WO2022225220A1 - 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법 - Google Patents

마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법 Download PDF

Info

Publication number
WO2022225220A1
WO2022225220A1 PCT/KR2022/004617 KR2022004617W WO2022225220A1 WO 2022225220 A1 WO2022225220 A1 WO 2022225220A1 KR 2022004617 W KR2022004617 W KR 2022004617W WO 2022225220 A1 WO2022225220 A1 WO 2022225220A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
microparticle
primer
acid amplification
digoxigenin
Prior art date
Application number
PCT/KR2022/004617
Other languages
English (en)
French (fr)
Inventor
황상현
오흥범
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Publication of WO2022225220A1 publication Critical patent/WO2022225220A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/143—Magnetism, e.g. magnetic label
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/149—Particles, e.g. beads

Definitions

  • the present invention relates to a microparticle-based nucleic acid detection kit, a nucleic acid amplification product detection method, and the like.
  • PCR polymerase chain reaction
  • the PCR technique adds a nucleic acid fragment sequence (primer) that specifically binds to the nucleic acid sequence of a target pathogen, and repeats denaturation, recombination, and polymerization according to temperature to amplify a trace amount of pathogen nucleic acid. It is a technology that can detect the presence or absence of
  • the PCR technique allows an objective large-scale test, unlike the cytological test of pap smear, and in terms of measurement principle, compared to cytology or liquid hybrid capture, test cost, experimental procedure, and detection sensitivity (sensitivity) ) and specificity, etc., are confirmed to have a relative advantage.
  • sensitivity detection sensitivity
  • the disadvantage is that it can be used only in limited places. In reality, when an infectious disease outbreak occurs, disease control must be carried out quickly, so disease diagnosis must be a fast, simple, inexpensive, and suitable method for a point-of-care (POCT) environment regardless of location.
  • POCT point-of-care
  • microfluidics, microelectronics, optical systems, and chip-based detection technologies have been developed, but most of them still require complex manufacturing processes and are limited to places that satisfy conditions such as analysis devices. It has the disadvantage that it can only be used in .
  • SPIN-DNA centrifugation-based detachable visual detection system
  • molecular point of care testing molecular point of care testing
  • molecular POCT molecular point of care testing
  • Hybridization tests based on metal nanoparticles are attractive systems for diagnostic applications, as they are simple to implement and visually read through color changes that occur due to plasmon interactions between probes. Applying a small force such as capillary force for the assay) is a more feasible approach.
  • hepatitis C virus HCV
  • HCV hepatitis C virus
  • PCR real-time polymerase chain reaction
  • the dominant model of centralized laboratory testing is not suitable for treating chronic hepatitis C patients in resource-constrained settings because they are often unavailable due to a lack of infrastructure and/or trained operators.
  • timely detection and diagnosis is important for infection control, antiviral therapy, and epidemiological studies for HCV, an alternative, inexpensive and point-of-care rapid diagnostic test is particularly useful.
  • the present inventors have developed not only for the diagnosis of infectious diseases such as hepatitis C virus, but also for all diseases that can be tested for nucleic acid amplification without other special devices such as paper, electrophoresis or centrifugation/column, signal detection such as fluorescence. An attempt was made to develop a simpler method that can rapidly detect amplified DNA with the naked eye.
  • the present inventors have developed a detection method for target DNA that visually visualizes amplified DNA only by adding microparticles and does not require additional centrifugation, probe conjugation, long incubation time, signal generation or dilution steps. Thus, the present invention was completed.
  • the present invention provides a method for detecting a nucleic acid amplification product based on microparticles, comprising the following steps:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • the present invention provides an information providing method for diagnosing an infectious disease, comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • the present invention provides a method for diagnosing an infectious disease, comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • the present invention consists of a forward primer and a reverse primer each labeled with any one selected from the group consisting of biotin, digoxigenin, antigen, target molecule and oligonucleotide. and a primer set that specifically binds to a nucleic acid to be detected; and
  • kits for detecting a microparticle-based nucleic acid comprising a microparticle coated with any one selected from the group consisting of (aptamer) and an oligonucleotide complementary to an oligonucleotide bound to the primer,
  • the kit provides a kit, characterized in that it is used to detect aggregation of nucleic acids captured by microparticles without centrifugation.
  • the primer set may be composed of a forward primer and a reverse primer each labeled with any one selected from the group consisting of biotin and digoxigenin, but is not limited thereto.
  • the microparticles may be coated with streptavidin or anti-digoxigenin antibody, but is not limited thereto.
  • the sample may be one or more selected from the group consisting of whole blood, serum, plasma, urine, feces, and saliva, but is not limited thereto.
  • the primer set in step (b) may be prepared so that the size of the nucleic acid amplification product is 100 to 200 bp, but is not limited thereto.
  • the amplification in step (b) is at least one method selected from the group consisting of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and isothermal amplification method. It may be made by, but is not limited thereto.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • isothermal amplification method It may be made by, but is not limited thereto.
  • the isothermal amplification method comprises recombinant enzyme polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), and helicase-dependent amplification.
  • RPA recombinant enzyme polymerase amplification
  • LAMP loop-mediated isothermal amplification
  • HDA helicase-dependent amplification
  • the diameter of the microparticles may be 0.25 to 10 ⁇ m, but is not limited thereto.
  • the microparticles may be magnetic beads or polystyrene particles, but is not limited thereto.
  • the detection limit concentration of the cDNA may be 1 to 15 IU/ml, but is not limited thereto.
  • the infectious disease is hepatitis C, hepatitis B, influenza, human immunodeficiency virus (HIV) induced AIDS, tuberculosis, severe acute respiratory syndrome coronavirus (SARS-CoV) infection , and may be one or more selected from the group consisting of Corona Virus Infectious Disease-19 (COVID-19), but is not limited thereto.
  • HIV human immunodeficiency virus
  • SARS-CoV severe acute respiratory syndrome coronavirus
  • the microparticle-based nucleic acid amplification product detection method amplifies a target nucleic acid and then only adds microparticles to the amplification product of the nucleic acid captured by the microparticles without a separate process or device such as centrifugation, additional probe, culture, or dilution. Aggregation can be detected with the naked eye, and an amplification product of a target nucleic acid can be detected easily and quickly with high sensitivity.
  • the microparticle-based nucleic acid amplification product detection method according to the present invention is a hepatitis C virus, hepatitis B virus, influenza virus, human immunodeficiency virus (HIV), Mycobacterium tuberculosis, severe acute respiratory syndrome coronavirus (SARS-CoV), or It is expected to be useful for rapidly diagnosing infectious diseases caused by SARS-CoV-2 and the like.
  • FIG. 1 schematically shows the principle of a microparticle-based visual detection system for amplified cDNA as a method for detecting a nucleic acid amplification product according to an embodiment of the present invention.
  • FIG. 2 is a view confirming the aggregation result by adding streptavidin-coated microparticles and anti-digoxigenin antibody-coated microparticles according to the presence or absence of amplified HCV cDNA according to an embodiment of the present invention.
  • FIG. 3 is a view showing optimization conditions and results for nucleic acid detection through aggregation in a microparticle-based visual detection system of amplified cDNA according to an embodiment of the present invention.
  • FIG. 4a and 4b show streptavidin-coated microparticles and anti-digoxigenin antibody coating in the presence ( FIG. 4a ) and in the absence ( FIG. 4b ) of amplified HCV cDNA according to an embodiment of the present invention. It is a diagram confirming the aggregation result by the addition of microparticles enlarged at 400x and 1000x magnification.
  • FIG. 5 is a graph showing the concentration of HCV cDNA after adding streptavidin-coated microparticles and anti-digoxigenin antibody-coated microparticles using microparticle-based visual detection of amplified cDNA according to an embodiment of the present invention. It is a figure confirming the aggregation result.
  • FIG. 6 shows the results of electrophoresis with actual clinical samples (HCV positive 4, 5, 6; negative, N4, N5, N6) (left diagram) and microparticle-based visual detection of amplified cDNA according to an embodiment of the present invention; It is a view comparing the results of confirming aggregation after adding the streptavidin-coated microparticles and the anti-digoxigenin antibody-coated microparticles using the (right figure).
  • FIG. 7 is a view confirming the sensitivity of the microparticle-based visual detection system of amplified cDNA according to an embodiment of the present invention compared to the case of using the conventional nucleic acid amplification detection method.
  • the present invention provides a method for detecting a microparticle-based nucleic acid amplification product comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • primer is a nucleic acid sequence having a short free 3 hydroxyl group, which can form a complementary template and base pair, and serves as a starting point for template strand copying. It refers to a short nucleic acid sequence that functions.
  • the primers are capable of initiating DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerate or reverse transcriptase) in an appropriate buffer and temperature.
  • the primer can be variously modified according to methods known in the art within the range that does not interfere with hybridization with the polynucleotide to be detected.
  • modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.), and fluorescence or enzymatic binding of a labeling material.
  • uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.
  • charged linkages eg, phosphorothioate, phosphorodithioate, etc.
  • the primer set may be composed of a forward primer and a reverse primer each labeled with any one selected from the group consisting of biotin and digoxigenin, and according to an embodiment of the present invention, the primer set is biotin. It may consist of a labeled forward primer and a reverse primer labeled with digoxigenin, and the size of the nucleic acid amplification product is 100 bp to 200 bp, 100 bp to 180 bp, 100 bp to 160 bp, 120 bp to 200 bp, 120 bp to 180 bp, 120 bp to 160 bp, 140 bp to 200 bp, 140 bp to 180 bp, or 140 bp to 160 bp, but is not limited thereto.
  • microparticle means a particle having a diameter of 0.1 ⁇ m to 1000 ⁇ m, and according to an embodiment of the present invention, the microparticle has a diameter greater than 0.1 ⁇ m.
  • the microparticles may be magnetic beads or polystyrene particles coated with streptavidin or anti-digoxigenin antibody, wherein the polystyrene particles may be blue polystyrene particles, It is not limited thereto.
  • the microparticles are 1 mg/ml to 20 mg/ml, 1 mg/ml to 17 mg/ml, 1 mg/ml to 15 mg/ml, 1 mg/ml to 12 mg/ml, 1 mg/ml to 10 mg/ml, 3 mg/ml to 20 mg/ml, 3 mg/ml to 15 mg/ml, 3 mg/ml to 12 mg/ml, 3 mg/ml to 10 mg/ml, 5 mg/ml to 20 mg/ml, 5 mg/ml to 15 mg/ml, 5 mg/ml to 12 mg/ml, 5 mg/ml to 10 mg/ml, 3 mg/ml to 7 mg/ml, 7 mg/ml It may be added at a concentration of 12 mg/ml, 5 mg/ml, or 10 mg/ml, but is not limited thereto.
  • the weight ratio of the streptavidin-coated microparticles to the anti-digoxigenin antibody-coated microparticles is 0.5 to 6 : 1, 1 to 6 : 1, 1 to 5 : 1, 1 to 4 : 1, 1 to 3 : 1, 1 to 2 : 1, 1 : 1, 2 to 6 : 1, 2 to 5 : 1, 2 to 4 : 1, 2 to 3 : 1, 2 : 1, 3 to 6 : 1, 3 to 5 : 1, 3 to 4 : 1, 3 : 1, 4 to 6 : 1, 4 to 5 : 1, 4 : 1, 5 to 6 : 1, 5 : 1, or 6 : 1 day can, but is not limited thereto.
