CN101970005A

CN101970005A - Breaking immunological tolerance with a genetically encoded unnatural amino acid

Info

Publication number: CN101970005A
Application number: CN2009801045632A
Authority: CN
Inventors: J·格鲁瓦尔德; 曹梦麟; R·佩尔拉; R·A·勒纳; V·V·斯米德尔; P·G·舒尔茨
Original assignee: Scripps Research Institute
Current assignee: Scripps Research Institute
Priority date: 2008-02-08
Filing date: 2009-02-07
Publication date: 2011-02-09
Also published as: CA2712080A1; KR20100125290A; JP2011514322A; IL207013A0; BRPI0906388A2; US20110052525A1; EP2249865A4; WO2009099672A3; US8318172B2; WO2009099672A2; EP2249865A2; AU2009210677A1; US20090263376A1; MX2010008633A

Abstract

The present invention comprises methods and compositions for producing and/or enhancing an immunological response in a subject against a target moiety such as a disease-related moiety by administration of an antigenic version of the target moiety having one or more unnatural amino acid and/or by administration of an antibody against a version of a target moiety having one or more unnatural amino acid which antibody is cross reactive with the natural target moiety.

Description

Alpha-non-natural amino acid with genetic coding is broken immunologic tolerance

Make the rights statement of invention under the research and development of federal funding

The present invention carries out under from the government-funded of NIH (NIH), subsidy HL-16411 (5RO1GM62159).U.S. government enjoys some right of the present invention.

The cross reference of related application

The application requires the priority and the rights and interests of following U.S. Provisional Patent Application serial number: 61/065,148 of submission on February 8th, 2008; 61/065,515 of submission on February 12nd, 2008; 61/135,947 of submission on July 25th, 2008; 61/137,676 of submission on July 31st, 2008; 61/203,948 of December in 2008 submission on the 29th; 61/065,147 of submission on February 8th, 2008; 61/065,590 of submission on February 12nd, 2008; 61/135,969 of submission on July 25th, 2008; 61/137,635 of submission on July 31st, 2008; With 61/203,947 of December in 2008 submission on the 29th; Include its whole disclosures in this paper and be used for all purposes.

Technical field

The present invention relates to field of immunology.More specifically say, the invention provides by having mixed the immunogen corresponding to target part (be described self part or external part) of one or more alpha-non-natural amino acids, at the object autoantigen that creates antagonism, as the immunne response of TNF α or countless other autoantigens, perhaps produce and improve the compositions and the method for the antigenic immunne response of object antagonism external (non-self).

Background of invention

A major challenge in the modern medicine is to treat to cause that neither object produces the medical conditions that antibody (for example, owing to the immunologic tolerance of object to autoantigen) does not cause powerful/strong antibody response (for example, some antibacterial/viral infection) yet.There are a large amount of medical conditions to belong to this type.For example, produce from or the disease that relates to object oneself protein matter can comprise as TNF α (participating in/relate to Crohn disease, endotoxin shock, cerebral malaria etc.) IL 10 parts such as (participating in SLE).And object is difficult to produce powerful antibody for multiple virus and bacterial infection, as virus and bacterial infection, as HIV, CMV, tuberculosis and staphylococcus.

Multiple different schemes can be proposed to solve this type of immunne response problem.For example, this type of scheme is considered the adjuvant/carrier of improvement, introduces strong t cell epitope, coupling vaccine and combination-vaccine in antigen.Referring to for example Baldridge etc., " vaccine adjuvant: immunology and clinical principle " (Vaccine Adjuvants:Immunological and Clinical Principles.) C.J.Hackett, Harn, D.A.Jr. compiles. (Xiu Mana publishing company, New Jersey Tuo Tuowa), 235-255; Makela etc., Expert Rev Vaccines, 1 (3): 399-410 (2002); Dalum etc., Nat Biotechnol.17:666 (1999); And Restifo, Curr Opin Immunol8:658 (1996)..Other scheme attempts carrying out immunity with the antigen (that is the antigen of diazo derivativeization) of non-specific labelling.Referring to Weigle, J Exp Med121:289 (1965).

Yet, need to continue the immunological response of the method and composition of better broader applications, and/or antagonism is from the immunne response of the specific proteins of multiple pathogen such as antibacterial, virus, fungus and/or the prion disease original with generation or enhancing object antagonism specificity oneself protein matter such as TNF α.The invention provides these and other benefit, in case check will be clear.

Summary of the invention

The ability that in the vaccine that produces various disease states, has significant selective induction antagonism oneself protein matter, or the immunogenic ability of enhancing exogenous antigen defined epitope, described morbid state comprises cancer, protein folding disease and infectious disease (as antibacterial or viral infection).The present invention produces the non-natural immunogen that is used for vaccination by mix alpha-non-natural amino acid in protein, perhaps produces the antibody that is used for passive immunity.In the present invention, add the target part (as the disease association part) of the corresponding inoculation/immune object of immunogen of alpha-non-natural amino acid, perhaps the intravital target part of corresponding objects (as the disease association part).Give in the embodiment of object in the immunogen that will have alpha-non-natural amino acid, the existence of alpha-non-natural amino acid causes the immunogenic immunne response of antagonism, described immunne response cross reaction antagonism target (as disease association) part.

In first aspect, the invention provides in object the method that produces or strengthen antagonism target part as polypeptide, sugar or the immunne response that both make up, as B-cell-mediated reply and/or T-is cell-mediated replys, described target part is in object or can be in object.Described method comprises provides the non-natural that comprises one or more alpha-non-natural amino acids immunogen, and gives object with the non-natural immunogen.Immunogenic one or more antibody of object (as people, monkey, mice, rat, pig, milch cow, chicken, cageling, aviary bird, reptile and/or the Amphibian) non-natural that creates antagonism, wherein said antibody is at the cross reaction of target part (therefore producing or strengthen the immunogenic response of antagonism target).

Give object with produce or non-natural immunogen corresponding objects body that enhance immunity is replied at least one target part (or to should be able in intravital at least one part of object).In some embodiments, the target part can comprise first aminoacid sequence, the non-natural immunogen can comprise second aminoacid sequence identical with target sequence, except one or more natural amino acids of target partial sequence are replaced by one or more alpha-non-natural amino acids in the immunogen sequence.Perhaps or in addition, the target part can comprise first aminoacid sequence, and the non-natural immunogen can comprise second aminoacid sequence identical with the target partial sequence, except the immunogen sequence also comprises one or more other alpha-non-natural amino acid sequences.In various embodiments, the non-natural immunogen can comprise the similar substantially structure of target part to its origin, and/or can comprise three grade and/or the quarternary structure similar substantially to the target of its origin.

The one or more alpha-non-natural amino acids that occur in the non-natural immunogen can be approaching by antibody arbitrarily.One or more cross reacting antibodies that produce in this aspect method can be arbitrarily have specificity to the epi-position on the target part, described epi-position comprise with the non-natural immunogen on the identical sequence of corresponding epi-position.Yet cross reacting antibody can have specificity to the epi-position on the target part arbitrarily, compares with the immunogenic corresponding epi-position of non-natural, and described epi-position comprises different sequences, as comprising the different sequences of one or more alpha-non-natural amino acids arbitrarily.

In this respect, can produce the non-natural immunogen that originates from the target part by number of ways.In a preferred embodiment, use the orthogonal translation system to produce the non-natural immunogen.Yet the non-natural immunogen can produce (as mixing by selection pressure) in the translation system arbitrarily in vivo; In external translating system, produce (as using the tRNAs of alpha-non-natural amino acid chemistry acyl groupization); Produce by the technology except that post translational modification; Or produce by the technology that one of classical aminoacid of 20 kinds of natural generations occurring in the immunogen is carried out outside the chemical modification.

Mix the immunogenic alpha-non-natural amino acid of non-natural and can comprise any alpha-non-natural amino acid except that the classical aminoacid of 20 kinds of natural generations arbitrarily.The alpha-non-natural amino acid that can mix also can comprise the arbitrary aminoacid except that 20 kinds of classical aminoacid, and wherein said alpha-non-natural amino acid comprises following structure:

Wherein R is any substituent group any used side chain in 20 kinds of classical natural amino acids; R wherein ₁It is a kind of used substituent group in the natural amino acid of 20 kinds of classics; Wherein R2 is any substituent group, R2-R1 is formed together be different from 20 kinds of classical natural amino acids any side chain; Wherein Z is OH, NH ₂, SH, NH-R ' or S-R '; Wherein R ' is any substituent group except that H; And each S or O naturally of X and Y wherein, and if R ' be H, then R is the L conformation.In some embodiments, mixing immunogenic one or more alpha-non-natural amino acid can comprise following one or more arbitrarily: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl (boronyl) Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMe Phe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.

In some embodiments, produce or enhanced immunne response institute at target partly can right and wrong self part, as, derive from the part of antibacterial, virus, fungus, mycoplasma, protista, anthelmintic or PrPC.Non-self target part can comprise arbitrarily following one or more: bacterial antigens, virus antigen, fungal antigen, mycoplasma 1 antigen, protozoacide antigen, anthelmintic antigen, Protein virus antigen, HIV antigen, HIVgp120, HIV gp41, HIV gag, HIV pol, HIV env, HIV tat, HIV nef, HIV rev, Calicivirus capsid antigen, hepatitis B core antigen, hbs antigen, hepatitis reagent (hepatitis delta agent), herpes simplex virus glycoprotein, varicella zoster virus glycoprotein, influenza virus hemagglutinin, influenza neuraminidase, influenza virus nucleoprotein, HPV capsid protein, parainfluenza virus hemagglutinin/neuraminidase, the capsid of poliomyelitis polypeptide, Hep A antigen, vaccinia virus polypeptide, rabies virus glucoprotein G, Borrelia burgdoyferi (B.burgdorferi) OspA, Type B OMP26, mycobacterium tuberculosis lipoarabinomannan, mycobacterium tuberculosis mAPG, streptococcus pyogenes M albumen, streptococcus pneumoniae capsular polysaccharide, Yersinia pestis F1, Yersinia pestis V antigen, Plasmodium falciparum ring sporinite (PfCSP), Plasmodium falciparum sporinite surface protein 2 (PfSSP2), Plasmodium falciparum liver classification antigen 1 carboxyl terminal (PfLSA1 c end), Plasmodium falciparum output protein 1 (PfExp-1), Pfs 48/45, and Pfs 28, Pfs 25 or Pfs 230.

Target non-self the part can derive from arbitrarily (originating from) following one or more: antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, Protein virus, actinomycetes, bacillus cereus, bacteroid, bordetella bacilli, Bartonella, the Borrelia bacterium, brucella, Campylobacter, the carbon dioxide Cytophaga, chlamydia, clostridium, corynebacterium, the cock steadite, sandflea, enterococcus, dust Garrick body, escherichia coli, francis fungus, Fusobacterium, the blood bartonia bodies, haemophilus, twine bacillus, Klebsiella pneumoniae, L type antibacterial, leptospira, the Listerella, mycobacteria, mycoplasma, Neisseria, new rickettsia, Nocard's bacillus, pasteurellosis bacillus, dyspepsiacoccus, peptostreptococcus, streptococcus pneumoniae, Bacillus proteus, pseudomonas, rickettsia, Rochalimaea, Salmonella, dysentery bacterium, staphylococcus aureus, streptococcus, spirillum, yersinia, adenovirus, Alphavirus, Calicivirus, coronavirus, cytomegalovirus, canine distemper virus, Ebola virus, enterovirus, Epstein-Barr virus, banzi virus, hepatitis C virus, hepadnavirus, hepatitis B virus, hepatitis, penta type or own Hepatitis virus, GBV-C, herpesvirus, herpes simplex virus, varicella zoster virus, immunodeficiency virus, HIV (human immunodeficiency virus), infectious peritonitis virus, influenza virus, A type influenza virus, leucovirus, Marburg virus, influenza virus, human papillomavirus, HPV, parainfluenza virus, paramyxovirus, RSV, parvovirus, Pestivirus, picornavirus, poliovirus, poxvirus, vaccinia virus, rabies virus, reovirus, retrovirus, rotavirus, colter is mould, prop up the top spore, chain lattice spore, aspergillosis, one basidiobolus haptosporus, bipolar mould, the ascus yeast, candidiasis, candida mycoderma, one ear is mould, cryptococcus, leaf spoting bacteria, epidermophyton, outer Saksenaea vasiformis, ground silk bacterium, histoplasma capsulatum, Madura branch bacterium, chlosma, sporidiole bacteria, Xiao Cong obstructs spore, Mortierella, Mucor, Paecilomyces varioti, penicillium sp, the unit cell Saksenaea vasiformis, Saksenaea vasiformis, chlorella, the swollen bacterium of foot, false little holder bacterium, rotten mould, the nose sporozoon, rhizopus, the wire basidiomycetes, sporothrix, the handle of crawling is mould, trichophyton, trichosporon bacteria, wood wool is mould, this worm of BABEI, balantidium Coli, sporozoon, Cryptosporidium, eimeria, Encephalocytozoon, entamoeba, giardia lamblia, the Hammond worm, the liver gregarina, isospora, Leishmania, microsporidian (Microsporidia), neospora, microsporidian (Nosema), pentatrichomonas ardin delteili, plasmodium, Plasmodium falciparum, the lung sac worm, sarcocystis, schistosomicide, the Old Taylor worm, toxoplasma, trypanosomicide, sour jujube lip worm, the cat strongylid, ancylostome, the pipe strongylid, ascarid, cloth Lu Geshi filaricide, Bunostomum trigonoce phalum, capillaria, the Xia Shi nematicide, cooperid, the ring body nematicide, the net filaria, swollen knot worm, the sour jujube filaria labialis, cestode, multiple hole cestode, dislike filaricide, the dragon nematicide, pinworm, the class filaricide, haemonchus, the cleftlip ascarid, Lip river Ah's polypeptide, mansonellosis, Muellerius, dwarf's shape trematodiasis, ancylostome, nematodirus, oesophagostome, dish tail worm, back testis trematodiasis, the stomach nematicide, the paranema worm, lung fluke, secondary ascarid, bubble wing nematicide, former roundworm, the abdominal cavity filaricide, revolve filaria, the palace cestode, the crown wire worm, quasi-colubriformis, strongylid, suck nematicide, bow ascarid nematicide, bend first ascarid, trichinella, the iris ancylostome, Trichocephalus, ancylostome, or Wuchereria.

In other embodiment of the present invention, produce or target part that enhanced immunne response is resisted can comprise self part of object arbitrarily.Self partly can comprise any multiple disease association part arbitrarily, as the relevant autoantigen of autoimmune disease, tumor associated antigen, the Alzheimer's disease related antigen, amyloid beta 40, amyloid beta 42, breast cancer correlation antigen, the ovarian cancer related antigen, the carcinoma of prostate related antigen, MAGE, BAGE, RAGE, NY-ESO, pedigree specific tumour related antigen, melanocyte-melanoma pedigree antigen, MART-1/Melan-A, tryrosinase or tyrosinase-related protein matter, tyrosinase-related protein matter 2, PSMA, PSA, the ras of sudden change, the bcr/ab1 that resets, Her2/neu, sudden change or wild type p53, Cytochrome P450 1B1, the intron sequences of the unconventionality expression of N-acetylglucosaminyltransferase-V, CA19-9, p53, OCAA, HOXB7, Cal25, PSA, PSMA, STEAP, PCTA-1, Ca15-3, EGF, EGFR, HER-1, CXCR4, g protein coupled receptor (GCPR) or CA27-29.

In some embodiments, target self partly is TNF α, and the non-natural immunogen is non-natural TNF α.For example, be in the embodiment of mice at object, target part can be mTNF α, and immunogen can be non-natural mTNF α, as comprises pNO ₂Phe ⁸⁶-mTNF α, pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α or pNO ₂Phe ¹¹³The non-natural mTNF α of-mTNF α.

Similar, when to as if man-hour, target self part can be hTNF α, and immunogen can be non-natural hTNF α, as pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

On the other hand, the present invention the method for morbid state in the preventative or therapeutic treatment object, as, by in object, produce B-cell-mediated reply and/or T-is cell-mediated replys.In various embodiments, morbid state include but not limited to following one or more: autoimmune disease, cancer, bacterial infection, viral infection, fungal infection, mycoplasma infection, prion infection, protozoal infections or helminthic infection.A set of this aspect method comprises that the non-natural immunogen that will comprise one or more alpha-non-natural amino acids gives object, as people, monkey, mice, rat, milch cow, pig, chicken, cageling, aviary bird, reptile and Amphibian.Therefore the non-natural immunogen stimulates and produces the antibody that cross reaction resists one or more targets parts as intravital polypeptide of object and/or sugar in the subject, or resists one or more can be in subject relevant with morbid state target parts.In second set of method aspect this, the present invention includes antibody, the interior morbid state of preventative or therapeutic treatment subject by the one or more target parts (as the disease association part relevant) that create antagonism with morbid state/situation.Produce this antibody-like and comprise that the creation antagonism comprises the immunogenic antibody of non-natural of one or more alpha-non-natural amino acids, wherein said antibody cross reaction antagonism target part.Give object with antibody then.

Intravital at least one target part of the common corresponding objects of non-natural immunogen in this aspect method (perhaps to should be able in intravital at least one the target part of object).In numerous embodiments, the target part can comprise first aminoacid sequence, the non-natural immunogen can comprise second aminoacid sequence identical with target sequence, except one or more natural amino acids of target partial sequence are replaced by one or more alpha-non-natural amino acids in the immunogen sequence.Perhaps or in addition, the target part can comprise first aminoacid sequence, the non-natural immunogen can comprise second aminoacid sequence, and wherein the immunogen sequence is identical with the target partial sequence, except the immunogen sequence also comprises one or more other alpha-non-natural amino acid sequences.The non-natural immunogen can comprise the similar substantially structure of target part to its origin, and/or can comprise three grade and/or the quarternary structure similar substantially to the target of its origin.

The one or more alpha-non-natural amino acids that occur in the non-natural immunogen in this aspect method can be approaching by antibody arbitrarily.One or more cross reacting antibodies can be arbitrarily have specificity to the epi-position on the target part, described epi-position comprise with the non-natural immunogen on the identical sequence of corresponding epi-position.Yet cross reacting antibody can have specificity to the epi-position on the target part arbitrarily, compares with the immunogenic corresponding epi-position of non-natural, and described epi-position comprises different sequences, as comprising the different sequences of one or more alpha-non-natural amino acids arbitrarily.

In the different embodiments aspect this, giving immunogen object or that create antagonism its antibody can produce by aforementioned aspect or other local described any method of this paper.The non-natural immunogen can comprise any alpha-non-natural amino acid arbitrarily, as described above other local described any alpha-non-natural amino acid of aspect or this paper.Target part can comprise non-self part part arbitrarily, as comprises other local described any non-self part of aforementioned aspect or this paper, as disease association self part, as described above aspect or this paper other local described those.

In some embodiments aspect this, target partly is TNF α, and the method for preventative or therapeutic treatment morbid state can comprise one or more that handle following morbid state arbitrarily: endotoxin shock, cerebral malaria, autoimmune disease, multiple organ dysfunction syndrome, multiple sclerosis, heart dysfunction, atherosclerosis, ischemical reperfusion injury, insulin resistant, rheumatoid arthritis, Crohn disease, inflammatory bowel, cachexia, septic shock, acquired immune deficiency syndrome (AIDS), graft versus host disease, the sterilization granuloma, adult respiratory distress syndrome, silicon dioxide causes pulmonary fibrosis.

In some embodiments, wherein said to as if mice, target part can be mTNF α, and immunogen can be non-natural mTNF α, as non-natural mTNF α, comprises pNO ₂Phe ⁸⁶-mTNF α, pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.To as if some embodiments of people in, self part can be hTNF α, and immunogen can be non-natural hTNF α, as pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

On the other hand, the invention provides the method (and the vaccine that produces) that produces vaccine, these class methods comprise that evaluation does not comprise the target part of alpha-non-natural amino acid, as polypeptide and/or sugar, be used for antibody therapy, the qigong comprises the non-natural immunogen of one or more alpha-non-natural amino acids, and with non-natural immunogen and one or more pharmaceutically acceptable adjuvants, carrier or mixed with excipients, thereby produce vaccine.The non-natural immunogen that provides in these methods can be similar to the target part-structure, thereby when giving object, other places of aspect or this paper are described as described above, and this object will produce and the immunogenic antibody of target part cross reaction antagonism non-natural.

Intravital at least one target part of non-natural immunogen corresponding objects in this aspect method (perhaps to should be able in intravital at least one the target part of object).In numerous embodiments, the target part can comprise first aminoacid sequence, the non-natural immunogen can comprise second aminoacid sequence identical with target sequence, except one or more natural amino acids of target partial sequence are replaced by one or more alpha-non-natural amino acids in the immunogen sequence.Perhaps or in addition, the target part can comprise first aminoacid sequence, the non-natural immunogen can comprise second aminoacid sequence, and wherein the immunogen sequence is identical with the target partial sequence, except the immunogen sequence also comprises one or more other alpha-non-natural amino acid sequences.The non-natural immunogen can comprise the similar substantially structure of target part to its origin, and/or can comprise three grade and/or the quarternary structure similar substantially to the target of its origin.

The alpha-non-natural amino acid that occurs in the non-natural immunogen can be approaching by antibody arbitrarily.One or more cross reacting antibodies can be arbitrarily have specificity to the epi-position on the target part, described epi-position comprise with the non-natural immunogen on the identical sequence of corresponding epi-position.Yet cross reacting antibody can have specificity to the epi-position on the target part arbitrarily, compares with the immunogenic corresponding epi-position of non-natural, and described epi-position comprises different sequences, as comprising the different sequences of one or more alpha-non-natural amino acids arbitrarily.

In various embodiments, provide immunogen itself to produce by aforementioned aspect or other local described any methods of this paper to produce vaccine.The non-natural immunogen also can comprise other local described alpha-non-natural amino acids of aforementioned aspect or this paper arbitrarily.Target part can comprise non-self part arbitrarily, as comprises above-mentioned aspect or this paper other local described any non-autoantigen or part, as disease association self part, and other local described any part in those of aspect or this paper as described above.

In some embodiments of this aspect, target self part can be TNF α, for example, to as if the embodiment of mice in, target self part can be mTNF α, and immunogen can be non-natural mTNF α, as non-natural mTNF α, comprises pNO ₂Phe ⁸⁶-mTNF α, pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.To as if some embodiments of people in, target self part can be hTNF α, and immunogen can be non-natural hTNF α, as pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ²Phe ⁸⁷-hTNF α, pNO ²Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

On the other hand, the present invention also provides to produce in cell and has comprised pNO ₂Phe ⁸⁶The method of the non-natural TNF α of-TNF α.Described method is included in cultured cell in the suitable culture medium.In this type of embodiment, cell can comprise the nucleic acid of coding TNF α, and comprises at least one selectivity codon in 86 amino acids.Cell also can comprise the quadrature-tRNA (O-tRNA) of identification selection codon, and preferentially uses pNO ₂The quadrature aminoacyl-tRNA synthetase (O-RS) of Phe amidatioon O-tRNA.Described method also comprises provides pNO ₂Phe, it allows preferentially to use pNO ₂(O-RS) of Phe amidatioon O-tRNA, and allow the quadrature aminoacyl-tRNA synthetase with pNO ₂Phe is incorporated into 86 amino acids of corresponding selection codon, thereby produces non-natural TNF α.Other embodiment of this paper comprise by similar be modified at any desired location use any required alpha-non-natural amino acid produce the immunogenic method of any other non-natural (as, required immunogenic nucleic acid, suitable selectivity codon in desired location, there is required alpha-non-natural amino acid s, and the quadrature machine ORS of suitable correspondence, OtRNA etc.).

The present invention also provides non-natural TNF α.Non-natural mTNF α provided by the invention comprises pNO ₂Phe ⁸⁶-mTNF α, pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.Non-natural provided by the invention comprises pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α, pNO ₂Phe ¹¹⁴-hTNF α, this paper also provide the compositions that comprises these non-naturals TNF α.

The present invention also provides the antibody that resists above-mentioned non-natural TNF α, and the compositions that comprises these antibody.The present invention also provides the cross reaction antagonism not comprise the natural TNF α of any alpha-non-natural amino acid and the antibody that comprises the TNF α of one or more alpha-non-natural amino acids, and the compositions that comprises these antibody.

The present invention also provides and has comprised pNO ₂Phe ⁴³The non-natural mRBP4 of mRBP4, and the compositions that comprises this non-natural mRBP4.In addition, the invention provides the antibody of this non-natural of antagonism mRBP4, the antagonism of described antibody intersection does not contain the RBP4 of alpha-non-natural amino acid, and the compositions that comprises these antibody.

At the different aspect of this paper, mix the immunogenic one or more alpha-non-natural amino acids of non-natural and in the process of synthetic immunogen, finish.In some embodiments, by the technology except that post translational modification or synthetic back chemical modification one or more alpha-non-natural amino acids are mixed the non-natural immunogen.Therefore, in various embodiments, by following one or more modes one or more alpha-non-natural amino acids are incorporated in the non-natural immunogen: orthogonal translation; External translation; Native chemical connects; Marking protein connects; Or solid phase synthesis.In the different embodiments of this paper; the non-natural immunogen comprises one or more in the classical aminoacid of 20 kinds of natural generations, described aminoacid by glycosylation, nitro aryl modify, nitrated, alkanisation, acetylation, oxidation, sulphation or phosphorylation (as by the technology except post translational modification or by the technology glycosylation except chemical modification, the modification of nitro aryl, nitrated, alkanisation, acetylation, oxidation, sulphation or phosphorylation).

In some embodiments, the invention provides and comprise test kit or the article that are used to make the method for the invention and compositions.This type of test kit can comprise one or more containers, label and description arbitrarily, and the component that is used to make up antibody and/or non-natural immunogen and/or real antiserum and/or non-natural immunogen (as non-natural TNF α s).Test kit also can comprise arbitrarily one or more antibody (as, the immunogenic antibody of antagonism non-natural, intravital natural target partly of described antibody cross reaction antagonism object) and/or one or more non-natural immunogens and other component (as various antibiotic, various antifungal drugs etc.) arbitrarily.This type of non-natural immunogen includes but not limited to: any one or multiple non-natural TNF α provided by the invention, perhaps any other non-natural immunogen as herein described.Test kit also comprise arbitrarily test tube or other container (as, containers such as glass, plastics, nylon, cotton, polyester, metal) be used for storage component, perhaps mixing/preparation component therein, and one or more carry out object (as, need the people of treatment etc.) equipment of administration.In some embodiments, carrying out equipment that object gives component comprises and storing and/or the container of mixing/preparation component.

Test kit also comprises other components except that antibody of the present invention/non-natural immunogen component arbitrarily, as buffer, diluent, filter, dressing, binder, shower nozzle, gauze, barrier, semipermeable barrier, inferior house plate, syringe needle and syringe etc.

In some embodiments, test kit comprises and relates to the description (as written guidance) of using one or more medical conditions/morbid states of test kit treatment target.In some embodiments, test kit comprises URL address that user contact instructs or telephone number etc.Test kit can be a unit dose, bag in bulk (multiple dosing packing) or subunit dosage.

Those skilled in the art understand that method and composition of the present invention can use separately or with other coupling.

After reading hereinafter detailed description and accompanying drawing and claim, these and other characteristics of the present invention will be distinct more fully.

Definition

Carrying out before the present invention describes in detail, should be understood that the invention is not restricted to particular device or biology system, they can be diversified certainly.。Be to be understood that term as used herein is only in order to describe specific embodiment rather than restrictive.Used singulative " " in this description and claims, " a kind of " and " being somebody's turn to do " comprises a plurality of indicants, unless tangible expression is arranged in the context.Comprise the combination on two or more surfaces when therefore, for example, mentioning " surface "; Comprise the mixture of antibacterial etc. when mentioning " antibacterial ".

Unless otherwise defined, as used herein all technology all the common sense with one of ordinary skill in the art of the present invention is consistent with scientific terminology.Though also can adopt to similar or any method of being equal to described herein and material is implemented or test the present invention, preferable methods and material are described below.In explanation and claimed process of the present invention, will be according to use following term to give a definition.

Antibody: one or more polypeptide that " antibody " used herein is encoded by immunoglobulin gene or immunoglobulin gene fragment wholly or in part.The immunoglobulin gene of generally acknowledging comprises κ, λ, α, γ, δ, ε and μ constant region gene, and countless immune globulin variable region genes.Light chain is categorized as κ or λ.Heavy chain classifies as γ, υ, α, δ or ε, and they define immunoglobulin class IgG, IgM, IgA, IgD and IgE respectively successively.The structural units of a kind of typical immunoglobulin (as antibody) comprises the tetramer.To forming, each is to having one " light chain " (about 25kD) and one " heavy chain " (about 50-70kD) by two identical polypeptide chains for each tetramer.The N-terminal of each chain is determined the about 100-110 or the variable region of amino acids more, mainly responsible antigen recognition.Term variable region of light chain (VL) and variable region of heavy chain (VH) refer to these light chains and heavy chain respectively.

Antibody can be complete immunoglobulin or exist with the fragment that different peptide enzymic digestions produce many well-characterized.Therefore, for example, digestion antibody below two sulfur of pepsin in hinge region connect produces F (ab ') ₂, the dimer of Fab itself is to be connected in by disulfide bond

Light chain.Can under temperate condition, reduce F (ab ') ₂Connect with two sulfur that interrupt in the hinge region, thereby with F (ab ') ₂Dimer is converted into Fab ' monomer.Fab ' monomer comes down to have the Fab (referring to, " basic immunology " (Fundermental Immunology), W.E.Paul compiles, Raven Press, N.Y. (1999) to the more detailed description of other antibody fragment) of part hinge region.Though the digestion according to complete antibody has defined the different antibodies fragment, it will be understood by those skilled in the art that also available chemical method or the described Fab ' fragment of method de novo synthesis by recombinant DNA etc.Therefore, used herein term antibody also comprises the antibody fragment of modifying or being produced with the recombinant DNA method de novo synthesis by whole antibody.Antibody comprises single-chain antibody, comprises strand Fv (sFv or scFv) antibody, wherein by variable heavy chain and variable light chain link together (directly or via peptide linker) form successive polypeptide.

Can combine with in the different piece each with the antibody of two or more different pieces " cross reaction ", as by ELISA, FACS or additive method known to the those skilled in the art.For example, with non-natural TNF α alpha-non-natural amino acid as described herein in any as pNO ₂Phe ⁸⁶The bonded antibody of mTNF α, and combine with born (or natural) TNF α (it does not comprise any), therefore with two parts cross reaction.In the specific embodiment kind of this paper, the natural version of antagonism non-natural proteinic antibody cross reaction same protein (be identical but do not comprise the protein of alpha-non-natural amino acid).In various embodiments, with the bonded antibody of non-native molecules with the natural version cross reaction of about 1-50% or 50-100% or more and the same molecular of non-native molecules binding ability.

Antigen: term used herein " antigen " refers to induce in the object kind of carrying out immunity with it molecule or material of antibody response.Antigen can be chemical compound protein, peptide, sugar, nucleic acid, lipid, hapten or other natural generation or synthetic (or its combination).Antigen can be as inborn (self) antigen, maybe can derive from as antibacterial, virus, parasite, fungus etc.This term is also amplified and is kinds of tumors antigen, autoimmune disease related antigen etc.

Homology: term " homology " refers to bring into play together the component of function, or the specificity that has certain aspect each other, and as quadrature tRNA (O-tRNA) and quadrature aminoacyl-tRNA synthetase (O-RS), wherein the O-RS specificity is with alpha-non-natural amino acid amidatioon O-tRNA.

Derived from:Term used herein " derived from " refer to separate from specific molecular or biology, or certain component that makes with specific molecular or biological sequence information.For example, the polypeptide derived from second polypeptide contains and the identical or substantially similar aminoacid sequence of this second amino acid sequence of polypeptide.With the polypeptide is example, can pass through, and for example mutation of natural generation, artificial orientation's mutation or artificial random mutagenesis obtain deutero-kind.The mutation of polypeptide of being used to derive can be to have a mind to directed or have a mind at random, or uses two kinds of methods with.The mutation polypeptide can be at random (for example, polymerase distortion due to) to produce not homopolypeptide derived from first (polypeptide), can pass through suitable screening technique, for example the method evaluation polypeptides derived described in the list of references quoted of this paper.The mutation polypeptide need be operated the polynucleotide of this polypeptide of encoding usually.

The target partOr target molecules: " target part ", " target molecules ", " target proteins matter part ", " target antigen " etc. refer to the part as protein, peptide, sugar, fat, nucleic acid or this type of combination, by using the present invention, resist described part expectation creation/enhance immunity and reply.Therefore, the target part can be born (self) or exogenous (external) molecule.Should be understood that quoting of specific embodiment herein, should not be considered as restrictively that and target part (and therefore non-natural immunogen corresponding with it) can be any molecule that needs immunne response as, TNF α.Therefore, target partly is to carry out simulation of non-natural immunogen or design on its basis, derives, with it Dui Ying part.As hereinafter describing in detail, the non-natural immunogen comprises identical with the target part or essentially identical sequence, except comprising one or more alpha-non-natural amino acids, the non-natural immunogen (and creates freely, the orthogonal translation system, external translating system etc., and/or by the method except post translational modification or chemical modification).In many embodiments, target partly is the disease association part, promptly in subject because morbid state (as, cancer, autoimmune disease causes from infectious organism or by it,, mycoplasma white as antibacterial, virus, soft egg, fungus, parasite etc.) part that causes or occur.Natural target part (promptly not comprising alpha-non-natural amino acid) can be antigenic/and immunogenic or really not so (as being weak immunogenicity).In the specific embodiment, the non-natural version of target part (as similar with natural target part but comprise with one or more alpha-non-natural amino acids and replace corresponding natural amino acid in the targets part, and/or adding aminoacid in the target part) is antigenic and/or immunogenic (and no matter whether natural target is antigenicity and/or immunogenicity partly).This type of non-natural target partly is described as " non-natural target part ", " non-natural antigen ", perhaps more usually is described as " non-natural immunogen " etc.Therefore, herein " non-natural " immunogen, partly, molecule etc. comprises one or more alpha-non-natural amino acids.In some this non-naturals parts, alpha-non-natural amino acid can be all or arbitrarily by antibody near (can be in conjunction with the zone of the part that comprises alpha-non-natural amino acid) as, antibody.

Effective dose: term " effective dose " refers to be enough to produce required result's dosage or amount.Required result can be included in objective or subjective improving among the receiver of dosage or amount (as producing cross reacting antibody, long-term surviving, the minimizing of tumor number and/or size, effectively prevention or partial prophylaxis morbid state etc.).

Coding:Term used herein " coding " is meant that the information in polymer macromolecule or the sequence string is used to instruct any program of the synthetic institute foundation of second molecule different with first molecule or sequence string or sequence string.In this article, this term is of many uses, serves many purposes.In some aspects, term " coding " is used to describe the process of DNA half conservative replication, and wherein double chain DNA molecule chain is as template, by the synthetic new complementary sisters' chain of the dependent archaeal dna polymerase coding of DNA.On the other hand, term " coding " is meant that an intramolecular information is used to instruct any program of the synthetic institute foundation of chemical property second molecule different with first molecule.For example, dna molecular codified RNA molecule, for example, by the transcription that has the dependent RNA polymerase of DNA to participate in.In addition, RNA molecule codified polypeptide is as translation process.When term " coding " when being used to describe translation process, this term also refers to the codeword triplet of coded amino acid.In some aspects, the RNA molecule is the codified dna molecular also, for example, and by the reverse transcription process that has the dependent archaeal dna polymerase of RNA to participate in.On the other hand, dna molecular codified polypeptide, " coding " is appreciated that the situation that not only comprises transcription but also comprise translation process at this moment.

Immunogen:" immunogen " used herein refers to give arbitrarily the part of object induce immune response." non-natural immunogen " refers to comprise the part of one or more alpha-non-natural amino acids, as the target part, as the disease association part, it can be given the object induce immune response.Referring to above.For non-natural immunogen of the present invention, serum antibody, B-cell and/or the T-cell cross reaction easily antagonism that produces by this type of immunne response do not comprise alpha-non-natural amino acid natural target part (as, the part of immunogen origin, the part of simulating on its basis/designing, and corresponding part), create antagonism the thus immunne response of natural target part.Therefore, in some embodiments, the non-natural immunogen can be induced the protective immune response (perhaps being used for the treatment of morbid state) of antagonism disease, the natural target part correlation (or the non-natural immunogen is corresponding with it) that described disease and non-natural immunogen are originated.

Immunogenic composition: " immunogenic composition " is the compositions that comprises one or more molecules, and compositions is given to cause in subject body fluid and/or cellullar immunologic response partly behind the object.Immunogenic composition boundary is as can be known introduced in the accepting object body, as by injection, suction, oral, intranasal and mucosa (as, internal rectum or intravaginal) administration.

Immunological responseOr Immunne response: " immunological response " or " immunne response " for (target) part or its compositions refers to produce for the cell of part and/or antibody-mediated immunne response in subject.Usually, immunne response includes but not limited to down one or more in the column effect: produce antibody (preferably), B cell, helper T cell, suppressor T cell and/or cytotoxic T cell and/or gamma delta T cells, one or more antigens of selectively targeted (target) part.In various embodiments, object shows therapeutic or preventative immunological response, has therefore strengthened the tolerance for (target) part, and/or reduced (target) part caused/clinical severity of the morbid state of being correlated with.

Right ... response:The term " right ... response " that this paper is used for producing non-native molecules refers to that O-tRNA identification selection codon and mediation and the link coupled alpha-non-natural amino acid of tRNA mix the process in the polypeptide chain of growth.

Orthogonal:In this article, term " orthogonal " is meant a kind of molecule, as quadrature tRNA (O-tRNA) and/or quadrature aminoacyl-tRNA synzyme (O-RS), compare its efficient with the corresponding molecule of cell or translation system during with the endogenous component functionating of cell and reduce, perhaps can't functionating with the endogenous component of cell.For tRNA and aminoacyl tRNA synthetase, when being meant quadrature tRNA with endogenous tRNA synzyme functionating, quadrature compares with endogenous tRNA synzyme form function with endogenous tRNA, compare with endogenous tRNA form function with endogenous tRNA synzyme when perhaps the quadrature aminoacyl tRNA synthetase is with endogenous tRNA functionating, invalid or efficient reduces, and for example efficient is lower than 20%, 10%, 5% or 1%.The quadrature molecule lacks the function of normal endogenous complementary molecule in cell.For example, tRNA compares with endogenous RS aminoacylation endogenous, and the efficient of the intracellular quadrature tRNA of endogenous RS aminoacylation that cell is all reduces, and perhaps efficient is 0.In another embodiment, tRNA compares with endogenous RS aminoacylation endogenous, and the efficient of all endogenous purpose tRNA of quadrature RS aminoacylation cell all descends, and perhaps efficient is 0.The second quadrature molecule can be imported in the cell with the first quadrature molecule functionating.For example, quadrature tRNA/RS is to comprising the complement components of importing, the two functionating together in cell, with contrast as corresponding tRNA/RS endogenous to or active quadrature right, its efficient is contrast, for example, 45%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, 99% or higher.

The quadrature aminoacyl tRNA synthetase:Quadrature aminoacyl tRNA synthetase as used herein (O-RS) refers to use the enzyme of the preferential amidatioon O-tRNA of aminoacid in interested translation system.The aminoacid that is loaded on the O-tRNA by O-RS can be any aminoacid, no matter natural, non-natural or artificial, this paper does not limit.Preferably with the identical or homologous synzyme of the tyrosyl amino acid synthetase of natural generation, perhaps identical or homology with the synzyme of being appointed as OR-S.

Quadrature tRNA:Quadrature tRNA used herein (O-tRNA) refers to and the orthogonal tRNA of translation system interested, wherein tRNA is, identical or similar substantially as (1) with the tRNA of natural generation, (2) derive from by tRNA natural or the natural generation that induced mutations produces, (3) derive from and any wild in (1) or (2) or sudden change tRNA sequence are considered wherein technology, (4) and wild type or sudden change tRNA homology; (5) with any tRNA example homology that is designed to quadrature tRNA synzyme substrate, or (6) any examples of conservative variations that is designed to the tRNA example of quadrature tRNA synzyme substrate.O-tRNA can carry amino acid whose state and exist, and perhaps exists with non-carrier state.It is to be further understood that similar synzyme uses alpha-non-natural amino acid can make " O-tRNA " to be in carrier state (amidatioon) arbitrarily.In fact, should be understood that in transcribing,, be easy to use O-tRNA any basically alpha-non-natural amino acid is inserted in the polypeptide of growth as response for the selectivity codon.

Pharmaceutical composition: term " pharmaceutical composition " refers to the compositions that is fit to object Chinese materia medica purposes or gives object (comprising the animal or human) medicine herein.Pharmaceutical composition comprises the active medicine of effective dose usually, as antibody of the present invention and/or non-natural immunogen, and pharmaceutically acceptable carrier, buffer, adjuvant etc." pharmaceutically acceptable " or " pharmacology is last acceptable " material refers to abiology or other unwanted material, when promptly in preparation or compositions, giving individuality, do not cause any (or seldom causing) unwanted biological effect or with compositions in any component interact in harmful mode.

Polypeptide: polypeptide is meant any length, usually but definitely be not any oligomer of the amino acid residue that linked together by the covalency peptide bond (natural or non-natural, or its combination).Polypeptide can be any source, for example, and the polypeptide in natural polypeptides, polypeptide, cell and translation system source or the polypeptide for preparing with acellular synthesis mode by the preparation of recombinant molecule gene technology.The feature of polypeptide is by its aminoacid sequence decision, and for example, it forms the primary structure of amino acid residue.In this article, amino acid sequence of polypeptide is not limited to full length sequence, also may be partial sequence or complete sequence.In addition, this and do not mean that according to having or do not have any particular organisms activity and limit polypeptide.In this article, term " protein " is the synonym of polypeptide.Term " peptide " is meant little polypeptide, for example is not limited to the polypeptide of 2-25 amino acid length.

Preferred amideization:In this article about in the orthogonal translation system, in expression system, when O-RS makes O-tRNA carry aminoacid to make any endogenous tRNA efficient higher than it, the similar O-tRNA of O-RS " preferential amidatioon ".Promptly when O-tRNA and any given endogenous tRNA appear in the translation system with the approximately equal mol ratio, it is higher than making endogenous tRNA and carry (aminoacid) frequency that O-RS makes O-tRNA carry (aminoacid).The relative scale height of the endogenous tRNA that the O-tRNA that preferred O-RS carries and O-RS carry, when O-tRNA and endogenous tRNA appear in the translation system with the approximately equal mol ratio preferred O-RS only to or near O-tRNA being carried.When O-tRNA and endogenous tRNA existed with equal molar ratio, the relative scale of O-tRNA that O-RS carries and endogenous tRNA was greater than 1: 1, preferably at least about 2: 1, more preferably 5: 1, more preferably 10: 1, more preferably 20: 1, more preferably 50: 1, more preferably 75: 1, more preferably 95: 1,98: 1,99: 1,100: 1,500: 1,1,000: 1,5,000: 1 or higher.

When (a) compares with endogenous tRNA, O-RS preferred amide O-tRNA, (b) use any natural amino acid amidatioon O-tRNA to compare with O-RS, amidatioon has specificity for alpha-non-natural amino acid, and O-RS " preferably uses alpha-non-natural amino acid to carry out amidatioon ".That is, when non-natural and natural amino acid appeared in the translation system that contains O-tRNA and endogenous tRNA with equal molar ratio, O-RS loaded the frequency ratio natural amino acid height of O-tRNA with alpha-non-natural amino acid.Preferably carry the O-tRNA and the O-tRNA ratio height that carries natural amino acid of alpha-non-natural amino acid.More preferably, O-RS only with or near only O-tRNA being carried with alpha-non-natural amino acid.When natural aminoacid and alpha-non-natural amino acid existed with equal molar ratio, the relative scale of O-tRNA of carrying the O-tRNA of alpha-non-natural amino acid and carrying natural amino acid was greater than 1: 1, preferably at least about 2: 1, more preferably 5: 1, more preferably 10: 1, more preferably 20: 1, more preferably 50: 1, more preferably 75: 1, more preferably 95: 1,98: 1,99: 1,100: 1,500: 1,1,000: 1,5,000: 1 or higher.

Preventative processing:" preventative processing " refers to when object does not show the indication of disease, pathology or medical science imbalance or symptom, or the processing that object is given when only showing the indication of early stage disease, pathology or medical science imbalance or symptom, therefore the purpose of handling be reduce, prevention or reduce the risk that disease, pathology or medical disorder take place.The preventative preventative processing of handling as antagonism disease or imbalance." preventative activity " refers to the activity of medicine, when this type of non-natural immunogen of the object that gives not show pathology, disease or disorderly indication or the symptom object of early stage indication or symptom (or only show) and/or antibody or during compositions, reduce, prevention or reduce the risk of object generation disease, pathology or medical disorder.Medicine that " prevents useful " or chemical compound (as non-natural immunogen of the present invention and/or antibody) refer to be used to reduce, prevent or reduce medicine or the chemical compound that disease, pathology or medical disorder take place.

