDNO.10. Also provide and comprise this type of multinuclearThe construct of thuja acid.
In yet another aspect, the invention provides a kind of carrier, it comprises the multivalence EZH2 tumour as defined above of encodingThe polynucleotides of associated antigen polypeptide or the construct that contains these type of polynucleotides. Carrier of the present invention can be cloning vector,Also can be expression vector.
In a preferred embodiment, carrier of the present invention is for example plasmid, clay, bacteriophage, coemid etc.
In yet another aspect, also provide the host cell that comprises polynucleotides of the present invention or construct or carrier orOrganism. This type of host cell includes but not limited to, prokaryotic is Bacillus coli cells such as, and such as yeast of eukaryoticCell, insect cell, plant cell and zooblast (such as, as mammalian cell, mouse cell, people's cell etc.). The present inventionCell can also be clone. In one embodiment, described organism is plant or animal.
In yet another aspect, the invention still further relates to a kind of pharmaceutical composition or vaccine, it comprises according to multivalence of the present inventionEZH2 tumor associated antigen peptide, optionally also comprises pharmaceutically acceptable carrier and/or excipient. Pharmaceutical composition of the present inventionOr vaccine can be for preventing and/or treating tumour.
In yet another aspect, the invention still further relates to multivalence EZH2 tumor associated antigen peptide according to the present invention for the preparation of medicineThe purposes of compositions, described pharmaceutical composition is used for preventing and/or treating tumour.
In yet another aspect, the invention still further relates to the method that prevents and/or treats tumour, it comprises the root of using effective doseAccording to multivalence EZH2 tumor associated antigen peptide of the present invention or the pharmaceutical composition that comprises described multivalence EZH2 tumor associated antigen peptide.
On the other hand, the invention still further relates to multivalence EZH2 tumor associated antigen peptide according to the present invention for the preparation of antibodyPurposes; Preferably, described antibody is used for preventing and/or treating tumour.
On the other hand, the invention still further relates to preparation according to the method for multivalence EZH2 tumor associated antigen peptide of the present invention,It comprises the steps:
1) cultivate and can express according to the host cell of multivalence EZH2 tumor associated antigen peptide of the present invention;
2) reclaim described multivalence EZH2 tumor associated antigen peptide;
Preferably, step 2) by multivalence EZH2 tumor associated antigen peptide described in affinitive layer purification.
One preferred embodiment in, said method specifically comprises the steps:
A) synthetic following two DNA single chains:
5`-GGAAGATCTGTTTATGGTGGAAGATGAAACTGTTTTATTTATAAATGATGAAATTTTTGTGGAGTTGAAATATG(SEQIDNO.11)，
5`-CCGCTCGAGtcaGACATACTTCAGGGCATCAGCCTGCTTACGATGTAGGAAGCAGTCATATTTCAACTCCACAAAA(SEQIDNO.12)；
Obtain the double chain DNA fragment of total length 130bp with overlap extension pcr, the product that the overlapping extension PCR of purifying obtainsAnd enter in the prokaryotic expression plasmid pET30a (+) of same enzyme digestion with BglII and XhoI double digestion digestion rear clone, obtain thusObtain recombinant plasmid pET30a (+)-EZH2-antigen;
B), with pET30a (+)-EZH2-antigen transfection Escherichia coli, cultivate the Escherichia coli of transfection acquisition and use IPTGAbduction delivering 4h;
C) the centrifugal collection thalline of culture step b) being obtained, cracking somatic cells is used the cell pyrolysis liquid obtainingNi-NTA resin carries out affinity chromatography, the protein sample of acquisition is dialysed, and by dialysis after protein sample through SDS-PAGE identifies and preserves.