  • the weight ratio may be a dry weight ratio, but is not limited thereto.
  • antibody refers to a polypeptide comprising a framework region derived from an immunoglobulin gene or fragment thereof that specifically binds to and recognizes an antigen. Recognized immunoglobulin genes include numerous immunoglobulin variable region genes, including kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes. Light chains were classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, consequently defining the immunoglobulin classes IgG, IgM, IgA, IgD and IgE, respectively.
  • antibodies or fragments of antibodies may be from different organisms, including humans, mice, rats, hamsters, camels, and the like.
  • Antibodies of the invention are modified or mutated at one or more amino acid positions to improve or modulate a desired function of the antibody (eg, glycosylation, expression, antigen recognition, effector function, antigen binding, specificity, etc.). may include
  • Exemplary immunoglobulin (antibody) structural units include tetramers. Each tetramer consists of two identical pairs of polypeptide chains, each pair having one "light” chain (about 25 kD) and one "heavy” chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids mainly responsible for antigen recognition.
  • the terms variable light (VL) and variable heavy (VH) chains refer to these light and heavy chains, respectively.
  • An Fc ie, fragment determinable region
  • the Fc region also binds various cellular receptors, such as Fc receptors, and other immune molecules, such as complement proteins.
  • sample means any amount of material derived from an organism, for example, the sample is whole blood, serum, plasma, urine, feces, saliva, bone marrow, tissue, cell, sputum, peritoneal fluid, hair, It may be one or more selected from the group consisting of a nasal fluid, and a sample obtained by a biopsy, but is not limited thereto.
  • the sample may be isolated from a subject, and the subject is, for example, a human or non-human primate, a mouse, a rat, a rabbit, a dog, a cat, a horse, and a mammal, including cattle, and the like. may be, but is not limited thereto.
  • nucleic acid refers to a molecule comprising one or more nucleotides, ie, ribonucleotides, deoxyribonucleotides, or both.
  • the term includes polymers and monomers of ribonucleotides and deoxyribonucleotides, wherein the ribonucleotides and/or deoxyribonucleotides are linked together via 5' to 3' bonds in the case of polymers. Ribonucleotide and deoxyribonucleotide polymers may be single or double stranded.
  • the nucleic acid includes all of DNA, mRNA, cDNA reverse transcribed from mRNA, DNA amplified from the cDNA, RNA transcribed from the amplified DNA, and the like.
  • the type of the nucleic acid is not limited, for example, hepatitis C virus (HCV), hepatitis B virus (HBV), influenza ( influenza) virus, human immunodeficiency virus (HIV), mycobacterium tuberculosis, severe acute respiratory syndrome coronavirus (SARS-CoV), or severe acute respiratory syndrome coronavirus 2 (Severe) acute respiratory syndrome coronavirus 2, SARS-CoV-2) nucleic acid.
  • HCV hepatitis C virus
  • HBV hepatitis B virus
  • influenza influenza
  • HMV human immunodeficiency virus
  • mycobacterium tuberculosis mycobacterium tuberculosis
  • severe acute respiratory syndrome coronavirus SARS-CoV
  • severe acute respiratory syndrome coronavirus 2 severe acute respiratory syndrome coronavirus 2
  • amplification means constructing a nucleic acid molecule into multiple copies or constructing multiple copies complementary to the nucleic acid molecule using one or more nucleic acid molecules as a template.
  • the amplification in step (b) can be made by one or more methods selected from the group consisting of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and isothermal amplification method
  • the isothermal amplification method is from the group consisting of recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), and helicase-dependent amplification (HDA). It may be one or more selected, but is not limited thereto.
  • measuring the presence level of the nucleic acid amplification product means measuring the presence (ie, measuring the presence or absence), or measuring the level of qualitative and quantitative change of the nucleic acid amplification product. it means.
  • the measurement may be performed without limitation, including both a qualitative method (analysis) and a quantitative method. Types of qualitative and quantitative methods for measuring the presence or absence of nucleic acid amplification products are well known in the art, and the experimental methods described herein are included therein.
  • the detection of the nucleic acid amplification product may be measured by aggregation of the nucleic acid amplification product captured by microparticles.
  • aggregation means that two or more dispersed nucleic acids are gathered by being captured by microparticles to form an aggregated state.
  • amplicon refers to a target sequence amplified in a single or double-stranded form from a target polynucleotide in a nucleic acid amplification reaction.
  • the detection limit concentration of the cDNA is 1 IU / ml to 15 IU / ml, 1 IU / ml to 13 IU / ml, 1 IU / ml to 10 IU / ml, 3 IU / ml to 15 IU / ml, 3 IU/ml to 13 IU/ml, 3 IU/ml to 10 IU/ml, 5 IU/ml to 15 IU/ml, 5 IU/ml to 13 IU/ml, 5 IU/ml to 10 IU/ml ml, 7 IU/ml to 15 IU/ml, 7 IU/ml to 13 IU/ml, or 7 IU/ml to 10 IU/ml, but is not limited thereto, and detection of nucleic acid amplification products according to the present invention Through this method, the amplification product of cDNA can be detected even when the concentration is as low as 15 IU/ml, 1
  • the microparticle-based nucleic acid amplification product detection method may have a sensitivity of 90% or more, for example, 90% to 100%, 90% to 98%, 90% to 96%, 90% to 94%, 90% to 92%, 92% to 95%, 92% to 97%, 92% to 100%, 95% to 97%, 95% to 100%, 97% to 100%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, but is not limited thereto.
  • a microparticle-based nucleic acid amplification product detection method wherein cDNA is synthesized through reverse transcription after RNA is extracted, amplified, and the amplified cDNA is treated with microparticles to visually detect amplified cDNA through aggregation.
  • the particle-based visual detection system may be referred to as “STAT-DNA”.
  • the present invention provides a forward primer and a reverse primer (forward primer) labeled with any one selected from the group consisting of biotin, digoxigenin, antigen, target molecule and oligonucleotide ( reverse primer) and a primer set that specifically binds to a nucleic acid to be detected; and
  • kits for detecting a microparticle-based nucleic acid comprising a microparticle coated with any one selected from the group consisting of (aptamer) and an oligonucleotide complementary to an oligonucleotide bound to the primer,
  • the kit provides a kit, characterized in that it is used to detect aggregation of nucleic acids captured by microparticles without centrifugation.
  • the present invention provides a forward primer and a reverse primer each labeled with any one selected from the group consisting of biotin, digoxigenin, antigen, target molecule and oligonucleotide.
  • reverse primer a primer set that specifically binds to a nucleic acid to be detected;
  • a kit for diagnosing a disease comprising a microparticle coated with any one selected from the group consisting of an oligonucleotide complementary to the oligonucleotide bound to the primer,
  • the kit may provide a kit, characterized in that it is used to detect aggregation of nucleic acids captured by microparticles without centrifugation.
  • the present invention provides (a) biotin, digoxigenin, an antigen, a target molecule, and an oligonucleotide selected from the group consisting of a forward primer and a reverse primer, respectively. preparing a primer set that specifically binds to a nucleic acid to be detected by labeling a reverse primer; and
  • the primer Including the step of preparing microparticles coated with any one selected from the group consisting of an aptamer that specifically binds to a target molecule bound to and an oligonucleotide complementary to an oligonucleotide bound to the primer As a method of manufacturing a formulation for the diagnosis of a disease,
  • the kit includes a container, instructions; and the primer set and microparticles according to the present invention.
  • the container may serve to package the primer set and microparticles according to the present invention, and may serve to store and fix them.
  • the material of the container may be, for example, plastic or a glass bottle, but is not limited thereto.
  • the instructions may describe, for example, the characteristics, composition, or method of use of the kit.
  • the kit may further include materials commonly used for PCR or isothermal nucleic acid amplification known in the art in addition to the primer set and microparticles, for example, a test tube or other suitable container, a reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, or sterile water, and the like.
  • dNTPs deoxynucleotides
  • the present invention provides an information providing method for diagnosing or predicting the onset of a disease, comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • the present invention provides a method for diagnosing a disease, comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer; and
  • the method may further include (e) determining that the patient has a disease when aggregation of the amplified nucleic acid captured by the microparticle is detected.
  • the microparticle-based nucleic acid amplification product detection method or disease diagnosis method according to the present invention amplifies a target nucleic acid and then easily and with high sensitivity the aggregation of the nucleic acid amplification product captured by the microparticles without a separate process or device only by adding the microparticles. Since it can be quickly detected with the naked eye, it is possible to quickly diagnose diseases such as infectious diseases, and through this, it is possible to immediately respond to diseases such as administration of therapeutic agents.
  • the method for detecting a microparticle-based nucleic acid amplification product or method for diagnosing a disease according to the present invention can be effectively used for treating a disease.
  • the present invention may provide a method of treating a disease comprising the steps of:
  • an antibody capable of binding to the amplified cDNA through an antigen-antibody reaction to streptavidin, avidin, digoxigenin or antigen bound to the primer, and a target molecule bound to the primer adding a microparticle coated with any one selected from the group consisting of an aptamer that specifically binds to and an oligonucleotide complementary to an oligonucleotide bound to the primer;
  • the nucleic acid to be detected is a nucleic acid to be detected for diagnosing or predicting the onset of a disease, and may be a nucleic acid of a bacterium or virus that causes the onset of a disease.
  • the disease is not limited in its type as long as it is a disease capable of nucleic acid amplification test, and may include an infectious disease or cancer. According to an embodiment of the present invention, the disease may be an infectious disease.
  • infectious disease means a disease caused by the growth of pathogenic microorganisms by settling on the tissues, body fluids, and surfaces of humans, animals, and plants, and can be divided into several types depending on the route of infection and whether it is contagious. .
  • infections include viral infections, fungal infections, bacterial infections, protozoal infections and parasitic infections.
  • the infectious disease is hepatitis C, hepatitis B, influenza, human immunodeficiency virus (HIV) induced AIDS (AIDS), tuberculosis, severe acute respiratory syndrome coronavirus (SARS-CoV) infection, and coronavirus Infectious disease-19 (severe acute respiratory syndrome coronavirus 2 infection) may be one or more selected from the group consisting of (SARS-CoV-2; COVID-19), but is not limited thereto.
  • HIV human immunodeficiency virus
  • SARS-CoV severe acute respiratory syndrome coronavirus
  • coronavirus Infectious disease-19 coronavirus Infectious disease-19 (severe acute respiratory syndrome coronavirus 2 infection) may be one or more selected from the group consisting of (SARS-CoV-2; COVID-19), but is not limited thereto.
  • the "treatment” refers to any action that improves or beneficially changes the target disease and metabolic abnormalities accompanying it, and methods such as chemotherapy, radiation therapy, surgical operation, biological therapy, or administration of antibiotics can be used
  • the chemotherapy refers to the act of using a chemical for the treatment of a specific disease and the entire drug used at that time.