Optant's codon:But term " optant's codon " is meant in translation process the codon of can be by O-tRNA identification can not be discerned by endogenous tRNA.The O-tRNA anticodon loop can be discerned the optant's codon on the mRNA, and its aminoacid such as alpha-non-natural amino acid are inserted on this site of polypeptide.Optant's codon comprises, for example nonsense codon such as termination codon, amber codon, ochre codon, opal codon; Four bases or polybase base codon; Rare codon; The codon in natural or non-natural base pair source and/or or the like.

Object:Term used herein " object " includes but not limited to mammal, comprise as people, non-human primates (as monkey), mice, pig, milch cow, goat, rabbit, rat, Cavia porcellus, hamster, horse, monkey, sheep or other non-human mammal, or nonmammalian, as non-suckling vertebrates, as bird (as chicken or duck).In some embodiments, method and composition of the present invention is used for handling (preventative and/or therapeutic) non-human animal.Many animals that important commercial value arranged for can use arbitrarily that the present invention handles as cancer or autoimmune disorder or various infection (as virus/antibacterial etc.) susceptible.

Therapeutic treatment:" therapeutic treatment " shows the processing of giving the object that shows pathology, disease or disorderly indication or symptom, the purpose that wherein gives object handles is to reduce or eliminate these pathology, disease or disorderly indication or symptom, as cause the morbid state of these indication/symptoms usually by minimizing and/or elimination." therapeutic activity " refers to the activity of medicine, when giving this type of non-natural immunogen of ill object and/or antibody or during compositions, reduces or eliminates object generation pathology, disease or disorderly indication or symptom.Medicine of " treating useful " or chemical compound (as non-natural immunogen of the present invention and/or antibody) refer to be used to reduce, treat or eliminate a disease, the medicine or the chemical compound of pathology or medical science indication or symptom.

Translation system:Term " translation system " refers to aminoacid is mixed the component of growth polypeptide chain (protein).The component of translation system comprises, as ribosome, tRNA, synzyme, mRNA etc.

Handle:" processing " used herein refers generally to prevention infection or infects, reduces or eliminates symptom, and/or eliminates cause of disease or morbid state substantially or fully.Processing can be preventative, as before infection, and before morbid state begins, or before the development of morbid state cardinal symptom, or curative, as the pathogen infection monkey, after morbid state begins, or after the development of morbid state cardinal symptom.

Alpha-non-natural amino acid: term used herein " alpha-non-natural amino acid " (UAA) refers to any aminoacid, the aminoacid of modifying, and/or amino acid analogue, and be not the aminoacid of 20 kinds of common natural generations or aminoacid such as one of selenocysteine or pyrroles's lysine of rare natural generation.For example, alpha-non-natural amino acid is right-Nitrobenzol alanine (Figure 1A), right-sulfo group tyrosine and right-carboxyphenylalanine have purposes in the various embodiments of this paper.In some embodiments, alpha-non-natural amino acid includes but not limited to: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMe Phe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.Should be understood that once more the present invention should not be limited to specific alpha-non-natural amino acid.The out of Memory that has hereinafter shown alpha-non-natural amino acid.

Should be understood that will be hereinafter to above term and other term describe in detail.

Brief Description Of Drawings

Fig. 1 has shown pNO ₂The chemical constitution of Phe, the trimerical protein structure of mTNF α, and measure pNO ₂Phe mixes the efficient of sudden change mTNF alpha protein and the experimental result of fidelity.

Fig. 2 has shown pNO ₂Phe ⁸⁶The MALDI-TOF mass spectral analysis of-mTNF α.

Fig. 3 has shown the MALDI-TOF mass spectral analysis of wt-mTNF α.

Fig. 4 has shown and determines to carry out Tyr on the quarternary structure of sudden change mTNF alpha protein ⁸⁶PNO ₂Phe replaces the FPLC experimental result of effect.

Fig. 5 has shown the active analysis of NF κ B-Luc of different mTNF α mutons.

Fig. 6 has shown with (a) PBS, (b) WT-mTNF α, (c) pNO ₂Phe ⁸⁶MTNF α or (d) Phe ⁸⁶The serum titer of mTNF alpha immunization C57BL/6 mice.

Fig. 7 has shown with wt mTNF α or pNO ₂Phe ⁸⁶MTNF alpha immunization Bcl2 mouse anti wt mTNF α and pNO ₂Phe ⁸⁶The serum titer of mTNF α.

Fig. 8 has shown and has determined under the condition that no adjuvant exists with wt mTNF α or pNO ₂Phe ⁸⁶MTNF alpha immunization Bcl-2 mice serum anti-wt mTNF α or pNO ₂Phe ⁸⁶The ELISA result of mTNF α titre.

Fig. 9 has shown under the condition that has or not adjuvant to exist and has used Phe ⁸⁶Anti-wtmTNF α and the Phe of mTNF alpha immunization Bcl2 mice ⁸⁶MTNF α serum titer.

Figure 10 A has shown and has used pNO ₂Phe ⁴²MTNF α or Phe ⁴²The anti-wt mTNF of mTNF alpha immunization Bcl2 mice serum α, pNO ₂Phe ⁴²MTNF α and Phe ⁴²MTNF α titre.Figure 10 B has shown and has used pNO ₂Phe ¹¹MTNF α or Phe ⁴²MTNF alpha immunization C57BL/6 mouse anti WTmTNF α, PBS and pNO ₂Phe ¹¹The serum titer of mTNF α.

Figure 11 has shown in serious endotoxemia model and is using pNO ₂Phe ⁸⁶Can the mTNF alpha immunization improve the experimental result of mouse existence.

Figure 12 has shown pNO ₂Phe ⁸⁶The segmental MS/MS sequencing result of-mTNF α Trypsin enzymolysis.

Figure 13 has shown His ₆-Phe ⁸⁶MTNF α (WT) or His ₆-pNO ₂Phe ⁸⁶The terminal His of the N-of mTNF α ₆Label does not have influence for the follow-up immunization experimental result.

Figure 14 has shown the experimental result of definite serum titer durability.

Figure 15 has shown T cell proliferation experiment result.

Figure 16 has shown pNO ₂Phe ⁸⁶The mTNF alpha immunization has promoted type conversion to reply to IgG, and this shows in mice the cross reactivity for WT mTNF α, and continues at least 40 weeks.

Figure 17 has shown 4 surperficial exposed sites of mTNF α, has showed significant immunogenicity.

Figure 18 has shown that lipopolysaccharide (LPS) stimulates the various pNO in back ₂Phe mTNF α muton immune mouse is survived benefited significantly.

Figure 19 has shown pNO ₂Whether Phe mixes autoantigen mRBP4 can lose tolerance to mRBP4.

Figure 20 has shown that WT mTNF α can not keep pNO ₂Phe ⁸⁶MTNF α, the inducing tolerance forfeiture.

Figure 21 has shown three segmental mass spectral analyses of mTNF α.

Figure 22 has shown anti--mTNF α mAb and three segmental combinations of mTNF α.

Figure 23 has shown that affirmation is with pNO ₂Phe mixes the experimental result of the surperficial exposed sites of mTNF α.

Figure 24 has shown that affirmation is with pNO ₂Phe mixes the experimental result of the surperficial exposed sites of mRBP4.

Figure 25 has shown for pNO ₂Phe ⁴³MRBP4 and pNO ₂Phe ¹⁰⁸The segmental MS/MS of mRBP4 Trypsin enzymolysis analyzes and pNO ₂The pattern of mixing of Phe matches.

Figure 26 has shown definite pNO ₂Phe ⁴³MRBP4 is immunogenic experimental result in the C57BL/6 mice.

Figure 27 (A) has shown pNO ₂Phe ⁴³MRBP4 contains pNO ₂The MS/MS sequencing result of the enzymatic fragment of Phe.(B) shown pNO ₂Phe ¹⁰⁸MRBP4 contains pNO ₂The MS/MS sequencing result of the enzymatic fragment of Phe.

Detailed Description Of The Invention

General introduction

The ability that in producing the vaccine of various disease states, has significant selective induction antagonism oneself protein matter or other self molecule, or the immunogenic ability of enhancing exogenous antigen defined epitope, described morbid state comprises cancer, protein folding disease and infectious disease (as antibacterial or viral infection).The present invention produces the useful non-natural immunogen that is used for vaccination by directly mix alpha-non-natural amino acid in protein, perhaps produces the antibody that is used for passive immunity.In the present invention, mix target (as the disease association part) (perhaps to should be able in the intravital target part of object) partly of the corresponding inoculation/immune object of protein of alpha-non-natural amino acid.Give in the embodiment of object in the immunogen that will contain alpha-non-natural amino acid, the existence of alpha-non-natural amino acid causes the immunogenic immunne response of antagonism non-natural.This type of replys the natural target part of the antibody of generation useful cross reaction antagonism immunogen origin (or corresponding), the immunne response of the target part that therefore creates antagonism.Be particularly useful in the immunne response of the method for the present invention non-immunogenic of (or can in subject) or weak immunogenicity target part in the subject that creates antagonism.Embodiments of the present invention also comprise and give the antibody that object antagonism non-natural immunogen (immunogen that promptly contains alpha-non-natural amino acid) produces, the natural target part (and for example disease association part) of the correspondence of (or can in subject) in the described antibody cross reaction antagonism subject.In arbitrary embodiment, the immunoprotection that the present invention partly stimulates the antagonism target raises, and no matter makes born autologous protein matter, as, TNF α, or exogenous molecule are as bacterial antigens.

In one embodiment, invention described herein also provides compositions and the method that can be used for treating and/or preventing TNF alpha active related pathologies.Tumor necrosis factor (TNF α) is a kind of pleiotropy cytokine, participates in aggravation and/or causes many chronic inflammation diseases, and as septic shock, rheumatoid arthritis, cerebral malaria and Crohn disease.The invention provides and produce non-natural TNF α as containing the TNF α of one or more immunogenic, come-at-able alpha-non-natural amino acids of antibody.The present invention also provides and has used non-natural TNF α to break the method that the TNF alpha immunization is tolerated, as, induce generation or enhancing immunne response for health endogenous TNF α.For example antibody that causes with non-natural TNF α and the table of TNF α are cross reaction, endogenic TNF α neutralizes, can alleviate or alleviate the symptom of this type of disease, cause pulmonary fibrosis as endotoxin shock, cerebral malaria, autoimmune disease, multiple organ dysfunction syndrome, multiple sclerosis, heart dysfunction, atherosclerosis, ischemical reperfusion injury, insulin resistant, rheumatoid arthritis, Crohn disease, inflammatory bowel, cachexia, septic shock, acquired immune deficiency syndrome (AIDS), graft versus host disease, sterilization granuloma, adult respiratory distress syndrome, silicon dioxide.

Comprise in the TNF α embodiment at some, with the alpha-non-natural amino acid that contains hyperimmunization originality nitrobenzophenone group right-the Nitrobenzol alanine replaces the tyrosine of 86 of mTNF alpha proteins, produces the non-natural TNF alpha derivative with useful therapeutic and/or preventative feature.Other non-natural TNF alpha derivative that has therapeutic and/or preventative processing purposes in object (as mice) body comprises pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α, or pNO ₂Phe ¹¹³-mTNF α.Other non-natural TNF alpha derivative that has therapeutic and/or preventative processing purposes in object (as the people) body comprises pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α or pNO ₂Phe ¹¹⁴-hTNF α.

In another embodiment, invention described herein also provides compositions and the method that can be used for treating and/or preventing the active related pathologies of retinol binding protein (RBP4).RBP4 participates in repairing Wood syndrome (Matthew Wood Syndrome) as horse, the appearance/development of age related macular degeneration (AMD) and recessive macular dystrophy (Stargardt ' s disease) etc.

Break immunologic tolerance with the non-natural immunogen

A major challenge in the modern medicine treatment is to develop effective ways, and the immunogenicity that strengthens the weak immunogenicity exogenous antigen of specificity is as obtaining neutralizing antibody, and perhaps selectivity overcomes the tolerance for autoantigen.Distinguishing self for immunology is self-tolerance with nonself process important concept, wherein mammiferous immune system to avoid autoimmune disease, mainly is because lack autoreaction B-or T-cell or inactivation takes place for autologous protein matter " tolerance ".Take multiple strategy to tackle these challenges, comprise exploitation improvement adjuvant and carrier, in antigen, introduce strong t cell epitope, fat coupling and combination-vaccine etc.Referring to for example Baldridge etc., " vaccine adjuvant: immunology and clinical principle " (Vaccine Adjuvants:Immunological and Clinical Principles.) C.J.Hackett, Harn, D.A.Jr. compiles. (Xiu Mana publishing company, New Jersey Tuo Tuowa), 235-255; Makela etc., Expert Rev Vaccines, 1 (399): 399-410 (2002); Dalum etc., Nat Biotechnol.17:666 (1999); And Restifo, Curr Opin Immunol8:658 (1996)..Shown that the rabbit Elityran with the extensive non-specific labelling of diazo compound derivative carries out immunity to rabbit, can induce the cross reacting antibody for natural Elityran.Referring to Weigle, J Exp Med121:289 (1965).Yet, be difficult to make things convenient for modification/control to solve other antigenic problem etc. to this method.Equally, the non-specific derivatization from the body cancer cell that contains the dinitro benzene group is used as vaccine (Berd in the melanomatosis people, D. (2004) " M-Vax: a kind of human cancer vaccine " (M-Vax:an autologous, hapten-modified vaccine for human cancer) from the body hapten transformation Expert Rev Vaccines3:521-527).Also can be with reference to other document (as embodiment hereinafter).

Compare with trial before, the present invention replaces a plurality of natural amino acids of work (in specific required site) with a plurality of alpha-non-natural amino acids of work (UAA) thereby creation non-natural immunogen in the target epi-position of target part (as the target part of disease association).Other or in addition, create the non-natural immunogens thereby can in the target epi-position of target part, add one or more specificity alpha-non-natural amino acid residues.Replacement and/or creation alpha-non-natural amino acid can be created one or more immunogenicities in the non-natural immunogen, the epi-position that arbitrary structures is conservative, thereby can (in object) cause that regional intensive immunne response is answered in natural target proteins confrontation at wild type (wt), as T-cell response and/or B-cell response.And as mentioned below, the cross reacting antibody that is produced for the non-natural immunogen also can have specificity to the zone of the corresponding natural target molecules that do not comprise alpha-non-natural amino acid.Vide infra.Using monoclonal antibody or chimeric medicine to break aspect the tolerance, the trial before the present invention can lead over arbitrarily, problem before need to be frequent injection and a large amount of protein.。As shown here, in some embodiments, use the serum persistency of the antibody that non-natural immunogen of the present invention produces in object that the frequency of immunostimulant is reduced.

The B cell is by free (solubility) antigen (as the non-natural immunogen) in BCR (B-cell receptor) or membrane bound immunoglobulin identification blood or the lymph.After antigen recognition, the B cell is its endocytosis, and with the form of MHC complex at its surface display antigen fragment.In a single day the B cell is activated, and grows to be memory B cell, produces justacrine antibody, in the help and the disease association target part of antigen (non-natural immunogen) origin (or corresponding), and/or help destruction to have antibody can be near the infectious target agent of epi-position.

Antigen (as the non-natural immunogen) specific T-cells is as CD4 ⁺The T cell combines with MHC-complex fragments of peptides as the B cell display.The T cell proliferation was kept away that cytokine that discharges immune stimulatory cell proliferation and confused China then; some bud into memory cells in these activated T cells; instant protection to the target (as disease association) that originates from as anti-non-natural immunogen is provided, and the ability that causes rapider and effective secondary immune response.In the T lymphocyte proliferation assay, can measure this activity (referring to embodiment 1 and 2).

The nonsense that antibacterial, yeast or mammalian cell are corresponding specific and move the frame codon hereditism's coding surpass 50 kinds of alpha-non-natural amino acids.Referring to for example, Wang etc., Science292:498 (2001); Chin etc., Science301:964 (2003); Liu etc., Nat Methods4:239 (2007); Anderson etc., Proc Natl Acad Sci U S A101:7566 (2004); With Wang etc., Angew Chem Int Ed Engl44:34 (2004), and other list of references of this paper.These comprise melts combine and post translational modification aminoacid, fluorescence and redox active amino acids, and photoreaction and chemical reaction aminoacid.For example, the derivant with phenylalanine right-Nitrobenzol alanine (pNO ₂Phe Figure 1A) mixes corresponding succinum nonsense codon in the bacterioprotein, has high fidelity and good efficiency during as the spectrum intervals probe.Referring to Tsao etc., J Am Chem Soc128:4572 (2006).Should be understood that and for example and in describing pNO has been discussed at this paper ₂The use of Phe, single the limitation therewith, the present invention contain any alpha-non-natural amino acid (as, include but not limited to described in cited herein and/or this paper list of references) purposes.Hereinafter provided the out of Memory of the alpha-non-natural amino acid that can be used for the various embodiments of this paper.

Break the embodiment of immunologic tolerance with the non-natural immunogen.

Once used the nitro aryl (to compile " catalytic antibody " referring to Keinan in history as the high immunogenicity hapten Catalytic Antibodies (WV company (Wiley-VCH), Wei En Haimu (Weinheim ), 2005), 1-28), may be because the pi system of electron deficiency is tending towards Tyr and the interaction of Trp side chain common with the antagonist binding site.Since their structural similarity, the Phe → pNO of interested target part ₂Phe or Tyr → pNO ₂Phe sudden change (as the disease association part) can produce the immunogen that strong immunization is replied, the originate natural target part cross reaction of (corresponding) of described immunne response and immunogen.

Therefore, as shown in the Examples, use as Mus tumor necrosis factor-alpha (mTNF α) Tyr ⁸⁶→ pNO ₂Phe muton immune mouse produces the high titre antibody to wild type mTNF α (wt mTNF α) response, therefore can effectively protect mice antagonism lipopolysaccharide (LPS) to stimulate.

Select mTNF α to show (a plurality of) of the present invention aspect as target proteins matter because it relate to infect, the evaluation of inflammation and autoimmune phenomena clearly cytokine (referring to Vassalli, Annu Rev Immunol10:411 (1992)); And, comprise that its expression, structure, function and signal transduction mechanism further investigate for the biological property of mTNF α.Referring to for example, aforementioned Vassalli; Baeyens etc., Acta Crystallogr D Biol Crystallogr55:772 (1999); Pennica etc., Proc Natl Acad Sci U S A82:6060 (1985); Pasparakis etc., J Exp Med184:1397 (1996); Baeyens, H.L. etc., Acta Crystallogr D Biol Crystallogr53:329 (1997); And Aggarwal, Vilcek, J., volume " tumor necrosis factor: structure, function and mechanism of action " ( Tumor necrosis factors: Structure, function, and mechanism of action) (New York De Keer, 1992) (Dekker, New York, 1992), 1-587.In addition, mTNF α knock-out mice can be survived, and does not show obvious phenotypes unusual (referring to Pasparakis, the same), this shows that mice can survive in the TNF that creates antagonism He in the immunne response, this makes the inoculation animal can be used for analyzing anti-TNF alpha production of antibodies and biologic activity.And, anti-TNF alpha antibody (Knight etc., Mol Immunol30:1443 (1993); With Present etc., N Engl J Med340:1398 (1999)) and the chimeric TNF α of solubility receptor (Peppel etc., J Exp Med174:1483 (1991); With Williams etc., Immunology84:433 (1995)) has been widely used in the treatment rheumatoid arthritis.Therefore, clinical need TNF α-specificity vaccine (Dalum, the same; Spohn etc., J Immunol178:7450 (2007); Buanec etc., Proc Natl Acad Sci U S A103:19442 (2006); Capini etc., Vaccine22:3144 (2004)).Based on the trimerical X-ray crystal structure of mTNF α basis (Baeyens etc., Acta Crystallogr D Biol Crystallogr55:772 (1999); With Baeyens etc., Acta Crystallogr D Biol Crystallogr53:329 (1997)), select Tyr ⁸⁶→ pNO ₂MTNF α (the pNO of the single sudden change of Phe ₂Phe ⁸⁶MTNF α is referring to Figure 1B) immunogen of showing explanation as the present invention.Tyr ⁸⁶Conservative at the mammiferous TNF camber of difference, determined that this site mutation does not influence Protein Folding or trimer forms.Tyr ⁸⁶Sudden change also causes Cytotoxicly significantly losing, and this has advantage to produce when vaccine is purpose.Referring to for example, Van Ostade etc., Protein Eng7:5 (1994); Loetscher etc., J Biol Chem268:26350 (1993); With Zhang etc., J Biol Chem267:24069 (1992).

Be tested and appraised feature and persistency to the polyclone IgG antibody of anti-TNF alpha, and by the displaying wild type retinol binding protein 4 that creates antagonism, the antibody of mRBP4 (purposes that has therefore shown the oneself protein that immunologic function has nothing to do among the present invention), embodiment 2 has further showed extensive use of the present invention.What is interesting is that embodiment 2 has shown pNO ₂Phe-induces and has broken self tolerance, has produced the antibody at a plurality of epi-positions of WT mTNF α, and described epi-position needn't comprise among the natural TNF α and non-natural immunogen TNF α pNO ₂The zone of Phe residue correspondence.Therefore, that utilizes that non-natural immunogen of the present invention carries out that immunity can be favourable causes the expansion of immunoglobulin epi-position, is different from the main target that the epi-position of inducing epi-position becomes ongoing immunne response in view of the above.Vide infra.The epi-position that immunity is extended to the disease association target part in whole non-natural immunogen source is a kind of a kind of phenomenon that especially needs after vaccine design.The effectiveness that its a plurality of targets that can attack disease association target part can be increased reply for the enhancing of immune system ability at the target partial immunity/or intensity.

That should be understood that embodiment hereinafter shows is not only TNF α or RPB4 in the embodiment of the present invention.Describe as can be known from this paper, in non-natural TNF α and RPB4 target part, can comprise one or more any alpha-non-natural amino acids in the various embodiments.And the alpha-non-natural amino acid that occurs on this type of non-natural immunogen can be positioned at any position of immunogen inside.The alpha-non-natural amino acid that replaces natural amino acid corresponding among natural TNF α and the RBP4 can be that conserved amino acid replaces, and also can be that non-conserved amino acid replaces.Also can any method of passing through in the several different methods make up non-natural immunogenicity TNF α and RBP4.Use orthogonal translation (vide infra) conduct directly to mix the approach of alpha-non-natural amino acid to right a lot of embodiments, but also can use other directly to mix method (as external translating system, solid phase and title etc.) arbitrarily.The embodiment of this paper does not generally use translation back or chemical modification method, except with directly mix method such as orthogonal translation coupling.

The method and composition that reinforcement/enhance immunity originality is replied

From this paper embodiment and the explanation as can be known; non-natural immunogen of the present invention natural target part (as not comprising the disease relative protein white matter of alpha-non-natural amino acid) the intensive cross reacting antibody that can create antagonism is replied, thus the disease (or can be used for handling morbid state) of protectiveness antagonism target part correlation.Therefore, the present invention as the surface exposure epi-position or the T-cell epitope of disease association target part, can break the immunology self tolerance by alpha-non-natural amino acid being mixed the specificity epitope of target part interested.For example, in following reduced graph, target part (as disease association target part) comprises epi-position 1,2 and 3.The non-natural immunogen also comprises epi-position 1,2 and 3, and described epi-position derives from or corresponding (having identical sequence) target epi-position 1,2 and 3 partly.Yet the immunogenic epi-position 2 of non-natural comprises the alpha-non-natural amino acid (asterisk is represented) of the corresponding natural amino acid of replacing the target part.In the non-natural immunogen, exist alpha-non-natural amino acid to produce the cross reacting antibody (epi-position expansion) that to discern the different epi-positions of target part.For example, can produce cross reacting antibody at epi-position 1 and 3 (the not corresponding immunogenic epi-position of non-natural that comprises alpha-non-natural amino acid) and epi-position 2 (correspondence comprises the immunogenic epi-position of non-natural of alpha-non-natural amino acid).

The target part

Epi-position 1

Epi-position 2

Epi-position 3

The non-natural immunogen

Epi-position 1

Epi-position 2 *

Epi-position 3

By locus specificity alpha-non-natural amino acid is mixed the defined epitope of leading interested target part and create the non-natural immunogen, thereby break the immunology self tolerance, can be applicable to a large amount of endogenous target parts (as protein), comprise those (as amyloid-β (1-42) peptide or prostate specific antigen) that protein folding disease or cancer are relevant.In addition, the powerful antibody of immunogen epi-position was replied a little less than this method can create antagonism, thereby obtained the neutralizing antibody at allos target part, as the allos target from virus, antibacterial, fungus, PrPC or parasitic infection.

Should be understood that, the various embodiments of this paper use the non-natural immunogen (promptly, corresponding target part but contain the molecule of one or more alpha-non-natural amino acids) administration, when object is gone in inoculation, the immunogenic antibody of non-natural, B cell and/or T-cell will create antagonism, their cross reactions antagonism target part, as not comprising the disease association part of alpha-non-natural amino acid, and described target part is in subject or can be in subject.In other embodiment, can use the non-natural immunogen to produce antibody with the cross reaction of natural target part, described antibody is preventative then/and therapeutic gives object.

Therefore, in some embodiments of this paper, the method that the present invention comprises gives object by the non-natural immunogen that will comprise one or more alpha-non-natural amino acids, in object (as the disease association part, the autoinducer molecule of object, from the molecule of cause of disease in the subject, or from can be at the molecule of the intravital cause of disease of object etc.) produce immunne response at the target part.Object produce with at the corresponding antigenic antibody of target part that does not contain alpha-non-natural amino acid, described antibody cross reaction resists the particular target part.It should also be understood that the time, the antibody that is produced needn't have specificity for the epi-position of target part, the epi-position with alpha-non-natural amino acid on the corresponding non-natural immunogen of described epi-position.Method of the present invention can be used for breaking in the subject for target (as disease association) immunologic tolerance partly.In addition, when this paper carries out when describing by orthogonal translation system or other method of directly mixing (vide infra), also can modify (as chemical modification etc.) by other method in case create immunogenicity non-natural antigen.Usually this class indirect method with directly mix method such as orthogonal method coupling or as a supplement.

Such as in hereinafter describing in detail explanation, be used for comprising target part in the subject or can be usually in " non-natural " version of the intravital target part of object (as target part, from tumorigenic target part in the subject etc.) from the antibacterial that can infect object in the immunogen that object produces immunological response.In other words, the non-natural immunogen comprises the aminoacid sequence/structure identical with the target part arbitrarily, except target one or more aminoacid deformity partly are replaced by alpha-non-natural amino acid (the embodiment part that vide infra and show as in addition).In addition or in addition, the non-natural immunogen can comprise aminoacid sequence and one or more other alpha-non-natural amino acid residue of target part.In the specific embodiment, partly to compare with initial target, replacement and/or adding alpha-non-natural amino acid do not change (or only slightly changing) immunogenic conformational structure of non-natural.Therefore, three grades of non-natural immunogen and target part and/or quarternary structure can be identical, or closely similar each other.Placing one or more alpha-non-natural amino acids in the non-natural immunogen can select based on following arbitrarily, as comparing with the immunogen that target is partly originated, whether placement location can change immunogenic conformation, placement location whether make alpha-non-natural amino acid by antibody near (can combine with the zone of containing alpha-non-natural amino acid) etc. as antibody.Mixing the immunogenic alpha-non-natural amino acid of non-natural can be conservative or non-conservative replacement (comparing with natural amino acid corresponding in the target part).

Other embodiment of the present invention also comprises method preventative and/or the therapeutic treatment object, by giving one or more non-natural immunogens and/or resisting one or more and the immunogenic antibody of non-natural of corresponding natural target part cross reaction.

The present invention also comprises containing and is tested and appraised the embodiment that the target part of inferring at least for treatment responsive (as TNF α) (as the disease association part) produces the method for vaccine.Should be understood that this type of target part normally " natural ", and do not comprise any alpha-non-natural amino acid.Described method also comprises provides the non-natural immunogen, i.e. target part pairing " non-natural " version, and it comprises one or more alpha-non-natural amino acids, as replacing and/or add alpha-non-natural amino acid.Once more, described immunogen can comprise the structure conformation identical or close with the target part, therefore gives object non-natural immunogen and induces at immunogenic intersection antagonism target antibody partly.The present invention also comprises the vaccine that these class methods produce.

Should be understood that in the various embodiments of this paper, when creating immunological response and/or when giving prophylactic treatment etc., natural target partly can occur or not come across in the subject.Therefore, when describe this paper target part or when being positioned at subject, should be understood that to comprise that also wherein the target part can be positioned at subject.Therefore, target part can come from the esoteric tumor of object, or from the infectious agent that can infect object etc.

Therefore, as making an explanation in the whole text, in various embodiments, the target part can be the disease association part, born part, external source part etc.Target part itself can the immunogenic or part or weak immunogenic of right and wrong.External source target part can be from any organism (as antibacterial, virus etc.).Target part itself can be any autoantigen (as tumor relevant etc.).Mixing the immunogenic alpha-non-natural amino acid of non-natural can be any alpha-non-natural amino acid, vide infra, and can be positioned at any position of immunogen.Compare with the natural amino acid of target part, it can be conservative or non-conservative replacement that the alpha-non-natural amino acid in the immunogen plays.As hereinafter further describing, the non-natural immunogen also can be created (as orthogonal translation, solid phase synthesis etc.) by the multiple method of directly mixing.This paper typical embodiment is not created the non-natural immunogen by doping method indirectly, as post translational modification or chemical modification (but these class methods can be mixed the method coupling arbitrarily Yu directly, use as orthogonal translation or after directly mixing method such as orthogonal translation).

Morbid state and disease association target part

Method and composition of the present invention can be used for preventative and/or the multiple medical condition/morbid state of therapeutic treatment.For example, the present invention can be used for treating Autoimmune Disorders.This type of immune disorder includes but not limited to: and autoimmune disease (as diabetes, arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis, multiple sclerosis (as relating to MS related antigen such as TRAIL, CD95/CD95 etc.), encephalomyelitis, myasthenia gravis, systemic lupus erythematosus (sle) (SLE), autoimmune thyroiditis, dermatitis, allergic dermatitis, eczematoid dermatitis, psoriasis, sjogren syndrome, Crohn disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, lupus erythematosus,cutaneous, scleroderma, vaginitis, proctitis, drug eruption, the leprosy reversal reaction, ENL, autoimmune uveitis, allergic encephalitis, acute hemorrhage gangrenosum acne encephalopathy, the bilateral gradual deafness of the special property sent out, aplastic anemia, the pure red cell anemia, the special property sent out thrombocytopenia, polychondritis, Wegner granuloma, chronic active hepatitis, Stevens-Johnson's syndrome, the special property sent out diarrhoea, lichen planus, Grave's disease, sarcoidosis, primary biliary cirrhosis, posterior uveitis and interstitial pulmonary fibrosis, graft versus host disease is transplanted and irritated (as atopic hypersensitivity).The present invention also can treat the morbid state in non-autoimmune/non-infectious cause of disease source, as diabetes/cardiovascular diseases's (as relating to RBP4), the perhaps special property source of sending out is as Alzheimer's disease (can comprise as amyloid beta 40 amyloid beta 42 etc. as disease association target part wherein).

The various embodiments of the inventive method and compositions also can be used for morbid state preventative and/or that therapeutic treatment TNF alpha active is relevant, as cachexia, septic shock, antibacterial granuloma, adult respiratory distress syndrome, the inductive pulmonary fibrosis of silicon dioxide, autoimmune disease, multiple organ failure, MOF, multiple sclerosis, heart dysfunction, atherosclerosis, ischemia reperfusion injury, insulin resistant and inflammatory bowel etc.Other embodiment of the present invention can be used for preventative and/or the active relevant morbid state of therapeutic treatment RBP4, repaiies the Wood syndrome as horse, degeneration of macula (AMD) that the age is relevant and recessive macular dystrophy (Stargardt ' s disease) etc.

In other embodiments, other embodiment of invention can be used for preventative and/or the various cancers of therapeutic treatment (as breast carcinoma, carcinoma of prostate, ovarian cancer, pulmonary carcinoma, skin carcinoma etc.).This type of treatment includes but not limited to: treatment has the cancer of tumor associated antigen.The tumor associated antigen of known multiple cancer, as breast carcinoma, carcinoma of prostate, ovarian cancer etc.Tumor associated antigen includes but not limited to: from the cancer embryo (CEA) of colon cancer and other cancer, and MAGE, BAGE, RAGE, and NY-ESO (the not mutated antigen of in the immunme-privileged sites of testis and kinds of tumor cells, expressing); Pedigree specific tumour antigen, as melanocyte-melanoma pedigree antigen MART-1/Melan-A, gp100, gp75, mda-7, tryrosinase and tyrosinase-related protein matter, or prostate specific membrane antigen (PSMA) and prostate specific antigen (PSA), they are expressed in the normal and malignant cell that derives from homologue; The epi-position proteins/peptides, come from the mutant gene of tumor cell or compare the different gene of transcriptional level with normal cell, as the ras that suddenlys change, bcr/ab1 resets, Her2/neu, sudden change or wild type p53, the intron sequences of Cytochrome P450 1B1 and unconventionality expression such as N-acetylglucosaminyltransferase-V; Clone's property rearrangement of immunoglobulin gene produces idiotype unique in myeloma and the B-cell lymphoma; Derive from the epi-position proteins/peptides of cancer virus process, as human papilloma virus poisonous protein E6 and E7; With the not mutated oncofetal protein matter of tumor-selective expression, as carcinoembryonic antigen and alpha-fetoprotein.

In the specific embodiment, the present invention can be used for treating ovarian cancer, and/or target disease association part can comprise as, ovarian tumor related antigen, CA19-9, p53, OCAA, HOXB7, Cal25 etc.In other embodiment, the present invention can be used for treating carcinoma of prostate, and/or target disease association part can comprise as tumor of prostate related antigen, PSA, PSMA, STEAP, PCTA-1 etc.Other embodiment of this paper comprises treatment breast carcinoma, and/or the target relevant portion can comprise as, CA15-3, CA27-29, Her2/neu etc.The out of Memory of the available tumor associated antigen of the present invention referring to as, " T lymphocyte identification tumor antigen " (Tumor-Antigens Recognized By T-lymphocytes) Boon etc., Annual Review Of Immunology12:337-365,1994; " the human tumor antigen tabulation of T cell recognition " (A listing of human tumor Antigens recognized by T cell) Renkvist etc., Cancer Immunology Immunotherapy50:(1) 3-152001 March.

In other embodiments, the present invention can be used for treating disease, imbalance etc., and related antigen includes but not limited to as EGF, EGFR, HER-1, CXCR4, any g protein coupled receptor (GCPR).Those skilled in the art are familiar with applicable tumor associated antigen of multiple the present invention and corresponding cancer, autoantigen and immune disorder.

In some embodiments, the present invention includes treatment HIV and infect, the relevant portion that non-natural antigen can the relevant target disease of corresponding HIV/AIDS wherein, as gp120, gp41, gp160 etc.Other exemplary HIV target partly includes but not limited to: gag, pol, env, tat, nef and rev.

In other embodiments, the present invention can be used for treating viral infection, and non-natural immunogen visiting team answers the relevant target relevant portion of virus, as adenovirus, α virus, Calicivirus (as the Calicivirus capsid antigen), coronavirus, CMV (as pp65), distemper virus, Ai Bola virus, enterovirus, EBV (as, gp340 or nuclear antigen 3A), banzi virus such as hepatitis C virus Hep C (as cAg), hepadnavirus, as hepatitis B virus (as HBc or surface antigen HbsAg, or peplos Ag pre S2, or pre S1ag), hepatitis, penta type or own Hepatitis virus, hepatitis A virus (as VP1), GBV-C, herpesvirus (as hsv protein matter, as I type glycoprotein G or gpD or CP27, or the varicella zoster virus glycoprotein, as IE62 or gp1 or envelope protein matter), immunodeficiency virus such as HIV (as peplos or protease), infectious peritonitis virus, influenza virus (as, influenza A hemagglutinin, neuraminidase or nucleoprotein), LCMV (as nucleoprotein), leucovirus, Ma Erbao virus, influenza virus virus, human papillomavirus such as HPV (as the HPV capsid protein), parainfluenza virus (as the hemagglutinin/neuraminidase), paramyxovirus such as RSV (as F or G protein s), parvovirus, Pestivirus, picornavirus is (as the capsid of poliomyelitis polypeptide, as VP1, VP2 or VP3, or hepatitis A antibody), poxvirus is (as the vaccinia virus polypeptide, as envelope protein), rabies virus (as rabies viral glycoprotein G), reo virus, retrovirus, rhinovirus (as the ERC group virus capsid), rubella virus (as capsid protein) or rotavirus.

In other embodiment, the present invention can be used for treating antibacterial or mycobacterial infections, and can utilize the relevant target of antibacterial or mycobacteria relevant disease partly to create the non-natural immunogen, as actinomycetes, bacillus cereus, bacteroid, bordetella bacilli (as the bordetella pertussis surface protein), Bartonella, Borrelia bacterium (as lyme disease spirochete Wu Sipa), brucella (as the brucella surface protein), Campylobacter, carbon dioxide Cytophaga, chlamydia (as the chlamydia trachomatis surface protein), clostridium, corynebacterium, cock steadite, sandflea, enterococcus, Ai Like body, escherichia coli, francis fungus, Fusobacterium, blood bartonia bodies, haemophilus (as Type B influenza outer membrane protein), twine bacillus, Klebsiella pneumoniae, L type antibacterial, leptospira, Listerella (as surface protein), mycobacteria, mycoplasma, Neisseria, new rickettsia, Nocard's bacillus, pasteurellosis bacillus, dyspepsiacoccus, peptostreptococcus, streptococcus pneumoniae, Bacillus proteus, pseudomonas, rickettsia, Rochalimaea, Salmonella, dysentery bacterium, staphylococcus aureus (as the GP-1 of staphylococcus aureus), streptococcus (as M albumen or streptococcus pneumoniae capsular polysaccharide or streptococcus surface protein antigen) as micrococcus scarlatinae, spirillum, vibrio (vibrio cholera and supposition pili subunit) and yersinia (as pestis F 1 and V antigen).

Other embodiment of this paper can comprise the method and composition for the treatment of fungal infection etc., and the non-natural immunogen of creating can the relevant target disease association part of corresponding fungus, and is mould as colter, a top spore, chain lattice spore, aspergillosis, a basidiobolus haptosporus, bipolar mould, the ascus yeast, candidiasis, candida mycoderma, an ear is mould, cryptococcus, leaf spoting bacteria, epidermophyton, outer Saksenaea vasiformis, ground silk bacterium, histoplasma capsulatum, Madura branch bacterium, chlosma, sporidiole bacteria, Xiao Cong obstructs spore, Mortierella, Mucor, Paecilomyces varioti, penicillium sp, unit cell Saksenaea vasiformis, Saksenaea vasiformis, chlorella, the swollen bacterium of foot, false little holder bacterium, rotten mould, nose sporozoon, rhizopus, the wire basidiomycetes, sporothrix, the handle of crawling is mould, trichophyton, trichosporon bacteria, wood wool is mould.

Other embodiment of this paper can comprise the method and composition for the treatment of protozoal infections etc., and the non-natural immunogen of creating can the relevant target disease association part of corresponding protozoon parasite, as this worm of BABEI, the intestinal basket worm, shellfish promise sporozoon, Cryptosporidium, eimeria, Encephalocytozoon, entamoeba worm, Giardia lamblia, Hammond worm, liver gregarina isospora, leishmania (as leishmania major surface glycoprotein such as gp63), microsporozoite, sporozoon, microsporidian, pentatrichomonas ardin delteili, plasmodium is (as Plasmodium falciparum ring sporinite (PfCSP), sporinite surface protein 2 (PfSSP2), liver state antigen 1 c-terminus (PfLSA1 c-end), output protein 1 (PfExp-1), Pfs 48/45, Pfs 28, Pfs 25, and Pfs 230), the lung sac worm, sarcocystis, schistosomicide, Old Taylor worm, toxoplasma and trypanosomicide.

Other embodiment of this paper can comprise the method and composition for the treatment of parasitic infection etc., and the non-natural immunogen of creating can the relevant target disease association part of corresponding parasite, as sour jujube lip worm, and the cat strongylid, ancylostome, pipe strongylid, ascarid, Bu Lugeshi filaricide, Bunostomum trigonoce phalum, capillaria, Xia Shi nematicide, cooperid, the ring body nematicide, net filaria, swollen knot worm, sour jujube filaria labialis, cestode, multiple hole cestode is disliked filaricide, imperial nematicide, pinworm, class filaricide, haemonchus, cleftlip ascarid, Lip river Ah's polypeptide, mansonellosis, Muellerius, dwarf's shape trematodiasis, ancylostome, nematodirus, oesophagostome, dish tail worm, back testis trematodiasis, stomach nematicide, paranema worm, lung fluke, secondary ascarid, bubble wing nematicide, former roundworm, abdominal cavity filaricide, revolve filaria, palace cestode, crown wire worm, quasi-colubriformis, strongylid sucks nematicide, bow ascarid nematicide, bend first ascarid, trichinella, iris ancylostome, Trichocephalus, ancylostome, or Wuchereria.

Other embodiment of this paper can comprise the method and composition of treatment epizoa infection etc., and the non-natural immunogen of creating can the relevant target disease association part of corresponding epizoa.This type of epizoa comprises that flat louse comprises hard Ticks and soft ticks as, flea, fly such as mosquito, and mosquito, sand, fly, black fly, horse botfly, the loudspeaker fly, deerfly, tsetse fly, steady fly, myiasis, fly larvae causes fly, Formica fusca; Aranea, louse, acarid, and hemipteran, as Cimex bedbug, that sucks blood has a kissing bug.In other embodiment, immunogen can corresponding pollen allergens or the target part of anaphylactogen.

Alpha-non-natural amino acid

Alpha-non-natural amino acid used herein refers to any aminoacid, modified amino acid, or be not selenocystein and/or pyrroles's lysine amino acid-like substance, be the a-amino acid of the genetic coding of 20 kinds of classics below: alanine, arginine, agedoite, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine.In various embodiments of the present invention, doping immunogenic one or more alpha-non-natural amino acids of non-natural can be any alpha-non-natural amino acid.Therefore, be to be understood that it is that this paper should not be considered as limitation of the present invention for quoting of concrete alpha-non-natural amino acid.Alpha-non-natural amino acid mixes in the protein by encoding widely in the body, comprises the translation system of quadrature element as use.Referring to for example, Liu etc. (2007) " in mammalian cell, alpha-non-natural amino acid being mixed protein " " Genetic incorporation of unnatural amino acids into proteins in mammalian cells " Nat Methods4:239-244; Wang etc. (2006) " expansion hereditism coding " " Expanding the genetic code " Annu Rev Biophys Biomol Struct35:225-249; Xie ﹠amp; Schultz (2006) " protein chemistry workbox-expansion hereditism coding " " A chemical toolkit for proteins--an expanded genetic code " Nat Rev Mol Cell Biol7:775-782; Wang and Schultz " expansion hereditism coding " " Expanding the Genetic Code, " Angewandte Chemie Int. compiles., 44 (1): (2003) such as 34-66 (2005) and Chin " expansion eucaryon genetic coding " " An expanded eukaryotic genetic code " Science301:964-967.

In addition; in various embodiments of the present invention, can alpha-non-natural amino acid be incorporated in the immunogen external, as using biological synthesis method; wherein will suppress sub-tRNA chemical acylation, and join then and can support in the biosynthetic vitro extraction thing of immunogen with required alpha-non-natural amino acid.About the description of this type of external synthetic method, referring to for example, V.W.Cornish, D.Mendel and P.G.Schultz, Angew.Chem.Int.Ed.Engl., 1995,34:621 (1995); C.J.Noren, S.J.Anthony-Cahill, M.C.Griffith, P.G.Schultz, " the alpha-non-natural amino acid fixed point is mixed proteinic common method " " A general method for site-specific incorporation of unnatural amimo acids into proteins, " Science244182-188 (1989); And J.D.Bain, C.G.Glabe, T.A.Dix, A.R.Chamberlin, E.S.Diala, " alpha-non-natural amino acid biosynthesis fixed point is mixed in the polypeptide " " Biosynthetic site-specific incorporation of a non-natural amino acid into a polypeptide, " J.Am.Chem.Soc.111 8013-8014 (1989).By available synthetic chemistry of peptides or by the translation post-treatment also can add alpha-non-natural amino acid natural or synthetic protein in (perhaps can utilize this type of technology that natural amino acid is converted into alpha-non-natural amino acid).Yet this type of the translation back nuclear chemistry that is to be understood that is modified usually and mix a plurality of alpha-non-natural amino acids of work (as directly mixing, as orthogonal translation, solid phase synthesis etc.) coupling or as a supplement in the synthetic molecules process.Therefore, amino acid whose translation back adds or chemical modification (if generation) has only added in having the synthetic molecules process usually on the molecule of alpha-non-natural amino acid and carries out.Hereinafter illustrated and mixed immunogenic further information with alpha-non-natural amino acid is nonopiate.