Preferably, step c) is specially the centrifugal collection thalline of the culture that step b) is obtained, and (8mol/L urinates BufferBElement, 100mmol/LNa2HPO4, 10mmol/LTris, pH8.0) and resuspended bacterium, jolt 2h cell lysis at 37 DEG C, cell splitsSeparate on liquid after Ni-NTA chromatographic column WashBuffer (8mol/L urea, 100mmol/LNa2HPO4，10mmol/LTris，pH6.3) wash-out foreign protein; Then use BufferE (8mol/L urea, 100mmol/LNa2HPO4，10mmol/LTris，pH4.3) the multivalence EZH2 tumor associated antigen peptide of elution of bound on Ni-NTA resin; To in the protein sample of the purifying of acquisition, wrapThe urea containing is progressively removed through dialysis; Protein sample after dialysis is identified and preserves through SDS-PAGE. Preferably, for dialysingBuffer solution is the phosphate buffer (10mmol/LNa containing Urea Gradient concentration2HPO4，10mmol/LNaH2PO4, 5% is sweetOil, pH7.4, urea concentration gradient is 5.0mol/L, 2.5mol/L, 1.0mol/L, 0.0mol/L), under every kind of urea concentration in 4DEG C dialysis 12h.
The beneficial effect of the invention
At present can be divided into eukaryotic expression system and prokaryotic expression system for the preparation of the expression system of albumen.
The albumen native conformation of expressing in eukaryotic expression system destroys few, often only need carry out simple purge processCan obtain the albumen with correct conformation. But for example baculovirus expression system of eukaryotic expression system and yeast expression system at presentExist expression low, cultivate high in cost of production defect, brought very big difficulty to large-scale industrial production.
Multivalence EZH2 tumor associated antigen peptide provided by the invention and preparation method thereof has solved the problems referred to above effectively. FirstFirst, in prokaryotic expression system, especially to have the cost of cultivation low for escherichia expression system, the advantage that expression is large. ThisBrightly express multivalence EZH2 tumor associated antigen peptide with prokaryotic expression system, guaranteed its high expressed amount. Secondly, the present invention adoptsWith multivalence EZH2 tumor associated antigen peptide described in affinitive layer purification, obtain highly purified destination protein. Further, according to thisThough the molecular weight of bright multivalence EZH2 tumor associated antigen peptide is little but Antigenic Peptide density is high. With WestewrnBlot method (Diagnosis of SghistosomiasisMark method) confirm, the multivalence EAH2 tumor associated antigen Toplink of prokaryotic expression of the present invention is effectively identified and combination by anti-EZH2 antibody,With efficiently inducing in animal body synthetic corresponding antibodies after this multivalence EAH2 tumor associated antigen peptide immunization experiment animal, because ofAnd there is the activity of stronger tumor associated antigen. Its successful development will provide new experiment material for immunotherapy of tumors researchMaterial, for the research and development of immunotherapy of tumors newtype drug lay the foundation, has important application prospect and exploitation to be worth.
Below in conjunction with drawings and Examples, embodiment of the present invention are described in detail, but art technology peopleMember will understand, and following drawings and Examples are only for the present invention is described, instead of restriction to scope of the present invention. With reference to the accompanying drawingsWith the following detailed description of preferred embodiment, various objects of the present invention and favourable aspect are to those skilled in the artTo become obvious.
Brief description of the drawings
Figure 1A has shown the DNA sequence dna of the coding multivalence EZH2 tumor associated antigen peptide of the overlapping elongation technology acquisition of PCR, itsIn
Swimming lane M:1kbDNAMarker;
Swimming lane 1-2: the coding DNA of multivalence EZH2 tumor associated antigen peptide.
Figure 1B has shown the result of the coded sequence (108bp) of DNA sequencing checking multivalence EZH2 tumor antigen peptide.
Fig. 1 C has shown amino acid sequence and the DNA sequences encoding thereof of multivalence EZH2 tumor antigen peptide.
Fig. 1 D has shown that the enzyme of plasmid pET30a (+)-EZH2-antigen cuts qualification result;
Swimming lane M:1kbDNAMarker;
Swimming lane 1:pET-30a (+) plasmid is cut (3932bp+1490bp) through HpaI+EcoRI enzyme;
Swimming lane 2:pET30a (+)-EZH2-antigen plasmid is cut (5447bp) through HpaI+EcoRI enzyme;
Swimming lane 3:pET-30a (+) plasmid (5422bp);
Swimming lane 4:pET-30a (+)-Ezh2-antigen plasmid (5447bp).