  • the drug is, for example, paclitaxel, doxorubicin, 5-fluorouracil, cisplatin, imatinib, carboplatin, oxaliplatin ( oxaliplatin), tegafur, irinotecan, docetaxel, cyclophosphamide, cemcitabine, ifosfamide, mitomycin C, bin vincristine, etoposide, methotrexate, topotecan, tamoxifen, vinorelbine, camptothecin, danuorubicin, chloram chlorambucil, bryostatin-1, calicheamicin, mayatansine, levamisole, DNA recombinant interferon alfa-2a, mitoxantrone, nimustine, interferon alfa-2a, doxifluridine, formestane, leuprolide acetate, megestrol Megestrol acetate,
  • the drug may be an antiviral agent
  • the antiviral agent may be a hepatitis C therapeutic agent that delays the progression of a disease by inhibiting the proliferation of the hepatitis C virus, for example, the cytokine peginterferon alpha 2a ( peginterferon- ⁇ -2a) and peginterferon- ⁇ -2b; a protease-based compound or a derivative thereof, or a pharmaceutically acceptable salt thereof, ribavirin; Direct-acting antivirals (DAA) compounds or derivatives thereof that act on viral proteins, or pharmaceutically acceptable salts thereof.
  • DAA Direct-acting antivirals
  • Boceprevir, dasabuvir, daclatasvir (daclatasvir), asunaprevir, and sofosbuvir and the combination drugs elbasvir/grazoprevir, glecaprevir/pibrentasvir , and ombitasvir / paritaprevir / ritonavir (ombitasvir / paritaprevir / ritonavir) may be at least one selected from the group consisting of, but is not limited thereto.
  • the antiviral agent may be a therapeutic agent for HIV virus-induced AIDS, for example, non-nucleoside reverse-transcriptase inhibitors (NNRTIs) series compounds or derivatives thereof, or pharmaceutically acceptable salts thereof.
  • NRTIs non-nucleoside reverse-transcriptase inhibitors
  • NRTIs Nucleoside reverse-transcriptase inhibitors
  • NRTIs Nucleoside reverse-transcriptase inhibitors
  • PIs Protease inhibitors
  • /tenofovir alafenamide cobicistat/elvitegravir/emtricitabine/Tenofovir alafenamide
  • cobicistat/elvitegravir/emtricitabine/tenofovir disoproxil cobicistat/Elvitegravir/emtricitabine/Tenofovir disoproxil
  • It may be at least one selected from the group consisting of /dolutegravir/lamivudine (abacavir/dolutegravir/lamivudine), but is not limited thereto.
  • the antiviral agent may be a flu therapeutic agent used for the treatment of influenza A and influenza B virus infection, and the flu therapeutic agent is an uncoating inhibitor-based compound or a derivative thereof, or a pharmaceutically acceptable salt thereof.
  • amantadine, and rimantadine; and Neuraminidase inhibitors (NAIs) series compounds or derivatives thereof, or pharmaceutically acceptable salts thereof such as oseltamivir, zanamivir, peramivir, baloxavir (baloxavir) and may be at least one selected from the group consisting of raninamivir (laninamivir), but is not limited thereto.
  • the antiviral agent is a severe acute respiratory syndrome coronavirus (SARS-CoV) infection, or coronavirus infection-19 (severe acute respiratory syndrome coronavirus 2 infection) (SARS-CoV-2; COVID-19) infection It may be a therapeutic agent used for the treatment of SARS-CoV.
  • SARS-CoV severe acute respiratory syndrome coronavirus
  • coronavirus infection-19 severe acute respiratory syndrome coronavirus 2 infection
  • COVID-19 coronavirus infection
  • the antiviral agent may be a hepatitis B therapeutic agent that inhibits the proliferation of hepatitis B virus to relieve inflammation, prevent fibrosis, and prevent liver cirrhosis and sensitive cell carcinoma, for example, lamivudine, clevudine ), telbivudine, entecavir, adefovir, tenofovir disoproxil, tenofovir alafenamide and besifovir It may be one or more selected from the group consisting of, but is not limited thereto.
  • the drug may be a treatment for tuberculosis, such as ethambutol, isoniazid, pyrazinamide, rifampicin, streptomycin, and amikacin. It may be one or more selected from the group consisting of, but is not limited thereto.
  • the radiation therapy means irradiating a patient with high-energy radiation, including but not limited to x-rays, gamma rays, and neutrons.
  • This type of therapy includes, but is not limited to, external light therapy, internal radiation therapy, implanted radiation, brachytherapy, and systemic radiation therapy.
  • the surgical operation includes any therapeutic or diagnostic treatment including the methodical action of the hand or the hand together with a device on the body of an individual to obtain a healing, therapeutic or diagnostic effect.
  • subject means a subject in need of treatment or diagnosis of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse. , and mammals such as cattle.
  • the biological therapy refers to a treatment using the body's immune system directly or indirectly using a biological agent containing a material derived from an organism or a material produced using an organism, and the biological agent is a physical , including vaccines, allergens, antigens, hormones, cytokines, enzymes, blood and plasma, immune sera, monoclonal antibodies, fermented products, antitoxins, and laboratory diagnostics for which the potency and stability cannot be assessed by chemical testing alone.
  • the biologic is, for example, adalimumab, alemtuzumab, bevacizumab, cetuximab, daratumumab, panitumumab ), Rituximab, Trastuzumab, Pertuzumab, Ipilimumab, Nivolumab, Pembrolizumab, Atezolizumab, More It may be at least one selected from the group consisting of valumab, avelumab, tocilizumab, sarilumab, satralizumab, and siltuximab, It is not limited thereto.
  • the antibiotic refers to a drug used to treat a bacterial infection, for example, amikacin, gentamicin, kanamycin, neomycin, plazomicin. ), streptomycin (streptomycin), and aminoglycoside (aminoglycoside) system including tobramycin (tobramycin) and the like; carbapenems, including doripenem, ertapenem, imipenem, and meropenem; cephalosporins; ciprofloxacin, delafloxacin, gemifloxacin, levofloxacin, moxifloxacin, fluoofloxacin, including norfloxacin, and ofloxacin Roquinolone (fluoroquinolone) system; Glycopeptide system and lipoglycopeptide system, including dalbavancin (dalbavancin), oritavancin (oritavancin), teicoplanin, telavan
  • macrolides including azithromycin, clarithromycin, erythromycin, and fidaxomicin; a monobactam type including aztreonam and the like; linezolid (linezolid) and tedizolid (tedizolid), including oxazolidinone-based (oxazolidinone) type; Amoxicillin, ampicillin, carbenicillin, dicloxacillin, nafcillin, oxacillin, penicillin G, penicillin V, penicillin V penicillin, including piperacillin, and ticarcillin; a polypeptide system including bacitracin, colistin, and polymyxin B; rifamycin, including rifabutin, rifampin, rifapentine, and rifaximin; Mafenide, sulfacetamide, sulfadiazine, sulfadoxine, sulfamethizole, sulfamethoxazo
  • cDNA amplification when anti-digoxigenin antibody-coated microparticles and streptavidin-coated microparticles are added It was visually confirmed that aggregation occurred by the microparticles in the presence of the product.
  • concentration of the microparticles was optimized to produce a clear visualization of amplicon aggregation, and the optimal concentration of microparticles was 2 ⁇ l of 10 mg/ml of magnetic streptavidin beads and 5 mg/ml of anti-digoxigenin alpha particles. It was determined to be 1 ⁇ l (see Experimental Example 1).
  • the reproducibility and limit of detection (LOD) of the nucleic acid amplification product detection method according to the present invention were confirmed using HCV cDNA at concentrations of 10 1 , 10 2 , 10 3 and 10 4 IU/ml, It was observed that aggregation was clearly seen even at about 10 1 IU/ml, so an analysis with a detection limit of less than 15 IU/ml was recommended (see Experimental Example 2).
  • Example 1 Microparticle-based visual detection method of amplified DNA: construction of a biosensor
  • STAT-DNA microparticle-based visual detection system
  • FIG. 1 The principle of the microparticle-based visual detection system (STAT-DNA) of amplified DNA according to the present invention is shown in FIG. 1 .
  • the final optimized protocol proceeded with the following steps.
  • Nucleic acids amplified with forward/reverse primers were labeled with other molecules such as biotin and digoxigenin at the 5' and 3' ends, respectively.
  • 2 ⁇ l of streptavidin-coated magnetic bead suspension (1 ⁇ m size, 10 mg/ml Dynabead) MyOne Streptavidin C1, Life Technologies, Grand Island, NY, USA
  • 1 ⁇ l of anti-digoxigenin polystyrene particles anti-digoxigenin alpha donor beads sized 250-350 nm, PerkinElmer, Waltham, MA, 5 mg/ml in PBS, pH 7.2, USA
  • Serum samples were collected from HCV-infected patients at Asan Hospital in Seoul from May 2018 to October 2020. After routine HCV RNA testing with the Roche cobas 6800 system (Roche Molecular Diagnostics), residual or residual serum samples were each aliquoted and stored at -80 °C, and the experiment was approved by the ethics review committee of Asan Hospital, Seoul (IRB No. 2017-). 1742).
  • HCV RNA 50 ⁇ l was extracted from clinical samples using the QIAamp MinElute Viurs Spin Kit (Qiagen, Germantown, MD) according to the manufacturer's instructions. The nucleic acids were then stored at -80 °C.
  • HCV cDNA synthesis was performed using the Roche Transcriptor First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) according to the manufacturer's protocol.
  • RNA sample 5 ⁇ l was mixed with 0.5 ⁇ l of Transcriptor Reverse Transcriptase (Roche), 2 ⁇ l of random hexamer (20 pmol), 2 ⁇ l of deoxynucleotide mixture, 0.5 ⁇ l of Protector RNase inhibitor, 6 It was mixed with 20 ⁇ l of a reverse transcription (RT) reaction mixture containing ⁇ l of nuclease-free water (Roche), and 4 ⁇ l of a 5x reaction mixture of the above substances.
  • RT reverse transcription
  • cDNA samples were then incubated in an FX thermocycler (Bio-Rad, California, USA) using the cDNA synthesis protocol (25 °C for 10 min, then 55 °C for 30 min, then 85 °C for 5 min. ). cDNA samples were stored at -80 °C until PCR analysis.
  • RT-PCR reverse transcription-polymerase chain reaction
  • the forward primer was biotinylated at the 5' end and the reverse primer was labeled with digoxigenin at the 5' end. They were prepared for capture with streptavidin-labeled magnetic beads (Dynabead MyOne Streptavidin C1) and anti-digoxigenin antibody coated polystyrene particles (anti-digoxigenin alpha donor beads, PerkinElmer), respectively. .
  • RT-PCR analysis was performed using the QIAGEN Taq PCR Master Mix Kit (Qiagen) according to the instruction manual. That is, 5 ⁇ l of HCV cDNA was amplified in a reaction volume of 25 ⁇ l containing 12.5 ⁇ l of QIAGEN Taq PCR Master Mix (Qiagen); 1 ⁇ l of 10 ⁇ mol/L biotinylated forward primer; 1 ⁇ l of 10 ⁇ mol/L of digoxigenin-labeled reverse primer and distilled water (DW). Thermal cycling was performed using an Applied Biosystems 7500 instrument [AB Sciex, Foster City, CA (formerly Applied Biosystems)] under the following conditions: 94 °C, 5 min; Final extension (40 cycles) at 95° C. for 30 seconds, 56° C. for 30 seconds, 72° C. for 30 seconds, and 72° C. for 10 minutes. Then, HCV PCR products were detected using 2% agarose gel electrophoresis.