The general structure of formula I explanation a-amino acid:

Alpha-non-natural amino acid generally is any structure with formula I, and wherein the R group is any substituent group use in 20 kinds of natural amino acids a kind of.Referring to for example, " biochemistry " of L.Stryer, the third edition, 1988, freeman company (Freeman and Company), the structure of 20 kinds of natural amino acids in the New York.It should be noted that alpha-non-natural amino acid of the present invention, for example being used for the alpha-non-natural amino acid that enhance immunity replys can be the chemical compound of the natural generation except that above-mentioned 20 kinds of a-amino acids.

Because alpha-non-natural amino acid used herein is general different with the natural amino acid in the side chain, alpha-non-natural amino acid and other aminoacid, for example, the same way as formation amido link that forms in the natural or protein of alpha-non-natural amino acid with natural generation.Yet alpha-non-natural amino acid has makes its side-chain radical different with natural amino acid.

In alpha-non-natural amino acid; for example; R among the formula I randomly comprise alkyl-, aryl-, acyl group-, hydrazine, cyano group-, halogen-, hydrazides, alkenyl, ether, boric acid, borate, phosphoryl, phosphono, phosphine, ketenes, imines, ester, azanol, amine etc., or their combination in any.Other interested alpha-non-natural amino acid includes but not limited to, contain can photoactivated cross-linking agent aminoacid, the aminoacid of spin labeling, fluorescence aminoacid, melts combine aminoacid, metallic aminoacid, radioactivity aminoacid, aminoacid with new functional group, with the covalently or non-covalently interactional aminoacid of other molecules, but the light cage covers and/or the aminoacid of light isomery, contain biotin or biotin-analog aminoacid, contain keto amino acid, glycosylation aminoacid, the sugar moieties that is connected with amino acid side chain, the aminoacid that contains Polyethylene Glycol or polyethers, the aminoacid that heavy atom replaces, but but the aminoacid of chemical cleavage or light cutting, compare with natural amino acid have prolong side chain aminoacid (for example, polyethers or long chain hydrocarbon are as greater than about 5, greater than about 10 carbon etc.), the aminoacid that contains carbon-connection sugar, the aminoacid and the aminoacid that contains one or more toxic moieties that contain amino thio-acid.Interested other alpha-non-natural amino acid includes but not limited to: contain the aminoacid that light can activate cross-linking agent, the aminoacid of spin-labelling, fluorescence aminoacid, melts combine aminoacid, metallic aminoacid, radioactivity aminoacid, the aminoacid that contains new functional group, can with the covalently or non-covalently interactional aminoacid of other molecule, the aminoacid of photolocking (photocaged) and/or photic isomery (photoisomerizable), the aminoacid that contains biotin or biotin analog, the aminoacid of ketone group containing, glycosylated aminoacid, the sugar moieties that links to each other with amino acid side chain, the aminoacid that contains Polyethylene Glycol or polyethers, the aminoacid that heavy atom replaces, the aminoacid that chemical method can be cut or light can cut, compare the aminoacid that side chain prolongs with natural amino acid (as polyethers or long chain hydrocarbon, as above about 5, about 10 carbon atoms etc.), carbon containing connects the aminoacid of sugar, the aminoacid that contains the aminoacid of amino thio-acid and contain one or more toxicity parts.

On the other hand, the present invention can utilize the alpha-non-natural amino acid with universal architecture shown in the formula IV:

Alpha-non-natural amino acid with this structure generally can be any structure, wherein R ₁Be the used substituent groups of one of 20 kinds of natural amino acids (for example, tyrosine or phenylalanine), R ₂Be substituent group, be different from any amino acid whose side chain in 20 kinds of classical natural amino acids so that R2-R1 constitutes together.Therefore, this type of alpha-non-natural amino acid can be regarded the natural amino acid derivant as.

Alpha-non-natural amino acid also can randomly comprise the backbone structure of modification, suc as formula structure shown in II and the III:

Wherein Z generally comprises OH, NH ₂, SH, NH-R ' or S-R '; X and Y can be identical or different, and they generally comprise S or O, and R and R ' are randomly identical or different, they generally be beyond the dehydrogenation any substituent group (if wherein R ' be H R is the L configuration).For example, alpha-non-natural amino acid used herein randomly is included in the replacement in amino or the carboxyl, shown in II and III.Such alpha-non-natural amino acid for example includes but not limited to, has alpha-hydroxy acid, α-thio-acid alpha-amido carbothioic acid ester with common 20 kinds of corresponding side chains of right aminoacid or non-natural side chain.In addition, the replacement on alpha-carbon randomly comprises L, D or α-α-two substituted amino acids, as D-glutamic acid, D-alanine, D-methyl-O-tyrosine, aminobutyric acid etc.Other structure substitute comprises cyclic amino acids, as proline analogs, and 3,4,6,7,8 and 9 yuan of loop proline analog, β and γ aminoacid are as Beta-alanine and the γ-An Jidingsuan that replaces.

In some respects, the present invention utilizes the alpha-non-natural amino acid of L configuration.Yet, should not think that the present invention only limits to use the alpha-non-natural amino acid of L-configuration.Consider that also the D-enantiomer with these alpha-non-natural amino acids is used for the present invention.

The various embodiments of the present invention also comprise; the tyrosine analog; it comprises the tyrosine of para-orientation, the tyrosine of ortho position replacement and the tyrosine that a position replaces; wherein the tyrosine of Qu Daiing comprises; for example; alkynyl, acetyl group, benzoyl, amino, hydrazine, azanol, mercapto, carboxyl, isopropyl, methyl, C ₆-C ₂₀Straight or branched hydrocarbon, saturated or unsaturated hydrocarbons, O-methyl, polyethers, nitro etc.In addition, also consider polysubstituted aromatic ring.Glutamine analog of the present invention includes but not limited to, the glutamine derivant that Alpha-hydroxy derivant, γ-substitutive derivative, cyclic derivatives and amide replace.The example of phenylalanine analogues includes but not limited to, the phenylalanine that a phenylalanine that the phenylalanine of para-orientation, ortho position replace and a position replace, wherein substituent group comprises, alkynyl, hydroxyl, methoxyl group, methyl, pi-allyl, aldehyde, nitro, mercapto or ketone group etc.The object lesson of alpha-non-natural amino acid includes but not limited to: right-ethylmercapto group carbonyl-L-phenylalanine; right-(3-oxobutanoyl)-L-phenylalanine; 1,5-dansyl-alanine; 7-amino-coumarin amino acids; 7-hydroxyl-coumarin amino acids; nitrobenzyl-serine; O-(2-nitrobenzyl)-L-tyrosine; right-carboxymethyl-the L-phenylalanine; right-cyano group-the L-phenylalanine; between-cyano group-L-phenylalanine; biphenyl alanine; 3-amino-L-tyrosine; the bipyridyl alanine; right-(2-amino-1-ethoxy)-L-phenylalanine; right-isopropyl sulfenyl carbonyl-L-phenylalanine; 3-nitro-L-tyrosine and right-nitro-L-phenylalanine.In addition; right in addition-alkynes propoxyl group phenylalanine; 3; 4-dihydroxy-L-phenylalanine (DHP); 3; 4; 6-trihydroxy-L-phenylalanine; 3; 4,5-trihydroxy-L-phenylalanine; 4-nitro-phenylalanine; right-acetyl group-the L-phenylalanine; O-methyl-L-tyrosine; L-3-(2-naphthyl) alanine; the 3-methylphenylalanine; neighbour-4-pi-allyl-L-tyrosine; 4-propyl group-L-tyrosine; 3-nitro-tyrosine; 3-sulfydryl-tyrosine; three-O-acetyl group-GlcNAc-serine; levodopa; fluoridize phenylalanine; isopropyl-L-phenylalanine; right-azido-the L-phenylalanine; right-acyl group-the L-phenylalanine; right-benzoyl-the L-phenylalanine; the L-phosphoserine; the phosphono serine; phosphono tyrosine; right-the iodo-phenylalanine; right-bromophenyl alanine; right-amino-L-phenylalanine and isopropyl-L-phenylalanine etc.Other alpha-non-natural amino acid that can be used in the various embodiments of the present invention for example comprises, and is right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMe Phe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.Other embodiment can comprise alpha-non-natural amino acid, as aliphatic, and aryl or heterocyclic substituted boric acid, right-the borono phenylalanine, between neighbour-borono phenylalanine-the borono phenylalanine.In the different embodiments of this paper; the non-natural immunogen comprises one or more in the classical aminoacid of 20 kinds of natural generations, described aminoacid by glycosylation, nitro aryl modify, nitrated, alkanisation, acetylation, oxidation, sulphation or phosphorylation (as by the technology except post translational modification or by the technology glycosylation except chemical modification, the modification of nitro aryl, nitrated, alkanisation, acetylation, oxidation, sulphation or phosphorylation).The known multiple structure of utilizing the alpha-non-natural amino acid that the orthogonal translation system can mix.Referring to this paper incorporated by reference document, it is for referencial use to include its each integral body in this paper.

The chemosynthesis of alpha-non-natural amino acid

Many alpha-non-natural amino acids that provide above can from, for example, U.S. Sigma company (Sigma, USA) or Aldrich company (WI USA) buys for Aldrich, Milwaukee.As the method that provided in the various publications or with randomly synthetic those alpha-non-natural amino acids that can not buy from the market of standard method well known by persons skilled in the art.Organic synthesis technology referring to, for example, " organic chemistry " of Fessendon and Fessendon, (1982, second edition, Boston, Massachusetts WG publishing company (Willard Grant Press, Boston Mass.)); " the senior organic chemistry " of March (third edition, 1985, Willie, New York father and son company (Wiley and Sons, New York)); " senior organic chemistry " (third edition, A and B part, 1990, New York Premacy publishing house (Plenum Press, New York)) with Carey and Sundberg.Describe synthetic other publication of alpha-non-natural amino acid and comprise that for example, WO2002/085923 is entitled as " mixing alpha-non-natural amino acid in the body " (In vivo incorporation of Unnatural Amino Acids); Matsoukas etc., (1995) J.Med.Chem., 38,4660-4669; King and Kidd (1949) are from the newly synthetic glutamine of the intermediate of phthalic acid and glutamic acid gamma-dipeptides (A New Synthesis of Glutamine and of γ-Dipeptides of Glutamic Acid from Phthylated Intermediates), J.Chem.Soc., 3315-3319; The synthetic glutamine derivant of Friedman and Chatterrji (1959) is as the pattern substrate (Synthesis of Derivatives of Glutamine as Model Substrates for Anti-Tumor Agents) of antitumor agent, J.Am.Chem.Soc.81,3750-3752; Craig etc. (1988) 7-chloro-4[[4-(lignocaine)-1-methyl butyl] amino] absolute configuration (Absolute Configuration of the Enantiomers of 7-Chloro-4[[4-(diethylamino)-1-methylbutyl] amino] quinoline (Chloroquine)) of enantiomer of quinoline (chloroquine), J.Org.Chem.53,1167-1170; Azoulay etc. (1991) are as the glutamine analog (Glutamin analogues as Potential Antimalarials) of potential antimalarial, Eur.J.Med.Chem.26,201-5; Koskinen and Rapoport (1989) synthesize the limited amino acid analogue 4-substituted prolines (Synthesis of 4-Substituted Prolines as Conformationally Constrained Amino Acid Analogues) of conformation, J.Org.Chem.54,1859-1866; Christie and Rapoport (1985) are from the pure pipecolinic acid of altheine synthesizing optical (Synthesis of Optically Pure Pipecolates from L-Asparagine).Be applied to by aminoacid decarbonylation and imines

Ion cyclisation complete synthesis (+)-apovincamine (Application to the Total Synthesis of (+)-Apovincamine through Amino Acid Decarbonylation and Iminium Ion Cyclization), J.Org.Chem.1989:1859-1866; Barton etc., (1987) with synthetic new a-amino acid of free-radical chemistry and derivant: synthetic L-and D-alpha-amido-adipic acid, L-alpha-amido 1,5-pentanedicarboxylic acid. and suitable unsaturation derivant (Synthesis of Novel α-Amino-Acids and Derivatives Using Radical Chemistry:Synthesis of L-and D-α-Amino-Adipic Acids, L-α-aminopimelic Acid and Appropriate Unsaturated Derivatives), Tetrahedron Lett.43:4297-4308; With, Subasinghe etc., synthetic and the activity (Quisqualic acid analogues:synthesis of beta-heterocyclic 2-aminopropanoic acid derivatives and their activity at a novel quisqualate-sensitized site) on new Quisqualic Acid-sensitization site of (1992) Quisqualic Acid analog: β-heterocycle 2-alanine derivatives, J.Med.Chem.35:4602-7.Also, be entitled as " protein array (PROTEIN ARRAYS) " referring to the international publication number WO 2004/058946 of December in 2003 submission on the 22nd.

The cellular uptake of alpha-non-natural amino acid

The cellular uptake alpha-non-natural amino acid normally designs and selects alpha-non-natural amino acid, and the quadrature that for example is used for by genetic coding mixes one of problem that immunogen should consider to (making the charged ORS of OtRNA of identification selection person's codon).For example, the high charge density of a-amino acid may limit picked-up.Natural amino acid is gone into cell by collection (effect) picked-up of protein transport system, and these systems often show the aminoacid specificity that degree is different.Can carry out rapid screening assesses cell and will absorb which kind of alpha-non-natural amino acid.Can be referring to, the toxicity test among the international publication WO 2004/058946 of December in 2003 " Protein Arrays (protein array) " by name submitted in 22nd for example; Liu and Schultz, (1999), " Progress toward the evolution of an organism with an expanded genetic code (progress that contains the organic evolution of the genetic code that increases) ", PNAS, 96:4780-4785.Adopt various analysis of experiments picked-up situations though be not difficult, the another kind of method that design is suitable for the alpha-non-natural amino acid of cellular uptake approach provides biosynthesis pathway, thereby can produce aminoacid in vivo.

The biosynthesis of alpha-non-natural amino acid

Existing many biosynthesis pathwaies produce aminoacid and other chemical compound in the cell.Though for example in the cell, may there be the biological synthesis method of specific alpha-non-natural amino acid in occurring in nature, various embodiments of the present invention provide this method.For example, by adding new enzyme or modifying existing host cell approach and can in host cell, choose the biosynthesis pathway that produces alpha-non-natural amino acid wantonly.Other new enzyme is optional to be the enzyme of natural generation or the enzyme of artificial exploitation.For example, biosynthesis p-Aminophenylalanine (shown in WO 2002/085923 (the same)) relies on the mixture that adds other biological known enzyme.Can be by these genes being introduced cell with the plasmid transfection cell of the gene that contains these enzymes.When these genes were expressed in cell, they provided the enzymatic pathway of synthetic required compound.The example of enzyme type that can choose adding wantonly is referring to for example Genbank.Also can be in the same manner with the optional cell that adds of the enzyme of manually developing.Manipulation cell mechanism and resource are in order to produce alpha-non-natural amino acid in this way.

In fact, thereby can adopt the whole bag of tricks to produce new enzyme in vivo or the external biosynthesis pathway that is used for, improve existing approach, produce alpha-non-natural amino acid.The many existing method of exploitation enzyme and other biosynthesis pathway component is applicable to that the present invention is to produce alpha-non-natural amino acid (perhaps, in fact, be used to develop synzyme and make it to have new substrate specificity or other interested activity).For example, can choose wantonly and adopt DNA to reorganize the new enzyme and/or the approach of these enzymes developed, thereby can in external or body, produce alpha-non-natural amino acid (or producing new synzyme).Can be referring to, Stemmer for example, (1994), " Rapid evolution of a protein in vitro by DNA shuffling (by DNA reorganization at external tachytelic evolution protein) ", Nature, 370 (4): 389-391; Stemmer, (1994), " DNA shuffling by random fragmentation and reassembly:In vitro recombination for molecular evolution (DNA by random fracture and assembling reorganizes: the vitro recombination of molecular evolution) ", Proc.Natl.Acad.Sci.USA., 91:10747-10751.Correlation technique is reorganized related (for example homologous) gene family, thereby can open the enzyme of desirable characteristics fast.The example of this " family gene reorganization " method is seen Crameri etc., (1998), " DNA shuffling of a family of genes from diverse species accelerates directed evolution (orthogenesis has been quickened in the DNA reorganization of variety classes gene family) ", Nature, 391 (6664): 288-291.Also can adopt and be called " truncate that increases progressively that produces hybrid enzyme " DNA recombination method (ITCHY) to produce new enzyme (no matter being biosynthesis pathway component or synzyme), Ostermeier etc. for example, (1999), " A combinatorial approach to hybrid enzymes independent of DNA homology (not relying on the combined method of the hybrid enzyme of dna homology) ", Nature Biotech is described in the 17:1205.This method also can be used for producing as one or more the enzyme of recombination method substrate or library of other approach variant in the external or body.Also can referring to, Ostermeier etc., (1999), " Combinatorial Protein Engineering by Incremental Truncation (employing increases progressively the combined protein matter engineering of truncate) ", Proc.Natl.Acad.Sci.USA, 96:3562-67; Ostermeier etc., (1999), " Incremental Truncation as a Strategy in the Engineering of Novel Biocatalysts (as the truncate that increases progressively of the method for engineered neoplasm catalyst) ", Biological and Medicinal Chemistry, 7:2139-44.The library that the optional another kind of method of using of this paper adopts index set mutation (exponential ensemble mutagenesis) to produce enzyme or other approach variant, it is catalysis and the relevant biosynthesis reaction of generation alpha-non-natural amino acid (or new synzyme) for example.In the method, the little group residue in picked at random (randomized) sequence interested abreast is to identify the aminoacid that can produce functional protein in variant position.Be applicable to that the present invention sees Delegrave and Youvan, (1993), Biotechnology Research, 11:1548-1552 with the example that produces new enzyme and then produce these class methods of alpha-non-natural amino acid (or new synzyme).In other method, utilize to mix or degenerate oligonucleotide at random or half random mutagenesis can be used for engineered enzyme and/or pathway components, for example adopt as the described general method of mutagenesis of following document: Arkin and Youvan, (1992), " Optimizing nucleotide mixtures to encode specific subsets of amino acids for semi-random mutagenesis " (optimizing the specific amino acids subgroup that mixture of ribonucleotides is encoded and is used for half random mutagenesis), Biotechnology 10:297-300; Or Reidhaar-Olson etc., (1991), " Random mutagenesis of protein sequences using oligonucleotide cassettes " (with oligonucleotide box random mutagenesis protein sequence), Methods Enzymol., 208:564-86.Utilize polynucleotide to reassembly and the another kind of method (often being called " nonrandom " mutation) of site saturation mutagenesis can be used for producing enzyme and/or pathway component, screen the ability that they exercise one or more synzyme or biosynthesis pathway function (for example producing alpha-non-natural amino acid in vivo) then.Can be referring to, Short for example, " NON-STOCHASTIC GENERATION OF GENETIC VACCINES AND ENZYMES (the nonrandom generation of genetic vaccine and enzyme) ", WO 00/46344.

The alternative method of this mutation method comprises the whole genome of reorganization biology and the offspring's that selection obtains particular approach function (often being called " full genome reorganization ").This method is applicable to the various embodiments of the present invention, for example can produce the biology (escherichia coli or other cell) of alpha-non-natural amino acid (or its intermediate) by genome reorganization and selection.For example, the method that following publication instructed can be applicable to the approach design, thereby can develop approach existing and/or new in the cell and then produce alpha-non-natural amino acid: Patnaik etc. in vivo, (2002), " Genome shuffling of lactobacillus for improved acid tolerance (the lactobacillus genome is reorganized and improved sour toleration) ", Nature Biotechnology, 20 (7): 707-712; With Zhang etc., (2002), " Genome shuffling leads to rapid phenotypic improvement in bacteria (genome reorganization causes the antibacterial phenotype to be improved fast) ", Nature, February 7,415:644-646.

Other can be used for technology biological and metabolic pathway engineering transformation (for example for producing required compound) and also is applicable to the generation alpha-non-natural amino acid.Instruct the example of the publication of the useful engineered method in path to comprise: Nakamura and White, (2003), " Metabolic engineering for the microbial production of 1; 3 propanediol (micro-organisms 1; metabolic engineering of 3 propylene glycol) ", Curr.Opin.Biotechnol., 14 (5): 454-9; Berry etc., (2002), " Application of Metabolic Engineering to improve both the production and use of Biotech Indigo (using production and purposes that metabolic engineering improves Biotech Indigo) ", J.Industrial Microbiology and Biotechnology, 28:127-133; Banta etc., (2002), " Optimizing an artificial metabolic pathway:Engineering the cofactor specificity of Corynebacterium 2; 5-diketo-D-gluconic acid reductase for use in vitamin C biosynthesis (optimize artificial metabolic pathway: the engineered synthetic corynebacterium 2 of vitamin C bio that is used for; the cofactor specificity of 5-diketo-D-gluconic acid reductase) ", Biochemistry, 41 (20): 6226-36; Selivonova etc., (2001), " Rapid Evolution of Novel Traits in Microorganisms (tachytelic evolution of new features in the microorganism) ", Applied and Environmental Microbiology, 67:3645 and many other publications.

No matter adopt any method, the concentration of the alpha-non-natural amino acid that produces with engineered biosynthesis pathway is enough to biosynthesis protein effectively, n cell content for example, but should not reach the amino acid whose concentration of other cell of appreciable impact or exhaust the degree of cell resource.The concentration that is produced in vivo is generally about 10mM to about 0.05mM in this way., can choose wantonly and adopt the generation of selecting in the body with further optimization alpha-non-natural amino acid in case thereby cell by engineered required enzyme and the alpha-non-natural amino acid of particular approach that produced, is grown with cell for ribosomal protein is synthetic.

The non-natural immunogen

This paper is used for comprising target part in the subject or can be in " non-natural " version of the intravital target part of object (as the target part from the antibacterial that can infect object, from tumorigenic target part in the subject etc.) usually in the immunogen that object produces immunological response.In other words, the non-natural immunogen comprises the aminoacid sequence/structure identical with the target part arbitrarily, except target one or more aminoacid deformity partly are replaced by alpha-non-natural amino acid (vide infra as the embodiment part of showing).In addition or in addition, the non-natural immunogen can comprise the same acid sequence of target part but have one or more other alpha-non-natural amino acid residues.Non-natural immunogen of the present invention comprise as, 10 lattice or more a plurality of alpha-non-natural amino acid, 5-10 alpha-non-natural amino acid, 5 or alpha-non-natural amino acid still less, perhaps 2 or alpha-non-natural amino acid etc. still less.Compare with total amino acids, the non-natural immunogen can comprise as 10% or more, 5-10%, 5% or still less, 2% or still less, the or 1% or the alpha-non-natural amino acid of percent still less.What be to be understood that has a liking for, and the non-natural immunogen can comprise the different alpha-non-natural amino acid of one or more numbers herein.

The position of one or more alpha-non-natural amino acids should not be considered as restriction in the non-natural immunogen of the present invention.Therefore, for example alpha-non-natural amino acid can come across immunogenic C-terminal or N-terminal, and perhaps alpha-non-natural amino acid can come across any position in the immune original amino acid.The embodiment part vide infra.The placement of alpha-non-natural amino acid (same selection for specific alpha-non-natural amino acid) can be carried out for multiple consideration.For example, partly compare with the natural target proteins matter of origin (or corresponding with it), the position/selection of alpha-non-natural amino acid is the immunogenic structure conformation of not appreciable impact arbitrarily.Therefore, therefore the cross reaction of antibody takes place in immunogenic structure conformation of resulting non-natural and the approaching arbitrarily coupling of corresponding natural target part.Therefore, in some embodiments of this paper, select specific alpha-non-natural amino acid and the ad-hoc location in immunogen thereof to change with the structure (three grades/level Four) that corresponding natural target is partly compared with the immunogen that takes effect as far as possible.In some embodiments, whether alpha-non-natural amino acid selection/placement can help to reduce problems such as infectiousness, toxicity alpha-non-natural amino acid and placement thereof are impacted.Mix the natural amino acid that can be different from its replacement on the immunogenic alpha-non-natural amino acid structure arbitrarily.Therefore, in some embodiments, specific alpha-non-natural amino acid is that non-conservation is replaced for the natural amino acid of target part.Participate among the embodiment hereinafter about in the non-natural immunogen with the Lys residue pNO of target part ₂Phe replaces.In other embodiments, alpha-non-natural amino acid is the conservative substituent for natural amino acid.The position of alpha-non-natural amino acid in immunogen is subjected to the antibody accessibility equally and/or it produces the influence of serum antibody, B-cell and/or T-cell response ability.Therefore, in various non-natural immunogens of the present invention, alpha-non-natural amino acid can be approaching by antibody, as be exposed to the surface.

In various embodiments, alpha-non-natural amino acid can be any alpha-non-natural amino acid.Hold,, can be used for alpha-non-natural amino acid of the present invention and have the side-chain radical that is different from natural amino acid although alpha-non-natural amino acid can be the chemical compound of the natural generation except that 20 kinds of albumen a-amino acids.The used alpha-non-natural amino acid of the present invention comprises neighbour-methyl-L-tyrosine, L-3-(2-naphthyl) alanine, 3-methylphenylalanine, neighbour-4-pi-allyl-L-tyrosine, 4-propyl group-L-tyrosine, three-O-acetyl group-GlcNAcb-serine, L-Dopa fluoridizes phenylalanine, isopropyl-L-phenylalanine, right-nitrine-the L-phenylalanine, right-acyl group-the L-phenylalanine, right-benzoyl-the L-phenylalanine, the L-phosphoserine, the phosphono serine, phosphono tyrosine, right-the iodo-phenylalanine, right-the boryl phenylalanine, right-amino-the L-phenylalanine, isopropyl-L-phenylalanine, the non-natural analog of tyrosine; The non-natural analog of glutamine; The non-natural analog of phenylalanine; The non-natural analog of serine; The non-natural analog of threonine; Alkyl, aryl, acyl group, azido, cyano group, halogen, hydrazine, hydrazides, hydroxyl, thiazolinyl, alkynyl (alkynl), ether, mercaptan, sulfonyl, seleno, ester, thio-acid, borate, boride (boronate), phosphorus, phosphono, phosphine, heterocycle, ketenes, imines, aldehyde, azanol, ketone or the amino aminoacid that replaces, or its any combination; The aminoacid that has the photoactivated cross-linking agent; The aminoacid of spin labeling; Fluorescence aminoacid; The aminoacid that has novel functional group; With the covalently or non-covalently interactional aminoacid of another molecule; The aminoacid of bond; Metallic aminoacid; Radioactivity aminoacid; The aminoacid of that light beam is tied up and/or intramolecular photosensitization; The aminoacid that contains biotin or biotin analog; Glycosylation or sugar-modified aminoacid; Contain keto amino acid; The aminoacid that comprises Polyethylene Glycol or polyethers; The aminoacid that heavy atom replaces; But but the aminoacid of chemical cracking or photodestruciton; Have the aminoacid that prolongs side chain; The aminoacid that contains toxophore; Sugar-substituted aminoacid is sugar-substituted serine etc. for example; The aminoacid of the sugar that carbon containing connects; Aminoacid with redox active; Contain alpha-hydroxy acid; The aminoacid that contains amino thio-acid; α, the α disubstituted amino acid;-aminoacid; And the cyclic amino acid outside the proline.

In various embodiments, non-natural immunogen herein such as non-natural TNF α can comprise following one or more: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMePhe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.Not should be understood that for enumerating of specific amino acids and should regard as, and can be used as the present invention yet as other alpha-non-natural amino acid cited herein for restriction of the present invention.

By using crystallization of protein, NMR etc., the influence (if any) that those skilled in the art are familiar with definite protein shape/conformation and definite alpha-non-natural amino acid mixes polypeptide.Hereinafter shown the example that produces the non-natural immunogen and determine this immunogenic structure conformation and antibody accessibility among the embodiment.This type of determine to help arbitrarily the natural immunity former in the selection and/or the placement of specific alpha-non-natural amino acid.

Non-natural immunogen of the present invention can be based on multiple target part, and can not only comprise polypeptides, also comprises the related polypeptides of sugar, fat, hapten and/or other nonprotein molecule.Immunogen of the present invention can include but not limited to other any target (disease association) part as herein described.

In the useful embodiment of a class as herein described, the non-natural immunogen comprises non-natural TNF α, can also comprise high immunogenicity (E.Keinan compiles. " catalytic antibody " (Catalytic Antibodies) (WV public affairs The department, Wei En Haimu, 2005), 1-28), structure conservative, can be by the approaching 4-nitro of antibody-L-phenylalanine (pNO ₂Phe, Figure 1A), as pNO ₂Phe ⁸⁶TNF α, pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α or pNO ₂Phe ¹¹³-mTNF α.In these embodiments, replace sudden change and make non-natural mTNF α keep three grade and the quaeternary protein structure similar substantially to natural mTNF α, the neutralizing antibody that therefore makes the antagonism non-natural mTNF α that is produced more likely with wt mTNF α on pairing epi-position cross reaction.As other local detailed description in detail of this paper, compare with endogenous mTNF α, the replacement of alpha-non-natural amino acid and/or add do not change (or significantly not changing) non-natural mTNF α and conformational structure.The non-natural hTNF α that has therapeutic and/or preventative processing purposes in people's object comprises pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α or pNO ₂Phe ¹¹⁴-hTNF α.

Usually, the rising of serum levels level is relevant with various disease states.Yet should be understood that the individuality etc. that produces the individual of immunne response in vivo and/or give preventative processing does not show the serum TNF alpha levels of representing morbid state.Therefore, should be understood that antibody of the present invention and/or non-natural immunogen can be to the individualities that shows or do not show the TNF alpha associated disorders.

In other embodiment of the present invention, the non-natural immunogen comprises non-natural RBP4, as treats and/or prevents the relevant morbid state of RBP4.Can use one or more alpha-non-natural amino acids to replace any natural RBP4 and produce non-natural RBP4.Should be understood that, for TNF α or other target part, replace and need not (but can) natural amino acid replaced with the conservative alpha-non-natural amino acid of structure.Perhaps or in addition, can in the RBP4 polypeptide, add one or more other alpha-non-natural amino acids (but not " replacements " natural amino acid wherein) and generation non-natural RBP4.As the former narration of the relevant non-natural TNF of preamble alpha immunization, make up for any other immunogen herein, therefore whether corresponding non-natural RBP4 can comprise the structure similar substantially to natural RBP4 arbitrarily, increased the probability (and regardless of the epi-position among the non-natural RBP4 with alpha-non-natural amino acid of this epi-position on the target RBP4) of the neutralizing antibody that produces at non-natural RBP4 and corresponding natural RBP4 epi-position generation cross reaction.Certainly, in like manner as can be known, any alpha-non-natural amino acid that being used in the non-natural immunogen replaces target part natural amino acid needs not be conservative replacement.Embodiment vide infra.The non-natural RBP4 that has therapeutic and/or preventative processing purposes in object comprises pNO ₂Phe ⁴³MRBP4 and pNO ₂Phe ¹⁰⁸MRBP4 and human body homologue thereof.

Produce the non-natural immunogen

Should be understood that, can make up non-natural immunogen of the present invention, the method for normally directly mixing by several different methods.Therefore, though mainly concentrating on, the narration of this paper and embodiment use the orthogonal translation system that alpha-non-natural amino acid is mixed protein, but also can use other method to create the non-natural immunogen and give object, as producing immunne response at the target part, or produce the non-natural immunogen be used to create cross reacting antibody, described antibody can give object as in and the target part.In many embodiments, in the middle of the immunogenic process of structure, alpha-non-natural amino acid is added non-natural immunogen (as making up in the immunogenic process with orthogonal translation, external synthetic or chemosynthesis etc.), but not carry out chemical modification (although these class methods can be arbitrarily and the method coupling of directly mixing or as a supplement) by post translational modification or to the natural amino acid in the molecule.Therefore, although this paper has described the concrete grammar that makes up the molecule that comprises alpha-non-natural amino acid in detail,, should not regard limitation of the present invention as orthogonal translation.Comprise also in many embodiments of this paper that other structure contains the method for the molecule of alpha-non-natural amino acid, comprise and modify behind the untranslated and non-chemically modify.

Should be understood that, utilizing genetic method that alpha-non-natural amino acid is mixed immunogen (as by the orthogonal translation system, as described in this paper and this paper list of references) in some embodiments can provide and be better than synthetic or other the similar in vitro method of solid-phase peptide and produce the immunogenic benefit of non-natural.For example, utilize genetic method that alpha-non-natural amino acid is mixed the synthetic non-natural immunogen of biosynthesis machine that immunogen is used living cells in vivo.Production can produce the accurate and born similar functional immunity former (or other parts) of (natural) target part in this type of body, but has additional activity/functional groups of introducing because of alpha-non-natural amino acid.Therefore the strong immunization that helps to produce born (natural) target part of intersection identification or wild type part is replied.And, use new biotechnology instrument to carry out the immunogen (promptly similar or identical) that being mixed with of alpha-non-natural amino acid helps produce correct native conformation in vivo, and productive rate is expensive low with the conformation of corresponding target part.In some embodiments, by the synthetic short molecule of the more targeting of the complete synthesis protein of alpha-non-natural amino acid (as～60-100 an aminoacid) that uses of other in vitro method such as solid-phase peptide, obtain denatured protein with lower productive rate, can connect together arbitrarily.

Quadrature tRNA/ amide groups-tRNA synzyme technology

Explain as this paper, be used for generation among the present invention and pass through quadrature tRNA/ amide groups-tRNA synthase systems structure usually at the non-natural immunogen of the immunne response of natural target part (object is born or ectogenic).Therefore, for the understanding of new compositions of the present invention and method by quadrature tRNA and quadrature aminoacyl-tRNA synthetase are deepened the understanding of related activity.Usually, in order to add alpha-non-natural amino acid in genetic coding, the new quadrature that need comprise aminoacyl-tRNA synthetase and suitable tRNA is to effective performance function in host's machine translator,, still exist for translation system " orthogonal " problem.Therefore, quadrature component performance function does not rely on endogenic synzyme of translation system and tRNA.Quadrature comprises required feature; only decoding or identification specific cryptosystem are as the tRNA of selectivity codon such as succinum termination codon; described codon is not by any endogenous tRNA decoding; and aminoacyl-tRNA synthetase, this synzyme only uses specific alpha-non-natural amino acid preferential amidatioon homology tRNA or " making it be in carrier state ".O-tRNA not by amidatioon or seldom amidatioon, is promptly carried by the endogenous synzyme usually.For example; in the escherichia coli host system; quadrature is to comprising not the aminoacyl-tRNA synthetase with any endogenous tRNA cross reaction; in the escherichia coli by 40 kinds of endogenic tRNA synzyme; and not by the amidated quadrature tRNA of any endogenous synzyme, the escherichia coli kind has 21 kinds of quadrature tRNA.

This area understand to be fit to produces the General Principle of the proteinic orthogonal translation system that comprises one or more alpha-non-natural amino acids of the present invention, and the conventional method that is used to produce the orthogonal translation system.For example referring to the international publication number WO 2002/086075 that is called " producing quadrature tRNA-amide-right method and composition of tRNA synzyme " (METHODS AND COMPOSITION FOR THE PRODUCTION OF ORTHOGONAL tRNA-AMINOACYL-tRNA SYNTHETASE PAIRS); The international publication number WO 2002/085923 of " mixing alpha-non-natural amino acid in the body " (VIVO INCORPORATION OF UNNATURAL AMINO ACIDS) by name; The international publication number WO 2004/094593 of " expansion eucaryon genetic coding " by name; The WO 2005/019415 that on July 7th, 2004 submitted to; The WO 2005/007870 that on July 7th, 2004 submitted to; The WO 2005/007624 that on July 7th, 2004 submitted to; The WO 2006/110182 that submitted on October 27th, 2005, " alpha-non-natural amino acid mixes used orthogonal translation system in the body " (ORTHOGONAL TRANSLATION COMPONENTS FOR THE VIVO INCORPORATION OF UNNATURAL AMINO ACIDS) by name; And the WO 2007/103490 of submission on March 7th, 2007, " in eukaryotic host cell, expressing the system of orthogonal translation assembly " (SYSTEMS FOR THE EXPRESSION OF ORTHOGONAL TRANSLATION COMPONENTS IN EUBACTERIAL HOST CELLS) by name.Referring to as (2007) such as Liu " in mammalian cell use genetic method alpha-non-natural amino acid is mixed protein " " Genetic incorporation of unnatural amino acids into proteins in mammalian cells " Nat Methods4:239-244; The international application no PCT/US2008/081868 that on October 30th, 2008 submitted to, " the boric acid aminoacid of hereditism's coding " " A Genetically Encoded Boronate Amino Acid, " by name; The WO2007/047301 " phage-displayed polypeptides is carried out selective posttranslational modification " " Selective Posttranslational Modification of Phage-Displayed Polypeptides, " that on October 11st, 2006 submitted to; And the WO2006/110182 of submission on October 27th, 2005 " alpha-non-natural amino acid mixes used orthogonal translation assembly in the body " " Orthogonal Translation Components for the In vivo Incorporation of Unnatural Amino Acids.These are applied for that the integral body of each includes this paper in as a reference.For the orthogonal translation system that will mix natural amino acid is discussed, and generation and purposes, can also be referring to Wang and Schultz, (2005) " expansion genetic coding " (Expanding the Genetic Code) Angewandte Chemie Int Ed44:34-66; Xie and Schultz, (2005) " genetic coding of expansion " (An Expanding Genetic Code) Methods36:227-238; Xie and Schultz, (2005) " in hereditary storehouse, adding aminoacid " (Adding Amino Acids to the Genetic Repertoire) Curr Opinion in Chemical Biology9:548-554; Wang etc. (2006) " expansion genetic coding " (Expanding the Genetic Code) Annu Rev Biophys Biomol Struct35:225-249; Deiters etc. (2005) " in the escherichia coli body, alkynes being mixed protein " (In vivo incorporation of an alkyne into proteins in Escherichia coli) Bioorganic ﹠amp; Medicinal Chemistry Letters15:1521-1524; Chin etc., (2002) " in the escherichia coli genetic coding, adding L-4-triazobenzene alanine " (Addition of p-Azido-L-phenylalanine to the Genetic Code of Escherichia coli) J Am Chem Soc124:9026-9027; And the international publication number WO2006/034332 of JIUYUE in 2005 submission on the 20th.It is for referencial use to include each content whole of these documents in this paper.Other details of orthogonal translation system is referring to U.S. Patent number 7,045,337; 7,083,970; 7,238,510; 7,129,333; 7,262,040; 7,183,082; 7,199,222 and 7,217,809.

In addition, alpha-non-natural amino acid used herein (making up then) refers to any aminoacid, the aminoacid of modification, the amino acid analogue except the a-amino acid of selenocysteine and/or pyrroles's lysine and 20 genetic codings.Referring to for example, " biochemistry " of L.Stryer, the third edition, 1988, the structure of 20 kinds of natural amino acids in the New York freeman company (Freeman and Company, New York).In various embodiments, alpha-non-natural amino acid is any immunogenicity aminoacid (as a common amino acid whose immunogenicity analog).In addition, although alpha-non-natural amino acid can be the chemical compound of the natural generation except that 20 kinds of albumen a-amino acids, alpha-non-natural amino acid of the present invention has the side-chain radical that is different from natural amino acid.The non-limitative example that can be used for the immunogenic alpha-non-natural amino acid of the present invention comprises neighbour-methyl-L-tyrosine, L-3-(2-naphthyl) alanine, 3-methylphenylalanine, neighbour-4-pi-allyl-L-tyrosine, 4-propyl group-L-tyrosine, three-O-acetyl group-GlcNAcb-serine, L-Dopa fluoridizes phenylalanine, isopropyl-L-phenylalanine, right-nitrine-the L-phenylalanine, right-acyl group-the L-phenylalanine, right-benzoyl-the L-phenylalanine, the L-phosphoserine, the phosphono serine, phosphono tyrosine, right-the iodo-phenylalanine, right-the boryl phenylalanine, right-amino-the L-phenylalanine, isopropyl-L-phenylalanine, the non-natural analog of tyrosine; The non-natural analog of glutamine; The non-natural analog of phenylalanine; The non-natural analog of serine; The non-natural analog of threonine; Alkyl, aryl, acyl group, azido, cyano group, halogen, hydrazine, hydrazides, hydroxyl, thiazolinyl, alkynyl (alkynl), ether, mercaptan, sulfonyl, seleno, ester, thio-acid, borate, boride (boronate), phosphorus, phosphono, phosphine, heterocycle, ketenes, imines, aldehyde, azanol, ketone or the amino aminoacid that replaces, or its any combination; The aminoacid that has the photoactivated cross-linking agent; The aminoacid of spin labeling; Fluorescence aminoacid; The aminoacid that has novel functional group; With the covalently or non-covalently interactional aminoacid of another molecule; The aminoacid of bond; Metallic aminoacid; Radioactivity aminoacid; The aminoacid of that light beam is tied up and/or intramolecular photosensitization; The aminoacid that contains biotin or biotin analog; Glycosylation or sugar-modified aminoacid; Contain keto amino acid; The aminoacid that comprises Polyethylene Glycol or polyethers; The aminoacid that heavy atom replaces; But but the aminoacid of chemical cracking or photodestruciton; Have the aminoacid that prolongs side chain; The aminoacid that contains toxophore; Sugar-substituted aminoacid is sugar-substituted serine etc. for example; The aminoacid of the sugar that carbon containing connects; Aminoacid with redox active; Contain alpha-hydroxy acid; The aminoacid that contains amino thio-acid; α, the α disubstituted amino acid; ###-aminoacid; And the cyclic amino acid outside the proline.

In specific implementations, non-natural immunogen herein such as non-natural TNF α or other any non-natural immunogen can comprise following one or more: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMePhe; Neighbour-OMe Phe; Between-OMe Phe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.Not should be understood that for enumerating of specific amino acids and should regard as, and other alpha-non-natural amino acid (as other immunogenicity alpha-non-natural amino acid) also can be used as the present invention for restriction of the present invention.

The orthogonal translation system

The orthogonal translation system generally includes and contains cell such as prokaryotic cell such as escherichia coli, and described cell comprises quadrature tRNA (O-tRNA), quadrature aminoacyl tRNA synthetase (O-RS) and alpha-non-natural amino acid, as p-nitrophenyl alanine (pNO ₂Phe), to carboxyphenylalanine, sulfuration tyrosine etc.(referring to above), wherein O-RS alpha-non-natural amino acid amidatioon O-tRNA.Quadrature be to can comprising O-tRNA, as suppressing tRNA, move frame tRNA etc., and similar O-RS.Can be used for producing the proteinic orthogonal system of this paper non-natural, it is right to generally include O-tRNA/O-RS, can comprise cell or acellular environment.

Usually, when quadrature also loaded with the corresponding aminoacid of selectivity codon to the identification selection codon, quadrature was to being called as " inhibition " selectivity codon.That is to say, translation system such as Bacillus coli cells nonrecognition selectivity codon, the endogenous machine is normal load not, has stoped the generation of polypeptide, will be polypeptide from translated nucleic acid then all.At quadrature to system's kind, O-RS with specific alpha-non-natural amino acid as, used p-nitrophenyl alanine (pNO among this paper embodiment ₂Phe), amidatioon O-tRNA.The O-tRNA identification selection codon that loads, and suppress the translation blocking-up that the selectivity codon causes.

Translation system, as Bacillus coli cells, use O-tRNA/O-RS to alpha-non-natural amino acid being mixed the polypeptide chain of growth, as the polynucleotide by the coding polypeptide of interest (as with subject in or can be in the corresponding non-natural immunogen of the intravital target part of object etc.), wherein polynucleotide comprise the selectivity codon of being discerned by O-tRNA.In some system, it is right that cell can comprise one or more other O-tRNA/O-RS, and wherein other O-RS loads other O-tRNA with different alpha-non-natural amino acids.For example, an O-tRNA can discern 4 base codons, and other O-tRNA can discern termination codon.Perhaps, a plurality of different termination codoies, a plurality of four different base codons, a plurality of different rare codons and/or a plurality of non-coding password together can be used in the identical code nucleic acid.Therefore, single polypeptide as the non-natural immunogen, can comprise a plurality of alpha-non-natural amino acids, and/or the not homopolypeptide of creating in the system can comprise different alpha-non-natural amino acids.About more about available O-RS/O-tRNA homology to and uses thereof details, referring to other local list of references that indicates of this paper for example.