Fig. 2 has shown and has detected among Escherichia coli BL-21 (DE3) use IPTG abduction delivering destination protein with SDS-PAGEResult;
Before swimming lane 1:IPTG induction;
Swimming lane 2-5:0.3mmol/LIPTG37 DEG C of induction 4h;
Swimming lane M: standard protein Marker-431.
Fig. 3 has shown that SDS-PAGE detects the result of the solubility of multivalence Ezh2 tumor associated antigen peptide;
Swimming lane M: standard protein marker-431;
Before swimming lane 1:IPTG induction;
Swimming lane 2:0.3mmol/LIPTG37 DEG C of induction 4h;
Swimming lane 3-4: supernatant after high speed centrifugation;
Swimming lane 5-6: high speed centrifugation postprecipitation.
Fig. 4 has shown that SDS-PAGE detects the result of the multivalence EZH2 tumor associated antigen peptide of affinitive layer purification;
Swimming lane 1: the multivalence EZH2 tumor associated antigen peptide of affinitive layer purification;
The bacterium liquid of swimming lane 2:0.3mmol/LIPTG37 DEG C of induction 4h;
Swimming lane 3: the bacterium liquid that does not add derivant IPTG;
Swimming lane M: standard protein marker-431.
Fig. 5 has shown the multivalence EZH2 tumor associated antigen peptide of WesternBlot qualification prokaryotic expression;
With anti-6 × his label monoclonal antibody as primary antibodie:
Swimming lane 1-2: the multivalence EZH2 tumor associated antigen peptide after purifying;
The bacterium liquid of swimming lane 3:IPTG37 DEG C of induction 4h;
How anti-as primary antibodie with anti-EZH2:
Swimming lane 1: the multivalence EZH2 tumor associated antigen peptide after purifying;
The bacterium liquid of swimming lane 2:0.3mmol/LIPTG37 DEG C of induction 4h.
Fig. 6 has shown that ELISA method detects the result of antiserum titre.
Detailed description of the invention
Referring now to the following embodiment that is intended to illustrate the present invention (and non-limiting the present invention), the present invention is described.
Unless specialized the experimental methods of molecular biology using in the present invention and immunodetection, substantially ginsengAccording to people such as J.Sambrook, molecular cloning: laboratory manual, the 2nd edition, publishing house of cold spring harbor laboratory, 1989, andThe people such as F.M.Ausubel, fine works molecular biology experiment guide, the 3rd edition, john wiley & sons, Inc., described in 1995Method carry out; The condition that the use of restriction enzyme is recommended according to goods producer. The examination in unreceipted source in embodimentAgent is all conventional reagent or the commercially available reagent of this area. Those skilled in the art know, and embodiment retouches with way of exampleState the present invention, and be not intended to limit the present invention's scope required for protection.
Material and reagent
Japan large ear rabbit is bought from Jing Zhou, Hubei animal center. Bacterial strain E.coliBL21 (DE3), plasmid pET30a (+)By this laboratory preservation, restriction endonuclease, T4DNA ligase, dye protein standard substance purchased from Fermentas company in advance,DNTP and PCR kit are TaKaRa company product, DNA reclaim purification kit be Omega company product, anti-His antibody andAnti-EZH2 antibody is Proteintech company product, and goat anti-rabbit igg-HRP is provided by Beijing company of Zhong Shan Golden Bridge, ECL nitrite ionFor ThermoScientific company product, not formula Freund's incomplete adjuvant and Fu Shi Freund's complete adjuvant are that Sigma-aldrich formula producesProduct. DNA synthesizes and order-checking is completed by Shanghai Sheng Gong bioengineering Co., Ltd.