  • the concentration of microparticles was optimized to produce a clear visualization of amplicon aggregation, and the optimal concentration of microparticles was 2 ⁇ l streptavidin magnetic Beads (S-b)/blue polystyrene particles (Blue-b) 10 mg/ml and 1 ⁇ l of anti-digoxigenin alpha particles (alpha-b) 5 mg/ml were determined.
  • S-b streptavidin magnetic Beads
  • Blue-b blue polystyrene particles
  • alpha-b anti-digoxigenin alpha particles
  • anti-digoxigenin particles anti-digoxigenin polystyrene particles (anti-digoxigenin alpha donor beads with a size of 250-350 nm, PerkinElmer, Waltham, Mass. , USA, 5 mg/ml in PBS, pH 7.2).
  • the minimum amount of capture reagent to generate an intense red line was 20 ⁇ g for both streptavidin-coated microparticles and anti-digoxigenin antibody-coated microparticles, whereas In the present invention, an amount as small as 5-10 ⁇ g could be used.
  • the dispensing system for dispensing the lateral flow dipstick, membrane paper, and line required for the existing lateral flow type molecular diagnosis technology was not required in the present invention, and the protein blocker, stabilizer, and membrane Fixation of the capture reagent was not required.
  • the detection process to which the existing lateral flow type technology is applied requires additional steps such as an additional hybridization step including heating, but this additional process was not required in the present invention.
  • the smartphone-based visual detection of PCR amplicons was performed without the aid of electric power, motor drive or centrifugal force.
  • particle aggregation was monitored visually as well as by smartphone. This direct visual observation was confirmed with a smartphone, and as shown in FIG. 2 , the positive sample showed characteristic aggregation and precipitation, and the negative control remained a cloudy solution without aggregation and precipitation.
  • FIG. 4a aggregation was observed when streptavidin-coated magnetic beads and anti-digoxigenin antibody-coated alpha donor beads were added in the presence of the target amplicon. Formation was confirmed, and when the target amplicon was not present, it was confirmed that aggregation was not formed as shown in FIG. 4B .
  • the precision and limit of detection (LOD) of the method according to the present invention were determined by serial dilutions of HCV cDNA to concentrations of 10 1 , 10 2 , 10 3 and 10 4 IU/ml.
  • Reproducible results of the microparticle-based visual detection biosensor of amplified cDNA according to the present invention were obtained by performing two runs for 5 days with serially diluted samples.
  • the detection limit of the biosensor was determined by comparing it with the results obtained by the agarose gel method of serially diluted PCR amplicons.
  • aggregation of the amplified cDNA was confirmed after the addition of the nin antibody-coated alpha donor beads, but it was observed that aggregation was clearly seen even at ⁇ 10 1 IU/ml. became The biosensor was similar to conventional PCR or real-time PCR, and analysis with a low HCV RNA detection limit of less than 15 IU/ml was recommended.
  • nucleic acids from several virus strains other than HCV virus were used.
  • the microparticle-based visual detection biosensor for diagnosing amplified HCV nucleic acids according to the present invention did not detect the nucleic acids of the following 8 viruses; Human rhinovirus (HRV), influenza A, B, norovirus, human matapenumovirus, parainfluenza virus type 3 (PIV3), CoV- 229E, adenovirus.
  • HRV Human rhinovirus
  • PIV3 parainfluenza virus type 3
  • CoV- 229E adenovirus
  • microparticle-based visual detection biosensor of amplified cDNA has analysis specificity.
  • the amplification product of the target nucleic acid can be detected with high sensitivity when using the microparticle-based nucleic acid amplification product detection method according to the present invention.
  • microparticle-based visual detection biosensor of amplified cDNA according to the present invention was compared with the results of the Roche Cobas 6800 HCV test (Roche HPV; Roche Molecular Diagnostics, Pleasanton, CA, USA). Of the 54 frozen samples, 32 were confirmed positive for HCV by the biosensor compared to the Roche HCV kit and 22 were confirmed negative. All were 100% consistent with the existing results.
  • the microparticle-based visual detection biosensor of amplified cDNA according to the present invention was one of the simplest visual detection systems among DNA sensors, especially compared to the lateral flow-based detection. It was also robust and sensitive compared to clinical grade HCV real-time PCR.
  • the microparticle-based visual detection biosensor of amplified cDNA according to the present invention was able to detect HCV amplicons within minutes without multiple incubation, adsorption/elution and washing steps with high sensitivity compared to conventional real-time PCR.
  • Microparticle-based visual detection of amplified cDNA there are several advantages in identifying amplified DNA through the biosensor, the system being a special sophisticated instrument, immobilization technology, and transformation technology such as surface plasmon resonance. (Qiu, 2020 #688), electrochemical transformation (Abad-Valle, 2005 #689), and surface-enhanced Raman scattering (SERS)-based biosensor (Wang, 2019 #686) were not required. In addition, because only the microparticles are visible, no color or signal generation process is required, and no driving force or microfluidic actuation is required due to the PCR reaction tube in which the visualization is generated. A major limitation of PASS-DNA (Yang, 2019 #608) in previous studies was the need for a separator for detection.
  • AuNPs Gold nanoparticles
  • SPR surface plasmon resonance
  • primer-dimers can produce problematic false positives, unless additional specific detection designs, such as probe-based detection, are considered, especially in real-time PCR formats.
  • additional specific detection designs such as probe-based detection
  • the microparticle-based visual detection biosensor of amplified cDNA according to the present invention minimizes the effect of the primer-dimer because the particle cannot be closed with a very short sequence such as a primer-dimer.
  • Magnetic nanoparticle-based capture has been widely used in DNA sensors due to its excellent dispersion, low cost, easy separation, purification of buffer systems, and signal detection (Tang, 2020 # 701).
  • signal detection required additional signal development processes for fluorescence, electrochemical or chemiluminescence (Zhuang, 2019 # 702; Cortina, 2016 # 704; Ali, 2016 # 703).
  • the microparticle-based visual detection method of amplified cDNA according to the present invention did not use the properties of magnetic nanoparticles for magnetically controllable aggregation, purification and separation.
  • the role of magnetic particles is only visible to the naked eye when they aggregate. This is the same as the role of the streptavidin coated blue particles in the above method.
  • Detection of captured DNA requires signal detection steps, including fluorescence scanning (Dou, 2014 #682) or visual RT-LAMP-CRISPR detection under blue light illumination (Wang, 2021 #690).
  • Anti-digoxigenin alpha donor particles successfully produced aggregation of DNA amplicons with streptavidin coated microparticles.
  • Anti-digoxigenin alpha donor particles were anti-digoxigenin latex-based particles with a size of 250-350 nm (Yu, 2015 # 683) and were originally used for homogeneous (no washing) bead-based sandwich immunoassays.
  • microparticle-based visual detection biosensor of amplified cDNA according to the present invention was also detected in smartphone-based detection, which was more identifiable and quantitative than visualizing aggregation with the naked eye. It was also expected that a fully integrated microparticle-based NAT with sample-in-answer-out function would be inexpensive, user-friendly, fast and robust, and would significantly improve the implementation of POCT in resource-limited settings.
  • Isothermal amplification methods e.g., recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP) and helicase-dependent amplification (HDA) are also used according to the present invention. It is compatible with microparticle-based visual detection systems of amplified cDNA.
  • RPA recombinase polymerase amplification
  • LAMP loop-mediated isothermal amplification
  • HDA helicase-dependent amplification
  • the microparticle-based nucleic acid amplification product detection method can visually detect the aggregation of the nucleic acid amplification product captured by the microparticles without a separate process or apparatus only by amplifying the target nucleic acid and then adding the microparticles, and has high sensitivity. can easily and quickly detect the amplification product of the target nucleic acid, and is expected to be useful for rapidly diagnosing and treating various infectious diseases, and thus has industrial applicability.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법에 관한 것으로서, 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법은 표적 핵산을 증폭시킨 다음 마이크로입자의 첨가만으로 별도의 과정이나 장치 없이 마이크로입자에 포획된 핵산 증폭산물의 응집을 육안으로 검출할 수 있으며, 높은 민감도로 쉽고 빠르게 표적 핵산의 증폭산물을 검출할 수 있다. 이에 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법은 C형 간염 바이러스, B형 간염 바이러스, 인플루엔자 바이러스, 인간 면역결핍 바이러스(HIV), 결핵균, 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV), 또는 SARS-CoV-2 등에 의한 감염성 질환을 신속하게 진단하는 데에 유용하게 이용될 것으로 기대된다.

Description

마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법
본 발명은 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법 등에 관한 것이다.
본 출원은 2021년 04월 20일에 출원된 한국특허출원 제10-2021-0051131호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
최근 특정 염기서열의 DNA 단편을 신속하고 간단하게 증폭할 수 있는 중합효소연쇄반응(PCR) 및 실시간 PCR 기법이 보편화되어, 감염 여부의 검출/진단이 용이해졌다. PCR 기법은 목적 병원체의 핵산 염기 서열에 특이적으로 결합하는 핵산 단편 서열(프라이머)를 가하여 온도에 따른 변성(denaturation), 재결합(annealing) 및 중합(polymerization) 과정을 반복하여 미량의 병원체 핵산을 증폭시켜 그 존부를 검출할 수 있는 기술로, 진단하는데 사용되는 대표적인 기술이다.
상기 PCR 기법은 임상 진단의 실용적 측면에서 세포진 검사(Pap smear)의 세포학적 검사와 달리 객관적인 대규모 검사가 가능하며, 측정원리상 세포검사나 액상 hybrid capture에 비해 검사비용, 실험 절차, 검출 감도(sensitivity) 및 특이도(specificity) 등에서 상대적 우위를 가지고 있는 것으로 확인되어 있다. 그러나, PCR 기법을 설계하고, 결과를 해석함에 주의가 요망되므로, 높은 기술력을 가진 운영자가 요구되며, PCR의 증폭물(amplicon)을 검출하기 위해서는 번거로운 과정을 거쳐야만 하며, PCR 장치의 가격이 매우 높아 제한된 장소에서만 사용이 가능하다는 단점이 있다. 현실적으로 전염성 질병이 창궐하면, 질병의 통제가 신속하게 이루어져야 하기 때문에, 질병 진단은 장소에 구애받지 않고 빠르고 간단하며 저렴하면서, 현장검사(POCT) 환경에 적합한 방법이여야만 한다.
상술한 요구를 만족시키기 위해, 마이크로 유체공학, 마이크로 전자공학, 광학 시스템 및 칩 기반 검출 기술 개발이 이루어져 왔으나, 이들 중 대부분은 여전히 복잡한 제조공정이 필수적이며, 분석장치 등의 조건들을 만족하는 제한된 장소에서만 사용이 가능하다는 단점을 가지고 있다.
일예로 인간 유두종 바이러스(HPV) DNA를 검출하기 위한 방법으로, 원심분리 기반의 분리형 시각 검출시스템(SPIN-DNA)이 개발된 바 있으나, 상기 SPIN-DNA는 비드로부터 DNA가 결합된 비드를 분리하기 위해 원심분리 장치가 필수적으로 구비되어야 한다는 문제점이 존재한다.