Therefore, it is right that some translation systems can comprise a plurality of O-tRNA/O-RS, thereby make more than a kind of alpha-non-natural amino acid mix polypeptide.For example, translation system also can comprise other different O-tRNA/O-RS to second kind of alpha-non-natural amino acid, second kind of selectivity codon of wherein said another kind of O-tRNA identification, and described other O-RS preferably uses second kind of alpha-non-natural amino acid amidatioon O-tRNA.For example, comprise the right cell of O-tRNA/O-RS, wherein O-tRNA identification is as amber codon, it is right also can to comprise second quadrature, wherein the 2nd O-tRNA discerns different selectivity codons, as opal codon, ochre codon, four base codons, rare codon, non-coding password etc.In some systems, different quadratures is to from separate sources, and this helps the identification of different choice codon.

Some translation system can comprise cell, as Bacillus coli cells, described cell comprises the nucleic acid of the polynucleotide of quadrature tRNA (O-tRNA), quadrature acylamino--tRNA synzyme (O-RS), alpha-non-natural amino acid and coding polypeptide of interest, described polypeptide of interest as with the corresponding non-natural immunogen of object oneself protein matter target, wherein polynucleotide comprise the selectivity codon of being discerned by O-tRNA.Although the orthogonal translation system can use cultured cell to produce the protein that contains alpha-non-natural amino acid, this does not also mean that the complete living cells of orthogonal translation system's needs used herein.For example, the orthogonal translation system can use the cell free system that has cell extract.In fact, using acellular in vitro transcription/translation system to be used for proteinic production is a mature technology.Be applied to use orthogonal translation system component described herein to produce these vitro system and have the protein of alpha-non-natural amino acid also within the scope of the invention.

O-tRNA and/or O-RS can be the sudden changes of the tRNA and/or the RS that maybe can come from natural generation of natural generation, as, from multiple organism, produce tRNA library and/or RS library, and/or use multiple available sudden change strategy.For example, a kind ofly be used to produce quadrature tRNA/ amide groups-right strategy of tRNA synzyme and comprise heterologous tRNA/ synzyme drawing-in system, wherein said to as a kind of source or multiple source, but not use the right translation system of tRNA/ synzyme.The feature of heterologous synzyme material standed for comprises, as not carrying any host cell tRNA, the feature of heterologous tRNA material standed for comprises, as not by the amidatioon of any host cell synzyme.In addition, heterologous tRNA is orthogonal for all host cells.Produce second right strategy of quadrature and comprise that producing the sudden change library is used for screening and/or selects O-tRNA or O-RS.Also can be with these strategy combinations.

Quadrature tRNA (O-tRNA)

Wish that quadrature tRNA (O-tRNA) mediation mixes the polypeptide of polynucleotide encoding with alpha-non-natural amino acid, described polynucleotide comprise O-tRNA in vivo or the selectivity codon of external identification.

Therefore the compositions that comprises O-tRNA also comprises quadrature aminoacyl-tRNA synthetase (O-RS), and wherein O-RS preferably uses alpha-non-natural amino acid amidatioon O-tRNA.But this type of compositions that contains O-tRNA is translation system in the outer or body of occlusion body also.The nucleic acid that comprises the polynucleotide of the polypeptide of interest of encoding, wherein polynucleotide comprise the selectivity codon of being discerned by O-tRNA, or the combination of one or more selectivity codons, can occur in cell.

Produce reorganization quadrature tRNA and screen its corresponding selection codon alpha-non-natural amino acid is mixed polypeptide efficient method referring to as, International Publication No. WO 2002/086075, " producing the right method and composition of quadrature tRNA amide groups tRNA synzyme " (METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYL-tRNA SYNTHETASE PAIRS "; WO 2004/094593, " expansion genetic coding " (EXPANDING EUKARYOTIC GENETIC CODE "; And the WO 2005/019415 of submission on July 7th, 2004.Referring to Forster etc., (2003) " by the translation genetic coding programming peptide mimics synzyme of brand-new design " " Programming peptidomimetic synthetases by translating genetic codes designed de novo " Proc Natl Acad Sci U S A100:6353-6357; With Feng etc., (2003) " by the tRNA identification of single amino acid conversion expansion tRNA synzyme " " Expanding tRNA recognition of a tRNA synthetase by a single amino acid change " Proc Natl Acad Sci U S A100:5676-5681.Other details is referring to U.S. Patent number 7,045,337; 7,083,970; 7,238,510; 7,129,333; 7,262,040; 7,183,082; 7,199,222 and 7,217,809.

Quadrature amide groups-tRNA synzyme (O-RS)

Be used to produce the O-RS system of non-natural polypeptide herein, preferably in external or body, use alpha-non-natural amino acid amidatioon O-tRNA.By polypeptide that comprises O-RS and/or polynucleotide that encodes O-RS or its part of passing through coding O-RS, O-RS can be offered translation system, as Bacillus coli cells.

Produce O-RS, measure its amidatioon efficient, and/or the general details that changes its substrate specificity is called " producing the right method and composition of quadrature tRNA aminoacyl-tRNA synthetase " (METHODS AND COMPOSITIONS FOR THE PRODUCTION OF ORTHOGONAL tRNA AMINOACYL-tRNA SYNTHETASE PAIRS) referring to international publication number WO 2002/086075; And WO 2004/094593, " expansion eucaryon genetic coding " (EXPANDING THE EUKARYOTIC GENETIC CODE) by name.Referring to, Wang and Schultz " expansion genetic coding " (Expanding the genetic Code) Angewandte Chemie Int Ed44:34-66 (2005); And Hoben and Soll (1985) Methods Enzymol113:55-59, it is for referencial use to include its content whole in this paper.About other details of this system referring to U.S. Patent number 7,045,337; 7,083,970; 7,238,510; 7,129,333; 7,262,040; 7,183,082; 7,199,222 and 7,217,809.

Source and host's organism

Can choose wantonly with it and produce the combination that the immunogenic orthogonal translation components of the present invention of non-natural (O-tRNA and O-RS) can derive from any biology or biology, the host's translation system that can be used for any other species is as long as described O-tRNA/O-RS component and host system can work with orthogonal manner.O-tRNA and O-RS in certain quadrature pairing need not to derive from same biology.For example, the quadrature component can derive from the archeobacteria gene that is used for the eubacteria host system.

In addition, quadrature O-tRNA can be derived from archeobacteria, as Methanococcus jannaschii, thermophilic alkali methagen; The salt antibacterial is as rich salt bacterium of Wo Shi and salt antibacterial kind NRC-1; Glimmer ancient green-ball bacterium, fierce fireball bacterium, extreme hyperthermophilic archaeon strain, thermophilic spring given birth to archeobacteria, extra large natural pond methane coccus, methane and had a liking for hyperpyrexia bacterium (Methanopyrus kandleri), Mei Shi sarcina methanica (Mm), superhigh temperature resistant hot pin bacterium (Pyrobaculum aerophilum), deep-sea fireball bacterium, sulfolobus solfataricus (Ss), super hyperthermophilic archaeon strain (Sulfolobus tokodaii), thermoplasma acidophilum, hot volcanic substance etc.; Or eubacteria, as escherichia coli, thermus thermophilus, Bacillus subtillis (Bacillussubtilis), bacstearothermophilus etc.; And quadrature O-RS can derive from following biology (or biological combination), and archeobacteria for example is as Methanococcus jannaschii, thermophilic alkali methagen; The salt antibacterial is as rich salt bacterium of Wo Shi and salt antibacterial kind NRC-1; Glimmer ancient green-ball bacterium, fierce fireball bacterium, extreme hyperthermophilic archaeon strain, thermophilic spring given birth to archeobacteria, extra large natural pond methane coccus, methane and had a liking for hyperpyrexia bacterium, Mei Shi sarcina methanica, superhigh temperature resistant hot pin bacterium, deep-sea fireball bacterium, sulfolobus solfataricus, super hyperthermophilic archaeon strain, thermoplasma acidophilum, hot volcanic substance etc.; Or eubacteria, as escherichia coli, thermus thermophilus, Bacillus subtillis, bacstearothermophilus etc.In other systems, the eukaryote source, for example plant, algae, protozoacide, fungus, yeast, animal (for example mammal, insecticide, arthropod) etc. also can be used as the source of O-tRNA and O-RS.And paired each component of O-tRNA/O-RS can derive from same biology or different biological.

O-tRNA, O-RS or O-tRNA/O-RS pairing can be in vivo or external selection or screening and/or can be used for cell, eubacteria cell for example, thus produce the polypeptide that contains alpha-non-natural amino acid.Used eubacteria cell can include but not limited to, for example, escherichia coli (Escherichia coli), thermus thermophilus (Thermus thermophilus), bacillus subtilis (Bacillus subtilis), bacstearothermophilus (Bacillus stearothermphilus) etc.

Optant's codon

But various optant's codons are the genetic code subframe of amplification protein matter biosynthesis machine all.For example, optant's codon can comprise, as the codon of three base codons of uniqueness, nonsense codon (as termination codon (as amber codon (UAG) or opal codon (UGA))), non-natural codon, at least four bases, rare codon etc.Many optant's codons can be introduced required gene, for example more than one, more than two, three with first-class.Can adopt conventional direct mutagenesis optant's codon to be introduced interested site in the polynucleotide of coding polypeptide of interest (for example, the autoantigen of object etc.).Can referring to, Sayers etc. (1988) for example, " 5 '; 3 ' Exonuclease in phosphorothioate-based oligonucleotide-directed mutagenesis (5 ' in the thiophosphate oligonucleotide site directed mutagenesis; 3 ' exonuclease) ", Nucleic Acids Res, 16:791-802.Utilize different optant's codons, can utilize many to quadrature tRNA/ synzyme pairing, thereby can utilize these different optant's codons to mix a plurality of alpha-non-natural amino acids simultaneously locus specificity, for example comprise at least one alpha-non-natural amino acid.

Alpha-non-natural amino acid also can be encoded by rare codon.For example, when the arginine lowering of concentration in the external protein synthesis reaction, confirm that seldom used arginine codon AGG can utilize the synthetic tRNA of alanine acidylate and effectively insert ala.Referring to for example, Ma etc., (1993) are " with the synthetic tRNA with different anticodons ^AlaCarry out external protein engineering transformation " (In vitro protein engineering using synthetic tRNA ^AlaWith different anticodons) Biochemistry32:7939-7945.In this case, the tRNA of a small amount of natural generation that exists in synthetic tRNA and the escherichia coli ^ArgCompetition.In addition, some biologies can not utilize all codeword triplets.Can in vitro transcription/translation extract, utilize the sub-AGA of not designated pin of micrococcus luteus (Micrococcus luteus) to insert aminoacid.Referring to for example, Kowal and Oliver, (1997) " the unspecified codon of use carries out the aminoacid mutation (Exploiting unassigned codons in Micrococcus luteus for tRNA-based amino acid mutagenesis) based on tRNA in micrococcus luteus " Nucl Acid Res25:4685-4689.

Optant's codon also can comprise the extension codon, and the codon of four or more base for example is as four, five, six or the codon of polybase base more.The example of four base codons comprises, for example AGGA, CUAG, UAGA, CCCU etc.The example of five base codons comprises, for example AGGAC, CCCCU, CCCUC, CUAGA, CUACU, UAGGC etc.The concrete grammar that alpha-non-natural amino acid is mixed protein such as non-natural immunogen any non-natural TNF α as mentioned below or in fact interested any target part can comprise that use is based on moving expansion cipher that frame suppresses.The codon of four or more base can insert same protein with for example one or more alpha-non-natural amino acids.In other example, for example at least a four base codons of anticodon loop decodable code, at least a five base codons or at least a hexabasic basic codon or more.Because four possible base codons have 256 kinds, so the codon of available four or more base multiple alpha-non-natural amino acid of encoding in the same cell.Referring to Anderson etc., (2002) " exploring the limit of codon and anticodon size " (Exploring the Limits of Codon and Anticodon Size) Chemistry and Biology9:237-244; Magliery etc., (2001) " expansion genetic coding: select effective four base passwords to suppress son, and in escherichia coli, use the library method to identify " cunning " four base codons " (Expanding the Genetic Code:Selection of Efficient Suppressors of Four-base Codons and Identification of " Shifty " Four-base Codons with a Library Approach in Escherichia coli) J MolBiol307:755-769; Ma etc., (1993) " external use has the synthetic tRNA of different anticodons ^AlaEngineered albumen " (In vitro protein engineering using synthetic tRNA ^AlaWith different anticodons) Biochemistry32:7939; Hohsaka etc., (1999) " alpha-non-natural amino acid that will contain big aromatic group in external protein-synthesizing system effectively mixes strepto-affinity element " (Efficient Incorporation of Nonnatural Amino Acids with Large Aromatic Groups into Streptavidin in In Vitro Protein Synthesizing Systems) J Am ChemSoc 121:34-40; And Moore etc., (2000) " tetrad codon: the enlightenment of codon amplification, and the explanation of translation steps size " (Quadruplet Codons:Implications for Code Expansion and the Specificaion of Translation Step Size) J Mol Biol298:195-209.Four base codons have been used as optant's codon in various orthogonal systems.Can referring to, for example, WO 2005/019415; WO 2005/007870 and WO 2005/07624.Also can be referring to Wang and Schultz, (2005) " expansion genetic coding " (Expanding the genetic Code) Angewandte Chemie Int Ed44:34-66.

For giving fixed system, optant's codon also can comprise that natural base codon that endogenous system in the natural three base codons need not (or seldom using).For example, this comprises that shortage can discern the system of the tRNA of these natural three base codons, and/or this three bases codon is the system of rare codon.

The optional non-natural base pair that comprises of optant's codon.Be applicable to that the description of the non-natural base pair of the purposes of method and composition comprises herein: Hirao etc. for example, (2002), " An unnatural base pair for incorporating amino acid analogues into protein (amino acid analogue is mixed proteinic non-natural base pair) ", Nature Biotechnology, 20:177-182.Referring to Wu etc., (2002) " enzyme phosphorylation of non-natural nucleoside " (Enzymatic Phosphorylation of Unnatural Nucleosides) J Am Chem Soc124:14626-14630.

As mentioned above, in different embodiments of the present invention, can make up non-natural immunogen (be used in and produce immunne response in the subject, perhaps produce cross reacting antibody and give object then) in several ways.For example, usually can be by directly mixing method such as orthogonal translation system or external translating system or making up the non-natural immunogen by solid phase synthesis.Yet, mix indirectly as chemical modification or post translational modification and can carry out couplings (or as a supplement) such as other modification (or carry out other modification to the natural amino acid that makes up in the molecule) to aminoacid with orthogonal translation method or external translating system method or by quadrature or external translating system.Should be understood that various embodiment of the present invention can comprise the alpha-non-natural amino acid that makes up by multiple methods availalbe.

Alpha-non-natural amino acid is mixed immunogenic nonopiate method

Except that above-mentioned, the target part (perhaps the alpha-non-natural amino acid that mixes target part (as the disease association part) being modified) during various nonopiate strategies can be used for alpha-non-natural amino acid is incorporated herein by orthogonal method produce the non-natural immunogen (as with above-mentioned orthogonal method coupling).Should be understood that, in the exemplary embodiment herein, in making up immunogenic process, alpha-non-natural amino acid mixed immunogen (as translate, create when immunogen/when synthesize etc.), and phase chemical modification or post translational modification adding after obstructed.Therefore, in some embodiments, have the amino acid whose derivant of reactive side chain such as Lys, Cys and Tyr, as lysine is converted into N ²-acetyl group-lysine can directly mix method coupling and/or as a supplement with orthogonal method or other.Chemosynthesis also can provide the method for mixing alpha-non-natural amino acid.Referring to for example Dawson etc., Annu.Rev.Biochem., 69:923 (2000).

In another embodiment; external biological synthetic method commonly used (wherein using the sub-tRNA of required alpha-non-natural amino acid chemistry acyl group inhibition) is joined in the vitro extraction thing that can support protein synthesis; this method has been used for mixing the protein of multiple any size with surpassing 100 kinds of alpha-non-natural amino acid fixed points, can be used for this paper and creates the non-natural immunogen.Referring to for example, Cornish etc., Angew.Chem.Int.Ed.Engl., 1995,34:621 (1995); Noren etc., Science244 182-188 (1989); And Bain etc., J.Am.Chem.Soc.111 8013-8014 (1989).

Be called confusion that method in the body that selection pressure mixes also can be used for utilizing the wild type synzyme and create the non-natural immunogen of this paper.Referring to for example, Budisa etc., FASEB J., 13:41 (1999).In this auxotrophic strain, the associated metabolic path of specific natural amino acid supply cell is closed, and strain growth is in containing the amino acid whose restricted culture medium of limited concentration natural, and transcribing of target gene is suppressed.When entering stationary growth phase, natural amino acid exhausts, and changes the alpha-non-natural amino acid analog.The inducing of recombinant protein expression causes and contains the proteinic accumulation of non-natural analog.Referring to as Minks etc., Anal.Biochem., 284:29 (2000); Duewel etc., Biochemistry, 36:3404 (1997); And Tang etc., Angew. Chem.Int.Ed.Engl., 40:1494 (2001).Other example can be referring to as Hendrickson etc., EMBO J., 9:1665 (1990); Boles etc., Nat.Struct.Biol., 1:283 (1994); Budisa etc., Eur.J.Biochem., 230:788 (1995); Budisa etc., J.Mol.Biol.,270:616 (1997); VanHest etc., FEBS Lett., 428:68 (1998); Van Hest etc., J.Am.Chem.Soc., 122:1282 (2000); And Kiick etc., Tetrahedron, 56:9487 (2000).

Herein another with alpha-non-natural amino acid mix immunogenic optional/additional policy is that the synzyme with check and correction mechanism is modified.These synzyme can not be distinguished, and therefore the aminoacid with similar natural amino acid structural similarity carries tRNA, and described similar natural amino acid is that tRNA carries usually.Correct a mistake in another site at synzyme, the aminoacid that this synzyme carries the tRNA mistake carries out removal of acylation, to guarantee the fidelity of protein translation.If the active inactivation of the check and correction of synzyme, the tRNA that carries common its amino acid structure analog that carries can break away from editting function, the structure amino acid analogue is mixed in the polypeptide chain of growth.。Referring to Doring etc., Science, 292:501 (2001).

Solid phase synthesis and semisynthesis also can be used for the synthetic immunogen that comprises this paper alpha-non-natural amino acid.For example, referring to following publication and citing document: Crick etc., Nature, 1227-1232 (1961); Hofmann etc., J.Am Chem, 5914-5919 (1966); Kaiser etc., Acc Chem Res, 47-54 (1989); Nakatsuka etc., J Am Chem Soc, 3808-3810 (1987); Schnolzer etc., Science, 221-225 (1992); Chaiken etc., CRC Crit Rev Biochem, 255-301 (1981); Offord, Protein Eng., 151-157 (1987); And Jackson etc., Science, 243 (1994).

Can in the various embodiments of this paper, use chemical modification in non-natural immunogen of the present invention, to introduce multiple non-natural side chain, comprise cofactor, spin label and oligonucleotide.Chemical modification and other post translational modification can be used as auxiliary (if any) that directly mixes method such as orthogonal translation usually.Therefore, chemical modification can be arbitrarily and above-mentioned other method coupling that just turning over a finished item, as the alpha-non-natural amino acid that mixes by orthogonal method is modified.Referring to as Corey etc., Science, 1401-1403 (1987); Kaiser etc., Rev Biochem, 565-595 (1985); Kaiser etc., Science, 505-511 (1984); Neet etc., J Biol. Chem, 6392-6401 (1968); Polgar etc., J.Am Chem Soc, 3153-3154 (1966); And Pollack etc., Science, 1038-1040 (1988).

Perhaps, use the biological synthesis method of the amide groups-tRNA of chemical modification to be used to multiple biophysics probe is mixed external synthetic protein, can be used for creating the non-natural immunogen in this article.Referring to following publication and citing document thereof: Brunner, J., Annu.Rev Biochem, 483-514 (1993); And Krieg etc., Proc.Natl.Acad.Sci, 8604-8608 (1986).

By the sub-tRNA of the inhibition of chemical amide groupsization being added in the protein synthesis reaction of the gene programming that comprises required succinum nonsense mutation, also the alpha-non-natural amino acid fixed point can be mixed non-natural immunogen of the present invention.Utilize these schemes, use the auxotrophic strain of specific amino acids, the multiple of 20 kinds of common amino acid kinds can be replaced with the close congener of structure, as fluorophenylalanine substituted benzene alanine.Referring to as Noren etc., Science, 244:182-188 (1989); Nowak etc., Science268:439-42 (1995); Bain etc., J.Am Chem Soc, 111:8013-8014 (1989); Budisa etc., FASEB J.,13:41-51 (1999); Ellman etc., Methods in Enz., 301-336 (1992); And Mendel etc., Annu Rev Biophys.Biomol Struct., 24,435-62 (1995).

Can use microinjection technique that alpha-non-natural amino acid is mixed non-natural immunogen of the present invention.Referring to for example Nowak etc., Science, 268:439 (1995); And Dougherty, Curr.Opin.Chem.Biol., 4:645 (2000).Referring to as Turcatti etc., J.Biol.Chem., 271:19991 (1996) Gallivan etc., Chem.Biol., 4:739 (1997); Miller etc., Neuron, 20:619 (1998); England etc., Cell, 96:89 (1999); And Lu etc., Nat.Neurosci., 4:239 (2001).

Solid-phase polypeptide is synthetic be widely used in chemosynthesis contain the polypeptide and the small protein of alpha-non-natural amino acid other method (referring to as Merrifield (1963) " solid-phase peptide is synthesized I, and tetrapeptide synthesizes " (Solid Phase Peptide synthesis.I.The synthesis of a tetrapeptide) JACS85:2149-2154), it can be changed to produce non-natural immunogen of the present invention.This technology comprised for two steps usually: phase I SPPS is included on the poly holder by multiple coupling-go to protect and recycles the assembling that shielded amino acid derivativges carries out peptide chain.The free N-terminal amine of solid phase connection peptides can with aminoacid unit's coupling of single N-protected.Then this unit is gone protection, expose the new N-terminal amine that can be connected by another aminoacid.In the SPPS second stage, peptide is cut from holder, and remove the side chain protected group, as comprise the peptide of a plurality of alpha-non-natural amino acids of work with the generation peptide.The two kinds of synthetic main type of service of solid-phase peptide: Fmoc (Carpino etc., (1972) " 9-fluorenes methoxy acylamino-blocking group " (9-Fluorenylmethoxycarbonyl amino-protecting group) are arranged J Org Chem37:3404-3409), wherein used alkaline active alpha-amino protecting group, and t-Boc, acid active alpha-amino protecting group wherein used.Each method comprises the protection of different resins and amino acid side chain and follow-up cutting/go to protect step.

Also can use the semi-synthetic non-natural immunogen of alpha-non-natural amino acid being mixed protein generation this paper of protein.The splitted albumen intein of the semi-synthetic normal use of protein, but a proteinic part of self shearing and being connected with remaining part as extein again, generation is called the new reactive protein of shearing product.For example, do not comprise alpha-non-natural amino acid protein domain can with second protein domain coupling that does not comprise alpha-non-natural amino acid, produce the non-natural immunogen.This strategy helps producing and is difficult to the non-natural immunogen expressed in the protein expression system in vivo.

The number of chemical interconnection technique also can be used for alpha-non-natural amino acid is mixed this paper protein, for example in the semi-synthetic process of protein, thereby produces the non-natural immunogen.For example, in the biochemical connection in sky (NCL) reaction, under the condition that has exogenous sulfydryl catalyst, the polypeptide that comprises the N-terminal cysteine reacts with the alpha-non-natural amino acid that contains the terminal α-thioesters of α-thioester group such as C-, produce born peptide bond (Dawson etc., (1994) " by proteins react of the biochemical connection in sky " (Synthesis of Proteins by Native Chemical Ligation) in connection site Science266:776-779).It is a kind of protein engineering modification scheme that expressing protein connects (EPL), makes connecting of reorganization and synthetic chemiluminescent polypeptide selectivity or regioselectivity.It is approaching that this method makes the primary structure of most protein can be synthesized organic chemistry instrument institute, makes in the multiple alpha-non-natural amino acid any class mix albumen to produce the non-natural immunogen.The details of going deep into about these and other chemical interconnection technique is compiled referring to Howl, " the synthetic and application of peptide " (Peptide Synthesis and Its Applications), Xiu Mana publishing company, New Jersey Tuo Tuowa (Humana Press:Totowa NJ), 2005 etc.

Other details about technology

Produce other useful list of references of RS and tRNA sudden change, and other process useful (comprising clone, expression, PCR etc.) of multiple reorganization and the operation of external nucleic acid comprises Berger and Kimmel, " molecule clone technology instructs: Enzymology method " ( Guide to Molecular Cloning Techniques, Methods in Enzymology) 152 volumesScience Press, Santiago, California, Bei Ge (Academic Press, Inc., San Diego, CA (Berger)); Kaufman etc., (2003) " biomedical molecule and cell method handbook second edition " (Handbook of Molecular and Cellular Methods in Biology and Medicine Second Edition) Ceske (volume) CRC publishing house (Kaufman); And " nucleic acid laboratory manual " ( The Nucleic Acid Protocols Handbook)Ralph Rapley (volume) (2000) cold spring port, Xiu Mana publishing company (La Puli) (Cold Spring Harbor, Humana Press Inc (Rapley)); Chen etc. (volume) " PCR cloning experimentation scheme: second edition " ( PCR Cloning Protocols, Second Edition)(molecular biology method, 192 volumes) Xiu Mana publishing company; And Viljoen etc., (2005) " molecular diagnosis PCR handbook ( Molecular Diagnostic PCR Handbook),Springer company (Springer), ISBN 1402034032.

The range protein method is known, and they can be used for separating, detect, operate or handle the protein that produces according to the present invention, for example from the protein of the reorganization culture of expressing the immunogenic cell of any non-natural of the present invention.Well known range protein separates and detection method, for example comprises R.Scopes, " protein purification " (Protein Purification), Springer-Verlag, N.Y. (1982); Deutscher, " Enzymology method " (Methods in Enzymology) the 182nd volume: " protein purification guide " (Guide to Protein Purification), Academic Press, Inc.N.Y. (1990); Sandana (1997) " proteic bio-separation " (Bioseparation of Proteins), Academic Press, Inc.; Bollag etc. (1996) " protein process " (Protein Methods) the 2nd edition, Wiley-Liss, NY; Walker (1996) " albumen Handbook Of Operating Procedures " (The Protein Protocols Handbook) Humana Press, NJ, the IRL Press of Harris and Angal (1990) " protein purification is used: practical approach " (Protein Purification Applications:A Practical Approach) Oxford, Oxford, England; The IRL Press of Harris and Angal " method for purifying proteins: practical approach " (Protein Purification Methods:A Practical Approach) Oxford, Oxford, England; Scopes (1993) " protein purification: principle and put into practice " (Protein Purification:Principles and Practice) the 3rd edition SpringerVerlag, NY; Janson and Ryden (1998) " protein purification: principle, high resolution method and application " (Protein Purification:Principles, High Resolution Methods and Applications), second edition, Wiley-VCH, NY; And Walker (1998) " the albumen operation sequence on the CD-ROM " (Protein Protocols on CD-ROM) Humana Press, NJ; Listed method in the list of references of wherein quoting.Other details about protein purification and detection method is compiled referring to Satinder Ahuja, " the bio-separation handbook ( Handbook of Bioseparations), Science Press (Academic Press) (2000).These available methods can be used for (arbitrarily with other method for purifying proteins coupling) separates and/or purification pass through the generation of this paper several different methods the non-natural immunogen (as, by the orthogonal translation method) thereby, as, preparation treatment used immunogen, vaccine or others of the present invention.

Antibody and antibody producing

In some embodiments, the present invention comprises one or more antibody at immunogen (the non-natural disease association part that promptly comprises one or more alpha-non-natural amino acids), can give object with antibody.Describe in detail as mentioned, this antibody usually with subject in or can be in its intravital corresponding target part cross reaction, wherein natural target part does not comprise alpha-non-natural amino acid, " non-natural " immunogen is derived from natural target partly and corresponding with immunogen.

As mentioned above, antibody refers to the protein that substantially is made of the polypeptide of the fragment coding of immunoglobulin gene or immunoglobulin gene one or more.The immunoglobulin gene of generally acknowledging comprises κ, λ, α, γ, δ, ε and μ constant region gene, and countless immune globulin variable region genes.Light chain is categorized as κ or λ.Heavy chain classifies as γ, υ, α, δ or ε, and they define immunoglobulin class IgG, IgM, IgA, IgD and IgE respectively successively.

The structural units of a kind of typical immunoglobulin (as antibody) comprises the tetramer.To forming, each is to having one " light chain " (about 25kD) and one " heavy chain " (about 50-70kD) by two identical polypeptide chains for each tetramer.The N-terminal of each chain is determined the about 100-110 or the variable region of amino acids more, mainly responsible antigen recognition.Term variable region of light chain (VL) and variable region of heavy chain (VH) refer to these light chains and heavy chain respectively.

Antibody of the present invention can be complete immunoglobulin or exist with the fragment that different peptide enzymic digestions produce many well-characterized.Therefore, for example, digestion antibody below two sulfur of pepsin in hinge region connect produces F (ab ') ₂, the dimer of Fab itself is to be connected in V by disulfide bond _H-C _H1 light chain.Can under temperate condition, reduce F (ab ') ₂Connect with two sulfur that interrupt in the hinge region, thereby with F (ab ') ₂Dimer is converted into Fab ' monomer.Fab ' monomer comes down to have the Fab (referring to, " basic immunology " (Fundermental Immunology), W.E.Paul compiles, Raven Press, N.Y. (1999) to the more detailed description of other antibody fragment) of part hinge region.Though the digestion according to complete antibody has defined the different antibodies fragment, it will be understood by those skilled in the art that also available chemical method or the described Fab ' fragment of method de novo synthesis by recombinant DNA.Therefore, used herein term antibody also comprises the antibody fragment of modifying or being produced with the recombinant DNA method de novo synthesis by whole antibody.Antibody specific comprises single-chain antibody (antibody that exists with a polypeptide chain form), or variable region of heavy chain link together with variable region of light chain (directly or by peptide linker being connected) go single-chain Fv antibody (sFv or scFv) into continuous polypeptide.Single-chain Fv antibody and VH-VL heterodimer are covalently bound, and described VH-VL heterodimer is expressed self-contained direct connection or the VH-that connects by peptide coding joint and the nucleic acid of VL-coded sequence.Referring to (1988) such as Huston Proc.Nat.Acad.Sci.USA, 85:5879-5883.Form the single polypeptide chain although VH and VL are connected to each other, VH and VL structure in to be connected be non-covalent.But those skilled in the art understand with natural accumulative chemically separated weight polypeptide chain from antibody V district be converted into have to the scFv antibody of the folding molecule of the similar substantially three dimensional structure of antigen binding site structure and multiple other structure (referring to as U.S. Patent number 5,091,513,5,132,405 and 4,956,778).Be used for antibody of the present invention and comprise polyclone and monoclonal antibody.

Can use non-natural immunogen of the present invention or its fragment to produce antibody of the present invention.Use the non-natural immunogen of this paper invention to produce polyclonal antibody, humanized antibody, monoclonal antibody or antibody fragment.By the standard method antibody purification, the prepared product that provides does not have the unwanted pollutant that can influence antibody response substantially, as serum proteins.For polyclonal antibody, the selected mammal of available non-natural immunogen immune of the present invention (as mice, rabbit, goat, horse etc.).Collect the serum of immune animal then according to those skilled in the art's well-known process, and handle.And, know step by those skilled in the art, utilize immune affinity chromatographic purification polyclonal antibody.

Perhaps in addition, can create at the immunogenic monoclonal antibody of non-natural of the present invention.Those skilled in the art know by hybridoma technology generation monoclonal antibody.For example, can use the Epstein-Barr virus transfection, create the immortal cell line that is used to produce antibody of the present invention by cell fusion or other technology such as the former cancer DNA conversion of direct usefulness bone-marrow-derived lymphocyte.Referring to for example Schreier etc., " hybridoma technology " (Hybridoma Techniques) (1980); Hammerling etc., " monoclonal antibody and T-quadroma " (Monoclonal Antibodies and T-cell Hybridomas) (1981); Kennett etc., " monoclonal antibody " (Monoclonal Antibodies) (1980); U.S. Patent number 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,452,570; 4,466,917; 4,472,500; 4,491,632; With 4,493,890 etc.

Other multiple known method of those skilled in the art's easy to understand instructs the design and the generation (as monoclonal, polyclone, humanization etc.) of antibody.Also can prepare antibody (as Bo Keli antibody laboratory (Berkeley Antibody Laboratories, shellfish plucked instrument laboratory (Bethyl Laboratories), peaceful and comfortable China (Anawa), Euro lucky safe (Eurogenetec etc.)) by multiple commerce services.

Based on contain antibody come-at-able right-the former anti-TNF alpha of non-natural TNF alpha immunization of Nitrobenzol alanine.

In the specific embodiment that embodiment describes in detail, the invention provides the compositions and the method that can be used for treating and/or preventing TNF alpha active related pathologies hereinafter.

Tumor necrosis factor (TNF α) at multiple chronic inflammatory diseases, comprises Crohn disease, endotoxin shock, and cerebral malaria, playing the part of in the pathology of rheumatoid arthritis etc. has the key player.The a major challenge that treats and/or prevents these diseases is to develop method to make the immune system selectivity overcome tolerance for endogenous TNF α, thereby stimulates the generation of TNF α neutralizing antibody.

Neutralization for TNF α can be alleviated these disease symptomses.For example, kinds of experiments use the anti-TNF alpha antiserum measure its treatment potential (referring to Veres etc., (2007) " infliximab is used for the treatment of the department of pediatrics Crohn disease " (Infliximab therapy for pediatric Crohn ' s disease ") Expert Opin Biol Ther7:1869-1880; Ackermann etc. (2007), " tumor necrosis factor is as the rheumatism treatment target spot " (Tumor necrosis factor as a therapeutic target of rheumatologic disease) Expert Opin Ther Targets8:2553-68, Knight etc. (1993) " the chimeric TNF antibody of mice-people must make up and tentatively characterize " (Construction and initial characterization of a mouse-human chimeric anti-TNF antibody) Mol Immunol30:1443-1453; Present etc., (1999) " in the Crohn disease people, treating fistula " " Infliximab for the Treatment of Fistulas in Patients with Crohn ' s Disease " with infliximab New Engl J Med340:1398-1405).Reducing arthritis for the chimeric TNF α of solubility receptor as far as possible, the effect of septic shock and Crohn disease has carried out studying (Peppel etc. (1991), " tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein is as the active antagonist of bivalence TNF " (A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity) J Exp Med174:1483-1489; Williams etc. (1995), " utilize TNF receptor-IgG fusion rotein and make up and successfully treat collagen-induced arthritis " (Successful therapy of collagen-induced arthritis with TNF receptor-IgG fusion protein and combination with anti-CD4) with anti--CD4 Immunology84:433-439; Hoy etc. (2007) " the purposes summary of Embrel aspect control ankylosing spondylitis and psoriatic arthritis " (Etanercept:A Review of its Use in the Management of Ankylosing Spondylitis and Psoriatic Arthritis) Drugs67:2609-2633; Fisher etc. (1996), " use Tumor Necrosis Factor Receptors: the Fc fusion rotein is treated septic shock " (Treatment of Septic Shock with the Tumor Necrosis Factor Receptor:Fc Fusion Protein) New Eng J Med334:1697-1702; Korzenik (2004), " Crohn disease: the following anti-tumor necrosis factor therapy outside the infliximab " (Crohn ' s disease:future anti-tumor necrosis factor therapies beyond infliximab) Gastro Clin of North Am33:285-301).Tolerance is a kind of strategy that treats and/or prevents the TNF alpha associated disorders to self TNF alpha immunization to break object.

The challenge of breaking immunologic tolerance by multiple strategy trial is as described in this paper and other document.Some embodiments of the present invention provide non-natural TNF α, the TNF α that promptly comprises alpha-non-natural amino acid (UAA), when giving object, stimulate or strengthen immunne response, as occurring in the object or not going out to represent the serum levels of morbid state and/or the TNF α of expression at endogenous TNF α.This paper also provides at the treatment of morbid state and vaccine, the existence of and TNF α described herein or have the relevant morbid state of level as those, this means the anti-non-natural TNF Alpha antibodies that gives with natural TNF α cross reaction, to weaken or to prevent the symptom of TNF α-relevant disease state.

Generation comprises the non-natural TNF α of any alpha-non-natural amino acid, as any non-natural TNF α described herein, uses in this article among generation of non-natural immunogen and non-natural immunogen and the embodiment.Although use the orthogonal translation system to produce alpha-non-natural amino acid among the embodiment hereinafter, should be understood that one or more nonopiate methods that also available this paper describes in detail also can produce non-natural TNF α, described nonopiate method is not chemical modification or post translational modification (mix as selection pressure, solid phase synthesis and protein are semi-synthetic etc.).

As the embodiment described herein, non-natural TNF α comprises high immunogenicity (E.Keinan volume, " catalytic antibody " (Catalytic Antibodies) on 86 amino acids (WV company, Wei En Haimu, 2005), 1-28), structure is guarded, the come-at-able 4-nitro of antibody-L-phenylalanine (pNO ₂Phe, Figure 1A) residue is as pNO ₂Phe ⁸⁶TNF α.In this embodiment, replace sudden change and make non-natural mTNF α, as pNO ₂Phe ⁸⁶MTNF α keeps three grade and the quaeternary protein structure similar substantially to natural mTNF α, therefore makes the antagonism non-natural mTNF α that is produced, as pNO ₂Phe ⁸⁶The neutralizing antibody of mTNF α more likely with natural mTNF α, as pairing epi-position cross reaction on the mice TNF α.Describe in detail as this paper, natural mTNF α compares with endogenous, the replacement of alpha-non-natural amino acid and/or add change arbitrarily (or significantly not changing) non-natural mTNF α and conformational structure.Other non-natural TNF alpha derivative (as GenBank accession number NP_038721) that has therapeutic and/or preventative processing purposes in the mouse subjects body comprises pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α, or pNO ₂Phe ¹¹³-mTNF α.Other non-natural hTNF alpha derivative (GenBank accession number AAA61200) that has therapeutic and/or preventative processing purposes in the human subjects body comprises pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α or pNO ₂Phe ¹¹⁴-hTNF α.

Usually, the rising of serum levels level is relevant with various disease states.Yet should be understood that the individuality etc. that produces the individual of immunne response in vivo and/or give preventative processing does not show the serum TNF alpha levels of representing morbid state.Therefore, should be understood that vaccine of the present invention, antibody and/or non-natural immunogen can be to the individualities that shows or do not show the TNF alpha associated disorders.

Based on contain antibody come-at-able right-the non-natural RBP of Nitrobenzol alanine immunogenic anti--RBP.

In embodiment 2 described embodiments, method and composition of the present invention helps treating and/or preventing the RBP4 relevant disease.RBP4, the low-molecular-weight serum proteins, secretion is the main carrier of 90% serum vitamin from liver and fatty tissue.Excessive this type of vision disease that causes of RBP4 level is repaiied Wood syndrome, age-related macular degeneration (AMD) and recessive macular dystrophy (Stargardt ' s disease) as horse.And also known serum RBP4 level raises and is beneficial to the generation of insulin resistant and/or diabetes.Some embodiments of the present invention provide non-natural RBP4, promptly comprise the RBP4 of alpha-non-natural amino acid, it can be given object and be used for treating and/or preventing these diseases, as stimulating antibody, B cell or the t cell response at natural RBP4.Yet should be understood that also that here the individuality etc. that produces the individual of immunne response in vivo and/or give preventative processing does not show the serum RBP4 level of representing morbid state.Therefore, should be understood that vaccine of the present invention, antibody and/or non-natural immunogen can be to the individualities that shows or do not show the RBP4 relevant disease.

The method that this paper can be used for producing non-natural TNF α can be used for producing non-natural RBP4.Non-natural RBP4 can comprise the alpha-non-natural amino acid that any method except post translational modification or chemical modification described herein is mixed RBP4.Can use any alpha-non-natural amino acid to replace any natural RBP4 and produce non-natural RBP4.Need not the conservative alpha-non-natural amino acid of utilization structure and replace natural amino acid.Perhaps or in addition, one or more other alpha-non-natural amino acids can be added the RBP4 polypeptide and produce non-natural RBP4.Non-natural RBP4 can comprise the structure similar substantially to natural RBP4 arbitrarily, and the neutralizing antibody that produces at non-natural RBP4 is increased with the probability that natural RBP4 goes up corresponding epi-position cross reaction.The non-natural RBP4 that has therapeutic and/or preventative processing purposes in object comprises pNO ₂Phe ⁴³MRBP4 and pNO ₂Phe ¹⁰⁸MRBP4 and corresponding human body construction.

Administration and preparation

Antibody and/or immunogen preparation

In order to produce or to strengthen at target immunne response partly, as TNF α or any other several possible target described herein, Therapeutic Method of the present invention can use at immunogenic antibody, described immunogen is the derivant as the target part that comprises one or more alpha-non-natural amino acids, and/or use immunogen itself, as non-natural TNF α.Usually this antibody-like and/or immunogen and the acceptable adjuvant of physiology, excipient and/or combination of stabilizers appearance, this is combined under the used dosage for receiver's (as object) is nontoxic.Yet the present invention who is to be understood that need not to limit the concrete preparation of antibody and/or immunogen preparing thing.

The preparation of antibody and/or immunogen (derivant that promptly comprises the target part of one or more alpha-non-natural amino acids) comprises the acceptable adjuvant of physiology, excipient and/or stabilizing agent.Excipient known in the art comprises for example vegetable and animal oil ﹠ fat.The salt of stabilizing agent, moistening and emulsifying agent, various osmotic pressuries is kept the buffer of required pH and/or the adjuvant (being excipient) that the skin penetration reinforcing agent can be used as various preparation kinds.The method of the various conventional form of medication of known preparation is also understood by those skilled in the art, for example referring to " thunderous: pharmaceutical science is put into practice " (Remington:The Science and Practice of Pharmacy) (the 21st edition, Donald Lippincott William Si ﹠amp; Louis Wilkins publishing company) (Lippincott Williams ﹠amp; Wilkins), 2005).Preparation comprises plants or multiple adjuvant, as Alumen, Freund's complete adjuvant (FCA), incomplete Freund (FIA), lipopolysaccharide (LPS), Squalene, virion, MSP1, QS21 etc.And, comprise also in the preparation that immunogen and carrier merge, described carrier such as peptide carrier, sugar carrier (as one or more units of monosaccharide such as mannose, mucinous one or more units etc.), key hole keyhole limpet hemocyanin (KLH), ovalbumin, chicken egg white, tetanus toxin or diphtheria toxin, diphtherotoxin etc.Those skilled in the art know multiple adjuvant, carrier, excipient, stabilizing agent etc., can be used for the present invention arbitrarily.

And, the example of usual excipients comprises that buffer is (as phosphate buffer in antibody and/or the immunogen preparation, citrate buffer solution and other organic acid buffer), antioxidant (as ascorbic acid), low-molecular-weight (less than about 10 residues of separating) polypeptide, other protein is (as serum albumin, gelatin and immunoglobulin), hydrophilic polymer (as polyvinylpyrrolidone), aminoacid is (as glycine, glutamine, agedoite, arginine, and lysine), monosaccharide, disaccharide and other sugar (comprise glucose, mannose and dextrin), chelating agen (as ethylenediaminetetraacetic acid [EDTA]), sugar alcohol (as mannitol and Sorbitol), salify counter ion (as sodium) and/or anion surfactant are (as tween ^TM, Pluronics ^TMAnd PEG).

Should be understood that used concrete adjuvant, excipient stabilizing agent and preparation are different, depend on whether preparation comprises this paper antibody or non-natural immunogen, concrete route of administration, used other medicines and used dosage etc.For example, in intravenous, intramuscular or subcutaneous administration, antibody or immunogen can be mixed in the pharmaceutically acceptable injection of vehicle.Usually excipient such as sterilized water, aqueous saline solution, aqueous buffered salt solution, aqueous dextrose solution, aqueous glycerol solution, ethanol or its combination.The scheme that is used for antibody or antigen protein administration of establishing according to this area guarantee the aseptic of this type of formulations prepared from solutions thing, suitable pH, etc. blend stability.Usually, the selection of excipient reduces sensitization and other unwanted effect as far as possible, being fit to concrete route of administration, as subcutaneous, intramuscular etc.

In some embodiments, can prepare preparations for oral administration, as mix food or beverage, preparation becomes can be chewed or deglutible tablet or capsule etc.Therefore this type of preparation can be absorbed and be distributed in each component of health rapidly by blood flow.The lactose of the excipient pharmacy level of general oral administration, mannitol, starch, methylcellulose, magnesium stearate, saccharin sodium, Pulvis Talci, cellulose, glucose, gelatin, sucrose, magnesium carbonate etc.When compositions is used for oral administration with the form of solid prepared product, prepared product can be tablet, granule, powder, capsule etc.