The structure of embodiment 1 plasmid pET30a (+)-EZH2-antigen
Select tumor associated antigen peptide section in 4 EZH2 as research object (Peptide-1:Aa120-128,Peptide-2:Aa165-174, Peptide-3:Aa291-299, Peptide-4:Aa735-742), by their coded sequenceMerge to obtain a kind of artificial short dna sequence (108bp) of these 4 tumor antigen peptides of simultaneously encoding, according to these peptidesSynthetic following two the DNA single chains of coded sequence design of section:
1)5`-GGAAGATCTGTTTATGGTGGAAGATGAAACTGTTTTATTTATAAATGATGAAATTTTTGTGGAGTTGAAATATG，
2)5`-CCGCTCGAGTCAGACATACTTCAGGGCATCAGCCTGCTTACGATGTAGGAAGCAGTCATATTTCAACTCCACAAAA。
Between the 3` end of above-mentioned two strands, have 20 base complementrities, 5` end contains respectively BglII and XhoI enzyme is cutSequence (having underscore part). By after above-mentioned two DNA single chain mixed in equal amounts, with overlap extension pcr acquisition total length 130bpDouble chain DNA fragment (seeing Figure 1A), this fragment is except sequence (108bp, SEQ containing for multivalence EZH2 tumor associated antigen peptide codingIDNO.9), outside, both sides also introduce respectively restriction enzyme site and protection base is beneficial to clone operations. PCR condition is 94 DEG CSex change 5min; 94 DEG C of sex change 1min, 45 DEG C of annealing 5min, 72 DEG C of extension 30s are a PCR circulation, and 12 circulations are carried out in reaction;Last 72 DEG C are extended 5min.
The product that the overlapping extension PCR of purifying obtains also enters through same enzyme to disappear with BglII and XhoI double digestion digestion rear cloneIn the prokaryotic expression plasmid pET30a (+) changing, obtain thus recombinant plasmid pET30a (+)-EZH2-antigen and cultivate through expandingAfter, to cut and DNA sequencing qualification with enzyme, the DNA sequence dna inserting in confirmation pET30a (+)-EZH2-antigen is correct with slottingInbound correct (the results are shown in Figure 1B, 1C, 1D).
Prokaryotic expression and the purifying of embodiment 2 multivalence EZH2 tumor associated antigen peptides
With plasmid pET30a (+)-EZH2-antigen conversion BL21 (DE3) competent cell, through 0.1g/L kanamycins37 DEG C of agar plates spend the night after screening, picking monoclonal colony inoculation in LB culture medium, 37 DEG C of concussion overnight incubation. Get in a small amountIncubated overnight bacterium liquid, adds the LB culture medium of 40 times of volumes, cultivates 3h for 37 DEG C, in the time that Host Strains growth reaches logarithmic phase, addsIPTG (final concentration 0.3mmol/L) induction Host Strains is expressed destination protein, and continue 37 DEG C and cultivate after 4h, centrifugal collection bacterium, soDetect afterwards the expression of recombinant protein with SDS-PAGE. As shown in Figure 2, after IPTG induction, in bacterium, there are a large amount of multivalence EZH2 tumoursAntigenic Peptide recombinant protein, apparent molecular weight is consistent with predicted molecular weight.
The bacterium of collection is resuspended in to (NaCl137mmol/L, KH in PBS2PO42mmol/L，Na2HPO410mmol/L，KCl2.7mmol/L), 4 DEG C of ultrasonic disruptions, the centrifugal rear upper cleer and peaceful precipitation of collecting respectively, then uses SDS-PAGE electrophoretic techniquesAnalyze the solubility of the gene recombinant protein of abduction delivering. Found that, multivalence EZH2 tumor associated antigen peptide is mainly present inIn ultrasound precipitation, mainly there is (the results are shown in Figure 3) with inclusion body form in destination protein under this inductive condition. At this experiment barUnder part the too fast and synthetic quantity of multivalence EAH2 tumor associated antigen peptide aggregate velocity in bacterium excessive may be that this phenomenon occursReason.