따라서 분자 현장검사(molecular point of care testing, molecular POCT)의 개발에 대한 필요성이 대두되었다. 분자 현장검사(molecular point of care testing, molecular POCT)에 적용할 수 있는 진단 기술을 개발하기 위해서는, 우선 질병에 대한 즉각 대응이 가능하도록, 현장에서 즉각 병원체의 DNA, RNA를 검출하거나 세포의 DNA, RNA를 분석하여, 빨리 결과를 취득하도록 하여야 하므로, 별도의 측정장비나 지식없이 시각적 혹은 육안으로 검출되어야 하고, 30 분 미만의 짧은 시간 내에 결과를 얻을 수 있어야 하며, 세척 단계와 같은 부가적인 공정단계를 배제하여야 하며, 측정장치 혹은 계측기 없이 저렴하면서도 정확하고, 우수한 재현성이 요구됨에 따라 기존에 사용해오던 DNA 진단방법 발굴전략으로는 한계가 있다.
이와 관련하여 이전 연구에서는 종이 기반의 증폭된 DNA용 단순 시각적 검출 시스템(Paper-based speedy separation of amplified DNA, PASS-DNA)을 사용하였으나, 이 검출 시스템은 DNA 결합되지 않은 마이크로 입자로부터 DNA 결합 마이크로 입자를 분리하기 위해 종이와 입자를 필요로 하였다.
금속 나노입자를 기반으로 한 혼성화 테스트는 구현이 간단하고 프로브 사이의 플라즈몬(plasmon) 상호 작용으로 인해 발생하는 색상 변화를 통해 시각적으로 읽을 수 있어 진단 응용 분야에 매력적인 시스템이며, 측면 흐름 분석(lateral flow assay)을 위해 모세관 힘과 같은 작은 힘을 적용하는 것이 더 실현 가능한 접근 방식이다.
한편, C 형 간염 바이러스(hepatitis C virus, HCV) 감염은 수혈 및 지역 특이적 전염(community-acquired)에 의해 발생되고, 신장 투석에 의해 약 70 % 정도가 감염되는 것으로 보고되었다. 일단 C형 간염 바이러스에 감염이 되면 약 20 % 정도가 5년 내에 간경화를 수반한 급성 간염을 일으키게 되고 간암으로 전이되는 것으로 알려져 있다. 이러한 높은 만성 감염률은 RNA 바이러스에서 보기 드문 일로서 C형 간염 바이러스가 높은 비율의 간암을 일으키는 매개체임을 보여주는 증거이다. 최근에는 모든 혈액에 대해서 C형 간염 바이러스 검사가 잘 이루어지고 있어 수혈로 인한 감염은 현저히 줄어들었지만, 지역 특이적 감염은 이에 대한 관리가 효과적으로 이루어지지 않아 그 감염률이 높으므로 전 세계적으로 중요한 문제로 대두되고 있으며, 약 7,100 만 명이 HCV에 영향을 받는 것으로 추정된다.
실시간 중합 효소 연쇄 반응(PCR)에 의한 HCV 게놈의 분자 검출 및 정량화는 HCV 진단의 황금 표준을 나타내며 치료 요법 관리에 중요한 역할을 한다. 그러나 감염된 환자의 최대 약 80 %는 특히 저소득층 및 중간 소득층에서 감염 사실을 알지 못하는 것으로 추정된다. 이에, 저렴한 비용으로 현장 진단 및 치료와 연결할 수 있는 보편적인 접근을 통한 진단의 증가가 필수적인 실정이다.
따라서 중앙 집중식 실험실 검사의 지배적 모델은 인프라 및/또는 훈련된 운영자의 부족으로 인해 종종 사용할 수 없기 때문에 자원이 제한된 환경에서 만성 C 형 간염 환자를 치료하는 데 적합하지 않다. 적시 검출 및 진단은 HCV에 대한 감염 관리, 항 바이러스 치료 및 역학 연구에 중요하므로, 대안으로 저렴하고 현장 진료의 신속한 진단 테스트가 특히 유용하다.
이에, 본 발명자들은 C형 간염 바이러스 등과 같은 감염성 질환의 진단뿐만 아니라, 핵산 증폭 검사가 가능한 모든 질환에 대한 진단을 위하여 종이, 전기영동 또는 원심분리/컬럼, 형광과 같은 신호검출 등 다른 특별한 장치 없이 증폭된 DNA를 육안으로 신속히 검출할 수 있는 보다 간단한 방법을 개발하고자 하였다.
본 발명자들은 마이크로입자의 추가만으로 증폭된 DNA를 육안으로 시각화하고, 추가 원심 분리, 프로브 접합, 긴 배양 시간, 신호 생성 또는 희석 단계를 필요로 하지 않는 표적 DNA의 검출 방법을 개발하였는 바, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명의 목적은 마이크로입자 기반 핵산 증폭산물 검출 방법 및 마이크로입자 기반 핵산 검출용 키트를 제공하는 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 목적을 달성하기 위해 본 발명은 하기 단계를 포함하는, 마이크로입자 기반 핵산 증폭산물 검출 방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
또한, 본 발명은 하기 단계를 포함하는, 감염성 질환의 진단을 위한 정보제공방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
또한, 본 발명은 하기 단계를 포함하는, 감염성 질환의 진단방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
또한, 본 발명은 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트; 및
스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 포함하는, 마이크로입자 기반 핵산 검출용 키트로서,
상기 키트는 원심분리 없이 마이크로입자에 포획되는 핵산의 응집을 검출하기 위해 사용되는 것을 특징으로 하는, 키트를 제공한다.
본 발명의 일 구현예로서, 상기 프라이머 세트는 비오틴 및 디곡시게닌으로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머 및 역방향 프라이머로 구성될 수 있으나, 이에 제한되지 않는다.
본 발명의 다른 구현예로서, 상기 마이크로입자는 스트렙타비딘 또는 항-디곡시게닌 항체로 코팅된 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 시료는 전혈, 혈청, 혈장, 소변, 대변, 및 타액으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 (b) 단계에서 프라이머 세트는 핵산 증폭산물의 크기가 100 내지 200 bp가 되도록 제작된 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 (b) 단계에서 증폭은 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 및 등온 증폭 방법으로 이루어진 군으로부터 선택되는 하나 이상의 방법에 의해 이루어지는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 등온 증폭 방법은 재조합 효소 중합 효소 증폭(recombinase polymerase amplification, RPA), 루프 매개 등온 증폭(loop-mediated isothermal amplification, LAMP), 및 헬리카제 의존 증폭(helicase-dependent amplification, HDA)으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 마이크로입자의 직경은 0.25 내지 10 μm일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 마이크로입자는 자성 비드(magnetic bead) 또는 폴리스티렌(polystyrene) 입자일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 cDNA의 검출 한계 농도는 1 내지 15 IU/ml일 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 구현예로서, 상기 감염성 질환은 C형 간염, B형 간염, 인플루엔자, 인간 면역결핍 바이러스(HIV) 유도 에이즈(AIDS), 결핵, 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV) 감염증, 및 코로나 바이러스 감염증-19(COVID-19)로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법은 표적 핵산을 증폭시킨 다음 마이크로입자의 첨가만으로 원심분리, 추가적인 프로브, 배양 또는 희석 등의 별도의 과정이나 장치 없이 마이크로입자에 포획된 핵산 증폭산물의 응집을 육안으로 검출할 수 있으며, 높은 민감도로 쉽고 빠르게 표적 핵산의 증폭산물을 검출할 수 있다. 이에 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법은 C형 간염 바이러스, B형 간염 바이러스, 인플루엔자 바이러스, 인간 면역결핍 바이러스(HIV), 결핵균, 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV), 또는 SARS-CoV-2 등에 의한 감염성 질환을 신속하게 진단하는 데에 유용하게 이용될 것으로 기대된다.
도 1은 본 발명의 일 구현예에 따른 핵산 증폭산물 검출 방법으로서 증폭된 cDNA의 마이크로입자 기반 시각적 검출 시스템의 원리를 도식화하여 나타낸 것이다.
도 2는 본 발명의 일 구현예에 따른 증폭된 HCV cDNA의 존재 여부에 따라 스트렙타비딘 코팅된 마이크로입자 및 항-디곡시게닌 항체 코팅된 마이크로입자 첨가에 의한 응집 결과를 확인한 도면이다.
도 3은 본 발명의 일 구현예에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 시스템에서 응집을 통한 핵산 검출을 위한 최적화 조건 및 결과를 나타낸 도면이다.
도 4a 및 4b는 본 발명의 일 구현예에 따른 증폭된 HCV cDNA가 존재하는 경우(도 4a) 및 존재하지 않는 경우(도 4b)에 스트렙타비딘 코팅된 마이크로입자 및 항-디곡시게닌 항체 코팅된 마이크로입자 첨가에 의한 응집 결과를 400x 및 1000x 배율로 확대하여 확인한 도면이다.
도 5는 본 발명의 일 구현예에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출을 이용하여 스트렙타비딘 코팅된 마이크로입자 및 항-디곡시게닌 항체 코팅된 마이크로입자를 첨가한 후 HCV cDNA 농도에 따른 응집 결과를 확인한 도면이다.
도 6은 실제 임상 검체(HCV 양성 4, 5, 6; 음성, N4, N5, N6)로 전기영동한 결과(좌측 도면)와 본 발명의 일 구현예에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출을 이용하여 스트렙타비딘 코팅된 마이크로입자 및 항-디곡시게닌 항체 코팅된 마이크로입자를 첨가한 후 응집을 확인한 결과(우측 도면)를 비교한 도면이다.
도 7은 본 발명의 일 구현예에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 시스템의 민감도를 기존 핵산 증폭 검출방법을 이용한 경우와 비교하여 확인한 도면이다.
본 발명은 하기 단계를 포함하는, 마이크로입자 기반 핵산 증폭산물 검출 방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
본 발명에 있어서, “프라이머”란 짧은 자유 3말단 수산화기(free 3 hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이트 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 상기 프라이머는 검출하고자 하는 표적이 되는 폴리뉴클레오티드와의 혼성화를 방해하지 않는 범위에서 당해 기술분야에 공지된 방법에 따라 다양하게 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환 및 뉴클레오티드 간의 변형, 예를 들면 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등), 그리고 형광 또는 효소를 이용한 표지물질(labeling material)의 결합 등이 있다.