In some embodiments, the present invention uses the slow release pharmaceutical formulations to send antibody and/or non-natural immunogen.Exemplary slow releasing preparation comprises the semi permeability substrate of solid hydrophobic polymer, antibody of the present invention and/or non-natural immunogen coupled or the encapsulation wherein.The example of suitable polymers comprises polyester, hydrogel, polylactic acid, L-glutamic acid and T-ethyl-L type glutamic acid copolymer, non-degrading ethylene, vinyl acetate, degradable ethyl lactate copolymer and poly-D-(-)-3-hydroxybutyric acid.This type of substrate can be the form of tangible material, as film or microcapsule.

In the whole bag of tricks of this paper, the immunogen antibody of immunogen such as any non-natural TNF α or any other immunogen described herein or anti-and the cross reaction of target part also can be prepared as the preparation of transdermal administration.For transdermal administration, can with antibody and/or the non-natural immunogen be mixed lipophilic carriers and preparation is external ointment or ointment adhesive patch.The method of the various conventional form of medication of known preparation is also understood by those skilled in the art, for example referring to " thunderous: pharmaceutical science is put into practice " (Remington:The Science and Practice of Pharmacy) (the 21st edition, Donald Lippincott William Si ﹠amp; Louis Wilkins publishing company) (Lippincott Williams ﹠amp; Wilkins), 2005).Therefore, slow releasing capsule can comprise the active medicine that liposome comprises.The vesicle that liposome is made up of various types of fat, phospholipid and/or surfactant.These components are generally formed arrangement with bilayer, with biomembranous fat homotaxis.Comprising the immunogenic liposome of antibody/non-natural can be prepared by any known method, as (1985) such as Epstein, PNAS USA82:3688-92, and Hwang etc., (1980) PNAS USA, 77:4030-34.Can pass through anti-phase method of evaporating, utilize the liquid preparation that comprises as the deutero-PHOSPHATIDYL ETHANOLAMINE of phosphatidylcholine, cholesterol and PEG-(PEG-PE) to produce useful liposome.Need, liposome can be pressed through the liposome that predetermined hole diameter obtains special diameter.

In other embodiment, the preparation that can be prepared as mucosa delivery as the antibody of the present invention described and/or non-natural immunogen in the whole text.Mucosa delivery comprises following approach: oral cavity, trachea, suction, nose, pharynx, rectum, Sublingual, vagina etc.By mucosa delivery, but antibody and/or non-natural immunogen preparation are emulsion, chewing gum, buccal tablet, spraying, tablet etc.Carry out intranasal administration by powder or spray agent.The preparation of rectum and vagina administration comprises ointment, lotion, enema or suppository etc.

In some embodiments, antibody and/or non-natural immunogen are mixed solution or suspension such as drop or the spraying that is suitable for the cornea application, preparation is fit to the preparation of cornea administration.

Pharmaceutical formulations used herein also comprises and is adsorbed in antibody and/or the immunogen that can plant on film such as the silicone rubber membrane, as described in international publication number WO 91/04014.

The used pharmaceutical formulations of the present invention is stored with canonical form, comprises aqueous solution or lyophilizing piece.When this type of preparation gives object usually is aseptic.Be easy to make aqueous solution aseptic by aseptic filter membrane.If preparation stores with lyophilised state, preparation can filter before or after lyophilizing and reprovision.

Antibody and/or the administration of non-natural immunogen

As described herein, the present invention pays close attention to by resisting non-natural target part (non-natural immunogen) with the antibody cross reaction of target part and/or by giving non-natural target part itself, produces in object or strengthens at target part as self partly as the compositions and the method for the immunne response of TNF α.This type of target for example partly comprises hereinafter any non-natural TNF α described in the embodiment, and multiple other molecule, and is as described herein.Usually, separately or with the concrete preparation of other processing or medication combined giving (as co-administered) with therapeutic and/or one or more medical symptom/morbid states of preventative processing.Should be understood that, according to whether giving whether give the non-natural immunogen at the immunogenic antibody of non-natural, institute's administered antibodies and/or the immunogenic concrete preparation of non-natural etc., the administration scheme is different.Therefore, in some embodiments, giving antibody of the present invention is different (as dosage, timeliness etc.) with giving non-natural immunogen of the present invention.Should be understood that this paper should not regard restriction to this paper as about the narration of concrete preparation and/or dosage regimen.

Those skilled in the art are familiar with multiple medical science/physiology/psychology test and measurement, the object that helps to select to accept the object of present composition administration and/or carry out the inventive method operation.For example detecting virus or bacterial infection etc. (infecting as HIV) is that those skilled in the art know and broad practice.Similar, multiple diagnostic test (as based on the appearance of symptom and/or concrete infectious agent etc.) can be used for other medical science imbalance, as cancer, autoimmune disease (as SLE) etc.Can use this class to measure to help and select non-natural immunogen herein and/or at the object that gives of the immunogenic antibody of non-natural.And, in some cases, based on any alternative such as family history and environmental exposure.For example, based on family history and family's susceptible disease state (as Alzheimer's disease, breast carcinoma etc.) alternative.Equally, (exposure to HIV maybe may expose as sex worker based on the exposure of infectious agent or other disease inducement or any alternative of potential/exposure, health care worker maybe may expose the exposure of hepatitis, and the workman may cause the inductive pulmonary fibrosis of silicon dioxide etc. to the exposure of silicon dioxide compound).Those skilled in the art are familiar with other example.

Antibody administration

Antibody of the present invention has therapeutic and/or preventative purposes.Therefore, in various embodiments, can use it for as producing or strengthening at one or more particular target immunne response partly.Therefore, the invention provides one or more relevant with this target or interrelate morbid states (as cancer, autoimmune disorder, pathogenicity infection etc.) of use Antybody therapy of the present invention.As described in the whole text, antibody of the present invention can be used for treating and/or preventing multiple disease and/or imbalance.For example, disease or imbalance cause pulmonary fibrosis such as endotoxin shock, cerebral malaria, autoimmune disease, multiple organ dysfunction syndrome, multiple sclerosis, heart dysfunction, atherosclerosis, ischemical reperfusion injury, insulin resistant, rheumatoid arthritis, Crohn disease, inflammatory bowel, cachexia, septic shock, acquired immune deficiency syndrome (AIDS), graft versus host disease, sterilization granuloma, adult respiratory distress syndrome, silicon dioxide, and multiple other disease, can use the present invention and treat.As mentioned above, antibody of the present invention has specificity for non-natural immunogen (non-natural disease association target part is as non-natural TNF α), still with corresponding target part (as the natural TNF α) cross reaction that does not comprise natural amino acid.Should be understood that the various antibody administration methods that comprise of the present invention can be arbitrarily and other therapeutic/preventative processing coupling (as chemotherapy, antibiotic and/or antiviral therapy, operation etc.).

Antibody of the present invention can give object by injecting (as intravenous, intraperitoneal, subcutaneous or intramuscular injection) or other method such as infusion.Can be by in the tumor, around the tumor, in the damage or the approach around the damage give antibody, thereby performance part and general effect.

Can rule of thumb determine to give effective dose, timeliness, scheme of antibody of the present invention etc.Those skilled in the art are familiar with the method for customizing with the multiple medical conditions of Antybody therapy.Parameter (as dosage, timeliness etc.) about Antybody therapy in object can be different, depend on the individuality (as object species, morbid state, overall health etc.) of for example accepting antibody, route of administration, it is preventative or therapeutic etc. that used antibody specific type and administration are handled.Bibliographical information specify the detailed guideline of Antybody therapy scheme, as " monoclonal antibody handbook (Handbook of Monoclonal Antibodies), volumes such as Ferrone, Nuo Ge publishing house, the Pa Erke Ritchie, New Jersey (Noges Publications) (Park Ridge, N.J.) (1985); Diagnosis and treatment antibody: technology mechanism and clinical data (Antibodies in Diagnosis and Therapy:Technologies Mechanisms and Clinical Data), CRC, 1999.

The administration of non-natural immunogen

In other embodiments, non-natural immunogen of the present invention (promptly do not contain the version of the target part of one or more alpha-non-natural amino acids, include but not limited to: hereinafter described non-natural TNF α or RBP4) can give object to carry out preventative and/or therapeutic treatment.Describe in detail as this paper, give this non-natural immunogen and in object, produce immunne response, the immunogenic antibody response of antagonism non-natural.And, yet the former antibody of the antagonism natural immunity that produces in object is preferably with in subject or can (be that pathology infects, cancer at the natural version of the intravital target part of object.The disease association part that autoimmune disorder etc. cause, but do not comprise alpha-non-natural amino acid) cross reaction is (corresponding with the non-natural immunogen.

In this paper method, the non-natural immunogen, as non-natural TNF α or any cited herein other multiple may target, any method of common acceptance that can the pharmaceutical composition administration is carried out administration.Those skilled in the art are very familiar for this type of route of administration and the scheme of sending.For example, non-natural immunogen route of administration includes but not limited to: in oral, the brain, in the sheath, intraperitoneal, intramuscular, intravenous, subcutaneous, transdermal, mucosa (as suppository or intranasal or wear the cheek administration) or cornea administration etc.Therefore, depend on route of administration, can multiple dosage form provide the non-natural immunogen, for example tablet, capsule, powder, controlled release preparation, suspending agent, Emulsion, suppository, emulsifiable paste, ointment, lotion or aerosol.Referring to above.The specific embodiment is used and is suitable for the accurate simple form of medication of dosage.

Send and comprise dosage all day at most, perhaps the amount of ADD prolonged non-natural immunogen Delivery time can effectively produce at least, as 3-10 days.

Antibody response in object (common natural target part at the correspondence that does not comprise alpha-non-natural amino acid) is more weak or compare the low of needs, can give non-natural immunogen (as fully raising up to required antibody titer) again.And, use after the non-natural immunogen immune, can from object, get blood serum sample and detect required production of antibodies.

The co-administered of antibody and/or non-natural immunogen and other component

The words that need can be united use with antibody of the present invention and/or non-natural immunogen and one or more other medicines and treatment.Antibody/non-natural immunogen and other medicines can be carried out administration in same preparation, or give (as according to different schemes, different condition is at different time, and different preparations carry out administration) respectively.And, in various embodiments, multiple antibody type and/or multiple non-natural immunogen can be arbitrarily and other medicines (treatment) give object simultaneously or sequentially.

Antibody of the present invention and/or non-natural immunogen also can give as operation, radiotherapy etc. simultaneously or sequentially with various treatments.

Other medicines/the treatment that can give jointly arbitrarily with antibody of the present invention and/or non-natural immunogen identical with the concrete aspect of antibody of the present invention/medical condition that the non-natural immunogen is treated (as reducing the intravital concrete target part of object) but or other or relevant (perhaps even not relevant) medical condition in the treatment target body.Therefore, common administered agents/treatment can be treated the others of potential medical condition (morbid state).For example, in various treatments, antibody of the present invention and/or non-natural immunogen can be arbitrarily and any multiple treatment coupling commonly used, as used aspirin such as treatment fever, arthralgia and inflammation, and salicylic acid, ibuprofen, naproxen, sulindac is (as Sulindac ^TMClinoril ^TM), oxaprozin and tolmetin.In some embodiments, antimalarial such as hydroxychloroquine, chloroquine and atabrine can be treated relevant malaria of other disease (as SLE) or various skin abnormality.Corticosteroid, normally chloroprednisone can be treated organ inflammation etc.Some male hormone compounds, as danazol (as Danocrine ^TM) can be used for controlling immune thrombocytopenia and significant hemolysis anemia.

And, antibody of the present invention/non-natural immunogen also can with the drug combination of second kind of disease of effective treatment, described second kind of disease cause by potential medical condition, or even because cause for the treatment of potential medical condition.For example, in some embodiments, treatment of the present invention can with the calcitonin coupling, help to treat the bone density that various attached diseases cause and lose, described attached disease may be because of causing at scheme kind use chloroprednisone, methotrexate, immunosuppressant, anti-inflammatory agent etc.

The timeliness and the adjustment of antibody and/or non-natural immunogen dosage

As mentioned above, immunogenic dosage range of antibody/non-natural and the medicine-feeding rate (therefore, any effective treatment for medical condition/morbid state) that reaches required effect in object can carry out according to the standard industry practice.These scope differences, depend on required reply whether be to medical condition (as cancer, SLE, Sjogren syndrome, bacterial infection, viral infection, scleroderma, anaphylactic disease, HIV/AIDS etc.) preventative, therapeutic or the processing of healing property, the symptom type or the order of severity, the other medicines that given, the age of treatment target, sex medical history or other individual parameter etc.In some embodiments, according to determining dosage as the variation of the concrete level of the target of measurements such as ELISA part.For this class level in the determination object, this paper exemplary embodiment can be used for measuring in any or the various biological tissue the level of target part, peripheral blood, serum, blood plasma, urine, vaginal secretion, seminal fluid, saliva, peritoneal fluid, lymph fluid, aqueous or vitreous humor, tear, pleural effusion or serosal fluid.

Those skilled in the art are familiar with reaching the individuality customization of the therapeutic scheme of required effect in various objects.Therefore, in many embodiments, although antibody specific and/or non-natural immunogen dosage can be adjusted this dosage as starting point or target level arbitrarily based on the material elements of the object of receiving treatment.For example, can not increase dosage if arrive required target part of horizontal.In addition, if/when reaching desired level, can reduce dosage and find stabilization energy to reach the floor level of desired level.

Symptom based on the potential medical condition of being treated is adjusted the immunogenic dosage of antibody/non-natural.For example, if the concrete medical condition of object is treated, the symptom of concrete situation can be arbitrarily as the guidance or the indication (measuring and timeliness) of dosage.Therefore, in some embodiments,,, can be used as the indirect measurement of therapeutic process as paresthesia epilepsy mensuration at interval to the evaluation of situation seriousness, therefore can corresponding tailoring administration of drugs.Those skilled in the art are familiar with other tested/diagnosed yardstick that can be used for monitoring the symptom of medical condition.

Can give antibody and/or non-natural immunogenic object

Multiple animal is benefited from vaccine provided by the invention, therapeutic treatment and/or preventative processing.These animals include but not limited to: domestic animal, and as cattle, pig, goat, sheep, chicken and/or farm-animals other.General domestic pets as cat, Canis familiaris L., Psittacula alexandri fasciata, Psittacula alexandri fasciata, is also benefited from and is resisted immunogenic cross-reacting antibody of non-natural and/or antigen itself.

About the elaboration of the more details of used animal target in biomedicine test and animal model and the veterinary treatment referring to as Ng, Chow and Ogden compile " use animal in biomedical research: researcher is crossed the threshold " (Using Animal Models in Biomedical Research:A Primer for the Investigator), front page, Singapore, World Science publishing company, 2008 (Singapore:World Scientific Publishing Company, 2008); Conn compiles " biomedical research model raw data " (Sourcebook of Models for Biomedical Research.) Springer-Verlag, and New Jersey Tuo Tuowa (Totowa, NJ:Springer), 2008; Woodhead compiles, " nonmammalian in the biomedical research (first volume) " (Nonmammalian Animal Models for Biomedical Research (Vol 1)), New York: Science Press, 1990 (New York:Academic Press, 1990).Referring to Adams etc., " veterinary pharmacology and treatment, the 8th edition " (Veterinary Pharmacology and Therapeutics.Eighth Edition), the U.S.: Wei Li-Blackwell (USA:Wiley-Blackwell), 2001; Kahn and Line compile. " Merck veterinary's handbook: the 9th edition " (Merck Veterinary Manual.Ninth Edition), the U.S.: Merck (USA:Merck), 2005; And institute's quoted passage is offered.

Antibody provided by the invention and/or non-natural immunogen not only can be used for morbid state such as the people in the treatment target, can also carry out the therapeutic effect test, and metabolism test, toxicology is tested and is specifically tested the influence to reproductive function or fetal toxicity of definite antibody and/or non-natural immunogen, or definite its oncogenic potential.Carry out these observational studies and mean that antibody of the present invention and/or non-natural immunogen gram give multiple animal target.Those skilled in the art are familiar with multiple medical science test and measure the object that helps to select to accept the animal target of present composition administration and/or carry out the inventive method operation.This type of animal target includes but not limited to: as mammal, as goat, sheep, camel, cattle, pig, rabbit, horse, hamster, non-human primates (monkey comprises macaque, baboon, Old World monkey and chimpanzee), Cavia porcellus, rat, mice and/or cat.Birds, as poultry (chicken, turkey), Nymphicus hollandicus, Psittacula alexandri fasciata and cageling and/or aviary bird, and the birds embryo, also can be used for the immunogenic research and development of antibody of the present invention and/or non-natural, produce Quality Control or security test.

Fish, as Brachydanio rerio, platy and and Xiphophorus helleri; Amphibian comprises as Rana nigromaculata, newt and reptiles (Serpentis, Eremiatis argi and Testudinis) also can being used in the safety that compositions described herein and/or its medication are determined in various tests, effective dose and/or toxicology.Referring to (2002) such as Barry, " information resources of the application of reptile, Amphibian, Fish and siphonopods biomedical research " (Information Resources for Reptiles, Amphibians, Fish, and Cephalopods Used in Biomedical Research), agricultural library animal welfare information centre (United States Department of Agriculture National Agricultural Library Animal Welfare Information Center) of country of United States Department of Agriculture (USDA), and institute's quoted passage is offered.

Test kit and manufacturing thing

In some embodiments, the invention provides and comprise test kit or the article that are used to make the method for the invention and compositions.This type of test kit can comprise one or more containers, label and description arbitrarily, and the component that is used to make up antibody and/or non-natural immunogen and/or real antiserum and/or non-natural immunogen (as non-natural TNF α or other multiple example described herein).

Test kit also can comprise one or more antibody arbitrarily (promptly, the immunogenic antibody of antagonism non-natural, described antibody cross reaction antagonism object is intravital natural in matrix section) and/or one or more non-natural immunogens and other components (as various antibiotic, various antifungal drugs etc.) arbitrarily.This type of non-natural immunogen includes but not limited to: any one or multiple non-natural TNF α provided by the invention.Test kit also comprise arbitrarily test tube or other container (as, containers such as glass, plastics, nylon, cotton, polyester, metal) be used for storage component, perhaps mixing/preparation component therein, and one or more carry out object (as, need the people of treatment etc.) equipment of administration.In some embodiments, carrying out equipment that object gives component comprises and storing and/or the container of mixing/preparation component.

In many embodiments, test kit comprises and relates to the description (as written guidance) of using one or more medical conditions/morbid states of test kit treatment target.In some embodiments, test kit comprises URL address that user contact instructs or telephone number etc.Test kit can be a unit dose, bag in bulk (multiple dosing packing) or subunit dosage.

Embodiment

Provide following examples, with explanation but not requirement for restriction protection the present invention.Should be understood that embodiment as herein described and embodiment just in order to illustrate, it will be understood by a person skilled in the art that various modifications or the change made in view of the above, they are included in the scope of the application's design and scope and appended claims.

Embodiment 1: the alpha-non-natural amino acid with genetic coding is broken immunologic tolerance

Selective induction is replied at the strong immunization of oneself protein matter, or the immunogenicity that increases defined epitope in the exotic antigen has appreciable impact for the production of cancer, protein false folding and infectious disease vaccine.We have shown that the immunogenicity alpha-non-natural amino acid is mixed protein of interest matter produces the proteinic high titre antibody of cross reaction WT herein.Specifically, the single tyrosine residue (Tyr of Mus tumor necrosis factor-alpha (mTNF α) ⁸⁶) sport right-Nitrobenzol alanine (pNO ₂Phe) in mice, induce high titre antibody response, yet for Tyr ⁸⁶→ Phe sudden change does not have remarkable antibody response.At pNO ₂The antibody that Phe produces has the height cross reactivity to natural mTNF α, the death of and protection mice antagonism lipopolysaccharide (LPS)-cause.This method provides the antibody response of inducing at self and external defined epitope, and causes the neutrality immunne response.

A major challenge of vaccinology is to produce the effective ways selective induction to reply at the strong immunization of oneself protein matter now, or strengthens the immunogenicity of defined epitope in the exotic antigen, and described epi-position is induced and produced neutralizing antibody but the immunodominance of not having.Existing multiple this challenge of strategy reply, comprise exploitation improvement adjuvant, the auxiliary peptide of external source is introduced chimeric antigen, and use dna vaccination (Dalum etc. (1999), " at the inductive therapeutic antibodies of TNF alpha immunization " (Therapeutic antibodies elicited by immunization against TNF-alpha) Nat Biotechnol17:666-669; Makela etc. (2002), " evolution of coupling vaccine " (Evolution of conjugate vaccines) Expert Rev Vaccines1:399-410; Restifo etc. (1996), " novel vaccine: the virus that makes up inducing antitumor immunity " (The new vaccines:building viruses that elicit anti-tumor immunity) Curr Opin Immunol, 8:658-663; Baldridge etc., " vaccine adjuvant: immunology and clinical practice " (Vaccine Adjuvants:Immunological and Clinical Principles) C.J.Hackett, Harn, D.A., J compiles (Xiu Mana publishing house, New Jersey Tuo Tuowa) (Humana Press, Totowa, NJ, 2006), 235-255).What is interesting is, before nearly 50 years, Weigle (Weigle (1965) " autoimmune of inducing rabbit behind the homology Elityran of injection allos or change " (The induction of autoimmunity on rabbits following inj ections of heterologous or altered homologous thyroglobulin) J Exp Med121:289-308) show with the antibody that produces behind the rabbit Elityran immunize rabbit of the non-specific labelling of diazo compound derivative natural Elityran cross reaction.Although these experiments have produced high heterogenetic antigen, a kind of explanation is that chemical modification causes producing the epitope of inducing the high titre cross reacting antibody of generation.Similar, there is report T cell tolerance to be broken by autoreaction B cell, be easy to inducing T cell tolerance (Mamula etc. (1992) break the T cell tolerance with external and self common antigen: the research of cytochrome C autoimmune B and t cell epitope (Breaking T cell tolerance with foreign and self co-immunogens.A study of autoimmune B and T cell epitopes of cytochrome c) with having the different cross reaction exotic antigen of one or more aminoacid to carry out immunity with autoantigen J Immunol149:789-795).

Compare with the chemical method of the modifying protein of relative non-selectivity, may make protein produce highly accurate " chemical mutation " by the encode method of alpha-non-natural amino acid of hereditism now.Have above 50 kinds of alpha-non-natural amino acids and in antibacterial, yeast or mammalian cell, encode, comprise melts combine and post translational modification aminoacid, fluorescence and redox active amino acids, and photoreaction and chemical reaction aminoacid (Wang etc. (2001), " expanding colibacillary genetic coding " (Expanding the genetic code of Escherichia coli) Science 292:498-500; Chin etc. (2003), " the eucaryon genetic coding of expansion " (An expanded eukaryotic genetic code) Science 301:964-967; Xie and Schultz (2006) " protein chemistry workbox-expansion genetic coding " (A chemical toolkit for proteins-an expanded genetic code.) Nat Rev Mol Cell Biol 7:775-782).Specifically, the derivant with phenylalanine right-Nitrobenzol alanine (pNO ₂Phe, Figure 1A) dope corresponding succinum nonsense codon in the bacterioprotein, have when the spectrum intervals probe high fidelity and good efficiency (Tsao etc. (2006), " in escherichia coli, the distance probes hereditism being mixed protein " (The genetic incorporation of a distance probe into proteins in Escherichia coli) J Am Chem Soc 128:.4572-4573)。Once used the nitro aryl (to compile " catalytic antibody " referring to Keinan in history as the high immunogenicity hapten Catalytic Antibodies (WV company, Wei En Haimu, 2005)), may be because the pi system of electron deficiency is tending towards Tyr and the Trp side chain interaction common with the antagonist binding site.Because its structural similarity, we comprise Phe → pNO at supposition ₂Phe or Tyr → pNO ₂The protein of Phe sudden change can produce the intensive immunne response with the native protein cross reaction.Therefore, we show with Mus tumor necrosis factor-alpha (mTNF α) Tyr ⁸⁶→ pNO ₂Phe muton immune mouse produces the high titre antibody to WT mTNF α response, therefore can effectively protect mice antagonism lipopolysaccharide (LPS) to stimulate.

Select the target protein of mTNF α as this research, because:(i) it is a cytokine through furtheing investigate, relate to the adjusting (Vassalli (1992), " pathophysiology of tumor necrosis factor " (The Pathophysiology of Tumor Necrosis Factors) Ann Rev Immunol 10:411-452) of infection, inflammation and autoimmune phenomena; (ii) this proteic biological property has carried out broad research, comprise its expression, structure, function and signal transduction mechanism (Vassalli (1992), " pathophysiology of tumor necrosis factor " (The Pathophysiology of Tumor Necrosis Factors) Ann Rev Immunol 10:411-452); Baeyens etc. (1999), " 1.4A differentiates mouse tumor necrosin down:to the adjusting of its selectivity and trimerizing " (The structure of mouse tumour-necrosis factor at 1.4 A resolution:towards modulation of its selectivity and trimerization.) Acta Crystallogr D Biol Crystallogr 55:772-778; Pennica etc. (1985), " cDNA of clone and expression mouse tumor necrosin in escherichia coli " (Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor) Proc Natl Acad Sci USA 82:6060-6064; Pasparakis etc. (1996), " immunity and inflammatory response in the TNF α deficient mice:former generation B cell folliculus; Be starved of TNF α in the formation of follicular dendritic cell network and germinal center and the humoral immunoresponse (HI) maturation " (Immune and inflammatory responses in TNF alpha-deficient mice:a critical requirement for TNF alpha in the formation of primary B cell follicles; Follicular dendritic cell networks and germinal centers; And in the maturation of the humoral immune response), J Exp Med 184:1397-1411; Baeyens etc. (1997) " crystallization of mouse tumor necrosin and preliminary X ray research " (Crystallization and preliminary X-ray studies of mouse tumor necrosis factor), Acta Crystallogr D Biol Crystallogr 53:329-330; B.B.Aggarwal, Vileck, J. compiles, " tumor necrosis factor:structure, function and the mechanism of action " (Tumor Necrosis Factors:Structure, Function and Mechanism of Action), (Dekker, New York, 1992), the 1-587 page or leaf); (iii) unusual (the Pasparakis etc. (1996) " immunity and inflammatory response in the TNF α deficient mice:be starved of TNF α in the formation of former generation B cell folliculus; Follicular dendritic cell network and germinal center and the humoral immunoresponse (HI) maturation " of obvious phenotypes can be survived and not have to mTNF α knock-out mice; J Exp Med 184:1397-1411); This prompting mice can survive in producing at TNF α and under the condition of immunne response.In addition; Anti-TNF alpha antibody (Knight etc. (1993) " structure of the chimeric anti-TNF antibodies of mice-people and preliminary the sign " (Construction and initial characterization of a mouse-human chimeric anti-TNF antibody), Mol Immunol 30:1443-1453; Present etc. (1999) " infliximab that is used for the treatment of Crohn's disease patient's fistula " (Infliximab for the Treatment of Fistulas in Patients with Crohn ' s Disease) New Engl J Med340:1398-1405) and the chimeric TNF α of solubility, acceptor (Peppel etc. (1991) " as TNF (TNF) acceptor of the divalence antagonist of TNF activity-IgG heavy chain chimeric protein " (A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity) J Exp Med 174:1483-1489; Williams etc. (1995) " with TNF receptor-IgG fusion rotein and unite anti--CD4 and successfully treat collagen-induced arthritis " (Successful therapy of collagen-induced arthritis with TNF receptor-IgG fusion protein and combination with anti-CD4); Immunology 84:433-439) is widely used in the treatment autoimmune disease; Exploring the TNF α-specificity vaccine that uses the several different methods exploitation to use clinically.The latter comprise the reorganization TNF alpha molecule that contains the auxiliary epi-position of ectophylaxination advantage T-, with phage Q^βThe TNF alpha fusion protein that forms of virus-like particle and key hole keyhole limpet hemocyanin-TNF α allos complex (Dalum etc. (1999) " the treatment antibody that produces with the TNF-alpha immunization " (Therapeutic antibodies elicited by immunization against TNF-alpha), Nat Biotechnol 17:666-669, Spohn etc. (2007) " vaccine based on virus-like particle of selectivity targeting soluble TNF α can prevent arthritis and not induce the reactivate lungy of hiding " (A Virus-Like Particle-Based Vaccine Selectively Targeting Soluble TNF α Protects from Arthritis without Inducing Reactivation of Latent Tuberculosis), J Immunol 178:7450-7457; " TNF α such as Le Buanec; the inductive TNF α of kinoid vaccination neutralizing antibody protection mice exempts from the chronic and acute inflammation that drives from body TNF α " (TNF α; kinoid vaccination-induced neutralizing antibodies to TNF α protect mice from autologous TNF α-driven chronic and acute inflammation), Proc Natl Acad Sci USA 103:19442-19447).

X-ray crystal structure (Baeyens etc. (1997) " crystallization of mouse tumor necrosin and preliminary X ray research " Acta Crystallogr D Biol Crystallogr 53:329-330 according to trimer mTNF α; Baeyens etc. (1999) " structure of mouse tumor necrosin under 1.4A resolution: the adjusting of selectivity and trimerizing " (The structure of mouse tumour-necrosis factor at 1.4 A resolution:towards modulation of its selectivity and trimerization) Acta Crystallogr D Biol Crystallogr 55:772-778), single Tyr ⁸⁶→ pNO ₂MTNF α (the pNO of Phe sudden change ₂Phe ⁸⁶MTNF α) is elected to be the immunogen (Figure 1B) that we carry out preliminary study.Tyr ⁸⁶Conservative at different mammal TNF camber, determined that this site mutation forms the nothing influence to protein folding and trimer, but caused cytotoxicity significantly to reduce (Van Ostade etc. (1994) " the structure-activity research of human tumour necrosis factor " (Structure-activity studies of human tumour necrosis factors) Protein Engineering 7:5-22; Loetscher etc. (1993) " only 55-kDa or 75-kDa TNF receptor being had specific huamn tumor necrosis factory alpha (TNF α) mutant " (Human tumor necrosis factor alpha (TNF alpha) mutants with exclusive specificity for the 55-kDa or 75-kDa TNF receptors) J Biol Chem 268:26350-7; Zhang etc. (1992) " the rite-directed mutagenesis analysis of human tumor necrosis factor-alpha receptor binding site and purchase and sale relation " (Site-directed mutational analysis of human tumor necrosis factor-alpha receptor binding site and structure-functional relationship) J Biol Chem 267:24069-75) (should be used for the immunity inoculation purpose).

In this example, by genetic method with alpha-non-natural amino acid right-Nitrobenzol alanine (pNO ₂Phe) introduce Mus tumor necrosis factor-alpha (mTNF α) to substitute residue Tyr ⁸⁶Find with this pNO that contains ₂The protein mice immunized of Phe can produce intensive neutralizing antibody and reply, and this replying can effective cross reaction take place with wild type mTNF α.And, find that this immunity can effectively protect the inductive death of mice antagonism lipopolysaccharide (LPS).The result shows the unique NO of the former part of the hyperimmunization that does not have in the protein that contains natural generation ₂The oneself protein of group will be an exotic antigen by immune system recognition.Owing to comprise unique NO ₂The structural similarity of group protein and native protein is at antibody and the corresponding oneself protein matter cross reaction that modifying protein caused.Therefore this method provides the conventional method of breaking oneself protein matter immunologic tolerance and producing vaccine.

In experiment, escherichia coli XL1-Blue and BL21 (DE3) are respectively applied for clone and expressive host.Carrier pET26b is available from (the Novagen (Madison, WI, USA)) of Nova base company (Wisconsin, USA Madison).Unless otherwise noted, coli strain grows in and contains in 1% glycerol and leucic minimal medium of 0.3mM (GMML culture medium) or the 2x YT culture medium.Restriction Enzyme, T4 dna ligase, dNTP and Xa factor protease available from NEB (masschusetts, u.s.a is than Buddhist profit) (Beverly, MA, USA).IPTG and be used for SDS-PAGE (SDS-PAGE) 4-12% Bis-Tris gel available from Ying Jun company (Invitrogen) (California, USA Carlsbad) (Carlsbad, CA, USA).PNO ₂-Phe is available from advanced chemical technology company (Advanced ChemTech) (Louisville, the Kentucky State, the U.S.).Primer is available from dna integration technology company (Integrated DNA Technologies) (Colville, Iowa,U.S.A state).Archaeal dna polymerase is looked into the (Stratagene (La Jolla, CA, USA)) of column foot company (California, USA La Jolla) available from this.Anti-TNF alpha antibody is available from R﹠amp; (the R﹠amp of d system company; D system) (Minneapolis, Minnesota, the U.S.) (Minneapolis, MN, USA), reorganization mTNF α available from living resources company (BioSource) (card Mario, California, the U.S.) (Camarillo, CA, USA).Utilize the qiagen plasmid purification kit to extract plasmid DNA, with QIAquick PCR or gel-purified test kit Restriction Enzyme digestion back purify DNA (Kai Jie company, Valencia, California, the U.S.) (QIAGEN, Valencia, CA, USA).

Make up mTNF alpha expression carrier

For at expression in escherichia coli mTNF α, make up and contain the terminal His of N- ₆The plasmid pET26-mTNF α of mTNF α gene after label, Xa factor cleavage site and the T7-lac promoter.Plasmid construction is as follows: use following primer, by polymerase chain reaction (PCR) the tnf α gene that increases from plasmid pMuTNF α (ATCC#63169): 5 '-ATATACATATGCTCAGATCATCTTCTCA AAATTCG and 5 '-AACAACCTCGAGTTATCACAGAGCAATGACTCCAAAGT AGACC.With NdeI and the nitrated gained PCR of XhoI Restriction Enzyme product, and connect into pET26b carrier (Nova base company).On recombinant vector, add the label (His of terminal 6 histidine of N-then ₆-label), the back is close to first codon of ripe WT mTNF α subsequently with Xa factor proteolysis site.By with Tyr among the plasmid pET26-mTNF α ⁸⁶, Lys ¹¹Or Asp ⁴²The site codon mutation be the TAG amber codon, with pNO ₂The Phe fixed point is mixed mTNF α, uses QuickChange mutagenesis kit (this looks into column foot company) to produce these replacements.Use identical test kit to prepare mTNF α muton Ala ⁸⁶MTNF α, Phe ⁸⁶MTNF α and Phe ⁴²MTNF α.(the Genomics Institute of the Novartis Research Foundation (the San Diego of research foundation Joint Genome Institute of Novartis (California, USA Santiago), CA, USA)) carry out the sequence that dna sequence analysis is confirmed all mTNF α constructions.

At expression in escherichia coli pNO2Phe ⁸⁶MTNF α

Suppress sub-tRNA at the quadrature succinum that derives from methane coccus (M.jannaschii) _CUA/ aminoacyl-tRNA synzyme is expressed pNO under the condition that exists ₂Phe ⁸⁶MTNF α, pNO ₂Phe ¹¹MTNF α and pNO ₂Phe ⁴²MTNF α muton, described to the response amber codon can be specifically with pNO ₂Phe (structure shown in Figure 1A) mixes (Tsao etc. (2006), " utilizing genetic method that distance probes is mixed in the colibacillary protein " (The genetic incorporation of a distance probe into proteins in Escherichia coli) in the colibacillary protein J Am Chem Soc128:4572-4573).Under degeneration or natural endowment, use Ni ²⁺Affinity chromatography purified mutant protein (about 1mg/L is in the GMML minimal medium) cuts His then ₆Label and and carry out purification with the size exclusion chromatograph.In order to express pNO ₂Phe ⁸⁶MTNF α, pNO ₂Phe ¹¹MTNF α and pNO ₂Phe ⁴²MTNF α muton is with mutNO2PheRS, mutRNACUA and the common transformed into escherichia coli BL21 of mTNF α gene (DE3) cell that suddenlys change separately.Transformant contains 1mM pNO under 37 ℃ ₂Cultivate in the GMML culture medium of Phe, and at OD _600nmReach at 0.5 o'clock and induce with 1mM IPTG.At 37 ℃ of continuous oscillation cultured cell 12-16h, collect then.Store cell mass up to use at-80 ℃.Express WT mTNF α, Phe by identical step ⁸⁶MTNF α and Phe ⁴²MTNF α.Yet, with pNO ₂Phe mTNF α muton is compared, and is containing pNO ₂Express these protein in the eutrophy culture medium of Phe (2x YT culture medium).

Purification WT mTNF α and pNO2Phe under the degeneration condition ⁸⁶MTNF α

All purification steps are at room temperature operated.Cell mass was melted on ice 15 minutes, add 5ml lysis buffer (100mM NaH with every gram weight in wet base ₂PO ₄, pH=8.0,10mM Tris/HCl, 8M carbamide), re-suspended cell is stuck with paste.With cell suspension at ultrasonic 3 minutes on ice.10,000x g adds 10ml Ni-NTA His-binding resin (Nova base company, state of Wisconsin Madison, the U.S.) after centrifugal 25 minutes in supernatant, and mixes 60 minutes on rotary shaker.

Lysate-resin compound is loaded on the poly-allylidene post of 5ml (Kai Jie company), and with 40ml lavation buffer solution A (100mM NaH ₂PO ₄, pH=6.3,10mM Tris/HCl, 8M carbamide) wash twice.With 10ml lavation buffer solution B (100mM NaH ₂PO ₄, pH=5.9,10mM Tris/HCl, 8M carbamide) flushing twice after, use 100mM NaH ₂PO ₄, pH=4.5,10mM Tris/HCl, 8M carbamide eluting.With the 10K molecular weight hold back Amicon Ultra-15 centrifugal filter equipment (Mi Libo, Bedford, Massachusetts, the U.S.) (Millipore, Bedford, MA, USA) condensing protein mixture is loaded into Xa cutting buffer (20mM Tris/HCl then; 200mM NaCl; 1mM EDTA, pH=7.4) HiPrep of pre-equilibration ^TMOn 26/10 desalting column (GE health care company (GE Healthcare), New Jersey Piscataway, the U.S.).Xa factor (5%w/w) is preceding adding, and uses molecular weight to hold back Amicon Ultra-15 centrifugal filter equipment and concentrates the muddy component that contains occlusion body.

Room temperature is quantitatively removed the terminal His of N-in following 3 days ₆-label is used the SDS-PAGE analytical control.Behind the proteolysis, by centrifugal solubility Xa protease and the His of from occlusion body, separating ₆-labelled peptide.Then protein is dissolved in～1ml solubilising buffer in (8M carbamide, 50mM Tris/HCl, pH=8.0,10mM DTT), and injects the Superdex 75 10/300GL posts (GE health care company) of solubilising buffer pre-equilibration.The flow velocity of going up with 0.3 ml/min (ml/min) at AKTA purification instrument (GE health care) carries out two-wheeled size exclusion chromatograph.For folding, use the 10K molecular weight to hold back Slide-A-Lyzer dialysis cassette (Pierre Si company, Rockford, the Illinois State U.S.) (Pierce, Rockford, IL, USA) relative renaturation buffer (240mM NaCl; 10mM KCl; 0.5%Triton X-100; 50mM Tris/HCl; 1mM EDTA, pH=8.0) dialysis protein example.. phosphate-buffered saline (PBS) is to folding again pNO relatively ₂Phe ⁸⁶MTNF α dialyses.

Purification WT and sudden change mTNF α under natural surroundings

Purification steps all under the natural endowment carry out at 4 ℃.Melt cell mass on ice 15 minutes, add 5ml lysis buffer (50mM Tris/HCl, pH=8.0 with every gram weight in wet base; 150mM NaCl, 10% (v/v) glycerol) the re-suspended cell paste.Add adequate proteins enzyme inhibitor mixture (Luo Shi, Indianapolis, seal younger brother An Nazhou, the U.S.) (Roche, Indianapolis, IN, USA) after, with 150L lysosome (100mg/mL; MP Biomedicines, Inc., Irving, California, the U.S.) (MP Biomedicals, Irvine, CA, USA), 50 L of DNase I (5mg/mL; Luo Shi), 5L RNase A (100mg/mL; Sigma-Ao De Ritchie company, St. Louis, the Missouri State, the U.S.) (Sigma-Aldrich, St.Louis, MO, USA), box 125 U benzonase ribozymes (Nova base company) (Novagen) are handled 10mL cell suspension.Stirred cell suspension 20 minutes under the room temperature, cracking takes place.Presplitting is solved cell quick-freezing in liquid nitrogen, and 37 ℃ of water-baths are melted then.Repeat freeze thawing once.In complete cracking in ultrasonic 2 minutes on ice.

18,000x g adds 1ml Ni-NTA His-binding resin (Nova base company) after centrifugal 20 minutes in supernatant, and mixes 30 minutes on rotary shaker.Lysate-resin compound is loaded on the poly-allylidene post of 5ml (QIAGEN), and washes twice with the 20ml lysis buffer.With the 2mL elution buffer (50mM Tris/HCl, pH 8.0; 150mM NaCl, the 250mM imidazoles, 10% (v/v) glycerol) elute protein is held back Amicon Ultra-15 centrifugal filter device (Mi Libo) with the 10K molecular weight and is concentrated, and carries out purification with the Superdex 75 10/300GL posts (flow velocity 0.3ml/min) of PBS pre-equilibration.With MALDI-TOF mass spectral characteristi all proteins, on the Voyager-DE-STR instrument, carry out (Applied Biosystems, Inc., Foster city, California, the U.S. (Applied Biosystems, Foster City, CA), USA), use sinapic acid as substrate, (Scripps Center for Mass Spectrometry, The Scripps Research Institute) (La Jolla, California, the U.S.) is carried out in experiment at The Scripps Research Inst. mass spectrum center.Concentration with＞10mg/mL under 25 ℃ of conditions of the mTNF alpha protein of all purification under natural endowment is dissolved in the PBS buffer (pH=7.5) fully.

Analyze pNO ₂Phe ⁸⁶The compositions of mTNF α and homogeneity

Pass through the composition and the homogeneity of SDS-PAGE (Fig. 1 C) and mass spectrum (Fig. 1 D) molecule mutain then.Shown in Fig. 1 C, use pNO ₂Phe specificity mutRNACUA/ aminoacyl-tRNA synthetase is right, at 1mM pNO ₂There is not (the 2nd road) in Phe and have mTNF α Tyr under the condition in (the 3rd road) ⁸⁶The expression of amber mutation.With Ni-NTA affinity column purifying protein quality sample, with SDS-PAGE and SimplyBlue ^TMDyeing is analyzed.Wild type mTNF α is represented in the 4th road, and the 1st road is the molecular weight standard product.The result of Fig. 1 C is presented at the pNO of purification under the degeneration condition ₂Phe ⁸⁶MTNF α has similar swimming to WT mTNF α on SDS-PAGE; When mutant gene is lacking pNO ₂Express under the condition of Phe, do not observe total length mTNF α, showing does not have on 86 can detected endogenous is amino acid whose to mix.

By MS/MS sequencing analysis Trypsin enzymolysis fragment, mutain homogeneity composition is analyzed (Fig. 1 D).In order to prepare the protein example of this step, will contain pNO ₂Phe ⁸⁶The cutting adhesive tape of mTNF α is cut into pieces, and with 25mM NH ₄HCO ₃/ 50% acetonitrile mixes.Behind the vortex 10 minutes, supernatant discarded.This step repeats twice, on Speed Vac with dry about 20 minutes of blob of viscose.Add 25mM NH ₄HCO ₃In 25 μ L reduction protein example.Be reflected at and carry out about 1 hour under 56 ℃.After removing supernatant, blob of viscose is mixed with 25 μ l 55mM iodoacetamides.After at room temperature lucifuge is hatched 45 minutes, carry out digesting in the trypsin glue, as (Rosenfeld etc., (1992) " behind one dimension or two-dimensional gel electrophoresis in the protein adhesive digestion be used for inner sequencing analysis " (In-gel digestion of proteins for internal sequence analysis after one-or two-dimensional gel electrophoresis) as described in the open step Anal Biochem203:173-179; Hellman etc., (1995) " improvement of the little preparation of amino acid sequencing internal protein fragment " in the glue " digestion step " (Improvement of an ' In-Gel ' digestion procedure for the micropreparation of internal protein fragment for aminoacid sequencing) Anal Biochem224:451-455).With C18 ZipTip (Mi Libo) purification gained peptide mixer, and Thermo Finnigan LTQ mass spectrograph (Sai Mo scientific ﹠ technical corporation, Somerset, the New Jersey, the U.S.) (Thermo Scientific, Somerset, NJ, USA) carry out the MS/MS fragmentation on, use the nanometer injection source to move with positive ion mode, (Scripps Center for Mass Spectrometry, The Scripps Research Institute) (La Jolla, California, the U.S.) is carried out in experiment at The Scripps Research Inst. mass spectrum center.8-to preparation as mentioned above gathers the segmental MS/MS analysis of Trypsin enzymolysis and mixes pNO at 86 residues ₂The pattern of Phe accurately mate (Fig. 1 D, Figure 12).The partial sequence of 10 poly-fragment FAISXQEK, wherein X represents pNO ₂Phe can read from the note b of Fig. 1 D or y ionization series.In Figure 12, contain pNO ₂-Phe trypsin fragment sequence is with single-letter coded representation (X, pNO ₂-Phe).The ion fragment that has shown observed y and b series.Redness has been indicated crucial proof pNO ₂Y that-Phe mixes and b ion.All quality are reported with single isotopic mass.