Owing to being instructed the 5` end of synthetic gene recombinant protein by pET30a (+)-EZH2-antigen in Escherichia coliContain 6 × His label, this experiment adopts Ni-NTA resin (8M urea) under Denaturing to carry out affinity chromatography to recombinant proteinPurifying. Key step is: the Escherichia coli through pET30a (+)-EZH2-antigen transfection are centrifugal after IPTG abduction delivering 4hCollect thalline, BufferB (8mol/L urea, 100mmol/LNa2HPO4, 10mmol/LTris, pH8.0) and resuspended bacterium,37 DEG C jolt 2h cell lysis, on cell pyrolysis liquid after Ni-NTA chromatographic column, and WashBuffer (8mol/L urea, 100mmol/LNa2HPO4, 10mmol/LTris, pH6.3) and wash-out foreign protein; Then use BufferE (8mol/L urea, 100mmol/LNa2HPO4, 10mmol/LTris, pH4.3) and the gene recombinant protein of elution of bound on Ni-NTA resin. The egg of above-mentioned purifyingThe urea comprising in white sample is progressively removed through dialysis. Be the phosphate-buffered containing Urea Gradient concentration for the buffer solution of dialysingLiquid (10mmol/LNa2HPO4，10mmol/LNaH2PO4, 5% glycerine, pH7.4, urea concentration gradient be 5.0mol/L,2.5mol/L, 1.0mol/L, 0.0mol/L), under every kind of urea concentration in 4 DEG C dialysis 12h. Protein sample after dialysis is through SDS-After PAGE qualification, be stored in-80 DEG C for subsequent use. Qualification result demonstration, the method can obtain the multivalence EZH2 tumour phase of purity approximately 95%Close Antigenic Peptide recombinant protein (seeing Fig. 4).
Embodiment 3WesternBlot analyzes multivalence EZH2 tumor associated antigen peptide
With the multivalence EZH2 tumor associated antigen peptide of purifying, after 15% SDS-PAGE separates, electrotransfer is to pvdf membraneOn. 5% skim milk for film-TBST (20mmol/LTris-HCl, 150mmol/LNaCl, 0.05%Tween-20, pH7.4) room temperature sealing is after 1 hour, successively with second of first antibody (anti-EZH2 antibody or anti-His tag antibody) and HRP markAntibody effect, ECL method spike target protein. Result confirmation, this recombinant protein can be had by anti-EZH2 antibody and anti-His tag antibodyEffect identification and combination, this presentation of results, the multivalence EZH2 tumor associated antigen peptide of artificial preparation has EZH2 specific antigen spyLevy (seeing Fig. 5).
The preparation of the anti-multivalence EZH2 tumor associated antigen of embodiment 4 peptide antibody
With the multivalence EZH2 tumor associated antigen peptide immunity Japan large ear rabbit of purifying to prepare corresponding polyclonal antibody.When first immunisation, mix with isopyknic not formula Freund's complete adjuvant with 500 μ g antigen proteins, after ice-bath ultrasonic emulsification, the subcutaneous note of multiple spotPenetrate. After 2 weeks, carry out secondary booster immunization, mix at every turn with 100 μ g antigen proteins with incomplete Freund's adjuvant equal-volume, ice bath is superAfter sound emulsification, multiple spot hypodermic injection, 2 weeks interval times. Last booster immunization is after 1 week, and ear source venous blood sampling, prepares bloodClearly.
Embodiment 5ELISA method detects serum antibody titer
It is 10mg/L that the multivalence EZH2 tumor associated antigen peptide of purifying is diluted to final concentration with coated buffer solution, uses this solutionCoated 96 hole ELISA Plates, every hole 100 μ l. After 4 DEG C of coated 16h, adding the antibody of serial dilution (is that rabbit prepared by embodiment 4 resistsSerum) 37 DEG C of solution hatch 30min, every hole 100 μ l, then add goat anti-rabbit igg (the 100 μ l/ of the HRP mark of dilution in 1: 5000Hole), hatch after 1h for 37 DEG C, with the colour developing of TMB method. In experiment taking the not negative contrast of immune serum, PBS as blank,ELIASA is measured every hole OD450 value. With blank zeroing, treat the ratio of gaging hole OD450 value and negative control hole OD450 value >=2.1 be judged to be the positive, can obtain positive greatest dilution tiring as antibody. Result shows, artificial prepare manyValency EZH2 tumor associated antigen Toplink efficiently induces antibody to generate in animal body, and antiserum titre is 1:64 ten thousand (seeing Fig. 6).
Although the specific embodiment of the present invention has obtained detailed description, those skilled in the art will appreciate that rootAccording to disclosed all instructions, can carry out various modifications and changes to details, and these change all guarantor of the present inventionWithin protecting scope. Four corner of the present invention is provided by claims and any equivalent thereof.