본 발명에 있어서, 상기 프라이머 세트는 비오틴 및 디곡시게닌으로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머 및 역방향 프라이머로 구성될 수 있고, 본 발명의 일 실시예에 따르면 상기 프라이머 세트는 비오틴으로 표지된 정방향 프라이머 및 디곡시게닌으로 표지된 역방향 프라이머로 구성될 수 있으며, 핵산 증폭산물의 크기가 100 bp 내지 200 bp, 100 bp 내지 180 bp, 100 bp 내지 160 bp, 120 bp 내지 200 bp, 120 bp 내지 180 bp, 120 bp 내지 160 bp, 140 bp 내지 200 bp, 140 bp 내지 180 bp, 또는 140 bp 내지 160 bp가 되도록 제작된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “마이크로입자(microparticle)”란 0.1 μm 내지 1000 μm의 직경을 갖는 입자를 의미하며, 본 발명의 일 실시예에 따르면 상기 마이크로입자는 직경이 상기 마이크로입자의 직경이 0.1 μm 보다 작을 경우 육안으로 관찰하기 어려우며, 바람직하게는 0.1 μm 내지 10 μm, 0.1 μm 내지 7 μm, 0.1 μm 내지 5 μm, 0.1 μm 내지 3 μm, 0.1 μm 내지 1 μm, 0.2 μm 내지 10 μm, 0.2 μm 내지 7 μm, 0.2 μm 내지 5 μm, 0.2 μm 내지 3 μm, 0.2 μm 내지 1 μm, 0.25 μm 내지 1 μm, 0.25 μm 내지 0.3 μm, 1 μm 내지 10 μm, 또는 1 μm일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 마이크로입자는 스트렙타비딘 또는 항-디곡시게닌 항체로 코팅된 자성 비드(magnetic bead) 또는 폴리스티렌(polystyrene) 입자일 수 있으며, 이때 상기 폴리스티렌 입자는 청색 폴리스티렌 입자일 수 있으나, 이에 제한되지 않는다. 또한, 상기 마이크로입자는 1 mg/ml 내지 20 mg/ml, 1 mg/ml 내지 17 mg/ml, 1 mg/ml 내지 15 mg/ml, 1 mg/ml 내지 12 mg/ml, 1 mg/ml 내지 10 mg/ml, 3 mg/ml 내지 20 mg/ml, 3 mg/ml 내지 15 mg/ml, 3 mg/ml 내지 12 mg/ml, 3 mg/ml 내지 10 mg/ml, 5 mg/ml 내지 20 mg/ml, 5 mg/ml 내지 15 mg/ml, 5 mg/ml 내지 12 mg/ml, 5 mg/ml 내지 10 mg/ml, 3 mg/ml 내지 7 mg/ml, 7 mg/ml 내지 12 mg/ml, 5 mg/ml, 또는 10 mg/ml의 농도로 첨가될 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 스트렙타비딘으로 코팅된 마이크로입자 : 항-디곡시게닌 항체로 코팅된 마이크로입자의 중량비는 0.5 내지 6 : 1, 1 내지 6 : 1, 1 내지 5 : 1, 1 내지 4 : 1, 1 내지 3 : 1, 1 내지 2 : 1, 1 : 1, 2 내지 6 : 1, 2 내지 5 : 1, 2 내지 4 : 1, 2 내지 3 : 1, 2 : 1, 3 내지 6 : 1, 3 내지 5 : 1, 3 내지 4 : 1, 3 : 1, 4 내지 6 : 1, 4 내지 5 : 1, 4 : 1, 5 내지 6 : 1, 5 : 1, 또는 6 : 1일 수 있으나, 이에 제한되지 않는다. 이때 상기 중량비는 건조 중량비일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “항체”란 항원에 특이적으로 결합하여 인식하는 면역글로불린 유전자 또는 이의 단편에서 유래하는 프레임워크 영역을 포함하는 폴리펩타이드를 의미한다. 인식된 면역글로불린 유전자는 카파, 람다, 알파, 감마, 델타, 엡실론, 및 뮤 불변 영역 유전자를 비롯하여, 무수한 면역글로불린 가변 영역 유전자를 포함한다. 경쇄는 카파 또는 람다로 분류되었다. 중쇄는 감마, 뮤, 알파, 델타, 또는 엡실론으로 분류되고, 결과적으로 각각 면역글로불린 부류 IgG, IgM, IgA, IgD 및 IgE를 한정한다. 전형적으로, 항체의 항원-결합 영역은 결합 특이성 및 친화성에서 가장 핵심적이게 된다. 일부 실시형태에서, 항체 또는 항체의 단편은 인간, 마우스, 래트, 햄스터, 낙타 등을 포함한, 상이한 유기체에서 유래될 수 있다. 본 발명의 항체는 항체의 바람직한 기능(예를 들어, 당화, 발현, 항원 인식, 이펙터 기능, 항원 결합, 특이성 등)을 개선시키거나 또는 조정하기 위해 1 이상의 아미노산 위치에서 변형되거나 또는 돌연변이된 항체를 포함할 수도 있다.
예시적인 면역글로불린(항체) 구조 단위는 사량체를 포함한다. 각각의 사량체는 폴리펩티드 사슬의 2개의 동일 한 쌍으로 구성되며, 각 쌍은 하나의 "경"쇄(약 25 kD) 및 하나의 "중"쇄(약 50-70 kD)를 갖는다. 각 사슬의 N말단은 항원 인식을 주로 담당하는 약 100 내지 110개 또는 그 이상의 아미노산의 가변 영역을 한정한다. 용어 가변 경쇄(VL) 및 가변 중쇄(VH)는 각각 이들 경쇄 및 중쇄를 의미한다. Fc(즉, 단편 결정가능 영역)는 면역글 로불린의 "베이스" 또는 "꼬리부"이고 전형적으로 항체의 부류에 의존적으로 2 또는 3개의 불변 도메인에 기여 하는 2개 중쇄로 구성된다. 특이적 단백질과의 결합에 의해, Fc 영역은 각각의 항체가 소정 항원에 대한 적절한 면역 반응을 생성시키는 것을 보장한다. Fc 영역은 또한 다양한 세포 수용체, 예컨대 Fc 수용체, 및 다른 면역 분자, 예컨대 보체 단백질에 결합한다.
본 발명에 있어서, “시료”란 생물체로부터 유래하는 임의의 양의 물질을 의미하며 예컨대 상기 시료는 전혈, 혈청, 혈장, 소변, 대변, 타액, 골수, 조직, 세포, 객담, 복막액, 머리카락, 비강액, 및 생체검사로 획득된 시료로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다. 본 발명에 있어서, 상기 시료는 피검체로부터 분리된 것일 수 있으며, 상기 피검체는 예컨대 인간 또는 비-인간인 영장류, 마우스, 래트, 토끼, 개, 고양이, 말, 및 소 등을 포함하는 포유 동물일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “핵산”이란 하나 이상의 뉴클레오타이드, 즉, 리보뉴클레오타이드, 데옥시리보뉴클레오타이드 또는 둘 다를 포함하는 분자를 의미한다. 상기 용어는 리보뉴클레오타이드 및 데옥시리보뉴클레오타이드의 중합체 및 단량체를 포함하며, 여기서, 리보뉴클레오타이드 및/또는 데옥시리보뉴클레오타이드는 중합체의 경우에 5' 내지 3' 결합을 통해 함께 결합한다. 리보뉴클레오타이드 및 데옥시리보뉴클레오타이드 중합체는 단일 또는 이중 가닥일 수 있다. 상기 핵산은 DNA, mRNA, mRNA로부터 역전사된 cDNA, 이 cDNA로부터 증폭된 DNA, 증폭된 DNA로부터 전사된 RNA 등을 모두 포함한다.
본 발명의 마이크로입자 기반 핵산 증폭산물 검출 방법에 있어서, 상기 핵산의 종류에는 제한이 없으며, 예컨대 C형 간염 바이러스(hepatitis C virus, HCV), B형 간염 바이러스(hepatitis B virus, HBV), 인플루엔자(influenza) 바이러스, 인간 면역결핍 바이러스(human immunodeficiency virus, HIV), 결핵균(mycobacterium tuberculosis), 중증 급성 호흡기 증후군 코로나 바이러스(Severe acute respiratory syndrome coronavirus, SARS-CoV), 또는 중증 급성 호흡기 증후군 코로나 바이러스 2(Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2) 핵산을 포함할 수 있다.
본 발명에 있어서, “증폭”이란 주형으로서 하나 이상의 핵산 분자를 사용하여, 핵산 분자를 다수의 복사체로 작제하거나 상기 핵산 분자에 대해 상보적인 다수의 복사체를 작제하는 것을 의미한다.
본 발명에 있어서, 상기 (b) 단계에서 증폭은 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 및 등온 증폭 방법으로 이루어진 군으로부터 선택되는 하나 이상의 방법에 의해 이루어질 수 있으며, 상기 등온 증폭 방법은 재조합 효소 중합 효소 증폭(recombinase polymerase amplification, RPA), 루프 매개 등온 증폭(loop-mediated isothermal amplification, LAMP), 및 헬리카제 의존 증폭(helicase-dependent amplification, HDA)으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, “검출”이란 핵산 증폭산물의 존재 여부를 측정 및 확인하는 것, 또는 핵산 증폭산물의 존재 수준(핵산 수)의 변화를 측정 및 확인하는 것을 모두 포함하는 의미이다. 같은 맥락에서, 본 발명에서 상기 핵산 증폭산물의 존재 수준을 측정하는 것은 존재 여부를 측정하는 것(즉, 존재 유무를 측정하는 것), 또는 상기 핵산 증폭산물의 질적, 양적 변화 수준을 측정하는 것을 의미한다. 상기 측정은 정성적인 방법(분석)과 정량적인 방법을 모두 포함하여 제한 없이 수행될 수 있다. 핵산 증폭산물 존재 여부 측정에 있어서 정성적 방법과 정량적 방법의 종류는 당업계에 잘 알려져 있으며, 본 명세서에서 기술한 실험법들이 이에 포함된다. 각 방법 별로 구체적 핵산 증폭산물 수준 비교 방식은 당업계에 잘 알려져 있다. 본 발명의 일 실시예에 따르면, 상기 핵산 증폭산물의 검출은 마이크로입자에 포획된 핵산 증폭산물의 응집에 의해 측정될 수 있다.
본 발명에 있어서, “응집”이란 2개 이상의 분산되어 있는 핵산이 마이크로입자에 포획(capture)됨으로써 모여 집합상태를 이루는 것을 의미한다.
본 발명에 있어서, “앰플리콘(amplicon)”이란 핵산 증폭 반응에서 표적 폴리뉴클레오티드로부터 단일 또는 이중 가닥 형태로 증폭되는 표적 서열을 의미한다.
본 발명에 있어서, 상기 cDNA의 검출 한계 농도는 1 IU/ml 내지 15 IU/ml, 1 IU/ml 내지 13 IU/ml, 1 IU/ml 내지 10 IU/ml, 3 IU/ml 내지 15 IU/ml, 3 IU/ml 내지 13 IU/ml, 3 IU/ml 내지 10 IU/ml, 5 IU/ml 내지 15 IU/ml, 5 IU/ml 내지 13 IU/ml, 5 IU/ml 내지 10 IU/ml, 7 IU/ml 내지 15 IU/ml, 7 IU/ml 내지 13 IU/ml, 또는 7 IU/ml 내지 10 IU/ml일 수 있으나, 이에 제한되는 것은 아니며, 본 발명에 따른 핵산 증폭산물 검출 방법을 통해 농도가 15 IU/ml 미만으로 낮은 경우에도 cDNA의 증폭산물을 검출할 수 있다.
본 발명에 있어서, 상기 마이크로입자 기반 핵산 증폭산물 검출 방법은 민감도가 90 % 이상일 수 있으며, 예컨대 90 % 내지 100 %, 90 % 내지 98 %, 90 % 내지 96 %, 90 % 내지 94 %, 90 % 내지 92 %, 92 % 내지 95 %, 92 % 내지 97 %, 92 % 내지 100 %, 95 % 내지 97 %, 95 % 내지 100 %, 97 % 내지 100 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 또는 100 %일 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법으로서, RNA를 추출 후 역전사를 통해 cDNA를 합성하고 이를 증폭시킨 다음 증폭된 cDNA에 마이크로입자를 처리하여 응집을 통해 시각적으로 증폭된 cDNA를 검출하는 마이크로입자 기반 시각적 검출 시스템을 “STAT-DNA”라고 칭할 수 있다.