With MALDI-TOF mass spectral characteristi all proteins (Fig. 2,3, and table 1), on the Voyager-DE-STR instrument, carry out (Applied Biosystems, Inc., the Foster city, the California, the U.S. (Applied Biosystems, Foster City, CA), USA), use sinapic acid as substrate, (Scripps Center for Mass Spectrometry is carried out in experiment at The Scripps Research Inst. mass spectrum center, The Scripps Research Institute) (La Jolla, California, the U.S.).(table 1 Fig. 2) has also shown and the pNO that contains total length mTNF α the MALDI-TOF spectrum ₂The desired molecular weight of Phe ([M-H]+: 17286). fully Pi Pei peak ([M-H]+: 17287.These results show that selectivity is with pNO ₂Phe mixes sudden change mTNF α.

Table 1:mTNF α variant MALDI-TOF mass spectral analysis.

Analyze pNO ₂Phe ⁸⁶The tertiary structure of mTNF α

In order to determine pNO ₂The Phe sudden change is for pNO ₂Phe ⁸⁶MTNF α, Phe ⁸⁶MTNF α, pNO ₂Phe ⁴²MTNF α, Phe ⁴²MTNF α and pNO ₂Phe ¹¹The influence of three grades/quarternary structure of mTNF α is analyzed WT mTNF α and sudden change mTNF α sample (table 2) with fast protein liquid chromatogram.Figure 1B has shown the trimerical X-ray crystal structure of mTNF α (PDB ID code 2TNF) that contains Tyr-86, Asp42m and Lys-11 introducing thing.Use Superdex 75 10/300GL gels to infiltrate post (GE health care), go up at fast protein liquid chromatogram (FLPC) and analyze all proteins sample.In 25 ℃ of PBS buffer, carry out the size exclusion chromatograph with the flow velocity of 0.3ml/min.WT mTNF α and pNO ₂Phe ⁸⁶MTNF α concentration with＞10mg/ml in 25 ℃ PBS buffer is dissolved fully.With Bole's (Bole's laboratory, Ai Kulaisi, the California, the U.S.) (Bio-Rad Labs, Hercules, CA, gel USA) infiltrate the molecular weight standard product pillar are calibrated, and standard substance comprise the B-12 (1.35kDa) of Elityran (670kDa), gamma Globulin (158kDa), ovalbumin (44.0kDa), Myoglobin (17.0kDa) and vitamin.Measure the light absorption of elution fraction behind the protein eluting at 280nm.

WT mTNF α and pNO ₂Phe ⁸⁶MTNF α all shows similar retention time, and corresponding molecular weight and its trimeric form are complementary.The logarithm that Fig. 4 has shown protein standard substance molecular weight is mapped in the retention time that Superdex 75 10/300GL gels infiltrate on the post relatively.Ignore Elityran (670kDa) in the calculating, because its molecular weight far surpasses the separating ranges of Superdex 75 10/300GL posts (3kDa-70kDa).Figure based on Fig. 4 determines pNO ₂Phe ⁸⁶MTNF α, WT mTNF α, mTNF α F ⁸⁶, pNO ₂Phe ⁴²MTNF α, mTNF α F ⁴²And pNO ₂Phe ¹¹The molecular weight of mTNF α tetramer structure, (as follows) as shown in table 2.Monomer pNO ₂Phe ⁸⁶MTNF α eluting retention time is 41.47 minutes.

The observed value and the value of calculation of table 2:WT mTNF α and mTNF α muton molecular weight

Logarithm to protein standard substance molecular weight is mapped in the retention time that Superdex 75 10/300GL gels infiltrate on the post relatively, determines pNO by this figure ₂Phe ⁸⁶TNF α, Phe ⁸⁶MTNF α, pNO ₂Phe ⁴²MTNF α, Phe ⁴²MTNF α, pNO ₂Phe ¹¹MTNF α and the tetrameric molecular weight of WT mTNF α.

PNO ₂Phe ⁸⁶The analysis of mTNF α biologic activity

In NF κ B-luciferase reporting cell line, proteinic biologic activity is detected by the activation of measuring mTNF α-inductive NF κ B.Use HEK293 cell (Ye etc., (2000) " ER pressure inducement SREBP processive enzyme cutting film is in conjunction with ATF6 " (ER Stress Induces Cleavage of Membrane-Bound ATF6 by the Same Proteases that Process SREBPs) of stably express NF κ B-Luc in the reporter gene experiment Mol Cell6:1355-1364).The nitrated stabilized cell of trypsin is resuspended among the DMEM that contains 10%FBS, and concentration is 5x10 ⁵Cells/ml, with 20 μ l/ holes plant in the blank of 384-hole (Ge Leina company, Lang Wude, Florida State) (Greiner, Longwood, FL).Contain 5%CO at 37 ℃ ₂Incubator for tissue culture in hatch 2 hours after, in cell, add 20 μ l TNF α.Continued incubated cell 24 hours.(Promega, Madison WI) measure uciferase activity, and read plate with the cold light plate reading machine to add 20 μ l Bright-Glo (Pu Luomaige company, state of Wisconsin Madison).Experimental result shows that WT mTNF α activates NF κ B signal transduction in the NF κ B-luciferase reporting cell line.By contrast, pNO ₂Phe ⁸⁶Muton (Fig. 5) only has the activity of WT mTNF α in 2% experiment, this with before about Tyr ⁸⁶By receptors bind necessary, introduce 86 residue sudden changes and cause the active significantly report unanimity of forfeiture (Van Ostade etc. (1994), " the structure-activity research of human tumour necrosis factor " (Structure-activity studies of human tumour necrosis factors) Protein Engineering7:5-22; Loetscher etc. (1993), " huamn tumor necrosis factory alpha (TNF α) muton has exclusive specificity for 55-kDa or 75-kDa TNF receptor " (Human tumor necrosis factor alpha (TNF alpha) mutants with exclusive specificity for the 55-kDa or 75-kDa TNF receptors) J Biol Chem268:26350-7; Zhang etc. (1992), " the rite-directed mutagenesis analysis and the structure-function relationship of human tumor necrosis factor-alpha receptor binding site " (Site-directed mutational analysis of human tumor necrosis factor-alpha receptor binding site and structure-functional relationship) J Biol Chem267:24069-75).In the MALDI-TOF spectrum, find another one peak and pNO ₂Phe ⁸⁶Preceding two the amino acid whose deletions of mTNF α are corresponding, and (table 1, Fig. 2), supposition is because due to excessively digesting in the Xa proteolysis cutting step.Preceding two amino acid whose deletions of N-terminal are minimal effect TNF activity only, therefore be difficult to truncated protein matter is separated (Van Ostade etc. (1994), " the structure-activity research of human tumour necrosis factor " (Strncture-activity studies of human tumour necrosis factors) from full length protein Protein Engineering7:5-22), so, comprise sudden change mTNF α and WT contrast with mixture direct immunization mice.

Experiment in addition shows the terminal His of N- ₆Whether label exists does not influence immune result (Figure 13).Five Bcl2 mices as #3262, #3263, #3264, #3331, #3351, are divided into two groups at random, use His respectively ₆-Phe ⁸⁶MTNF α (WT) or His ₆-pNO ₂Phe ⁸⁶MTNF α injects, and used scheme is RIMMS (multidigit point repeats an immunity) scheme (as mentioned below).Simply say 18 days mice is carried out 8 injections.In the per injection, contain the proteinic 200 μ l PBS of 5 μ g and complete Freund's adjuvant (CFA) and mix at 1: 1, or be mixed near the injection of specific site remaining 6 periphery lymph nodes at 1: 1 with incomplete Freund's adjuvant (IFA) as injection first.In the time of the 21st day,, use the goat anti-mouse IgG second antibody of horseradish peroxidase, determine at pNO by enzyme-linked immunosorbent assay (ELISA) ₂Phe ⁸⁶MTNF α and Phe ⁸⁶The antibody titer of mTNF α.Referring to Figure 13.1K post) or 10,000 times (1: carry out ELISA 10K post) among this figure, with 100 times (1: 100 pre) of mice serum dilution before the immunity, with 1,000 times of mice serum dilution after the immunity (1:.With WT mTNF α (WT, first three root post) or pNO ₂Phe ⁸⁶MTNF α (mod, back three posts) The wraps by elisa plate.

PNO ₂Phe ⁸⁶Anti-pNO in the mTNF alpha immunization mice ₂Phe ⁸⁶The serum titer analysis of mTNF α or WT mTNF α

MTNF α can be survived and do not shown the unusual (Pasparakis etc. (1996) of obvious phenotype, " immunity and inflammatory response in the TNF α deficient mice: tumor necrosis factor is at former generation B cell folliculus, the formation of dendritic cells,follicular network and germinal center, and the pivotal role in the sophisticated humoral immunization " (Immune and inflammatory responses in TNF alpha-deficient mice:a critical requirement for TNF alpha in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response) J Exp Med 184:1397-1411), show that mice can survive at TNF α He in the immunne response, produce and biologic activity thereby make immunized mice can be used for analyzing the TNF Alpha antibodies.In order to measure pNO ₂Phe ⁸⁶The immunogenicity of mTNF α muton, 32 C57BL/6 mices are divided into three groups and also inject pNO respectively ₂Phe ⁸⁶MTNF α, WT mTNF α and PBS buffer, used scheme is RIMMS (multidigit point repeats immunity) scheme (Kilpatrick etc. (1997), " using the RIMMS affine sophisticated monoclonal antibody of exploitation fast " (Rapid development of affinity matured monoclonal antibodies using RIMMS) Hybridoma16:381-389).For fear of the caused side effect of mTNF α toxicity, use per injection 5 μ g mTNF α (Libert etc., (1999) " identifying the locus that No. 12 end of chromosome control of mice tumor necrosis factor induces the lethal shock to tolerate " (Identification of a locus on distal mouse chromosome 12 that controls resistance to tumor necrosis factor-induced lethal shock) in the research always Genomics55:284-289).Fig. 6 shows with PBS (6A), WT mTNF α (6B), pNO ₂Phe ⁸⁶MTNF α (6C) or Phe ⁸⁶Serum titer in the immune C57BL/6 mice of mTNF α (6D).Simply say 17 days mice is carried out 8 injections.In the per injection, contain the proteinic 200 μ l PBS of 5 μ g and complete Freund's adjuvant (CFA) and mix at 1: 1, or be mixed near the injection of specific site remaining 6 periphery lymph nodes at 1: 1 with incomplete Freund's adjuvant (IFA) as injection first.In the time of the 21st day,, use the goat anti-mouse IgG second antibody of horseradish peroxidase, determine at pNO by enzyme-linked immunosorbent assay (ELISA) ₂Phe ⁸⁶The antibody titer of mTNF α and WT mTNF α.

In order to carry out ELISA, (Nunc, Rochester's high absorption 384-orifice plate (Lang Ke company, New Jersey Rochester) NY) are spent the night with 4 ℃ of bags of 30 μ l, 0.5 μ g/ml protein.(PBST) washes plate twice with the PBS+0.05% polysorbas20, also washes with PBST once more with the PBS sealing that contains 80 μ l 1%BSA.Successively with plate and 20 μ l first antibodies or with the serum of the PBS dilution that contains 1%BSA, the link coupled goat anti-mouse IgG of 20 μ l HRP-(Jackson's immune Research laboratory, Xi Geluowei, Pennsylvania) (Jackson ImmunoResearch Laboratories, West Grove, PA) and 20 μ l tmb substrate (KPL, the Gaithersburg, the Maryland State) (KPL, Gaithersburg, MD) hatch, and measure the 650nm absorption.Wash plate with PBST between hatching.

Measure anti-WT mTNF α (Fig. 6 A and 6B, left side post) or pNO with ELISA ₂Phe ⁸⁶MTNF α (Fig. 6 A and 6B, right side post).For Phe ⁸⁶MTNF alpha immunization mice is measured anti-WT mTNF α (Fig. 6 C and 6D, left side post) or Phe with ELISA ⁸⁶MTNF α (Fig. 6 C and 6D, right side post).Before the measurement, with the PBS buffer dilute serum sample that contains 1%BSA.With WT mTNF α or anti-pNO in the PBS buffer mice immunized serum is only arranged ₂Phe ⁸⁶MTNF α and WT mTNF α IgG titre be remarkable (Fig. 6) not.As expection, WT mTNF α should be tolerated by the mouse immune system as oneself protein matter.By contrast, use pNO ₂Phe ⁸⁶The mice of mTNF alpha immunization has shown pNO ₂Phe ⁸⁶The obvious high serum titer of mTNF α (Fig. 6 C, the right side post of every pair of pillar) and WT mTNF α (Fig. 6 C, the left side post of every pair of pillar).Therefore, single pNO ₂Intensive immunne response has been induced in Phe sudden change (making the monomer molecule amount change 29 dalton), obtains the antibody with the cross reaction of WT mTNF α height.Use the Bcl-2 mice to obtain analog result, show that this result does not rely on strain (Fig. 7).The RIMMS scheme that reuses comprises 17 days carries out 8 injections (per injection 5g), carries out initial injection under the condition that CFA exists, and IFA remains 7 injections under existing.Measure anti-WT mTNF α (first, second roots of four pillars of each group) or pNO with ELISA ₂Phe ⁸⁶MTNF α (second, third root pillars of four pillars of each group).Before the measurement, with the PBS buffer 1/100 or the 1/1000 dilute serum sample that contain 1%BSA.

We have also detected the immunogenicity when not having immunostimulant, find to use pNO ₂Phe ⁸⁶MTNF alpha immunization mice has also been induced significant anti-TNF alpha titre (Fig. 8) when existing without any adjuvant, show that this scheme not needing can be used for the treatment condition of strong adjuvant.Under the condition that does not have CDA or IFA, with (a) WT mTNF α, or (b) pNO ₂Phe ⁸⁶The mTNF alpha immunization carried out the serum titer of the Bcl-2 mice of 8 injections (per injection 5 μ g protein) in 17 days.Measure anti-WT mTNF α (the left side post of every coupled columns) or pNO with ELISA ₂Phe ⁸⁶MTNF α (the right side post of every coupled columns).Before the measurement, with the PBS buffer dilute serum sample that contains 1%BSA.

And, order pNO ₂Phe ⁸⁶MTNF α carries out 8 immunity back antibody responses and continues, after 19 weeks very strong (Figure 14).Clinical application especially needs this long-term persistence, because the therapy defective is that after immunity stops the autoantibody titre reduces rapidly at present.Figure 14 has shown the result who measures the serum titer persistence.In order to carry out this experiment, use pNO ₂Phe ⁸⁶Three Bcl-2 transgenic mices of mTNF alpha immunization.After order is carried out 8 immunity, get blood at the appointed time and carry out anti-pNO ₂Phe ⁸⁶The elisa assay of mTNF α.Before each the measurement, with 1: the 100 dilute serum sample of PBS buffer that contains 1%BSA.The corresponding last immunity of T and get time span between the blood.

In order to verify that immunne response is the result of immunogenicity nitro aryl in the alpha-non-natural amino acid, produce Tyr ⁸⁶→ Phe sudden change mTNF α (Phe ⁸⁶MTNF α).After confirming the trimer quarternary structure with the size exclusion chromatograph, CFA/IFA exist or non-existent condition under with the immune Bcl2 mice of this muton.For mice immunized under the no adjuvant condition, the RIMMS scheme comprises 17 days 8 times injections (per injection 5g protein).To with the adjuvant existence condition under mice immunized, CFA as first the injection, IFA is used to remain 7 injections.Measure anti-WT mTNF α (Fig. 9, first, second root of four pillars of each group) or Phe with ELISA ⁸⁶MTNF α (Fig. 9, second, third root pillar of four pillars of each group).Before the measurement, with the PBS buffer 1/100 or the 1/1000 dilute serum sample that contain 1%BSA.Exist or do not exist under the condition of adjuvant all not produce significant anti-TNF alpha titre, show NO ₂Be to break immunologic tolerance needed (Fig. 6 D and 9).And, pNO ₂Phe ⁸⁶MTNF alpha specific CD ₄ ⁺The T cell only produces with this mutein immune mouse the time, and is using WT mTNF α or Phe ⁸⁶Then do not produce during mTNF alpha immunization mice (Figure 15 A).By contrast, when stimulating from pNO at external use WT mTNF α ₂Phe ⁸⁶The CD of mTNF alpha immunization mice ₄ ⁺During the T cell, do not observe significant propagation (Figure 15 B).In order to carry out the T-cell proliferation experiment, the magnetic consumption by using MACS pearl (beautiful day Ni biotech company) (Miltenyi Biotec) separates CD4 from immune mouse from lymph node ⁺The T cell.Then the T cell being placed the antigen that increases progressively with radiating splenocyte and quantity from natural B cl-2 mice cultivates.Culture is hatched 48h, use then [ ³H] the thymidine pulse labeling spends the night.Collect culture plate and place on the filter paper pads, and ((PerkinElmer) carries out quantitatively with TopCount scintillation counter (Perkinelmer Inc.).

Use the preliminary epitope mapping experiment of mTNF α muton and WT mTNF α fragments of peptides to show for pNO ₂Phe ⁸⁶The polyclone of mTNF α is replied and is related to a plurality of protein epitopes.To sum up, these results show pNO ₂Phe mixes mTNF α sequence and has created t cell epitope, has strengthened the help of T cell for the effective immunne response that triggers antagonism disease relative protein white matter.Other immunization protocol (as, with sudden change and WT TNF α sequential immunization) also can produce the cross reacting antibody of high titre.(1999) such as these results and Dalum, " therapeutic antibodies that antagonism TNF alpha immunization obtains " (Therapeutic antibodies elicited by immunization against TNF-alpha) Nat Biotechnol 17:666-669 is consistent, and this piece article mixes mTNF α to break immunologic tolerance with immunodominance t helper cell epi-position.Yet present scheme causes existing in the protein little disturbance, can not destroy its three grades folding or its expression of appreciable impact, solubility or stability.

Computer analysis prediction Tyr to potential MHC II class DR epi-position among the TNF α based on sequence ⁸⁶Peptide sequence on every side is not T-cell epitope (Steed etc. (2003), " the negative TNF variant of appropriate design dominance makes TNF signal transduction inactivation " (Inactivation of TNF Signaling by Rationally Designed Dominant-Negative TNF Variants) Science 301:1895-1898).In order to begin to inquire into the universality of this method, we have detected and have carried out pNO in other site ₂Phe replaces whether have similar effect.The surperficial exposed residue Asp of trimerizing or receptors bind will do not participated in ⁴²Sport pNO ₂Phe.After SDS-PAGE and mass spectrum affirmation sudden change, use pNO ₂Phe ⁴²MTNF α or Phe ⁴²MTNF α muton immunity two groups of C57BL/6 mices (Figure 10).The RIMMS scheme is included in adjuvant and does not have following 17 days and carry out 8 injections (per injection 5g protein).ELISA measures anti-WT mTNF α (Figure 10 A, first of every group of three pillars; Figure 10 B, first of every pair of pillar), anti-pNO ₂Phe ⁴²MTNF α/pNO ₂Phe ¹¹MTNF α (Figure 10 A, Figure 10 A, second of every group of three pillars; Figure 10 B, in 7,8,9 second of every pair of pillar), or anti-Phe ⁴²MTNF α (Figure 10 A, every group of pillar the 3rd) or PBS (Figure 10 B, in 5,6 second of every pair of pillar).Before the measurement, with PBS buffer 1/100 (Figure 10 A) or 1/800 (Figure 10 B) dilute serum sample of containing 1%BSA.Only work as pNO ₂Phe ⁴²MTNF α induces significant anti-TNF alpha titre when carrying out immunity, use pNO ₂Phe ⁴²The mice of mTNF alpha immunization is induced significant anti-TNF alpha titre.This result shows pNO ₂Phe mutation is a quite general method of giving specific self or exotic antigen hyperimmunity.

With another surperficial exposed residue Lys ¹¹Sport pNO ₂Phe obtains analog result.These results show pNO ₂The method that one of Phe mutation is quite general gives specific self or exotic antigen hyperimmunity can be not limited only to the replacement that the surface exposes Tyr or Phe residue.Yet preliminary study shows at 104 and 19 mixes pNO ₂The Phe effect relatively a little less than.Use pNO ₂Phe ¹⁰⁴MTNF alpha immunization C57BL/6 mice produces the antibody that lacks with the remarkable cross reaction of natural mTNF α.Therefore, environmental effect has influence for the characteristics of determining immunne response.At last, possible genetic coding immunogenicity aminoacid also has same favourable application, perhaps for littler antigen, and can be by the synthetic immunogenicity alpha-non-natural amino acid that mixes of semi-synthetic or full peptide.

Analyze pNO ₂Phe ⁸⁶MTNF alpha immunization mice is to replying that LPS stimulates

Next we measure in serious endotoxemia mouse model and use pNO ₂Phe ⁸⁶Can TNF alpha immunization inoculation mice make its antagonism lipopolysaccharide (LPS) stimulate (F.Niessen etc. (2008) " dendritic cell PAR-S1P3 signal transduction links together blood coagulation and inflammation " (Dendritic cell PAR-S1P3 signalling couples coagulation and inflammation) Nature 452:654-658.In this model, the inductive septic shock of known LPS participates in generation and the release of TNF α.The experiment of all research mice endotoxemias is all carried out according to NIH's animal protection guide (National Institutes of Health Animal Protection Guidelines), and through Si Kelipu academy's animal care and the approval of use committee.By vortex 30 seconds with lipopolysaccharide (LPS, escherichia coli (E.coli) O111:B4, CEB company (Calbiochem/EMD Biosciences), Santiago, California, the U.S.) be dissolved in 37 ℃ of normal saline (0.9%w/v NaCl), respectively carry out 2 minutes supersound process before and afterwards.Under 2% isoflurane anesthesia, male C57BL/6 mice ((maine state of u.s.a Ba Er Haber (the Bar Harbor of Jackson Lab to 9 ages in week, ME, USA)) peritoneal injection 7.5mg/kg LPS is to carry out passive immunity, and perhaps the injected in mice 8.5mg/kg LPS to 15 ages in week carries out active immunity.All experiments are all in that day alternates with night in 12 hours is indoor, carry out under the steady-state conditions (temperature 20-22 ℃ with relative humidity 40-60%).Accept the Kaplan-Meier survival curve of the mice of active or passive immunity and see Figure 11.Make the Kaplan-Meier curve, and analyze survival difference with the logarithm rank tests.

With PBS, WT mTNF α and pNO ₂Phe ⁸⁶MTNF alpha immunization C57BL/6 mice.After finishing above-mentioned immunization protocol,, determine their survival rate to injecting LPS (8.5mg/kg) in these mouse peritoneums.In Figure 11 A, will utilize pNO ₂Phe ⁸⁶The mice of mTNF α or WT mTNF alpha immunization (8 every group) is made comparisons with 7 mices accepting false immunity.Demonstration is compared with wild type and is used pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).In Figure 11 B, will utilize 100 μ g from pNO ₂Phe ⁸⁶The mice (8 every group) of the IgG purification injection of mTNF α or wild type immune mouse is made comparisons with the contrast of accepting saline injection.Demonstration is compared with wild type and is used pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).In Figure 11 C, mice (6 every group) is accepted 100 μ L from pNO ₂Phe ⁸⁶MTNF α or wild type mTNF alpha immunization mice compile serum.Demonstration is compared with wild type and is used pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).Control mice is injected isopyknic normal saline.

Shown in Figure 11 A, use pNO ₂Phe ⁸⁶The survival advantage (87.5%) of mTNF alpha-mutant mice immunized is apparently higher than the mice (survival rate 12.5%) of accepting PBS and WT mTNF alpha immunization.Similarly, accept to hang oneself pNO ₂Phe ⁸⁶The survival rate (83.3-87.5%) of the C57BL/6 mice that compiles serum (100uL) or IgG purification antibody (4mg/kg) of the Bcl-2 mice of the pre-immunity of mTNF α apparently higher than the mice that compiles serum or IgG (16.7-25.0%) of the Bcl-2 mice of the WTmTNF alpha immunization of accepting to hang oneself (Figure 11 B, 11C).Therefore, these results show, the single NO of oneself protein matter ₂The Phe mutation induction is replied at the intensive cross reacting antibody of native protein, thereby produces protective effect in disease model.At present, we expand to other TNF α dependency models with these researchs, comprise collagen-induced arthritis (CIA) model and KRN transgenic mice (K/BxN) model (Ditzel (2004) " K/BxN mice: people's inflammatory arthritis model " (arthritis (CIA) model and KRN transgenic mouse (K/BxN) model (Ditzel (2004) " The K/BxN mouse:A model of human inflammatory arthritis) Trends Mol Med 10:40-45).

IgG antibody used in the above-mentioned injection is by being loaded into Mus serum 10ml agarose coupling protein G affinity column (γ combination+agarose (GammaBind Plus Sepharose), Pharmacia biotech company (Pharmacia Biotech), the New Jersey Piscataway is prepared on USA).PBS (pH 7=4) with three times of column volumes washs this post.0.1M acetic acid (pH 3=0) with the twice column volume carries out eluting.Use among the 1M Tris/HCl (pH=9.0) then and eluent, and dialyse with PBS (pH=7.4).

Stimulated preceding 24 hours at endotoxin, mice is carried out passive immunity.In first experiment, mice is accepted peritoneal injection 100 μ L from pNO ₂Phe ⁸⁶MTNF α or WT mTNF alpha immunization mice compile serum.Second winding is subjected to 4mg/kg by pNO ₂Phe ⁸⁶The IgG of the mice serum purification of mTNF α or WT mTNF alpha immunization.Control mice is injected isopyknic normal saline.

Above-mentioned discovery shows, in TNF α dependent form mouse model, and Tyr ⁸⁶To pNO ₂(with the proteinic unique difference of WT-is to contact site usefulness-NO at solvent in the single sudden change of Phe ₂Group replace to replace-and OH) significantly strengthen proteinic immunogenicity and caused neutralizing antibody to be replied.With residue 86 with close on residue 85 mutation and become Ala pNO ₂Phe ⁸⁶Or the influence of WT protein antibody titre is very little, shows the discontinuous epi-position of these antibody recognition.The result shows the unique NO of the former part of the hyperimmunization that does not have in the protein that contains natural generation ₂The protein of group will be exotic antigen by immune system recognition.Because structure is closely similar, the antibody capable of initiation and corresponding oneself protein matter generation cross reaction, thus break immunologic tolerance.

This embodiment shows and may pass through pNO ₂The Phe fixed point is mixed protein epitope, breaks immune self tolerance as the epi-position of target oneself protein matter, for example is used to produce vaccine.Though but the protein inducing self-body antibody of known change, the disease of giving the immunogenic change of protein limits characteristic makes their generation use the complicated (Lerner etc. (1968) " inducing acute glomerulonephritis with the soluble antigen that separates from normal homology and self urine in rabbit " (The induction of acute glomerulonephritis in rabbits with soluble antigens isolated from normal homologous and autologous urine) that become with treatment J Immunol100:1277-1287). for example, used Ah 's acyl-sulphonyl in the research of Weigle-thyroglobulin prepared product comprises per molecule thyroglobulin～50 azo and connects (Weigle (1965) " do not contain adjuvant and inject unaltered thyroid gland immunoglobulin (Ig) generation thyroiditis and antibody in the rabbit that stimulates with the thyroid gland immunoglobulin (Ig) that changes in advance " (The production of thyroiditis and antibody following injection of unaltered thyroglobulin without adjuvant into rabbits previously stimulated with altered thyroglobulin)J Exp Med122:1049-1062), the antigen that obtains the height heterologous and may assemble or partly fold.Similar, insert the T-cell epitope in antigenic different loci and can create with native protein and compare tertiary structure, solubility and stable immovable protein.By contrast, the change of this paper has clear and definite chemistry definition and is confined to single residue.As and if these sudden changes do not influence proteic overall quarternary structure and solubility thereof.Therefore the antibody that obtains more may discern the corresponding epi-position in the native protein.At last, contain pNO ₂The TNF alpha-mutant of Phe is induced the cross reaction immunne response of protectiveness, and need not strong adjuvant, and resulting high titre was kept 4 months.These characteristics help the treatment of the our science of law and use.

This scheme can be applicable to other oneself protein matter, comprises that those (as starch β 1-42 peptide) or cancers with the protein folding disease association are relevant.In addition, by introducing pNO in weak immunogenicity or reticent epi-position ₂Phe group, this method can produce the strong antibody response at the cause of disease zone, predict that it obtains antagonism virus.The neutralizing antibody of antibacterial or parasitic infection (as, the CS1 protein of malaria or the E410 epi-position of HIV-1 gp41).And, immunogenicity aminoacid selectivity is mixed protein help producing functional antibodies, as g protein coupled receptor, and other is difficult to produce the agonist or the antagonist of the membrane-bound receptor of strong antibody response in history.The architecture basics of current this phenomenon and to it among discussion that human diseases is used is being illustrated.

Result's explanation shown in embodiment 1 relevant drawings.

Fig. 1 shows affirmation pNO ₂Phe mixes the experimental result of mTNF α.Figure 1A is alpha-non-natural amino acid pNO ₂The structure of Phe.Figure 1B has shown the trimerical X-ray crystal structure of the mTNF α that contains Tyr-86, Asp42 and Lys-11 (PDB ID code 2TNF).Fig. 1 C has shown use pNO ₂Phe-specificity mutRNA _CUA/ aminoacyl-tRNA synthetase is right, at 1mM pNO ₂There is (the 3rd swimming lane) in Phe but not lack under the condition of (the 2nd swimming lane) mTNF α Tyr ⁸⁶The affirmation experimental result of the expression of amber mutation.Under the degeneration condition, use Ni-NTA affinity column purifying protein quality sample among Fig. 1 C, with SDS-PAGE and SimplyBlue ^TMDyeing is analyzed.The 4th road comprises WT mTNF α, and the 1st road is the molecular weight standard product.Fig. 1 D is to pNO ₂Phe ⁸⁶MTNF α muton characterizes.The polyphone mass spectrum of 10 poly-fragment FAISXQEK is provided, and wherein X represents pNO ₂Phe.10 poly-fragments are by trypsinization pNO ₂Phe ⁸⁶MTNF α produces.Contain pNO ₂The partial sequence of 10 aggressiveness of Phe can be read from b or y ionization series.

Carry out kinds of experiments and confirm pNO ₂Phe mixes mTNF α, and pNO is mixed in demonstration ₂Phe does not influence the quarternary structure of non-natural TNF α.Fig. 2 provides pNO ₂Phe ⁸⁶MTNF α MALDI-TOF mass spectrometry results, Fig. 3 provides WT mTNF α mass spectrometry results; The bright pNO that mixes of non-natural TNF alpha molecule scale is confirmed at the peak among Fig. 2 ₂The Phe residue.Fig. 4 has shown and determines to carry out Tyr on the quarternary structure of sudden change mTNF alpha protein ⁸⁶→ pNO ₂Phe replaces the FPLC experimental result of effect.The muton elution time shows the muton trimerizing.

Also mutation T NF α has been carried out activity rating, Fig. 5 has shown WT mTNF α (square), pNO ₂Phe ⁸⁶MTNF α (triangle), pNO ₂Phe ⁴²MTNF α (inverted triangle), Phe ⁸⁶MTNF α (diamond) and Phe ⁴²The NF-κ B-uciferase activity of mTNF α (circle) is analyzed.Compare with WT TNF α, non-natural TNF alpha active reduces.

Fig. 6 A has shown the serum titer of PBS immunity C57BL/6 mice; Fig. 6 B has shown the serum titer of WT mTNF alpha immunization mice; Fig. 6 C has shown pNO ₂Phe ⁸⁶The serum titer of mTNF alpha immunization mice; Fig. 6 D has shown Phe ⁸⁶The serum titer of mTNF alpha immunization mice; With WT mTNF α or the anti-pNO that only obtains with PBS buffer immune mouse ₂Phe ⁸⁶MTNF α and WT mTNF α serum IgG titre are not obvious.As expection, WT mTNF α should be tolerated by the mouse immune system as oneself protein matter.By contrast, pNO ₂Phe ⁸⁶Mice has shown for pNO the mTNF alpha immunization ₂Phe ⁸⁶The high serum titer of mTNF α.

Experimental program comprises 17 days carries out 8 injections (per injection 5 μ g protein), and initial being injected under the condition that has complete Freund's adjuvant (CFA) carried out, and remaining being injected under the condition that has incomplete Freund's adjuvant (IFA) carried out.Measure anti-WT mTNF α (the left side post of the every coupled columns of 1-32) or pNO with ELISA ₂Phe ⁸⁶MTNF α (the right side post of the every coupled columns of 1-32).For Phe ⁸⁶MTNF alpha immunization mice (Fig. 6 D), ELISA measures antagonism WT mTNF α (the left side post of the every coupled columns of 33-36) or Phe ⁸⁶MTNF α (the right side post of the every coupled columns of 33-36).Before the measurement, with 1: the 1000 dilute serum sample of PBS buffer that contains 1%BSA.

Use the Bcl-2 mice to obtain and last analog result, show that this result does not rely on strain (Fig. 7).Fig. 7 has shown WT mTNF α or pNO ₂Phe ⁸⁶Antagonism WT mTNF α and pNO in the mTNF alpha immunization Bcl2 mice ₂Phe ⁸⁶The serum titer level of mTNF α.The RIMMS scheme comprises 17 days carries out 8 injections (per injection 5 μ g protein), and initial being injected under the condition that has CFA carried out, and remaining being injected under the condition that has IFA carried out.Measure anti-WT mTNF α (first, second roots of four pillars of each group) or pNO with ELISA ₂Phe ⁸⁶MTNF α (second, third root pillars of four pillars of each group).Before the measurement, with the PBS buffer 1: 100 or 1: 1 that contains 1%BSA, 000 dilute serum sample.

Fig. 8 has shown pNO under the condition that does not have adjuvant to exist ₂Phe ⁸⁶MTNF alpha immunization mice serum titre measurement result.This immune induction significant anti-TNF alpha titre, show that this scheme do not need under the treatment condition of strong adjuvant can be applied to.。Fig. 8 A has shown the serum titer of WT mTNF alpha immunization Bcl-2 mice, and Fig. 8 B has shown pNO ₂Phe ⁸⁶The titre of mTNF alpha immunization mice.Followingly carry out immunity: under the condition that does not have CFA or IFA to exist, carried out 8 injections (per injection 5 μ g protein) in 17 days.Measure anti-WT mTNF α (the left side post of every coupled columns) or pNO with ELISA ₂Phe ⁸⁶MTNF α (the right side post of every coupled columns).Before the measurement, with 1: the 1000 dilute serum sample of PBS buffer that contains 1%BSA.

In order to verify that immunne response is the result of immunogenicity nitro aryl in the alpha-non-natural amino acid, produce Tyr ⁸⁶→ Phe muton mTNF α (Phe ⁸⁶MTNF α) and exist or lack under the condition of CFA/IFA with this muton Bcl2 mice.Fig. 9 provides under the condition that has or not adjuvant to exist and has used Phe ⁸⁶Anti-wt mTNF α and the Phe of mTNF alpha immunization Bcl2 mice ⁸⁶MTNF α serum titer is measured.Exist or do not exist under the condition of adjuvant all not produce significant anti-TNF alpha titre, show NO ₂Be that to break immunologic tolerance needed.

For mice immunized under the no adjuvant condition, the RIMMS scheme comprises 17 days 8 times injections (per injection 5 μ g protein).To with the adjuvant existence condition under mice immunized, CFA as first the injection, IFA is used to remain 7 injections.Measure anti-WT mTNF α (first, second roots of four pillars of each group) or Phe with ELISA ⁸⁶MTNF α (second, third root pillars of four pillars of each group).Before the measurement, with the PBS buffer 1: 100 or 1: 1 that contains 1%BSA, 000 dilute serum sample.

Figure 10 shows that the immunogenicity of determining other surface site of TNF α determines result of experiment; Figure 10 A has shown and has used pNO ₂Phe ⁴²MTNF α or Phe ⁴²MTNF alpha immunization C57BL/6 mouse anti WT mTNF α, pNO ₂Phe ⁴²MTNF α and Phe ⁴²The serum titer of mTNF α.Shown among Figure 10 B and used pNO ₂Phe ¹¹MTNF α or WT mTNF alpha immunization C57BL/6 mouse anti WT mTNF α, PBS and pNO ₂Phe ¹¹The serum titer of mTNF α.Only work as pNO ₂Phe ⁴²MTNF α induces significant anti-TNF alpha titre when carrying out immunity, use pNO ₂Phe ⁴²The mice of mTNF alpha immunization is induced significant anti-TNF alpha titre.This result shows pNO ₂Phe mutation is a quite general method of hatching specific self or exotic antigen hyperimmunity.

The RIMMS scheme is included in does not have adjuvant to carry out 8 injections (per injection 5 μ g protein) in following 17 days.ELISA measures anti-WT mTNF α (Figure 10 A, first of every group of three pillars; Figure 10 B, first of every pair of pillar), anti-pNO ₂Phe ⁴²MTNF α/pNO ₂Phe ¹¹MTNF α (Figure 10 A, Figure 10 A, second of every group of three pillars; Figure 10 B, in 7,8,9 second of every pair of pillar), or anti-Phe ⁴²MTNF α (Figure 10 A, every group of pillar the 3rd) or PBS (Figure 10 A, in 5,6 second of every pair of pillar).Before the measurement, with PBS buffer 1/100 (Figure 10 A) or 1/800 (Figure 10 B) dilute serum sample of containing 1%BSA.

In this model, the inductive septic shock of known LPS participates in generation and the release of TNF α.Next we measure in serious endotoxemia mouse model and use pNO ₂Phe ⁸⁶Can TNF alpha immunization inoculation mice make its antagonism lipopolysaccharide (LPS) stimulate (F.Niessen etc. (2008) " dendritic cell PAR-S1P3 signal transduction links together blood coagulation and inflammation " (Dendritic cell PAR-S1P3 signalling couples coagulation and inflammation) Nature 452:654-658.Can Figure 11 has shown in serious endotoxemia model improve the experimental result of mouse existence with the pNO2Phe86mTNF alpha immunization.Shown and accepted initiatively or the Kaplan-Meier survival curve of the mice of passive immunity.In Figure 11 A, will utilize pNO ₂Phe ⁸⁶The mice of mTNF α or WT mTNF alpha immunization (8 every group) is made comparisons with 7 mices accepting false immunity.Demonstration is compared with WT and is used pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).In Figure 11 B, will utilize 100 μ g from pNO ₂Phe ⁸⁶The mice (8 every group) of the IgG purification injection of mTNF α or WT immune mouse is made comparisons with the contrast of accepting saline injection.Demonstration is compared with WT and is used pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).In Figure 11 C, mice (6 every group) is accepted 100 μ L from pNO ₂Phe ⁸⁶MTNF α or WT mTNF alpha immunization mice compile serum.Compare with WT and to use pNO ₂Phe ⁸⁶The survival advantage of the mice of mTNF alpha immunization (p＜0.01).Shown WT.

Figure 12 provides and has been derived from pNO ₂Phe ⁸⁶The MS/MS of the 8 polyprotein enzymatic fragments of mTNF α analyzes.Contain pNO with single-letter for buying expression ₂Phe proteolysis fragments sequence (X=pNO ₂Phe).The ion fragment that has shown observed y and b series.Proof pNO ₂Crucial y and b ion that Phe mixes are b ₅, b ₆, b ₇, y ₇, y ₆, y ₅And y ₄All quality are reported with single isotopic mass.MS/MS analyzes with 86 residues and mixes pNO ₂The pattern of Phe is accurately mated.

Clinical application especially needs the long-term persistence of serum antibody, because the therapy defective is that after immunity stops the autoantibody titre reduces rapidly at present.Figure 14 has shown the experimental result of definite anti-TNF alpha immunne response serum titer persistence.Use pNO ₂Phe ⁸⁶Three Bcl-2 transgenic mices of mTNF alpha immunization.After order is carried out 8 immunity, get blood at the appointed time and carry out anti-pNO ₂Phe ⁸⁶The elisa assay of mTNF α.Before each the measurement, with 1: the 100 dilute serum sample of PBS buffer that contains 1%BSA.The corresponding last immunity of T and get time span between the blood.First of every group of 6 posts is before getting blood, and second is t=1 week, and the 3rd is t=8 week, and the 4th is t=12 week, and the 5th is t=16 week, and the six roots of sensation is t=19 week.

Figure 15 has shown T cell proliferation experiment result.Figure 15 A has shown use by oneself WT mTNF α, pNO ₂Phe ⁸⁶MTNF α and Phe ⁸⁶The CD4 of the Bcl-2 transgenic mice of mTNF alpha immunization ⁺The T cell is at the pNO of external use gradient dilution ₂Phe ⁸⁶MTNF α stimulates.Figure 15 B has shown use by oneself WT mTNF α, pNO ₂Phe ⁸⁶MTNF α and Phe ⁸⁶The CD4 of the Bcl-2 transgenic mice of mTNF alpha immunization ⁺The T cell stimulates at the WT of external use gradient dilution mTNF α.PNO ₂Phe ⁸⁶MTNF alpha specific CD ₄ ⁺The T cell only produces with this mutein immune mouse the time, and is using WT mTNF α or Phe ⁸⁶Then do not produce during mTNF alpha immunization mice.By contrast, when stimulating from pNO at external use WT mTNF α ₂Phe ⁸⁶The CD of mTNF alpha immunization mice ₄ ⁺During the T cell, do not observe significant propagation.

Embodiment 2: the Mechanism Study that stops tolerance with the alpha-non-natural amino acid immunochemistry

The characteristic and the persistency of the polyclone IgG antibody that is produced that 2 couples of embodiment have mixed the TNF α of alpha-non-natural amino acid characterizes, for alpha-non-natural amino acid is induced (as pNO ₂Phe-induces) the generality of forfeiture of self tolerance increased new support.Embodiment 2 has shown that a plurality of surface residue independent mutations with Mus tumor necrosis factor-alpha (mTNF α) are right-Nitrobenzol alanine (pNO ₂Phe) caused the polyclone of T cell-dependence and continue anti--mTNF α IgG autoantibody and reply and continued at least 40 weeks.Embodiment shows antibodies a plurality of epi-positions on mTNF α, and the protection mice exempts from the inductive serious endotoxemia of lipopolysaccharide (LPS) stimulation.With Mus retinol binding protein matter (RBP4) pNO ₂Phe ⁴³The muton immune mouse also shows the IgG antibody response that can induce high titre, this antibody and wild type mRBP4 cross reaction.Therefore, embodiment 2 has further supported the present invention to can be used as common method relevant or other the weak immunogenic effective immunization therapy therapy of cancer that creates antagonism.

Active immunotherapy is surpassing forward position (Waldmann, the T.A. (2003) " immunotherapy: the past, present and following " (Immunotherapy:past, present and future) that all is in prophylaxis against infection diseases twoth century and makes great efforts Nat Med9:269-277).Yet the ability reduction that immune system starts to reply for the strong immunization of autoantigen makes generation difficult more at the treatment vaccine of cancer or chronic degenerative diseases.Recently, we show with the immunogenicity alpha-non-natural amino acid mix autologous protein provide the simple effective method that overcomes immunologic tolerance (referring to Grunewald, J. etc. (2008) " immunochemistry termination self-tolerance " (Immunochemical termination of self-tolerance) Proc Natl Acad Sci U S A105:11276-11280 and embodiment 1).We have characterized the characteristic and the persistence of polyclone IgG antibody response herein, and begin to establish pNO ₂The generality of the inductive self tolerance forfeiture of Phe-.With a plurality of surface residue independent mutations of Mus tumor necrosis factor-alpha (mTNF α) is right-Nitrobenzol alanine (pNO ₂Phe) caused the polyclone of T cell-dependence and continue anti--mTNF α IgG autoantibody and reply and continued at least 40 weeks.Antibodies is a plurality of epi-positions on mTNF α, and the protection mice exempts from the inductive serious endotoxemia of lipopolysaccharide (LPS) stimulation.With Mus retinol binding protein matter (RBP4) pNO ₂Phe ⁴³The muton immune mouse also shows the IgG antibody response that can induce high titre, this antibody and wild type mRBP4 cross reaction.These discoveries show that this may be to produce effectively antagonism cancer conventional method relevant or the antigenic immunotherapy of immunogenicity a little less than other.