Claims (9)
1. a multivalence EZH2 tumor associated antigen peptide, its by SEQIDNO.1, SEQIDNO.3, SEQIDNO.5 andAmino acid sequence shown in SEQIDNO.7, and optional label, optional joint and optional signal peptide composition; PreferablyGround, described multivalence EZH2 tumor associated antigen peptide is made up of the amino acid sequence as shown in SEQIDNO.9 and label; PreferablyGround, the amino acid sequence of described multivalence EZH2 tumor associated antigen is as shown in SEQIDNO.9; Preferably, described label be 6 ×His label.
2. the polynucleotides of the multivalence EZH2 tumor associated antigen peptide of coding claim 1.
3. comprise the construct of the polynucleotides of claim 2.
4. comprise the carrier of the polynucleotides of claim 2 or the construct of claim 3, for example described carrier is to express to carryBody; Preferably, described expression vector is the plasmid of the construct of the polynucleotides that comprise claim 2 or claim 3pET30a(+)。
5. comprise the host cell of the carrier of the polynucleotides of claim 2 or the construct of claim 3 or claim 4;Preferably, described host cell is prokaryotic; Preferably, described host cell is Escherichia coli.
6. pharmaceutical composition or a vaccine, the multivalence EZH2 tumor associated antigen peptide that it comprises claim 1, optionally also wrapsContaining pharmaceutically acceptable carrier and/or excipient.
7. the multivalence EZH2 tumor associated antigen peptide of claim 1 is for the preparation of the purposes of pharmaceutical composition, described drug regimenThing is used for preventing and/or treating tumour.
8. the multivalence EZH2 tumor associated antigen peptide of claim 1 is for the preparation of the purposes of antibody; Preferably, described antibody is used forPrevent and/or treat tumour.
9. the method for preparing multivalence EZH2 tumor associated antigen peptide, it comprises the steps:
1) cultivate host cell claimed in claim 5;
2) reclaim described multivalence EZH2 tumor associated antigen peptide;
Preferably, step 2) by multivalence EZH2 tumor associated antigen peptide described in affinitive layer purification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511027007.3A CN105602915A (en) | 2015-06-24 | 2015-12-31 | Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2015103548775 | 2015-06-24 | ||
| CN201510354877 | 2015-06-24 | ||
| CN201511027007.3A CN105602915A (en) | 2015-06-24 | 2015-12-31 | Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105602915A true CN105602915A (en) | 2016-05-25 |
Family
ID=55983262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511027007.3A Pending CN105602915A (en) | 2015-06-24 | 2015-12-31 | Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105602915A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106279395A (en) * | 2016-09-13 | 2017-01-04 | 上海交通大学医学院附属新华医院 | The epitope peptide of a kind of EZH2 albumen and application thereof |
| WO2021196415A1 (en) * | 2020-03-30 | 2021-10-07 | 国家纳米科学中心 | Targeting-specific polypeptide and use thereof |
| CN113549603A (en) * | 2021-06-29 | 2021-10-26 | 洛阳职业技术学院 | Research method of prokaryotic expression and purification method of chicken EZH2 protein |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102657854A (en) * | 2012-05-22 | 2012-09-12 | 郑州大学 | Multi-epitope vaccine YL66 and application of preparing vaccine for treating tumour |
-
2015
- 2015-12-31 CN CN201511027007.3A patent/CN105602915A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102657854A (en) * | 2012-05-22 | 2012-09-12 | 郑州大学 | Multi-epitope vaccine YL66 and application of preparing vaccine for treating tumour |
Non-Patent Citations (8)
| Title |
|---|
| ITOH Y ET AL: "New peptides of the polycomb group protein enhancer of zeste homolog 2 with the potential to induce cancer-reactive cytotoxic T lymphocytes in human leukocyte antigen-A2+ prostate cancer patients", 《ONCOLOGY REPORTS》 * |