본 발명의 다른 양태로서, 본 발명은 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트; 및
스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 포함하는, 마이크로입자 기반 핵산 검출용 키트로서,
상기 키트는 원심분리 없이 마이크로입자에 포획되는 핵산의 응집을 검출하기 위해 사용되는 것을 특징으로 하는, 키트를 제공한다.
본 발명의 또 다른 양태로서, 본 발명은 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트; 및
스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 포함하는, 질병의 진단용 키트로서,
상기 키트는 원심분리 없이 마이크로입자에 포획되는 핵산의 응집을 검출하기 위해 사용되는 것을 특징으로 하는, 키트를 제공할 수 있다.
본 발명의 또 다른 양태로서, 본 발명은 (a) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)를 표지하여, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 제조하는 단계; 및
(b) 검출하고자 하는 핵산의 증폭산물이 포획되도록 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 제조하는 단계를 포함하는 질병의 진단을 위한 제제를 제조하는 방법으로서,
상기 제제는 원심분리 없이 마이크로입자에 포획되는 핵산의 응집을 검출하기 위해 사용되는 것을 특징으로 하는, 방법을 제공할 수 있다.
본 발명에 있어서, 상기 키트는 컨테이너, 지시서(instruction); 및 본 발명에 따른 상기 프라이머 세트 및 마이크로입자를 포함할 수 있다. 상기 컨테이너는 본 발명에 따른 상기 프라이머 세트 및 마이크로입자를 포장하는 역할을 할 수 있고, 보관 및 고정하는 역할을 할 수도 있다. 상기 컨테이너의 재질은 예컨대, 플라스틱, 유리병 등일 수 있으나, 이에 제한되는 것은 아니다. 상기 지시서에는 예를 들어, 키트의 특성, 구성 또는 사용방법 등이 기재되어 있을 수 있다.
본 발명에 있어서, 상기 키트는 상기 프라이머 세트 및 마이크로입자 외에 당해 기술분야에 공지된 PCR 또는 등온 핵산 증폭에 통상적으로 사용되는 물질을 더 포함할 수 있으며, 예컨대 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오타이드(dNTPs), Taq-중합효소 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-물(DEPC-water), 또는 멸균수 등을 포함할 수 있다.
본 발명의 다른 양태로서, 본 발명은 하기 단계를 포함하는, 질병의 진단 또는 발병 예측을 위한 정보제공방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
본 발명의 또 다른 양태로서, 본 발명은 하기 단계를 포함하는, 질병의 진단방법을 제공한다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
본 발명에 있어서, 상기 (a) 내지 (d) 단계에 추가로 (e) 마이크로입자에 포획된 핵산 증폭산물의 응집이 검출된 경우 질병을 가진 것으로 판정하는 단계를 더 포함할 수 있다.
본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법 또는 질병의 진단방법은 표적 핵산을 증폭시킨 다음 마이크로입자의 첨가만으로 별도의 과정이나 장치 없이 마이크로입자에 포획된 핵산 증폭산물의 응집을 높은 민감도로 쉽고 빠르게 육안으로 검출할 수 있어, 감염성 질환 등의 질병을 신속하게 진단할 수 있으며, 이를 통해 치료제 투여 등과 같은 질병에 대한 즉각 대응이 가능하다.
이에, 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법 또는 질병의 진단방법은 질병의 치료에 효과적으로 사용될 수 있다.
본 발명의 또 다른 양태로서, 본 발명은 하기 단계를 포함하는, 질병의 치료방법을 제공할 수 있다:
(a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
(b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
(c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계;
(d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계;
(e) 마이크로입자에 포획된 핵산 증폭산물의 응집이 검출된 경우 질병을 가진 것으로 판정하는 단계; 및
(f) 상기 (e) 단계에서 판정된 질병을 치료하는 단계.
단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
본 발명에 있어서, 상기 검출하고자 하는 핵산은 질병의 진단 또는 발병 예측을 위해 검출하고자 하는 핵산으로서, 질병의 발병 원인이 되는 세균 또는 바이러스의 핵산일 수 있다.
본 발명에 있어서, 상기 질병은 핵산 증폭 검사가 가능한 질병이라면 그 종류에 제한이 없으며, 감염성 질환 또는 암 등을 포함할 수 있다. 본 발명의 일 실시예에 따르면 상기 질병은 감염성 질환일 수 있다.
본 발명에 있어서, “감염성 질환”이란 병원성 미생물이 사람이나 동물, 식물의 조직, 체액, 표면에 정착하여 증식함으로써 발생하는 질환을 의미하며, 감염 경로, 전염성 여부에 따라 여러 종류로 구분될 수 있다. 상기 감염은 바이러스성 감염, 진균 감염, 세균 감염, 원충 감염 및 기생충 감염을 포함한다. 본 발명에 있어서, 상기 감염성 질환은 C형 간염, B형 간염, 인플루엔자, 인간 면역결핍 바이러스(HIV) 유도 에이즈(AIDS), 결핵, 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV) 감염증, 및 코로나 바이러스 감염증-19(중증 급성 호흡기 증후군 코로나 바이러스 2 감염증)(SARS-CoV-2; COVID-19)로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 “치료”는 목적하는 질병과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, 화학 요법, 방사선 요법, 외과적 수술, 생물학적 요법, 또는 항생제 투여 등의 방법을 사용할 수 있다.
본 발명에 있어서, 상기 화학 요법(Chemotherapy)은 특정 질병의 치료를 위해 화학물질을 사용하는 행위와 그때 사용되는 약물 전체를 의미한다.
본 발명에 있어서, 상기 약물은 예컨대, 파클리탁셀(paclitaxel), 독소루비신(doxorubicin), 5-플루오로우라실(5-fluorouracil), 시스플라틴(cisplatin), 이마티닙(Imatinib), 카보플라틴(carboplatin), 옥살리플라틴(oxaliplatin), 테가푸르(tegafur), 이리노테칸(irinotecan), 도세탁셀(docetaxel), 사이클로포스파미드(cyclophosphamide), 셈시타빈(cemcitabine), 이포스파미드(ifosfamide), 미토마이신 C(mitomycin C), 빈크리스틴(vincristine), 에토포사이드(etoposide), 메토트렉세이트(methotrexate), 토포테칸(topotecan), 타모시펜(tamoxifen), 비노렐빈(vinorelbine), 캄토테신(camptothecin), 다누오루 비신(danuorubicin), 클로람부실(chlorambucil), 브리오스타틴-1(bryostatin-1), 칼리케아미신(calicheamicin), 마이아탄신(mayatansine), 레바이솔(levamisole), DNA 재조합 인터페론 알파-2a(DNA recombinant interferon alfa-2a), 미토산트론(mitoxantrone), 니무스틴(nimustine), 인터페론 알파-2a(interferon alfa-2a), 독시플루리딘(doxifluridine), 포메스테인(formestane), 류프롤라이드 아세테이트(leuprolide acetate), 메게스트롤 아세테이트(megestrol acetate), 카모포르(carmofur), 테니포사이드(teniposide), 블레오마이신(bleomycin), 카무스틴(carmustine), 헵타플라틴(heptaplatin), 엑세메스탄(exemestane), 아나스트로졸(anastrozole), 에스트라무스틴(estramustine), 카페시타빈(capecitabine), 고세렐린 아세테이트(goserelin acetate), 폴리사카라이드 칼륨(polysaccharide potassuim), 메드록시포게스테론 아세테이트(medroxypogesterone acetate), 에피루비신(epirubicin), 레트로졸(letrozole), 피라루비신(pirarubicin), 토포테칸(topotecan), 알트레타민(altretamine), 토레미펜 시트레이트(toremifene citrate), BCNU, 탁소텔(taxotere), 악티노마이신 D(actinomycin D), 및 이들의 합성 아날로그, 및 변형되거나 동일한 약효를 나타내는 물질로 이루어진 군에서 선택된 하나 이상의 항암제일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 약물은 항바이러스제일 수 있으며, 상기 항바이러스제는 C형 간염 바이러스의 증식을 억제하여 질병의 진행을 지연시키는 C형 간염 치료제일 수 있고, 예컨대 사이토카인인 페그인터페론 알파 2a(peginterferon-α-2a) 및 페그인터페론 알파 2b(peginterferon-α-2b); 단백분해효소 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 리바비린(ribavirin); 바이러스 단백질에 작용하는 항바이러스제(DAA; Direct-acting antivirals) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염으로 단일제인 보세프레비르(boceprevir), 다사부비르(dasabuvir), 다클라타스비르(daclatasvir), 아수나프레비르(asunaprevir), 및 소포스부비르(sofosbuvir) 및 복합제인 엘바스비르/그라조프레비르(elbasvir/grazoprevir), 글레카프레비르/피브렌타스비르(glecaprevir/pibrentasvir), 및 옴비타스비르/파리타프레비르/리토나비르(ombitasvir/paritaprevir/ritonavir)로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 항바이러스제는 HIV 바이러스 유도 AIDS 치료제일 수 있고, 예컨대 비뉴클레오시드 역전사 효소 억제제(NNRTIs; Non-nucleoside reverse-transcriptase inhibitors) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 에파비렌즈(efavirenz), 에트라비린(etravirine), 네비라핀(nevirapine), 도라비린(doravirine), 릴피비린(rilpivirine) 및 델라비르딘(delavirdine); 뉴클레오시드 역전사 효소 저해제(NRTIs; Nucleoside reverse-transcriptase inhibitors) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 지도부딘(zidovudine), 디다노신(didanosine), 잘시타빈(zalcitabine), 스타부딘(stavudine), 라미부딘(lamivudine), 아바카비어(abacavir), 테노포비르 디소프록시 푸마레이트(tenofovir disoproxil fumarate), 엠트리시타빈(emtricitabine) 및 테노포비르 알라페나미드 푸마레이트(tenofovir alafenamide fumarate); 단백분해효소 억제제(PIs; Protease inhibitors) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염으로 단일제인 사퀴나비르(saquinavir), 리토나비르(ritonavir), 인디나비르(indinavir), 넬피나비르(nelfinavir), 암프레나비르(amprenavir), 로비나비르(lopinavir), 아타자나비르(atazanavir), 포삼프레나비르(fosamprenavir), 티프라나비르(tipranavir), 다루나비르(darunavir) 및 복합제인 아타자나비르+코비시스타트(cobicistat), 다루나비르+코비시스타트, 및 리토나비르+로피나비르; 통합효소억제제(INSTI; Integrase Strand Transfer Inhibitor) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 돌루테그라비르(dolutegravir) 또는 랄테그라비르(raltegravir); 융합 억제제 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 엔푸버타이드(enfuvirtide); 및 CCR 5(Chemokine (C-C motif) ligand 5) 억제제 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염으로 단일제인 마라비록(maraviroc) 및 복합제인 코비시스타트/엘비테그라비르/엠트리시타빈/테노포비르 알라페나미드(cobicistat/elvitegravir/emtricitabine/Tenofovir alafenamide), 코비시스타트/엘비테그라비르/엠트리시타빈/테노포비르 디소프록실(cobicistat/Elvitegravir/emtricitabine/Tenofovir disoproxil) 및 아바카비르/돌루테그라비르/라미부딘(abacavir/dolutegravir/lamivudine)로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 항바이러스제는 인플루엔자 A 및 인플루엔자 B 바이러스 감염의 치료에 사용되는 독감 치료제일 수 있고, 상기 독감 치료제는 탈피(uncoating) 저해제 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 아만타딘(amantadine), 및 리만타딘(rimantadine); 및 뉴라미니다아제 저해제(NAIs; Neuraminidase inhibitors) 계열 화합물 또는 이의 유도체, 또는 이의 약학적으로 허용되는 염인 오셀타미비르(oseltamivir), 자나미비르(zanamivir), 페라미비르(peramivir), 발록사비르(baloxavir) 및 라니나미비어(laninamivir)로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 항바이러스제는 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV) 감염증, 또는 코로나 바이러스 감염증-19(중증 급성 호흡기 증후군 코로나 바이러스 2 감염증)(SARS-CoV-2; COVID-19) 감염의 치료에 사용되는 치료제일 수 있다.