The key of immunity identification self-non-self process is self-tolerance (Goodnow (2007) " a plurality of steps of autoimmune disease morbidity " (Multistep pathogenesis of autoimmune disease) Cell 130:25-35), wherein mammiferous immune system produces " tolerance " to avoid autoimmune disease for oneself protein, mainly is because autoreaction B-or T-cell lack or inactivation.Yet, but known many years ago induction of immunity system attack oneself protein matter.For example, can induce cross reaction immunne response (Dalum etc. (1999), " immune induction is to the therapeutic antibodies of anti-TNF alpha " (Therapeutic antibodies elicited by immunization against TNF-alpha) by in chimeric antigen, introducing external t helper cell epi-position for oneself protein matter Nat Biotechnol17:666-669, Zuany-Amorim etc. (2004) " Auto Vac TNF106 induces the generation of TNF α autoantibody: the new method of treatment anaphylactic disease " (Induction of TNF-alpha autoantibody production by AutoVac TNF 106:a novel therapeutic approach for the treatment of allergic diseases) Int Arch Allergy Immunol133:154-163) by extensive chemical derivatization (Weigle to autoantigen, W.O. (1965), " autoimmune of inducing rabbit after the homology Elityran injection of allos or change " (The Induction of Autoimmunity in Rabbits Following Injection of Heterologous or Altered Homologous Thyroglobulin) J Exp Med121:289-308), or by dna vaccination (Leitner etc. (2003), " activate inherent antiviral path based on the dna vaccination of α virus and break immunologic tolerance " (Alphavirus-based DNA vaccine breaks immunological tolerance by activating innate antiviral Pathways) Nat Med9:33-39).In addition, the specific gene and the cell mechanism of multiple participation self tolerance have been identified, destroy them and will break tolerance and autoimmune disease (Goodnow (2007), " a plurality of steps that immunological diseases take place " (Multistep pathogenesis of autoimmune disease) Cell130:25-35; Hill etc. (2008), " progress on autoimmune disease hereditism basis " (Recent acquisitions on the genetic basis of autoimmune disease) Front Biosci13:4838-4851).Although obtained these progress, but the process that designs effective immunotherapy is still slow, such as only there being minority treatment of cancer vaccine to be in (Small etc. (the 2006) " transitivity in late period of clinical development, asymptomatic, the III phase immunization therapy experiment that the placebo that uses sipuleucel-T (APC8015) to carry out among the intractable carcinoma of prostate patient of hormone is controlled " (Placebo controlled phase III trial of immunologic therapy with sipuleucel-T (APC8015) in patients with metastatic, asymptomatic hormone refractory prostate cancer) J Clin Oncol24:3089-3094; Schlom etc. (2007), " vaccine therapy of cancer: biology and put into practice " (Role of vaccine therapy in cancer:biology and practice) Curr Oncol14:238-245).

The nitro aryl has hyperimmunization originality, may be because it forms powerful piling up and the interactional ability of Van der Waals.In fact, the non-specific derivatization from the body cancer cell that contains the dinitro benzene group is used as vaccine (Berd, D. (2004) " M-Vax:an autologous, hapten-modified vaccine for human cancer " in the melanomatosis people Expert Rev Vaccines3:521-527), and the formation of 3 '-nitrotyrosine participates in the pathology of various autoimmune disease (Aulak etc. (2001), " protein group method identify in the inflammatory stimulus process in the body nitrated protein " (Proteomic method identifies proteins nitrated in vivo during inflammatory challenge) among the physiology Proc Natl Acad Sci U S A98:12056-12061; Pacher etc. (2007), " nitric oxide and peroxide nitroso-group anion and health and disease " (Nitric oxide and peroxynitrite in health and disease) Physiol Rev87:315-424; Hardy etc. (2008), " at TCR or MHC contact position tyrosine is converted into inflammation related analogs 3 '-nitrotyrosine and can fully affects cd8 t cell to the identification of the restrictive lymphocytic choriomeningitis virus glycoprotein antigen of MHC I class epi-position " (Conversion of tyrosine to the inflammation-associated analog 3 '-nitrotyrosine at either TCR-or MHC-contact positions can profoundly affect recognition of the MHC class I-restricted epitope of lymphocytic choriomeningitis virus glycoprotein 33 by CD 8T cells) J Immunol 180:5956-5962). Whether can be used for breaking tolerance for specific oneself protein matter in order to test this immunogenicity group, we at first introduce right-Nitrobenzol alanine (pNO in the single site of Mus TNF α₂Phe) residue.Use genetic method that the Tyr86 of mTNF α is substituted by pNO2Phe, having strengthened the T cell help induces at the strong cross reacting antibody of disease association oneself protein matter and replys (Grunewald, J. etc. (2008), " immunochemistry of self tolerance stops " (Immunochemical termination of self-tolerance) Proc Natl Acad Sci U S A 105:11276-11280).Herein, we show that immunochemistry breaks self tolerance and cause that lasting high titre resists to reply, and effectively protect the stimulation of mice antagonism lipopolysaccharide (LPS).And, but we show this method vague generalization to the irrelevant oneself protein matter of immunologic function, retinol binding protein matter 4 (RBP4) by name.

PNO ₂ Phe-induces the Mechanism Study of breaking self tolerance

We have shown and have used pNO before ₂Phe replaces mTNF α Tyr86 to be caused at the cross reacting antibody of the proteinic high titre of wild type (WT) and replys.The demonstration mutain can be bred by inducing T cell in immune animal, although WT protein can not be induced (Grunewald, J. etc. (2008), " immunochemistry of self tolerance stops " (Immunochemical termination of self-tolerance) Proc Natl Acad Sci U S A 105:11276-11280).For antagonism pNO is provided ₂More evidences of the immunne response that the T cell of Phe TNF α relies on, we are with anti--mice IgM or resist-and mice IgG second antibody is to carrying out mTNF α, and autoantibody carries out elisa assay.PNO ₂Phe ⁸⁶Anti-in the mTNF alpha immunization Bcl-2 mice serum-mTNF α autoantibody mainly is the IgG hypotype, shows the immunoglobulin class conversion (Figure 16 A) that T is cell-mediated.In order to determine pNO ₂Whether the existence of Phe is important for whole immunologic process, and we at first use the pNO in the complete Freund's adjuvant (CFA) ₂Phe ⁸⁶MTNF α injects 4 mices, WT mTNF α or pNO in the full Freund adjuvant (IFA) that toos many or too much for use then ₂Phe ⁸⁶MTNF α carries out 7 injections.The result of Figure 20 clearlys show, with respect to pNO ₂Phe ⁸⁶The cross reactivity that mTNF α, WT mTNF α can not keep remarkable titre resists-the mTNF Alpha antibodies.This result has supported pNO ₂The inductive self tolerance of Phe-needs this different viewpoint of t cell response of nitrobenzophenone mediation, and consistent with the research that can't induce strong immunization to reply about Tyr86Phe TNF α muton before.

A problem of inducing self tolerance to break related mechanism about pNO2Phe-is whether antibody response is at comprising pNO ₂Whether the epi-position of Phe the epi-position expansion perhaps takes place, and causes that the polyclone IgG of a plurality of epi-positions in the antagonism target proteins matter replys.In order to answer this problem, use pNO ₂Phe ⁸⁶MTNF alpha immunization Bcl-2 mice produces 50 B cell hybridomas, and these clone the antibody of the WT mTNF α that whether creates antagonism through the ELISA Screening and Identification.We test these monoclonal antibodies (mAbs) and combining that three mTNF α fragments compositions are gathered then, these fragments are passed through escherichia coli expression, molecular weight is verified (Figure 21) through MALDI TOF: N-terminal fragment (aa 1-60), interior segments (aa 61-100) and C-terminal fragment (aa 101-156).Although this experiment on a large scale the family that at the linearity (supposition is successive) B cell epitope specificity, we have identified 5 mAb (3L24,5K19,6J22,7O1, and 7F23) be incorporated into the N-terminal fragment, 1 mAb (1P19) is incorporated into C-terminal fragment (Figure 22).Be not have mAbs significantly in conjunction with original immunogenic pNO ₂Phe ⁸⁶The coding interior segments.Therefore, pass through pNO ₂Phe ⁸⁶The mTNF alpha immunization produces in conjunction with the antibody more than an epi-position, and these epi-positions need not to comprise the pNO in the immunogen ₂The Phe residue.From pNO ₂Phe ⁸⁶Polyclone IgG of mTNF alpha immunization mice and natural mTNF α cross reaction, the Kd value is at nanomole scope (Figure 16 B).In a word, these results have further supported by simply inserting pNO in oneself protein matter ₂The Phe residue produces the hypothesis at the cross reaction neutralizing antibody of oneself protein matter.

PNO2Phe induces the persistence of antibody response

In order to determine the persistence of anti--mTNF α IgG antibody titer, we use pNO ₂Phe ⁸⁶Three Bcl-2 mices of mTNF alpha immunization.After stimulating injection the last time, get blood at the appointed time with the anti-pNO of elisa assay ₂Phe ⁸⁶MTNF α.Be that antibody horizontal maintains greater than 80% initial level, 40 weeks (Figure 16 C) at least at least, puts to death mice afterwards significantly.By contrast, one based on carrying out with the mTNF α that comprises the clear lysosome t cell epitope of ovum gallinaceum in the anti-mTNF α inoculation study of immunity before, the last 4 all backs titres that stimulate descend, mTNF Alpha antibodies titre has reduced 80-87% (Dalum etc. (1999), " anti-TFN alpha immunization inductive treatment antibody " (Therapeutic antibodies elicited by immunization against TNF-alpha) Nat Biotechnol 17:666-669) after 26 weeks.Therefore, we are based on pNO ₂The vaccine scheme of Phe can effectively be induced lasting immunity and the generation long-term protection of antagonism as the TNF α of disease association autoantigen.

Sudden change is extended to other surface site of mTNF α

In order to check pNO ₂The versatility of breaking of the inductive self tolerance of Phe sports pNO with other 4 surperficial exposed residues of mTNF α ₂Phe:Lys ¹¹, Gln ²¹, Asp ⁴²And Val ⁴⁹(Figure 23 A).The structure of these residues is also different with right-Nitrobenzol alanine.Confirm pNO at SDS-PAGE and mass spectrum ₂Phe ¹¹MTNF α, pNO ₂Phe ²¹MTNF α, pNO ₂Phe ⁴²MTNF α and pNO ₂Phe ⁴⁹After the composition and homogeneity of mTNF α (Figure 23 B and table 3), the size exclusion chromatograph shows that proteinic quarternary structure is a trimer (table 4).And the experiment of NF κ B-luciferase reporter gene shows pNO ₂Phe ¹¹The mTNF alpha active be WTmTNF α 9%, pNO ₂Phe ²¹The mTNF alpha active be WT mTNF α 22%, pNO ₂Phe ⁴²The mTNF alpha active is 22% and the pNO of WT mTNF α ₂Phe ⁴⁹The mTNF alpha active is 10% (table 4 and Figure 23 C) of WT mTNF α.Therefore the pNO that characterizes before the activity of all mutons is significantly higher than ₂Phe ⁸⁶MTNF α, it only is equivalent to wild-type protein active 2% in experiment.In order to measure pNO ₂The immunogenicity of PhemTNF α muton, 14 C57BL/6 mices are divided into five groups and also inject these mutons or WT mTNF α respectively, used scheme is RIMMS (multidigit point repeats immunity) scheme (Kilpatrick etc. (1997), " using the RIMMS affine sophisticated monoclonal antibody of exploitation fast " (Rapid development of affinity matured monoclonal antibodies using RIMMS) Hybridoma16:381-389).Elisa assay shows that the mTNF alpha active in the experiment of NF κ B-luciferase reporter gene is irrelevant with the ability of inducing antibody response, has got rid of for immune direct influence.As shown in figure 17,11 pNO ₂Phe induces the IgG of the high titre of antagonism WT mTNF α to reply, with antagonism pNO ₂Phe ¹¹The mTNF alpha immunization former quite.By contrast, although also having produced antagonism, 21,42 and 49 sudden change contains pNO ₂The antigenic high titre IgG of Phe replys, but IgG antibody only produces faint cross reaction with WT mTNF α.The antibody that produces at four sudden change antibody TNF α is used for 40 C57BL/6 mices are carried out active immunity, and mice is divided into 5 groups at random, and with resisting-pNO ₂Phe or anti--WT mTNF α IgG inject.Behind the active immunity 24 hours, stimulate animal (Niessen etc. (2008), " dendritic cell PAR1-S1P3 signal path is relevant with blood coagulation and inflammation " (Dendritic cell PAR1-S1P3 signalling couples coagulation and inflammation) Nature 452:654-658) with LPS as previously mentioned.Under the LPS of lethal dose stimulated, all accepted anti--pNO ₂Phe ¹¹The mice of mTNF α IgG all survive (Figure 18) even if. accept anti--pNO of moderate cross reaction ₂Phe ²¹MTNF α IgG, anti--pNO ₂Phe ⁴²MTNF α IgG and anti--pNO ₂Phe ⁴⁹Other group of mTNF α IgG, survival rate also is at least 75%; Yet the survival rate of injecting anti--WTmTNF α IgG mice only is 13%.Therefore, use pNO ₂The ability that Phethe breaks self tolerance does not depend on the single amino acid position, because we show that at least 5 positions (comprising 86) can induce anti--neutrality cross reaction that mTNF α IgG replys in vivo.And the replacement site need not the structural similarity with right-Nitrobenzol alanine.

The ESI mass spectral analysis of table 3:mRBP4 variant

(n.d. does not detect)

The quarternary structure of table 4:mTNF α variant measures and NF-κ B-uciferase activity is analyzed

Sudden change mRBP4 protein expression and sign

Since when a plurality of positions in the mTNF α are sported pNO ₂Can break self tolerance during Phe, so we consider whether this method can be generalized to other oneself protein matter.Specifically, we have detected pNO ₂Phe breaks the ability (Zanotti etc. (2004) of another serum oneself protein matter of antagonism RBP4 model self tolerance, " the blood plasma retinol binding protein: structure and with the interaction of retinol, vitamin A and thyroxine transport protein " (Plasma retinol-binding protein:structure and interactions with retinol, retinoids, and transthyretin) Vitam Horm 69:271-295; Raghu etc. (2004), " blood plasma retinol binding protein, the interaction of thyroxine transport protein and its part: in the balance of vitamin A, the influence of thyroxine transport protein amyloidosis " (Interactions amongst plasma retinol-binding protein, transthyretin and their ligands:implications in vitamin A homeostasis and transthyretin amyloidosis) Biochim Biophys Acta 1703:1-9).Compare with TNF α, this is the monomeric protein of highly solvable a, molecular weight relatively low (20kDa).The RBP4 knock-out mice does not show the unusual (Vogel etc. (2002) of phenotype except visual impairment, " retinol binding protein deficient mice: visually impaired biochemical basis " (Retinol-binding protein-deficient mice:biochemical basis for impaired vision) Biochemistry 41:15360-15368), show that mice can survive at self RBP4 and in the immunne response.X-ray crystal structure (Cowan etc. (1990) based on people's monomer RBP4, " with 2A resolution crystal refinement Retinol Binding Protein from Human Serum " (Crystallographic refinement of human serum retinol binding protein at 2A resolution) Proteins 8:44-61), we select to sport pNO as the lower surface exposed residue ₂Phe:Tyr ⁴³And Tyr ¹⁰⁸(Figure 24).These residues are conservative at the mammiferous RBP4 camber of difference, comprise Mus RBP4 (mRBP4).These mRBP4 mutons and WT mRBP4 are expressed with the terminal His6-label protein of N-matter in escherichia coli, under the degeneration condition, use Ni2+ affinity chromatography purification, and carry out again folding (Greene etc. (2001) according to the previous experiments scheme, " the role of conserved residues in structure and stability: the tryptophan of Retinol Binding Protein from Human Serum, lipocalin protein superfamily model " (Role of conserved residues in structure and stability:tryptophans of human serum retinol-binding protein, a model for the lipocalin superfamily) Protein Sci 10:2301-2316).SDS-PAGE analyzes and to containing the Trypsin enzymolysis MS/MS fragmentation of alpha-non-natural amino acid, has confirmed pNO ₂43 and 108 sites (Figure 24,25 and 27) that the Phe fixed point is mixed mRBP4.Analytical type size exclusion chromatograph shows that all mRBP4 protein are monomer structure, this and the quarternary structure consistent (table 5) (Cowan etc. (1990), " with 2A resolution crystal refinement Retinol Binding Protein from Human Serum " (Crystallographic refinement of human serum retinol binding protein at 2A resolution) Proteins 8:44-61) of the people RBP4 that has delivered.And, replace experiment, all pNO according to retinol ₂The bonded Kd value of PhemRBP4 muton and retinol is in the nanomole scope, this and WT mRBP4 very consistent (table 5).

Table 5:mRBP4 quaternary structure of protein is measured and the retinol binding affinity

With the mapping of the retention time on the relative Superdex 75 10/300GL posts of the logarithm value of protein standard substance molecular weight, determine pNO ₂Phe ⁴³MRBP4, pNO ₂Phe ¹⁰⁸The quarternary structure of mRBP4 and WT mRBP4.Determine mRBP4 combination of proteins affinity with the TR-FRET retinol in conjunction with experiment.

PNO ₂ Phe-induces the versatility of breaking self tolerance

In order to detect pNO ₂The immunogenicity of Phe mRBP4 muton is divided into 4 groups at random with 12 Bcl2 mices, according to RIMMS scheme pNO ₂Phe ⁴³MRBP4, pNO ₂Phe ¹⁰⁸MRBP4 and WT mRBP4 injection.(referring to (1997) such as Kilpatrick, " using the RIMMS affine ripe monoclonal antibody of exploitation fast " (Rapid development of affinity matured monoclonal antibodies using RIMMS) Hybridoma 16:381-389).According to elisa assay, with WT mRBP4 or pNO ₂Phe ¹⁰⁸The do not create antagonism remarkable serum IgG titre (Figure 19 A) of WT mRBP4 of mRBP4 mice immunized.By contrast, use pNO ₂Phe ⁴³The mRBP4 mice immunized shows significantly high serum IgG titre (until 1: 100,000), with pNO ₂Phe ⁴³MRBP4 immunogen and wild-type protein all produce combination.Use the C57BL/6 mice to obtain analog result (Figure 26).And, according to using pNO before ₂Phe ⁸⁶PNO is used in the observation of mTNF α ₂Phe ⁴³MRBP4 protein carries out immune induction pNO ₂Phe ⁴³MRBP4 specific C D4 ⁺The T cell shows the immunne response (Figure 19 B) of mature T cells-dependence.In a word, these results have further supported to introduce pNO in protein sequence ₂Phe creates strong t cell epitope, thereby initial persistence is intersected the hypothesis of reflection IgG antibody response.Be not that all sites all cause strong cross reactivity immunne response, this is not astonishing, because can not all corresponding potential t cell epitope of all sites.

We introduce pNO with genetic method at demonstration ₂Phe causes lasting antagonism oneself protein matter mTNF α and the IgG antibody response of mRBP4.The mechanism aspect mixes in single site that right-nitrobenzophenone obtains being stimulated by the pNO2Phe muton and the T cell that can not be stimulated by WT albumen.This pNO ₂The inductive T cell of Phe relies on replys the activation that finally causes self-activation B cell and the polyclonal antibody of generation and the cross reaction of natural oneself protein matter height.These results and the research that recently can strengthen t cell response about post translational modification protein be comparability (Cantaert etc. (2006), " citrulline albumen is at rheumatoid arthritis: key ... but not enough! " (Citrullinated proteins in rheumatoid arthritis:crucial ... but not sufficient! ) Arthritis Rheum 54:3381-3389; Backlund etc., (2002) " the saccharifying antigen of selection advantage T cell-specific type in humanized transgenic mice and the rheumatoid arthritis, (263-270) ", (Predominant selection of T cells specific for the glycosylated collagen type II epitope, (263-270) in humanized transgenic mice and in rheumatoid arthritis) Proc Natl Acad Sci U S A 99:9960-9965; Dzhambazov etc. (2005), " the main t cell epitope on the II collagen type in normal cartilage by glycosylation, but in rat and human arthritis, modified " (The major T cell epitope on type II collagen is glycosylated in normal cartilage but modified by arthritis in both rats and humans) Eur J Immunol 35:357-366).For example, citrullineization and glycosylation be post translational modification related in the T cell dependency autoimmune disease (Cantaert etc. (2006), " citrulline albumen is at rheumatoid arthritis: key ... but not enough! " (Citrullinated proteins in rheumatoid arthritis:crucial ... but not sufficient! ) Arthritis Rheum 54:3381-3389; Backlund etc., (2002) " the saccharifying antigen of selection advantage T cell-specific type in humanized transgenic mice and the rheumatoid arthritis, (263-270) ", (Predominant selection of T cells specific for the glycosylated collagen type II epitope, (263-270) in humanized transgenic mice and in rheumatoid arthritis) Proc Natl Acad Sci U S A 99:9960-9965; Dzhambazov etc. (2005), " the main t cell epitope on the II collagen type in normal cartilage by glycosylation, but in rat and human arthritis, modified " (The major T cell epitope on type II collagen is glycosylated in normal cartilage but modified by arthritis in both rats and humans) Eur J Immunol 35:357-366).357-366; Zhang etc. (2008), " in the rheumatoid arthritis to the proteic immunity of citrullineization " (Immunity to citrullinated proteins in rheumatoid arthritis) Annu Rev Immunol 26:651-675; Sollid, L.M. (2000), " molecular basis of celiac disease " (Molecular basis of celiac disease) Annu Rev Immunol 18:53-81).Similar, the dinitrofluorobenzene of dermatogen is modified as the t cell response model of allergy contact and has been used many decades (Toews etc. (1980) " whether the decision of epidermis youth Ge Hansi cell density vomits contact allergy or bradykinesia after dyeing with DNFB skin " (Epidermal Langerhans cell density determines whether contact hypersensitivity or unresponsiveness follows skin painting with DNFB) J Immunol 124:445-453).Therefore with pNO ₂Phe fixed point is mixed oneself protein matter and has been set up a simple model system by behind the biochemical method mock translation or the self tolerance forfeiture of chemistry mediation.Therefore this method helps also to understand how immune system produces immunne response to chemical modification antigen in self-immunprocess.And, pNO ₂The inductive self tolerance of Phe break not only effective ways as the neutralizing antibody of the rational oneself protein matter of cancer or degenerative disease related diseases that creates antagonism, also can be applicable to the weak immunity exotic antigen of infectious agent.

Bacterial isolates and reagent

Escherichia coli XL1-Blue and XL10-Gold are as cloning host, and e. coli bl21 (DE3) is as expression strain.Restriction Enzyme, T4 dna ligase, dNTP and Xa factor protease available from NEB (masschusetts, u.s.a is than Buddhist profit) (Beverly, MA, USA).Primer is available from dna integration technology company (Integrated DNA Technologies) (Colville, Iowa,U.S.A state).Use PureLink ^TMThe Quick plasmid is taken out test kit (Ying Jun company) preparation plasmid DNA for a short time, uses PureLink ^TMThe miniature test kit of PCR (Ying Jun company) carries out the postdigestive DNA purification of restriction endonuclease.

Contain pNO ₂ The production of the mTNF α of Phe and WT mTNF α

Produce WT mTNF α and pNO as previously mentioned ₂Phe mTNF α muton (Grunewald, J etc. (2008), " immunochemistry of self tolerance stops " (Immunochemical termination of self-tolerance) Proc Natl Acad Sci U S A 105:11276-11280).Simply say, use Standard PC R mutation step to introduce the TAG amber codon, thereby with pNO ₂The Phe fixed point is mixed Mus TNF α gene.In order to express pNO ₂Phe mTNF α muton is used mutNO ₂PheRS, mutRNA _CUAThe common transformed into escherichia coli BL21 of mTNF α gene (DE3) cell with sudden change.Transformant is incubated at for 37 ℃ and contains 1mMpNO ₂Phe (Alpha's Amado Azar company, mountain, Ward, Massachusetts) (Alfa Aesar, Ward Hill, MA), in 1% glycerol and the leucic minimal medium of 0.3mM (GMML culture medium), add 1mM IPTG and start protein expression.Do not containing pNO ₂Express WT mTNF α in the 2x YT culture medium of Phe.Under natural or degeneration condition, by curing metal affinity chromatography (IMAC) and size exclusion chromatograph (SEC) purifying protein.With MALDI-TOF or ESI mass spectrum all albumen are characterized.In the trypsin glue nitrated and to MS/MS fragment China of the enzymatic fragment separately that comprises alpha-non-natural amino acid also inflammation pNO ₂Phe successfully mixes mutein.(CA) gauged Superdex 75 10/300GL gels infiltrate on the post, by the quarternary structure of analytical type SEC analysing protein for Bio-Rad Labs, Hercules to infiltrate molecular weight standard product (having dialled laboratory, Ai Kulaisi, California) at Bole's gel.Use the HEK293 cell of stably express NF κ B-luciferase as previously mentioned, determine pNO by the experiment of NF κ B-luciferase reporter gene ₂Activity (the Grunewald of Phe mTNF α muton, J etc. (2008), " immunochemistry of self tolerance stops " (Immunochemical termination of self-tolerance) Proc Natl Acad Sci U S A 105:11276-11280).

Make up mRBP4 expression vector pSpeedET-mRBP4

Use the incomplete primer of polymerase to extend the special primer of (PIPE) PCR cloning PCR; By pcr amplification mouse RBP4 code cDNA (aa 19-201) (research foundation Joint Genome Institute of Novartis) (Genomics Institute of the Novartis Research Foundation) (Klock etc. (2008), " the incomplete primer extension combined miniature screening of the polymerase accelerating structure genome research that is used for clone and mutagenesis " (Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts) Proteins 71:982-994): 5 '-CTGTACTTCCAGGGCGAGCGCGACTGCAGGG (5 ' insertion forward primer) and 5 '-CAAACTGTTTCTGGAGGGCC (3 ' inserts reverse primer).Use 5 ' carrier reverse primer 5 '- GCCCTGGAAGTACAGGTTTTCGTGATGATGATGATGATG and 3 ' carrier forward primer 5 '-

AACTCGTTTAAACGGTCTCCAGC.Underscore represents to take place between primer annealed two different complementary regions with the italic base.The terminal His6-sequence label (MGSDKIHHHHHH) of the additional N-of pSpeedET carrier, the back is with TEV protease site (ENLYFQG), and the back is right after the 19th codon of mRBP4.Unpurified mRBP4 (aa 19-201) insert PCR product mixes with unpurified pSpeedET carrier PCR product 1: 1 (v/v).After the mixing, transform the XL10-Gold cell with 2 μ L reactant mixtures.By the codon mutation with Tyr43 or Tyr108 is the TAG amber codon, with pNO ₂The Phe fixed point is mixed mRBP4 (aa 19-201).Confirm the sequence of all pSpeedET-mRBP4 constructions by dna sequence analysis.

The protein expression of pNO2Phe mRBP4 and WT mRBP4 and purification

In order to express pNOPhe mRBP4 muton, use mutNO ₂PheRS, mutRNA _CUAThe common transformed into escherichia coli BL21 of mRBP4 gene (DE3) cell with sudden change.The conversion bacterial strain grows in 37 ℃ and contains 1mM pNO ₂In the GMML culture medium of Phe, work as OD ₆₀₀Arrive at 0.5 o'clock, induce, and after 12-16 hour, collect with 0.2% (w/v) arabinose.With respect to pNO ₂Phe mRBP4 muton, WT mRBP4 is not containing pNO ₂Cultivated 3 hours in the 2x YT culture medium of Phe.Cell mass is resuspended in contains NaH ₂PO ₄, in the 8M carbamide of 10mM Tris (pH 8.0), and ultrasonic degradation on ice 3 minutes.40,000x g removed cell debris in centrifugal 25 minutes.In supernatant, add in the 5ml 50%Ni-NTA mud (Nova base company, state of Wisconsin Madison), vibrate 60 minutes soft mixing.Use 8M carbamide, 100mM NaH ₂PO ₄And 10mM Tris (pH 6.3) washing Ni-NTA pearl.With containing 100mM NaH ₂PO ₄And the 8M carbamide of 10mM Tris (pH 4.5) carries out eluting.Hold back Amicon Ultra-15 centrifugal filter device with the 10L molecular weight and carry out albumen concentrated (Mi Libo, Bedford, Massachusetts, the U.S.).Phosphate-buffered saline (PBS, pH 7.4) is dialysed and is precipitated mRBP4 protein relatively, and dissolves with the 8M carbamide that contains 20mM Tris and 20mM dithiothreitol, DTT (pH 8.0).According to (2001) such as Greene, " the role of conserved residues in structure and stability: the tryptophan of Retinol Binding Protein from Human Serum, lipocalin protein superfamily model " (Role of conserved residues in structure and stability:tryptophans of human serum retinol-binding protein, a model for the lipocalin superfamily) Protein Sci 10:2301-2316) the described mRBP4 aleuroplast that carries out is folding more outward.Simply say, the degeneration material is added 8M carbamide produce native protein, dropwise join in the folding buffer that contains 20mM Tris, 10mM beta-mercaptoethanol, 1mM 2,2 '-two sulfur diethanol and 1% glycerol (pH 8.5) with～30 droplets/minute speed then.Be folded in 4 ℃ and carry out 16h, hold back Amicon Ultra-15 centrifugal filter device with the 10L molecular weight and carry out protein solution concentrated (Mi Libo).Flow velocity (GE health care company, New Jersey Piscataway) on the equilibrated Superdex 7510/300GL post of PBS (pH 7.4) with 0.3ml/min is further purified albumen by SEC.

The mouse model of serious systemic inflammatory

All experiments are all carried out according to NIH's animal protection guide (National Institutes of Health Animal Protection Guidelines), and through Si Kelipu academy's animal care and the approval of use committee.All zooperies are all in that day alternates with night in 12 hours is indoor, carry out (Niessen etc. (2008), " dendritic cell PAR1-S1P3 signal path is relevant with blood coagulation and inflammation " (Dendritic cell PARl-S1P3 signalling couples coagulation and inflammation) Nature 452:654-658) under the steady-state conditions (temperature 20-22 ℃ and relative humidity 40-60%).LPS stimulated preceding 24 hours, with purification from pNO ₂Phe ¹¹MTNF α, pNO ₂Phe ²¹MTNF α, pNO ₂Phe ⁴²MTNF α and pNO ₂Phe ⁴⁹The IgG of mTNF alpha immunization mice serum is injected into abdominal cavity, 9 week male C57BL/6 mices in age (Jackson Lab, Ba Er Haber, the Maine State) left side with 4mg/kg and carries out active immunity, from the IgG of non-immune wild-type mice as negative control.With 7.5mg/kg lipopolysaccharide (LPS, escherichia coli O111:B4 Ka Er biochemistry/EMD Biological Science Co., Ltd, the La Jolla, California) (LPS, E.coli O111:B4 Calbiochem/EMD Biosciences, La Jolla, CA) abdominal cavity, right side of injection 2% isoflurane anesthesia mice.Make the Kaplan-Meier curve and add up, and proofread and correct (Bonferroni correction) with logarithm rank tests Jia Bangfeiluoni and analyze survival difference.

ELISA

(NY) 4 ℃ are spent the night for Nunc, Rochester by height absorption 384-orifice plate (Lang Ke company, New Jersey Rochester) with 30 μ l, 0.5 μ g/ml protein bag.After PBS+0.05% polysorbas20 (PBST) washing, the PBS sealing that contains 1%BSA with 80 μ l is also washed with PBST once more.Successively with plate and 20 μ l first antibodies or with the serum of the PBS dilution that contains 1%BSA, the link coupled goat anti-mouse IgG of 20 μ l HRP-(Jackson's immune Research laboratory, Xi Geluowei, Pennsylvania) (Jackson ImmunoResearch Laboratories, West Grove, PA) and 20 μ l tmb substrate (KPL, the Gaithersburg, the Maryland State) (KPL, Gaithersburg, MD) hatch, and measure the 650nm absorption.Wash plate at least 6 times with PBST between hatching.

The T cell proliferation experiment

(magnetic consumption CA) is from the lymph node separation of C D4 of the C57BL/6 mice of immunity for Miltenyi Biotec, Auburn by using MACS pearl (beautiful day Ni biotech company, Ao Ben, California) ⁺The T cell.Then the T cell being placed the antigen that increases progressively with radiating splenocyte and quantity from natural C57BL/6 mice cultivates.After hatching 48 hours, with ³The H-thymidine is hatched overnight incubation.Collect culture plate and place on the filter paper pads, and with TopCount scintillation counter (Perkinelmer Inc..Boston, the Massachusetts) ((PerkinElmer, Boston MA) carry out quantitatively.

Mus RBP4 activity experiment

Instruct according to manufacturer, (IL is USA) with biotin labeling WT and pNO for Pierce, Rockford to use N-hydroxy thiosuccinimide-biotin test kit (Pierre Si company, Rockford, the Illinois State U.S.) ₂Phe mRBP4 mutein.In order to measure retinol in conjunction with activity, the RBP4 of 10nM biotin-labelling and 1nM Streptavidin europium chelate (LANCE

Eu-W8044 strepto-affinity element, Perkinelmer Inc., Foster city, California) (Perkin Elmer, Foster City CA) mix.The retinol of the Cy5-labelling that concentration is increased adds reaction, shifts (TR-FRET) by the homogeneous phase time discrimination fluorescence resonance energy and measures the retinol combination.

Immunity also produces monoclonal antibody (mAb)

The WT of purification or pNO ₂Phe mTNF α produces anti--mTNF Alpha antibodies as immunogen.Use RIMMS scheme immunity Bcl-2 transgenic mice (C57BL/6-TgN (BCL2) 22Wehi) or C57BL/6 mice.(referring to (1997) such as Kilpatrick, " using the RIMMS affine ripe monoclonal antibody of exploitation fast " (Rapid development of affinity matured monoclonal antibodies using RIMMS) Hybridoma 16:381-389).The Bcl-2 transgenic mice shows the B cells survival and prolongs and the folliculus lymphocytic hyperplasia, makes it especially be fit to immunity.Simply say 18 days mice is carried out 8 injections.In the per injection, contain the proteinic 200 μ l PBS of 5 μ g and mix (as injection first) with complete Freund's adjuvant (CFA) at 1: 1, or mix (injection that is used to be left) at 1: 1 with incomplete Freund's adjuvant (IFA).Around all 6 the characteristic sites of periphery lymph node (PLN), carry out the immunogen injection.Carrying out injection same day the 8th time, collect test blood, use the elisa assay serum antibody titer.Collection and separation are from the PLN of high serum titer mice.With 50%PEG 1500 isolating lymphocyte and F0 murine myeloma cell are merged.With the cell seeding that merges in 384-hole tissue culturing plate.In hypoxanthine aminopterin thymidine (HAT) culture medium, select hybridoma, and screen anti-WT mTNF α with ELISA.

Result's explanation shown in embodiment 2 relevant drawings.

Figure 16 has shown mensuration pNO ₂Phe ⁸⁶Whether the mTNF alpha immunization promotes that type conversion is that IgG replys.IgG replys with WT mTNF α and produces remarkable cross reactivity in the demonstration mice, and continues at least 40 weeks.Figure 16 A exists in 17 days that remain injection in the initial injection that has complete Freund's adjuvant (CFA) and at incomplete Freund's adjuvant (IFA) and to measure pNO ₂Phe ⁸⁶The serum titer of the Bcl-2 mice of mTNF α or WT mTNF alpha immunization.As second antibody, measure anti-WTmTNF α with anti-mice IgM (first and second posts of each group of four posts) or anti-mice IgG (third and fourth post of each group of four posts) by ELISA.Before the measurement, with PBS buffer 1/100 (first and the 3rd post) or 1/1,000 (second and the 4th post) dilute serum sample of containing 1%BSA.Figure 16 B has shown the ELISA titration results, with polyclone anti--WT mTNF α IgG (inverted triangle) and polyclone resist-pNO ₂Phe ⁸⁶MTNF α IgG (diamond) is to pNO ₂Phe ⁸⁶The affinity of mTNF α or WT mTNF α quantizes.Figure 16 C has shown pNO ₂Phe ⁸⁶The persistence of serum titer in three Bcl-2 mices of mTNF alpha immunization.Order pNO ₂Phe ⁸⁶After mTNF α carries out 8 immunity, get blood at the appointed time and carry out anti-pNO 20 times ₂Phe ⁸⁶Elisa assay (the corresponding last immunity of t and get time between the blood).Before each the measurement, with 1: the 100 dilute serum sample of PBS buffer that contains 1%BSA.First of every group of 7 posts is before getting blood, and second is t=19 week, and the 3rd is t=23 week, and the 4th is t=28 week, and the 5th is t=32 week, and the six roots of sensation is t=36 week, and the 7th is t=40 week.

Other mTNF α surface exposed sites also has significant immunogenicity.In Figure 17 A, shown pNO ₂Phe ¹¹Anti-WT mTNF α (one on the left side of every coupled columns) in mTNF α or the WT mTNF alpha immunization C57BL/6 mice, pNO ₂Phe ¹¹The serum titer of mTNF α (one on the right of the 3rd, 4,5 coupled columns) and PBS (one on the right of 1,2 coupled columns).In Figure 17 B, shown pNO ₂Phe ²¹Anti-WT mTNF α (one on the left side of every coupled columns) in mTNF α or the WTmTNF alpha immunization C57BL/6 mice, pNO ₂Phe ²¹The serum titer of mTNF α (one on the right of the 6th, 7,8 coupled columns) and PBS (one on the right of 1,2 coupled columns).In Figure 17 C, shown pNO ₂Phe ⁴²Anti-WT mTNF α (one on the left side of every coupled columns) in mTNF α or the WT mTNF alpha immunization C57BL/6 mice, pNO ₂Phe ⁴²The serum titer of mTNF α (one on the right of the 9th, 10,11 coupled columns) and PBS (one of the mutation of 1,2 coupled columns).In Figure 17 D, shown pNO ₂Phe ⁴⁹Anti-WT mTNF α (one on the left side of every coupled columns) in mTNF α or the WT mTNF alpha immunization C57BL/6 mice, pNO ₂Phe ⁴⁹The serum titer of mTNF α (one on the right of the 12nd, 13,14 coupled columns) and PBS (one of the mutation of 1,2 coupled columns).Use the PBS buffer dilute serum sample (17A) 1/800 that contains 1%BSA before each the measurement; (17B) 1/200; (17C) 1/200; Or (17D) 1/200.

The result shows 11 pNO ₂Phe induces the IgG of the high titre of antagonism WT mTNF α to reply, with antagonism pNO ₂Phe ¹¹The mTNF alpha immunization former quite.By contrast, although also having produced antagonism, 21,42 and 49 sudden change contains pNO ₂The antigenic high titre IgG of Phe replys, but IgG antibody only produces faint cross reaction with WTmTNF α.

Figure 18 has shown that lipopolysaccharide (LPS) stimulates the various pNO in back ₂Phe mTNF α muton immune mouse is survived benefited significantly.In Figure 18 A, LPS stimulates the previous day, uses from pNO ₂Phe ¹¹MTNF α and pNO ₂Phe ⁴⁹The IgG purification 4mg/kg of mTNF alpha immunization mice carries out peritoneal injection to male C57BL/6 mice.In Figure 18 B, LPS stimulates the previous day, uses from pNO ₂Phe ²¹MTNF α and pNO ₂Phe ⁴²The IgG purification 4mg/kg of mTNF alpha immunization mice carries out peritoneal injection to mice.The mice that these mices are injected contrast IgG relatively carries out Kaplan-Meier survival curve mapping (n=8 group).Logarithm rank tests Jia Bangfeiluoni proofreaies and correct (Bonferroni correction) and analyzes as can be known, and each modifies survival advantage relative comparison group p＜0.01 of TNF mice immunized.

Under the LPS of lethal dose stimulated, all accepted anti--pNO ₂Phe ¹¹The mice of mTNF α IgG all survives.Even if accept the anti--pNO of moderate cross reaction ₂Phe ²¹MTNF α IgG, anti--pNO ₂Phe ⁴²MTNF α IgG and anti--pNO ₂Phe ⁴⁹Other group of mTNF α IgG, survival rate also is at least 75%; Yet the survival rate of injecting anti--WT mTNF α IgG mice only is 13%.Therefore, use pNO ₂The ability that Phe breaks self tolerance does not depend on the single amino acid position.

Figure 19 has shown the tolerance of forfeiture to second kind of autoantigen mRBP4.Shown with WT mRBP4 (19A), pNO ₂Phe ⁴³MRBP4 (19B), pNO ₂Phe ¹⁰⁸The serum titer of the immune Bcl-2 mice of mRBP4 (19C).ELISA measures the anti-WT mRBP4 (single-column in 1,2,3,7,8 and 9; The left side post of 5,6 each coupled columns) and pNO 4, ₂Phe ⁴³MRBP4 (the right side posts of 4,5,6 each coupled columns).Before the measurement, with 1: the 1000 dilute serum sample of PBS buffer that contains 1%BSA.Figure 19 B has shown from pNO ₂Phe ⁴³The CD4 of the C57BL/6 mice of mRBP4 immunity ⁺The T cell is at the pNO of external use gradient dilution ₂Phe ⁴³Propagation when mRBP4 stimulates.

According to elisa assay among Figure 19 A, with WT mRBP4 or pNO ₂Phe ¹⁰⁸The do not create antagonism remarkable serum IgG titre of WT mRBP4 of mRBP4 mice immunized.By contrast, use pNO ₂Phe ⁴³The mRBP4 mice immunized shows significantly high serum IgG titre (until 1: 100,000), with pNO ₂Phe ⁴³MRBP4 immunogen and wild-type protein all produce combination.

Figure 20 has shown that WT mTNF α can not keep pNO ₂Phe ⁸⁶MTNF α, the inducing tolerance forfeiture.According to the RIMMS scheme, with WT mTNF α (20A), pNO ₂Phe ⁸⁶MTNF α (20B) and pNO ₂Phe ⁸⁶The mTNF alpha immunization, the back is with the serum titer of the Bcl-2 mice of mTNF α (20C) immunity.For (20C), the pNO among the CFA is once used in the immunity design ₂Phe ⁸⁶MTNF α injection, and the follow-up injection of WT mTNF α among 7 IFA.Before ELISA measures, with 1: the 1000 dilute serum sample of PBS buffer that contains 1%BSA.Measure anti-WT mTNF α (the left side post of every coupled columns) or pNO with ELISA ₂Phe ⁸⁶MTNF α (the right side post of every coupled columns).With respect to pNO ₂Phe ⁸⁶The titre of mTNF α, WT mTNF α can not keep cross reactivity anti--mTNF Alpha antibodies.This result has supported pNO ₂The breaking of the inductive self tolerance of Phe needs this viewpoint of t cell response of nitrobenzophenone mediation.

Figure 21 has shown three segmental mass spectral analyses of mTNF α.Figure 21 A has shown the MALDI-TOF mass spectral analysis of the N-terminal fragment (aa 1-60) of mTNF α; Calculate molecular weight 7776.51.Figure 21 B has shown the MALDI-TOF mass spectral analysis of the interior segments (aa 61-100) of mTNF α; Calculate molecular weight 5597.36.Figure 21 C has shown the MALDI-TOF mass spectral analysis of the C-terminal fragment (aa 101-156) of mTNF α; Calculate molecular weight 7388.18.The peak of each plate has confirmed that each TNFa fragment is the expection molecular weight among Figure 21.

Antagonism-mTNF α mAb measures with three segmental combinations of mTNF α.Among Figure 22, ELISA measures anti-WT mTNF α aa 1-156 (every group of four posts first) or WT mTNF α aa 1-60 (every group of four posts second), WT mTNF α aa 61-100 (every group of four posts the 3rd) and WT mTNF α aa 101-156 (every group of four posts the 4th).From pNO ₂Phe ⁸⁶Produce 50 hybridomas of secreting anti--mTNF α IgG in the mice of mTNF alpha immunization.Three fragments from expression in escherichia coli and purification mTNF α: N-terminal fragment (aa 1-60), interior segments (aa 61-100) and C-terminal fragment (aa 101-156).Attention: the 86th (interior segments) coding pNO in the original antigen ₂Phe.With each fragment of elisa assay, and use WT mTNF α in contrast.Indicate with the bonded antibody of fragment: square, N-terminal fragment; Asterisk, the C-terminal fragment).Only there are 6 mAb can obviously discern a fragment.A mAb (6G17) discerns all three fragments, perhaps may represent the non-specific binding activity.It should be noted that the linear epitope that does not have to discern corresponding intermediate segment among 50 mAb, this zone comprises the pNO among the mutation T NF α ₂Phe.

Figure 23 has shown that affirmation is with pNO ₂Phe dopes the experimental result of the surperficial exposed sites of mTNF α.Figure 23 A provides mTNF α trimerical X-ray crystal structure, indicates Lys ¹¹, Gln ²¹, Asp ⁴², Val ⁴⁹And Tyr ⁸⁶(PDB ID encode 2TNF) ³⁰Referring to (1999) such as Baeyens, " structure of 1.4A resolution mouse tumor necrosin ﹠: modify its selectivity and trimerizing " (The structure of mouse tumour-necrosis factor at 1.4A resolution:towards modulation of its selectivity and trimerization) Acta Crystallogr D Biol Crystallogr 55:772-8.Figure 23 B has shown pNO ₂Phe ¹¹MTNF α (the 1st swimming lane), pNO ₂Phe ¹⁹MTNF α (the 2nd swimming lane), pNO ₂Phe ²¹MTNF α (the 3rd swimming lane), pNO ₂Phe ⁴²MTNF α (the 4th swimming lane), pNO ₂Phe ⁴⁹The SDS-PAGE gel analysis of mTNF α (the 5th swimming lane) and WT mTNF α (the 6th swimming lane).With Ni-NTA affinity chromatography purifying protein quality sample, under natural endowment, analyze with SDS-PAGE and coomassie G-250 dyeing.Figure 23 C provides WT mTNF α (blockage), pNO ₂Phe ¹¹MTNF α (triangle), pNO ₂Phe ²¹MTNF α (hollow diamond), pNO ₂Phe ⁴²MTNF α (solid diamond), pNO ₂Phe ⁴⁹MTNF α (circle) and pNO ₂Phe ⁸⁶The NF-κ B-uciferase activity analysis result of mTNF α (big square).Therefore the pNO that characterizes before the activity of all mutons is significantly higher than ₂Phe ⁸⁶MTNF α, it only is equivalent to wild-type protein active 2% in experiment.