| RIKA OGATA ET AL: "Identification of polycomb group protein enhancer of zeste homolog 2 (EZH2)‐derived peptides immunogenic in HLA‐A24+ prostate cancer patients", 《PROSTATE》 * |
| 余彤 等: "肿瘤多肽疫苗的研究进展", 《世界华人消化杂志》 * |
| 吴亚红 等: "肿瘤抗原细胞毒性T淋巴细胞表位鉴定和多肽疫苗的研究进展", 《郑州大学学报（医学版）》 * |
| 张焜 等: "《生物制药及工程技术现状与应用前景》", 31 May 2015, 广东经济出版社 * |
| 李倩 等: "EZH2作为抗肿瘤免疫治疗靶点研究进展", 《生物技术通报》 * |
| 赵广荣 等: "《现代制药工艺学》", 28 February 2015, 清华大学出版社 * |
| 陈薪宇 等: "组蛋白甲基酶EZH2的研究进展", 《生物技术通讯》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106279395A (en) * | 2016-09-13 | 2017-01-04 | 上海交通大学医学院附属新华医院 | The epitope peptide of a kind of EZH2 albumen and application thereof |
| WO2021196415A1 (en) * | 2020-03-30 | 2021-10-07 | 国家纳米科学中心 | Targeting-specific polypeptide and use thereof |
| CN113549603A (en) * | 2021-06-29 | 2021-10-26 | 洛阳职业技术学院 | Research method of prokaryotic expression and purification method of chicken EZH2 protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | A Plasmodium falciparum 48/45 single epitope R0. 6C subunit protein elicits high levels of transmission blocking antibodies | |
| CN108503698B (en) | Immunogenicity of Acinetobacter baumannii Ata protein | |
| CN107033250B (en) | Bovine coronavirus recombinant multi-epitope antigen and application thereof | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN105602915A (en) | Multi-valence EZH2 tumor-associated antigen peptide and preparation thereof | |
| CN107510841B (en) | Vaccine for blocking echinococcus granulosus transmission of echinococcosis pathogen at source | |
| CN102260322B (en) | Antigen peptide of Helicobacter pylori and application thereof | |
| CN104755619A (en) | Vaccine for preventing porcine edema disease | |
| CN110746496B (en) | PAL recombinant protein of Acinetobacter baumannii, encoding gene thereof and application of PAL recombinant protein and encoding gene | |
| CN103725697A (en) | Chemically synthesized staphylococcus aureus surface protein FnBPA gene fragment and expression and application thereof | |
| CN116478953A (en) | Acinetobacter baumannii DlaT recombinant protein, preparation method and application | |
| CN105777909A (en) | A-type foot-and-mouth disease targeting composite epitope protein mediated by pig chemotactic factors and vaccine | |
| CN105906716B (en) | Preparation and application of echovirus 9 type VP1 protein specific epitope and fusion protein thereof | |
| US20030044936A1 (en) | Peptide repeat immunogens | |
| CN103880953A (en) | Porcine P21 protein antibody as well as preparation method and application thereof | |
| KR101526886B1 (en) | Recombinant Protein Comprising Epitope of Fowl Adenovirus fiber 2 Protein and Antibody thereto | |
| CN106581667A (en) | Design and preparation method and application of echinococcus multilocularis subunit vaccine LTB-Emy162 | |
| Fang et al. | Immunogenicity of Recombinant Maltose-binding Protein (MBP)–Gonadotropin Releasing Hormone I (GnRH-I) | |
| CN104593385A (en) | Eimeria tenella gametophyte antigen gam59 gene and application thereof | |
| CN106554968A (en) | Schistosoma japonicum recombiant protein and its preparation method and application | |
| CN116462743B (en) | Acinetobacter baumannii translation elongation factor recombinant protein, preparation method and application | |
| CN104402974A (en) | Polypeptide with mucosal immunity adjuvant activity, and application of polypeptide in preparation of mucosal immunity adjuvant | |
| CN111925447B (en) | Human and mouse egg zona pellucida fusion protein and preparation method and application thereof | |
| CN112138154B (en) | Helicobacter pylori tetravalent adhesion factor GEM particle vaccine, preparation method and application | |
| RU2590701C2 (en) | Antigenic composition and therapeutic application thereof for preventing and treating oncological diseases, recombinant plasmid dna, providing synthesis of hybrid protein, as well as method of producing protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160525 |