Figure 24 has shown that affirmation is with pNO ₂The Phe fixed point dopes the experimental result of the exposed sites of mRBP4.Figure 24 A provides the X-ray crystal structure diagram of people RBP4, indicates Tyr ⁴³And Tyr ¹⁰⁸(PDB ID encode 1RBP) ²¹Referring to (1990) such as Cowan, " with 2A resolution crystal refinement Retinol Binding Protein from Human Serum " (Crystallographic refinement of human serum retinol binding protein at 2A resolution) Proteins 8:44-61).The retinol cofactor is represented with yellow.Figure 24 B has shown after Ni-NTA affinity chromatography and the size exclusion chromatography WT mRBP4, pNO ₂Phe ⁴³MRBP4 and pNO ₂Phe ¹⁰⁸The SDS-PAGE of mRBP4 analyzes.Figure 24 C has shown and has had (the 1st swimming lane) and lack (the 2nd swimming lane) 1mM pNO ₂The Tyr of mRBP4 under the condition of Phe ⁴³The expression of amber mutation; There is (the 3rd swimming lane) and lack (the 4th swimming lane) 1mM pNO ₂The Tyr of mRBP4 under the condition of Phe ¹⁰⁸The expression of amber mutation.These results show pNO ₂Phe mixes the mRBP muton with high degree of specificity.With Ni-NTA affinity chromatography purifying protein quality sample, under the degeneration condition, analyze with SDS-PAGE and coomassie G-250 dyeing.The 5th swimming lane comprises WT mRBP4.

Figure 25 has shown for pNO ₂Phe ⁴³MRBP4 and pNO ₂Phe ¹⁰⁸The segmental MS/MS of mRBP4 Trypsin enzymolysis analyzes and pNO ₂The pattern of doping of Phe matches.Figure 25 A has shown the polyphone mass spectrum of 11 segment fraction of polymer FSGLWXAIAKK, and wherein X represents pNO ₂Phe.This fragment is by trypsinization pNO ₂Phe ⁴³MRBP4 produces.Figure 25 B has shown the polyphone mass spectrum of 12 segment fraction of polymer MKXWGVASFLQR, and wherein X represents pNO ₂Phe.This fragment is by trypsinization pNO ₂Phe ¹⁰⁸MRBP4 produces.Contain pNO ₂The partial sequence of the oligomer of Phe can be read from b or y ionization series.

Figure 26 has shown definite pNO ₂Phe ⁴³MRBP4 is immunogenic experimental result in the C57BL/6 mice.Figure 26 A has shown anti-WT mRBP4 and the pNO of the C57BL/6 mice of WT mRBP4 immunity ₂Phe ⁴³The mRBP4 serum titer.Figure 26 B has shown pNO ₂Phe ⁴³Anti-WT mRBP4 and the pNO of the C57BL/6 mice of mRBP4 immunity ₂Phe ⁴³The mRBP4 serum titer.ELISA measures anti-WTmRBP4 (1-10 organizes second and first post) or pNO ₂Phe ⁴³MRBP4 (6-10 organizes the 4th and the 3rd post).Before the measurement, with the PBS buffer 1: 100 or 1: 1 that contains 1%BSA, 000 dilute serum sample.

According to these elisa assay, with WT mRBP4 or pNO ₂Phe ¹⁰⁸The do not create antagonism remarkable serum IgG titre of WT mRBP4 of mRBP4 mice immunized.By contrast, use pNO ₂Phe ⁴³The mRBP4 mice immunized shows significantly high serum IgG titre (until 1: 100,000), with pNO ₂Phe ⁴³MRBP4 immunogen and wild-type protein all produce combination.

Figure 27 A has shown pNO ₂Phe ⁴³MRBP4 contains pNO ₂The MS/MS sequencing result of the enzymatic fragment of Phe.Contain pNO with single-letter for buying expression ₂Phe proteolysis fragments sequence (X=pNO ₂Phe).The ion fragment that has shown observed y and b series.Redness has been indicated crucial proof pNO ₂Y that Phe mixes and b ion.All quality are reported with single isotopic mass.Figure 27 B has shown pNO ₂Phe ¹⁰⁸MRBP4 contains pNO ₂The MS/MS sequencing result of the enzymatic fragment of Phe.Contain pNO with single-letter for buying expression ₂Phe proteolysis fragments sequence (X=pNO ₂Phe).The ion fragment that has shown observed y and b series.Proof pNO ₂Crucial y and b ion that Phe mixes are b ₉, b ₁₀, y ₁₀, y ₉, y ₈, y ₇And y ₆All quality are reported with single isotopic mass.

Although in some details, described the present invention for the purpose that is aware and understand, but those skilled in the art can be well understood to by reading this description very much, can carry out the variation of various forms and details under the situation that does not deviate from true scope of the present invention.For example, above-mentioned all technology and equipments can be with various combination couplings.All public publications, patent, patent application or the document of mentioning among the application all included in herein in full by reference, is equivalent to described each independent public publication, patent, patent application or document and all includes this paper independently by reference in and be used for all purposes.

Claims

1. method that in object, produces or strengthen at the immunne response of target part, described method comprises:

The non-natural immunogen is provided, and wherein the non-natural immunogen comprises one or more alpha-non-natural amino acids; And

Give object with the non-natural immunogen, wherein said object produces at immunogenic one or more antibody of non-natural, and wherein said antibody partly produces cross reaction at target;

Thereby generation or enhancing are at the immunne response of target part.

2. method according to claim 1 is characterized in that, described immunne response comprise B-cell-mediated reply and/or T-is cell-mediated replys.

3. method according to claim 1 is characterized in that, describedly provides the non-natural immunogen to be included in to produce the non-natural immunogen in the orthogonal translation system.

4. method according to claim 1 is characterized in that, describedly provides the non-natural immunogen to be included in to produce the non-natural immunogen in the external translating system.

5. method according to claim 1 is characterized in that, described non-natural immunogen comprises the alpha-non-natural amino acid beyond one of classical aminoacid of 20 kinds of natural generations.

6. the method for claim 1 is characterized in that, described non-natural immunogen is by producing except the technology of one of the classical aminoacid of 20 kinds of natural generations in the immunogen being carried out chemical modification.

7. the method for claim 1 is characterized in that, described non-natural immunogen is by producing except the technology of one of the classical aminoacid of 20 kinds of natural generations in the immunogen being carried out post translational modification.

8. method according to claim 1 is characterized in that described object is selected from: people, monkey, mice, rat, pig, milch cow, chicken, cageling, aviary bird, reptile and Amphibian.

9. method according to claim 1 is characterized in that described target partly comprises polypeptide.

10. method according to claim 1 is characterized in that described target partly comprises polypeptide and/or carbohydrate.

11. method is characterized in that according to claim 1, described target partly is object self part.

12., it is characterized in that described target partly is the disease association part as method as described in the claim 11.

13. as method as described in the claim 12, it is characterized in that, described self partly be selected from following one or more: the autoimmune disease autoantigen of being correlated with, tumor associated antigen, Alzheimer's disease related antigen, amyloid beta 40, amyloid beta 42, breast cancer correlation antigen, ovarian cancer related antigen, the carcinoma of prostate related antigen, MAGE, BAGE, RAGE, NY-ESO, pedigree specific tumour related antigen, melanocyte-melanoma pedigree antigen, MART-1/Melan-A, tryrosinase or tyrosinase-related protein matter, tyrosinase-related protein matter 2, PSMA, PSA, the ras of sudden change, the bcr/ab1 of rearrangement, Her2/neu, sudden change or wild type p53, Cytochrome P450 1B1, the intron sequences of the unconventionality expression of N-acetylglucosaminyltransferase-V, CA19-9, p53, OCAA, HOXB7, Cal25, PSA, PSMA, STEAP, PCTA-1, Ca15-3, EGF, EGFR, HER-1, CXCR4, g protein coupled receptor (GCPR) or CA27-29.

14. method is characterized in that according to claim 1, self part of described target part and non-object.

15., it is characterized in that described target partly comes from antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic or Protein virus as method as described in the claim 14.

16. as method as described in the claim 15, it is characterized in that, described target partly be selected from following one or more: bacterial antigens, virus antigen, fungal antigen, mycoplasma antigen, protozoacide antigen, anthelmintic antigen, Protein virus antigen, HIV antigen, HIVgp120, HIV gp41, HIV gag, HIV pol, HIV env, HIV tat, HIV nef, HIV rev, Calicivirus capsid antigen, hepatitis B core antigen, hbs antigen, hepatitis D reagent, herpes simplex virus glycoprotein, varicella zoster virus glycoprotein, influenza virus hemagglutinin, influenza neuraminidase, influenza virus nucleoprotein, HPV capsid protein, parainfluenza virus hemagglutinin/neuraminidase, the capsid of poliomyelitis polypeptide, Hep A antigen, vaccinia virus polypeptide, rabies virus glucoprotein G, the OspA of B.burgdorferi, Type B OMP26, mycobacterium tuberculosis lipoarabinomannan, mycobacterium tuberculosis mAPG, streptococcus pyogenes M albumen, streptococcus pneumoniae capsular polysaccharide, Yersinia pestis F1, Yersinia pestis V antigen, Plasmodium falciparum ring sporinite (PfCSP), Plasmodium falciparum sporinite surface protein 2 (PfSSP2), Plasmodium falciparum liver classification antigen 1 carboxyl terminal (PfLSA1 c end), Plasmodium falciparum output protein 1 (PfExp-1), Pfs48/45, Pfs 28, Pfs 25 or Pfs 230.

17. as method as described in the claim 15, it is characterized in that, described target partly be selected from following one or more: antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, Protein virus, actinomycetes, bacillus cereus, bacteroid, bordetella bacilli, Bartonella, Borrelia bacterium, brucella, Campylobacter, carbon dioxide Cytophaga, chlamydia, clostridium, corynebacterium, the cock steadite, sandflea, enterococcus, dust Garrick body, escherichia coli, francis fungus, Fusobacterium, the blood bartonia bodies, haemophilus twines bacillus, Klebsiella pneumoniae, L type antibacterial, leptospira, Listerella, mycobacteria, mycoplasma, Neisseria, new rickettsia, Nocard's bacillus, pasteurellosis bacillus, dyspepsiacoccus, peptostreptococcus, streptococcus pneumoniae, Bacillus proteus, pseudomonas, rickettsia, Rochalimaea, Salmonella, dysentery bacterium, staphylococcus aureus, streptococcus, spirillum, yersinia, adenovirus, Alphavirus, Calicivirus, coronavirus, cytomegalovirus, canine distemper virus, Ebola virus, enterovirus, Epstein-Barr virus, banzi virus, hepatitis C virus, hepadnavirus, hepatitis B virus, hepatitis, penta type or own Hepatitis virus, GBV-C, herpesvirus, herpes simplex virus, varicella zoster virus, immunodeficiency virus, HIV (human immunodeficiency virus), infectious peritonitis virus, influenza virus, A type influenza virus, leucovirus, Marburg virus, influenza virus, human papillomavirus, HPV, parainfluenza virus, paramyxovirus, RSV, parvovirus, Pestivirus, picornavirus, poliovirus, poxvirus, vaccinia virus, rabies virus, reovirus, retrovirus, rotavirus, colter is mould, prop up the top spore, chain lattice spore, aspergillosis, one basidiobolus haptosporus, bipolar mould, ascus yeast, candidiasis, candida mycoderma, one ear is mould, cryptococcus, leaf spoting bacteria, epidermophyton, outer Saksenaea vasiformis, ground silk bacterium, histoplasma capsulatum, Madura branch bacterium, chlosma, sporidiole bacteria, Xiao Cong obstructs spore, Mortierella, Mucor, Paecilomyces varioti, penicillium sp, the unit cell Saksenaea vasiformis, Saksenaea vasiformis, chlorella, the swollen bacterium of foot, false little holder bacterium, rotten mould, nose sporozoon, rhizopus, the wire basidiomycetes, sporothrix, the handle of crawling is mould, trichophyton, trichosporon bacteria, wood wool is mould, this worm of BABEI, balantidium Coli, sporozoon, Cryptosporidium, eimeria, Encephalocytozoon, entamoeba, giardia lamblia, Hammond worm, liver gregarina isospora, Leishmania, microsporidian, neospora, microsporidian, pentatrichomonas ardin delteili, plasmodium, Plasmodium falciparum, lung sac worm, sarcocystis, schistosomicide, Old Taylor worm, toxoplasma, trypanosomicide, sour jujube lip worm, cat strongylid, ancylostome, the pipe strongylid, ascarid, Bu Lugeshi filaricide, Bunostomum trigonoce phalum, capillaria, the Xia Shi nematicide, cooperid, ring body nematicide, the net filaria, swollen knot worm, sour jujube filaria labialis, cestode, multiple hole cestode, dislike filaricide, imperial nematicide, pinworm, the class filaricide, haemonchus, cleftlip ascarid, Lip river Ah's polypeptide, mansonellosis, Muellerius, dwarf's shape trematodiasis, ancylostome, nematodirus, oesophagostome, dish tail worm, back testis trematodiasis, the stomach nematicide, the paranema worm, lung fluke, secondary ascarid, bubble wing nematicide, former roundworm, the abdominal cavity filaricide is revolved filaria, the palace cestode, the crown wire worm, quasi-colubriformis, strongylid, suck nematicide, bow ascarid nematicide is bent first ascarid, trichinella, the iris ancylostome, Trichocephalus, ancylostome, or Wuchereria.

18. method according to claim 1, it is characterized in that, described target partly comprises first aminoacid sequence, described non-natural immunogen comprises second aminoacid sequence, wherein said second sequence is identical with first sequence, except the one or more natural amino acids in first sequence are replaced by one or more alpha-non-natural amino acids in second sequence.

19. method according to claim 1, it is characterized in that, described target partly comprises first aminoacid sequence, and described non-natural immunogen comprises second aminoacid sequence, wherein said second aminoacid sequence is identical with first aminoacid sequence, except second aminoacid sequence also comprises one or more other alpha-non-natural amino acid sequences.

20. method is characterized in that according to claim 1, described one or more cross reacting antibodies have specificity for the epi-position of target part, and wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises identical sequence.

21. method is characterized in that according to claim 1, described one or more cross reacting antibodies have specificity for the epi-position of target part, and wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises different sequences.

22., it is characterized in that the sequence on the non-natural immunogen epi-position of described correspondence comprises one or more alpha-non-natural amino acids as method as described in the claim 21.

23. method is characterized in that according to claim 1, described one or more alpha-non-natural amino acids can be approaching by antibody.

24. method is characterized in that according to claim 1, described non-natural immunogen comprises and the similar substantially structure of target part.

25. method is characterized in that according to claim 1, described non-natural immunogen comprises and three grades similar substantially and/or quarternary structure of target part.

26. method is characterized in that according to claim 1, described alpha-non-natural amino acid is the aminoacid except that 20 kinds of classical aminoacid, and described alpha-non-natural amino acid comprises following structure:

Wherein R is any substituent group any used side chain in 20 kinds of classical natural amino acids; R wherein ₁It is a kind of used substituent group in the natural amino acid of 20 kinds of classics; Wherein R2 is any substituent group, R2-R1 is formed together be different from 20 kinds of classical natural amino acids any side chain; Wherein Z is OH, NH ₂, SH, NH-R ' or S-R '; Wherein R ' is any substituent group except that H; And each S or O naturally of X and Y wherein.

27. method is characterized in that according to claim 1, described alpha-non-natural amino acid is selected from: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMePhe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.

28., it is characterized in that described target partly is TNF α as method as described in the claim 12.

29. as method as described in the claim 28, it is characterized in that, described to as if mice, described target partly is mTNF α, and described immunogen is non-natural mTNF α.

30., it is characterized in that described non-natural mTNF α comprises pNO as method as described in the claim 29 ₂Phe ⁸⁶-mTNF α.

31., it is characterized in that described non-natural mTNF α is selected from: pNO as method as described in the claim 29 ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.

32. as method as described in the claim 28, it is characterized in that, described to as if the people, described target partly is hTNF α, and immunogen is hTNF α.

33., it is characterized in that described non-natural hTNF α is selected from: pNO as method as described in the claim 28 ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

34. the method for a preventative or therapeutic treatment object morbid state, described method comprises:

Give object non-natural immunogen, described immunogen comprises one or more alpha-non-natural amino acids, and the non-natural immunogen stimulates production of antibodies in the object, one or more target part cross reactions in wherein said antibody and the object are perhaps at one or more relevant with morbid state in subject target parts.

35. the method for morbid state in the preventative or therapeutic treatment object, described method comprises:

Generation is at the antibody of one or more target parts, and this type of generation comprises manufacturing needles to the immunogenic antibody of non-natural, and described non-natural immunogen comprises one or more alpha-non-natural amino acids, and described antibody is at the cross reaction of target part; And,

Give object with antibody.

36. as method as described in claim 34 or 35, it is characterized in that, described preventative or therapeutic treatment be included in cause in the object B-cell-mediated reply and/or T-is cell-mediated replys.

37., it is characterized in that described non-natural immunogen produces as claim 34 or 35 described methods in the orthogonal translation system.

38., it is characterized in that described non-natural immunogen produces as claim 34 or 35 described methods in external translating system.

39., it is characterized in that described non-natural immunogen does not comprise the aminoacid through post translational modification or chemical modification as claim 34 or 35 described methods.

40., it is characterized in that described non-natural immunogen comprises the alpha-non-natural amino acid beyond one of classical aminoacid of 20 kinds of natural generations as claim 34 or 35 described methods.

41., it is characterized in that described non-natural immunogen is by producing except the technology that one of the classical aminoacid of 20 kinds of natural generations in the immunogen is carried out the chemical modification as claim 34 or 35 described methods.

42., it is characterized in that described non-natural immunogen is by producing except the technology that one of the classical aminoacid of 20 kinds of natural generations in the immunogen is carried out the post translational modification as claim 34 or 35 described methods.

43., it is characterized in that described morbid state is autoimmune disease, cancer, bacterial infection, viral infection, fungal infection, mycoplasma infection, prion-infected, protozoal infections or actinomycotic infection as claim 34 or 35 described methods.

44. as claim 34 or 35 described methods, it is characterized in that described object is selected from: people, monkey, mice, rat, pig, milch cow, chicken, cageling, aviary bird, reptile and Amphibian.

45., it is characterized in that described target partly comprises polypeptide as claim 34 or 35 described methods.

46., it is characterized in that described target partly comprises polypeptide and/or carbohydrate as claim 34 or 35 described methods.

47., it is characterized in that described target partly is object self part as claim 34 or 35 described methods.

48., it is characterized in that described target partly is the disease association part as claim 34 or 35 described methods.

49. method as claimed in claim 48, it is characterized in that, described target partly be selected from following one or more: the autoimmune disease autoantigen of being correlated with, tumor associated antigen, the Alzheimer's disease related antigen, amyloid beta 40, amyloid beta 42, breast cancer correlation antigen, the ovarian cancer related antigen, the carcinoma of prostate related antigen, MAGE, BAGE, RAGE, NY-ESO, pedigree specific tumour related antigen, melanocyte-melanoma pedigree antigen, MART-1/Melan-A, tryrosinase or tyrosinase-related protein matter, tyrosinase-related protein matter 2, PSMA, PSA, the ras of sudden change, the bcr/ab1 that resets, Her2/neu, sudden change or wild type p53, Cytochrome P450 1B1, the intron sequences of the unconventionality expression of N-acetylglucosaminyltransferase-V, CA19-9, p53, OCAA, HOXB7, Cal25, PSA, PSMA, STEAP, PCTA-1, Ca15-3, EGF, EGFR, HER-1, CXCR4, g protein coupled receptor (GCPR) or CA27-29.

50., it is characterized in that described target part is not object self part as claim 34 or 35 described methods.

51., it is characterized in that described target partly comes from antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, or Protein virus as method as described in the claim 50.

52. method as claimed in claim 51, it is characterized in that, described target partly be selected from following one or more: bacterial antigens, virus antigen, fungal antigen, mycoplasma antigen, protozoacide antigen, anthelmintic antigen, Protein virus antigen, HIV antigen, HIVgp120, HIV gp41, HIV gag, HIV pol, HIV env, HIV tat, HIV nef, HIV rev, the Calicivirus capsid antigen, hepatitis B core antigen, hbs antigen, hepatitis D reagent, herpes simplex virus glycoprotein, the varicella zoster virus glycoprotein, influenza virus hemagglutinin, influenza neuraminidase, influenza virus nucleoprotein, the HPV capsid protein, parainfluenza virus hemagglutinin/neuraminidase, the capsid of poliomyelitis polypeptide, Hep A antigen, the vaccinia virus polypeptide, rabies virus glucoprotein G, the OspA of B.burgdorgeri, the Type B OMP26, the mycobacterium tuberculosis lipoarabinomannan, mycobacterium tuberculosis mAPG, streptococcus pyogenes M albumen, streptococcus pneumoniae capsular polysaccharide, Yersinia pestis F1, Yersinia pestis V antigen, Plasmodium falciparum ring sporinite (PfCSP), Plasmodium falciparum sporinite surface protein 2 (PfSSP2), Plasmodium falciparum liver classification antigen 1 carboxyl terminal (PfLSA1 c end), Plasmodium falciparum output protein 1 (PfExp-1), Pfs48/45, Pfs 28, Pfs 25 or Pfs 230.

53. method as claimed in claim 51, it is characterized in that, described target partly be selected from following one or more: antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, Protein virus, actinomycetes, bacillus cereus, bacteroid, bordetella bacilli, Bartonella, the Borrelia bacterium, brucella, Campylobacter, the carbon dioxide Cytophaga, chlamydia, clostridium, corynebacterium, the cock steadite, sandflea, enterococcus, dust Garrick body, escherichia coli, francis fungus, Fusobacterium, the blood bartonia bodies, haemophilus, twine bacillus, Klebsiella pneumoniae, L type antibacterial, leptospira, the Listerella, mycobacteria, mycoplasma, Neisseria, new rickettsia, Nocard's bacillus, pasteurellosis bacillus, dyspepsiacoccus, peptostreptococcus, streptococcus pneumoniae, Bacillus proteus, pseudomonas, rickettsia, Rochalimaea, Salmonella, dysentery bacterium, staphylococcus aureus, streptococcus, spirillum, yersinia, adenovirus, Alphavirus, Calicivirus, coronavirus, cytomegalovirus, canine distemper virus, Ebola virus, enterovirus, Epstein-Barr virus, banzi virus, hepatitis C virus, hepadnavirus, hepatitis B virus, hepatitis, penta type or own Hepatitis virus, GBV-C, herpesvirus, herpes simplex virus, varicella zoster virus, immunodeficiency virus, HIV (human immunodeficiency virus), infectious peritonitis virus, influenza virus, A type influenza virus, leucovirus, Marburg virus, influenza virus, human papillomavirus, HPV, parainfluenza virus, paramyxovirus, RSV, parvovirus, Pestivirus, picornavirus, poliovirus, poxvirus, vaccinia virus, rabies virus, reovirus, retrovirus, rotavirus, colter is mould, prop up the top spore, chain lattice spore, aspergillosis, one basidiobolus haptosporus, bipolar mould, the ascus yeast, candidiasis, candida mycoderma, one ear is mould, cryptococcus, leaf spoting bacteria, epidermophyton, outer Saksenaea vasiformis, ground silk bacterium, histoplasma capsulatum, Madura branch bacterium, chlosma, sporidiole bacteria, Xiao Cong obstructs spore, Mortierella, Mucor, Paecilomyces varioti, penicillium sp, the unit cell Saksenaea vasiformis, Saksenaea vasiformis, chlorella, the swollen bacterium of foot, false little holder bacterium, rotten mould, the nose sporozoon, rhizopus, the wire basidiomycetes, sporothrix, the handle of crawling is mould, trichophyton, trichosporon bacteria, wood wool is mould, this worm of BABEI, balantidium Coli, sporozoon, Cryptosporidium, eimeria, Encephalocytozoon, entamoeba, giardia lamblia, the Hammond worm, the liver gregarina, isospora, Leishmania, microsporidian, neospora, microsporidian, pentatrichomonas ardin delteili, plasmodium, Plasmodium falciparum, the lung sac worm, sarcocystis, schistosomicide, the Old Taylor worm, toxoplasma, trypanosomicide, sour jujube lip worm, the cat strongylid, ancylostome, the pipe strongylid, ascarid, cloth Lu Geshi filaricide, Bunostomum trigonoce phalum, capillaria, the Xia Shi nematicide, cooperid, the ring body nematicide, the net filaria, swollen knot worm, the sour jujube filaria labialis, cestode, multiple hole cestode, dislike filaricide, the dragon nematicide, pinworm, the class filaricide, haemonchus, the cleftlip ascarid, Lip river Ah's polypeptide, mansonellosis, Muellerius, dwarf's shape trematodiasis, ancylostome, nematodirus, oesophagostome, dish tail worm, back testis trematodiasis, the stomach nematicide, the paranema worm, lung fluke, secondary ascarid, bubble wing nematicide, former roundworm, the abdominal cavity filaricide, revolve filaria, the palace cestode, the crown wire worm, quasi-colubriformis, strongylid, suck nematicide, bow ascarid nematicide, bend first ascarid, trichinella, the iris ancylostome, Trichocephalus, ancylostome, or Wuchereria.

54. as claim 34 or 35 described methods, it is characterized in that, described target partly comprises first aminoacid sequence, described non-natural immunogen comprises second aminoacid sequence, wherein said second sequence is identical with first sequence, except the one or more natural amino acids in first sequence are replaced by one or more alpha-non-natural amino acids in second sequence.

55. as claim 34 or 35 described methods, it is characterized in that, described target partly comprises first aminoacid sequence, and described non-natural immunogen comprises second aminoacid sequence, wherein said second aminoacid sequence is identical with first aminoacid sequence, except second aminoacid sequence also comprises one or more other alpha-non-natural amino acid sequences.

56., it is characterized in that described one or more cross reacting antibodies have specificity for the epi-position of target part as claim 34 or 35 described methods, wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises identical sequence.

57., it is characterized in that described one or more cross reacting antibodies have specificity for the epi-position of target part as claim 34 or 35 described methods, wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises different sequences.

58., it is characterized in that the sequence on the non-natural immunogen epi-position of described correspondence comprises one or more alpha-non-natural amino acids as method as described in the claim 57.

59., it is characterized in that described one or more alpha-non-natural amino acids can be approaching by antibody as claim 34 or 35 described methods.

60., it is characterized in that described immunogen comprises and the similar substantially structure of target part as claim 34 or 35 described methods.

61. method as claimed in claim 60 is characterized in that, described immunogen comprises and three grades similar substantially and/or quarternary structure of target part.

62., it is characterized in that described alpha-non-natural amino acid is the aminoacid except that 20 kinds of classical aminoacid, and described alpha-non-natural amino acid comprises following structure as claim 34 or 35 described methods:

63. method as claimed in claim is characterized in that, described alpha-non-natural amino acid is right-Nitrobenzol alanine.

64. as claim 34 or 35 described methods, it is characterized in that described alpha-non-natural amino acid is selected from: right-the Nitrobenzol alanine; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMe Phe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.

65., it is characterized in that described target partly is TNF α as claim 34 or 35 described methods.

66. as method as described in the claim 65, it is characterized in that, described target partly be selected from following one or more: endotoxin shock, cerebral malaria, autoimmune disease, multiple organ dysfunction syndrome, multiple sclerosis, heart dysfunction, atherosclerosis, ischemical reperfusion injury, insulin resistant, rheumatoid arthritis, Crohn disease, inflammatory bowel, cachexia, septic shock, acquired immune deficiency syndrome (AIDS), graft versus host disease, sterilization granuloma, adult respiratory distress syndrome, silicon dioxide cause pulmonary fibrosis.

67., it is characterized in that described to liking mice, described target partly is mTNF α, and described immunogen is non-natural mTNF α as the described method of claim 65.

68., it is characterized in that described non-natural mTNF α comprises pNO as the described method of claim 67 ₂Phe ⁸⁶-mTNF α.

69., it is characterized in that described non-natural mTNF α is selected from: pNO as method as described in the claim 67 ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.

70. as method as described in the claim 65, it is characterized in that, described to as if the people, described target partly is hTNF α, and immunogen is hTNF α.

71., it is characterized in that described non-natural hTNF α is selected from: pNO as method as described in the claim 70 ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

72. a method of producing vaccine, described method comprises:

Identify the target part of antibody therapy, wherein said target part does not comprise alpha-non-natural amino acid;

The non-natural immunogen is provided, wherein said non-natural immunogen comprises one or more alpha-non-natural amino acids, and described non-natural immunogen is similar to the target part-structure, and when giving object, object produces antibody immunogenic at non-natural and the cross reaction of target part; And,

With non-natural immunogen and one or more pharmaceutically acceptable adjuvants, carrier or mixed with excipients, produce vaccine thus.

73. as method as described in the claim 72, it is characterized in that, describedly provide the non-natural immunogen to be included in to produce the non-natural immunogen in the orthogonal translation system.

74. as method as described in the claim 72, it is characterized in that, describedly provide the non-natural immunogen to be included in to produce the non-natural immunogen in the external translating system.

75., it is characterized in that described non-natural immunogen comprises the alpha-non-natural amino acid beyond one of classical aminoacid of 20 kinds of natural generations as method as described in the claim 72.

76., it is characterized in that described non-natural immunogen produces by the technology except one of the classical aminoacid of 20 kinds of natural generations in the immunogen being carried out chemical modification as method as described in the claim 72.

77., it is characterized in that described non-natural immunogen produces by the technology except one of the classical aminoacid of 20 kinds of natural generations in the immunogen being carried out post translational modification as method as described in the claim 72.

78., it is characterized in that described object is selected from: people, monkey, mice, rat, pig, milch cow, chicken, cageling, aviary bird, reptile and Amphibian as method as described in the claim 72.

79., it is characterized in that described target partly comprises polypeptide as method as described in the claim 72.

80., it is characterized in that described target partly comprises polypeptide and/or carbohydrate as method as described in the claim 72.

81., it is characterized in that described target partly is object self part as method as described in the claim 72.

82., it is characterized in that described target partly is the disease association part as method as described in the claim 72.

83. as method as described in the claim 82, it is characterized in that, described target partly be selected from following one or more: the autoimmune disease autoantigen of being correlated with, tumor associated antigen, the Alzheimer's disease related antigen, amyloid beta 40, amyloid beta 42, breast cancer correlation antigen, the ovarian cancer related antigen, the carcinoma of prostate related antigen, MAGE, BAGE, RAGE, NY-ESO, pedigree specific tumour related antigen, melanocyte-melanoma pedigree antigen, MART-1/Melan-A, tryrosinase or tyrosinase-related protein matter, tyrosinase-related protein matter 2, PSMA, PSA, the ras of sudden change, the bcr/ab1 that resets, Her2/neu, sudden change or wild type p53, Cytochrome P450 1B1, the intron sequences of the unconventionality expression of N-acetylglucosaminyltransferase-V, CA19-9, p53, OCAA, HOXB7, Cal25, PSA, PSMA, STEAP, PCTA-1, Ca15-3, EGF, EGFR, HER-1, CXCR4, g protein coupled receptor (GCPR) or CA27-29.

84., it is characterized in that self part of described target part and non-object as method as described in the claim 72.

85., it is characterized in that described target partly comes from antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, or Protein virus as method as described in the claim 84.

86. as method as described in the claim 85, it is characterized in that, described target partly be selected from following one or more: bacterial antigens, virus antigen, fungal antigen, mycoplasma antigen, protozoacide antigen, anthelmintic antigen, Protein virus antigen, HIV antigen, HIVgp120, HIV gp41, HIV gag, HIV pol, HIV env, HIV tat, HIV nef, HIV rev, Calicivirus capsid antigen, hepatitis B core antigen, hbs antigen, hepatitis reagent, herpes simplex virus glycoprotein, varicella zoster virus glycoprotein, influenza virus hemagglutinin, influenza neuraminidase, influenza virus nucleoprotein, HPV capsid protein, parainfluenza virus hemagglutinin/neuraminidase, the capsid of poliomyelitis polypeptide, Hep A antigen, vaccinia virus polypeptide, rabies virus glucoprotein G, the OspA of B.burgdorferi, Type B OMP26, mycobacterium tuberculosis lipoarabinomannan, mycobacterium tuberculosis mAPG, streptococcus pyogenes M albumen, streptococcus pneumoniae capsular polysaccharide, Yersinia pestis F1, Yersinia pestis V antigen, Plasmodium falciparum ring sporinite (PfCSP), Plasmodium falciparum sporinite surface protein 2 (PfSSP2), Plasmodium falciparum liver classification antigen 1 carboxyl terminal (PfLSA1 c end), Plasmodium falciparum output protein 1 (PfExp-1), Pfs48/45, Pfs 28, Pfs 25 or Pfs 230.

87. as method as described in the claim 85, it is characterized in that, described target partly be selected from following one or more: antibacterial, virus, fungus, mycoplasma, protozoacide, anthelmintic, Protein virus, actinomycetes, bacillus cereus, bacteroid, bordetella bacilli, Bartonella, the Borrelia bacterium, brucella, Campylobacter, the carbon dioxide Cytophaga, chlamydia, clostridium, corynebacterium, the cock steadite, sandflea, enterococcus, dust Garrick body, escherichia coli, francis fungus, Fusobacterium, the blood bartonia bodies, haemophilus, twine bacillus, Klebsiella pneumoniae, L type antibacterial, leptospira, the Listerella, mycobacteria, mycoplasma, Neisseria, new rickettsia, Nocard's bacillus, pasteurellosis bacillus, dyspepsiacoccus, peptostreptococcus, streptococcus pneumoniae, Bacillus proteus, pseudomonas, rickettsia, Rochalimaea, Salmonella, dysentery bacterium, staphylococcus aureus, streptococcus, spirillum, yersinia, adenovirus, Alphavirus, Calicivirus, coronavirus, cytomegalovirus, canine distemper virus, Ebola virus, enterovirus, Epstein-Barr virus, banzi virus, hepatitis C virus, hepadnavirus, hepatitis B virus, hepatitis, penta type or own Hepatitis virus, GBV-C, herpesvirus, herpes simplex virus, varicella zoster virus, immunodeficiency virus, HIV (human immunodeficiency virus), infectious peritonitis virus, influenza virus, A type influenza virus, leucovirus, Marburg virus, influenza virus, human papillomavirus, HPV, parainfluenza virus, paramyxovirus, RSV, parvovirus, Pestivirus, picornavirus, poliovirus, poxvirus, vaccinia virus, rabies virus, reovirus, retrovirus, rotavirus, colter is mould, prop up the top spore, chain lattice spore, aspergillosis, one basidiobolus haptosporus, bipolar mould, the ascus yeast, candidiasis, candida mycoderma, one ear is mould, cryptococcus, leaf spoting bacteria, epidermophyton, outer Saksenaea vasiformis, ground silk bacterium, histoplasma capsulatum, Madura branch bacterium, chlosma, sporidiole bacteria, Xiao Cong obstructs spore, Mortierella, Mucor, Paecilomyces varioti, penicillium sp, the unit cell Saksenaea vasiformis, Saksenaea vasiformis, chlorella, the swollen bacterium of foot, false little holder bacterium, rotten mould, the nose sporozoon, rhizopus, the wire basidiomycetes, sporothrix, the handle of crawling is mould, trichophyton, trichosporon bacteria, wood wool is mould, this worm of BABEI, balantidium Coli, sporozoon, Cryptosporidium, eimeria, Encephalocytozoon, entamoeba, giardia lamblia, the Hammond worm, the liver gregarina, isospora, Leishmania, microsporidian, neospora, microsporidian, pentatrichomonas ardin delteili, plasmodium, Plasmodium falciparum, the lung sac worm, sarcocystis, schistosomicide, the Old Taylor worm, toxoplasma, trypanosomicide, sour jujube lip worm, the cat strongylid, ancylostome, the pipe strongylid, ascarid, cloth Lu Geshi filaricide, Bunostomum trigonoce phalum, capillaria, the Xia Shi nematicide, cooperid, the ring body nematicide, the net filaria, swollen knot worm, the sour jujube filaria labialis, cestode, multiple hole cestode, dislike filaricide, the dragon nematicide, pinworm, the class filaricide, haemonchus, the cleftlip ascarid, Lip river Ah's polypeptide, mansonellosis, Muellerius, dwarf's shape trematodiasis, ancylostome, nematodirus, oesophagostome, dish tail worm, back testis trematodiasis, the stomach nematicide, the paranema worm, lung fluke, secondary ascarid, bubble wing nematicide, former roundworm, the abdominal cavity filaricide, revolve filaria, the palace cestode, the crown wire worm, quasi-colubriformis, strongylid, suck nematicide, bow ascarid nematicide, bend first ascarid, trichinella, the iris ancylostome, Trichocephalus, ancylostome, or Wuchereria.

88. as the described method of claim 72, it is characterized in that, described target partly comprises first aminoacid sequence, described non-natural immunogen comprises second aminoacid sequence, wherein said second sequence is identical with first sequence, except the one or more natural amino acids in first sequence are replaced by one or more alpha-non-natural amino acids in second sequence.

89. as method as described in the claim 72, it is characterized in that, described target partly comprises first aminoacid sequence, and described non-natural immunogen comprises second aminoacid sequence, wherein said second aminoacid sequence is identical with first aminoacid sequence, except second aminoacid sequence also comprises one or more other alpha-non-natural amino acid sequences.

90., it is characterized in that described one or more cross reacting antibodies have specificity for the epi-position of target part as method as described in the claim 72, wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises identical sequence.

91., it is characterized in that described one or more cross reacting antibodies have specificity for the epi-position of target part as method as described in the claim 72, wherein said epi-position is compared with corresponding non-natural immunogen epi-position, comprises different sequences.

92., it is characterized in that the sequence on the non-natural immunogen epi-position of described correspondence comprises one or more alpha-non-natural amino acids as method as described in the claim 91.

93., it is characterized in that described one or more alpha-non-natural amino acids can be approaching by antibody as method as described in the claim 72.

94., it is characterized in that the structure that described non-natural immunogen comprises and the target part is similar substantially as method as described in the claim 72.

95., it is characterized in that described non-natural immunogen comprises and the target part is similar substantially three grades and/or quarternary structure as method as described in the claim 94.

96., it is characterized in that described alpha-non-natural amino acid is the aminoacid except that 20 kinds of classical aminoacid, and described alpha-non-natural amino acid comprises following structure as method as described in the claim 72:

97., it is characterized in that described alpha-non-natural amino acid is selected from: right-the Nitrobenzol alanine as method as described in the claim 72; Neighbour-Nitrobenzol alanine; Between-the Nitrobenzol alanine; Right-boron carbonyl Phe; Neighbour-boron carbonyl Phe; Between-boron carbonyl Phe; Right-amino Phe; Neighbour-amino Phe; Between-amino Phe; Right-acyl group Phe; Neighbour-acyl group Phe; Between-acyl group Phe; Right-OMe Phe; Neighbour-OMe Phe; Between-OMePhe; Right-sulfo group Phe; Neighbour-sulfo group Phe; Between-sulfo group Phe; 5-nitro His; 3-nitro Tyr; 2-nitro Tyr; The Leu that nitro replaces; The His that nitro replaces; The Ile that nitro replaces; The Trp that nitro replaces; 2-nitro Trp; 4-nitro Trp; 5-nitro Trp; 6-nitro Trp; 7-nitro Trp; The amino tyrosine of 3-, the amino tyrosine of 2-, O-sulfo group tyrosine, 2-sulfur oxygen base phenylalanine, 3-sulfur oxygen base oxygen base phenylalanine or right-carboxyphenylalanine, neighbour-carboxyphenylalanine and-carboxyphenylalanine.

98., it is characterized in that described target partly is TNF α as method as described in the claim 72.

99., it is characterized in that described to liking mice, described target partly is mTNF α, and described non-immunogen is non-natural mTNF α as the described method of claim 98.

100., it is characterized in that described non-natural mTNF α comprises pNO as method as described in the claim 99 ₂Phe ⁸⁶-mTNF α.

101., it is characterized in that described non-natural mTNF α is selected from: pNO as method as described in the claim 99 ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.

102. as method as described in the claim 98, it is characterized in that, described to as if the people, described target partly comprises hTNF α, and immunogen comprises hTNF α.

103., it is characterized in that described non-natural hTNF α is selected from: pNO as method as described in the claim 102 ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

104. vaccine that produces by the described method of claim 72.

105. the method at cell kind generation non-natural TNF α, wherein said non-natural TNF α comprises pNO ₂Phe ⁸⁶-TNF α, described method comprises:

Cultured cell in suitable culture medium, wherein said cell is included in the nucleic acid that 86 amino acids contain at least one selectivity codon, and described nucleic acid coding TNF α; And,

PNO is provided ₂Phe;

Wherein said cell also comprises:

Quadrature-the tRNA of identification selection codon (O-tRNA); And,

Preferably use pNO ₂Phe aminoacylation O-tRNA and under the effect of optant's codon with pNO ₂Phe mixes 86 in aminoacid, thereby produces the quadrature aminoacyl-tRNA synthetase (O-RS) of non-natural TNF α.

106. a non-natural TNF α, described TNF α comprises pNO ₂Phe ⁸⁶-mTNF α.

107. a non-natural TNF α, described TNF α comprise the TNF α that is selected from down group: pNO ₂Phe ¹¹-mTNF α, pNO ₂Phe ¹⁹-mTNF α, pNO ₂Phe ²¹-mTNF α, pNO ₂Phe ⁴²-mTNF α, pNO ₂Phe ⁴⁹-mTNF α, pNO ₂Phe ¹⁰⁴-mTNF α and pNO ₂Phe ¹¹³-mTNF α.

108. a non-natural TNF α, described TNF α comprise the TNF α that is selected from down group: pNO ₂Phe ¹¹-hTNF α, pNO ₂Phe ¹⁹-hTNF α, pNO ₂Phe ²¹-hTNF α, pNO ₂Phe ⁴²-hTNF α, pNO ₂Phe ⁴⁹-hTNF α, pNO ₂Phe ⁸⁷-hTNF α, pNO ₂Phe ¹⁰⁵-hTNF α and pNO ₂Phe ¹¹⁴-hTNF α.

109. a compositions, it comprises claim 106,107 or 108 described non-natural TNF α.

110. the antibody of an anti-claim 106,107 or 108 described non-natural TNF α.

111. the antibody of an anti-claim 106,107 or 108 described non-natural TNF α, cross reaction takes place with the TNF α that does not contain alpha-non-natural amino acid in described antibody capable.

112. a compositions, it comprises claim 110 or 111 described antibody.

113. a non-natural RBP4, described RBP4 comprises pNO ₂Phe ⁴³MRBP4.

114. a compositions, it comprises the described non-natural RBP4 of claim 113.

115. the antibody of the described non-natural RBP4 of anti-claim 113, cross reaction takes place with the RBP4 that does not contain alpha-non-natural amino acid in described antibody capable.

116. compositions that comprises the described antibody of claim 115.

117., it is characterized in that described one or more alpha-non-natural amino acids mix between synthesis stage in the described non-natural immunogen in immunogen as claim 1,34,35 or 72 described methods.

118., it is characterized in that described one or more alpha-non-natural amino acids mix in the described non-natural immunogen by the method that is different from post translational modification or synthetic back chemical modification as claim 1,34,35 or 72 described methods.

119., it is characterized in that described one or more alpha-non-natural amino acids mix in the described non-natural immunogen by following one or more methods: orthogonal translation as claim 1,34,35 or 72 described methods; External translation; Native chemical connects; Marking protein connects; Or solid phase synthesis.

120. as claim 1,34,35 or 72 described methods; it is characterized in that, described non-natural immunogen comprise through glycosylation, nitro aryl modify, one or more aminoacid in the classical aminoacid of 20 kinds of natural generations of nitrated, alkylation, acetylation, oxidation, sulphation or phosphorylation.

121. as the described method of claim 120; it is characterized in that, described one or more aminoacid be by the method that is different from post translational modification or the method glycosylation that is different from chemical modification, nitro aryl modify, nitrated, alkylation, acetylation, oxidation, sulphation or phosphorylation.