본 발명에 있어서, 상기 항바이러스제는 B형 간염 바이러스의 증식을 억제하여 염증 완화, 섬유화 방지 및 간경변증, 감세포암종 발생을 예방하는 B형 간염 치료제일 수 있고, 예컨대 라미부딘(lamivudine), 클레부딘(clevudine), 텔비부딘(telbivudine), 엔테카비르(entecavir), 아데포비르(adefovir), 테노포비르 디소프록실(tenofovir disoproxil), 테노포비르 알라페나미드(tenofovir alafenamide) 및 베시포비르(besifovir)로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 약물은 결핵 치료제일 수 있고, 예컨대 에탐부톨(ethambutol), 이소니아지드(isoniazid), 피라진아마이드(pyrazinamide), 리팜피신(rifampicin), 스트렙토마이신(streptomycin), 및 아미카신(amikacin)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 방사선 요법은 x-선, 감마선 및 중성자를 포함하지만 이들로 제한되지 않는 고에너지 방사선을 환자에게 쪼이는 것을 의미한다. 이런 유형의 요법으로는 외부광선 요법, 내부 방사선 요법, 삽입 방사선, 근접 치료, 및 전신 방사선 요법을 들 수 있지만, 이에 제한되지 않는다.
본 발명에 있어서, 상기 외과적 수술은 치유, 치료 또는 진단 효과를 얻기 위해 개체의 신체에 대하여 손(hand) 혹은 기기와 함께 손의 방법적 작용을 포함하는 어떠한 치료상 또는 진단 처치를 모두 포함한다.
본 발명에 있어서, “개체”란 질병의 치료 또는 진단을 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에 있어서, 상기 생물학적 요법은 생물체에서 유래된 물질이나 생물체를 이용하여 생성시킨 물질을 함유한 생물학적 제제를 이용하여 직, 간접적으로 인체의 면역체계를 이용하는 치료법을 의미하며, 상기 생물학적 제제는 물리적, 화학적 시험만으로는 그 역가와 안정성을 평가할 수 없는 백신, 알레르겐, 항원, 호르몬, 사이토카인, 효소, 혈액 및 혈장, 면역 혈청, 단클론 항체, 발효 제품, 항독소, 및 실험실 진단제 등을 포함한다.
본 발명에 있어서, 상기 생물학적 제제는 예컨대 아달리무맙(Adalimumab), 알렘투주맙(Alemtuzumab), 베바시주맙(Bevacizumab), 세툭시맙(Cetuximab), 다라투무맙(Daratumumab), 파니투무맙(Panitumumab), 리툭시맙(Rituximab), 트라스투주맙(Trastuzumab), 퍼투주맙(Pertuzumab), 이필리무맙(Ipilimumab), 니볼루맙(Nivolumab), 펨브롤리주맙(Pembrolizumab), 아테졸리주맙(Atezolizumab), 더발루맙(Durvalumab), 아벨루맙(Avelumab), 토실리주맙(tocilizumab), 사릴루맙(sarilumab), 사트랄리주맙(satralizumab), 및 실툭시맙(siltuximab)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 항생제는 세균 감염을 치료하는데 사용되는 약물을 의미하며, 예컨대 아미카신(amikacin), 겐타마이신(gentamicin), 카나마이신(kanamycin), 네오마이신(neomycin), 플라조마이신(plazomicin), 스트렙토마이신(streptomycin), 및 토브라마이신(tobramycin) 등을 포함하는 아미노글리코사이드(aminoglycoside)계; 도리페넴(doripenem), 에르타페넴(ertapenem), 이미페넴(imipenem), 및 메로페넴(meropenem) 등을 포함하는 카르바페넴(carbapenem)계; 세팔로스포린(cephalosporin)계; 시프로플록사신(ciprofloxacin), 델라플록사신(delafloxacin), 제미플록사신(gemifloxacin), 레보플록사신(levofloxacin), 목시플록사신(moxifloxacin), 노르플록사신(norfloxacin), 및 오플록사신(ofloxacin) 등을 포함하는 플루오로퀴놀론(fluoroquinolone)계; 달바반신(dalbavancin), 오리타반신(oritavancin), 테이코플라닌(teicoplanin), 텔라반신(telavancin), 및 반코마이신(vancomycin) 등을 포함하는 글리코펩티드(glycopeptide)계와 리포글리코펩티드(lipoglycopeptide)계; 아지스로마이신(azithromycin), 클라리스로마이신(clarithromycin), 에리스로마이신(erythromycin), 및 피닥소미신(fidaxomicin) 등을 포함하는 마크롤라이드(macrolide)계; 아즈트레오남(aztreonam) 등을 포함하는 모노박탐(monobactam)계; 리네졸리드(linezolid) 및 테디졸리드(tedizolid) 등을 포함하는 옥사졸리디논(oxazolidinone)계; 아목시실린(amoxicillin), 암피실린(ampicillin), 카르베니실린(carbenicillin), 디클록사실린(dicloxacillin), 나프실린(nafcillin), 옥사실린(oxacillin), 페니실린(penicillin) G, 페니실린(penicillin) V, 피페라실린(piperacillin), 및 티카르실린(ticarcillin) 등을 포함하는 페니실린(penicillin); 바시트라신(bacitracin), 콜리스틴(colistin), 및 폴리믹신(polymyxin) B 등을 포함하는 폴리펩티드(polypeptide)계; 리파부틴(rifabutin), 리팜핀(rifampin), 리파펜틴(rifapentine), 및 리팍시민(rifaximin) 등을 포함하는 리파마이신(rifamycin)계; 마페니드(Mafenide), 술파아세타미드(sulfacetamide), 술파디아진(sulfadiazine), 술파독신(sulfadoxine), 술파메티졸(sulfamethizole), 술파메톡사졸(sulfamethoxazole), 설파닐아마이드(sulfanilamide), 설파살라진(sulfasalazine), 및 술피스옥사졸(sulfisoxazole) 등을 포함하는 술폰아미드(sulfonamide)계; 퀴누프리스틴(quinupristin), 및 달포프리스틴(dalfopristin) 등을 포함하는 스트렙토그라민(streptogramin)계; 및 독시사이클린(doxycycline), 에라바사이클린(eravacycline), 미노사이클린(minocycline), 오마다사이클린(omadacycline), 및 테트라사이클린(tetracycline) 등을 포함하는 테트라사이클린(tetracycline)계로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 실험예에서는 본 발명에 따른 핵산 증폭산물 검출 방법을 이용하여 HCV의 cDNA를 증폭시킨 후 항-디곡시게닌 항체 코팅된 마이크로입자 및 스트렙타비딘 코팅된 마이크로입자를 첨가하였을 때 cDNA 증폭산물이 존재하는 경우 상기 마이크로입자에 의해 응집이 발생하는 것을 육안으로 확인하였다. 이때 상기 마이크로입자의 농도는 앰플리콘 응집의 명확한 시각화를 생성하도록 최적화되었으며, 마이크로입자의 최적 농도는 10 mg/ml의 스트렙타비딘 자성 비드 2 μl 및 5 mg/ml의 항-디곡시게닌 알파 입자 1 μl 로 결정되었다(실험예 1 참조).
본 발명의 다른 실험예에서는 본 발명에 따른 핵산 증폭산물 검출 방법의 재현 가능성 및 검출 한계(LOD)를 101, 102, 103 및 104 IU/ml 농도의 HCV cDNA를 이용하여 확인한 결과, 101 IU/ml 정도에서도 응집이 선명하게 보이는 것이 관찰되어, 15 IU/ml 미만의 낮은 농도의 검출 한계를 가진 분석이 권장되었다(실험예 2 참조).
본 발명의 또 다른 실험예에서는, 본 발명에 따른 핵산 증폭산물 검출 방법을 이용하는 경우 높은 민감도로 핵산 증폭산물을 검출할 수 있음을 확인하였다(실험예 3 참조).
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예 및 실험예를 제시한다. 그러나 하기의 실시예 및 실험예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예 및 실험예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 증폭된 DNA의 마이크로입자 기반 시각적 검출 방법: 바이오센서의 구축
본 발명에 따른 증폭된 DNA의 마이크로입자 기반 시각적 검출 시스템(STAT-DNA)의 원리는 도 1에 나타내었다. 최종 최적화된 프로토콜은 다음과 같은 단계로 진행되었다.
정방향/역방향 프라이머로 증폭된 핵산은 각각 5' 및 3' 말단에서 비오틴(biotin) 및 디곡시게닌(digoxigenin)과 같은 다른 분자로 표지하였다. 비오틴화된(biotinylated) 정방향 프라이머 및 디곡시게닌으로 표지된 역방향 프라이머로 RT-PCR을 통해 증폭 후, 2 μl의 스트렙타비딘(streptavidin) 코팅된 자성 비드 현탁액(1 μm 크기, 10 mg/ml Dynabead MyOne Streptavidin C1, Life Technologies, Grand Island, NY, 미국) 및 1 μl의 항-디곡시게닌 폴리스티렌(polystyrene) 입자(250-350 nm 크기의 항-디곡시게닌 알파 공여체 비드, PerkinElmer, Waltham, MA, 미국, pH 7.2의 PBS에서 5 mg/ml)를 증폭된 DNA를 포함하는 PCR 튜브에 추가한 다음 시각적 응집을 생성하고 60 μl LISS(Low Ionic Strength Solution) 완충액(BLISS, Ortho-Clinical Diagnostics)을 추가하여 양성(+) 결과와 음성(-) 결과를 명확하게 구분하였다.
입자 응집은 증폭된 HCV cDNA의 존재 하에 상기 비드를 첨가한 후 몇 초 이내에 시각화되었다. 그 결과, 도 2에 나타낸 바와 같이, 표적이 없는 상태에서 입자의 응집은 음성 결과를 나타내었으며, 스트렙타비딘 코팅된 자성 비드(Dynabeads) 대신 스트렙타비딘 코팅된 청색 폴리스티렌 입자(0.3-0.39 μm, SPHERO, Spherotech, Lake Forest, IL, 미국)와 같은 다른 마이크로 입자로 동일한 실험을 추가로 수행하였을 때, 증폭된 HCV cDNA의 존재 여부에 따라 비드 첨가에 의한 응집 양성 및 음성 결과를 육안으로 명확하게 관찰할 수 있었다.
응집으로 인한 혼합물은 시각적으로 또는 스마트폰과 같은 다른 광학 기기로 관찰되었으며, 양성 결과 및 음성 결과를 객관적으로 구분하기 위해 스마트폰을 사용하였다.
HCV 앰플리콘(amplicon)의 직접적인 시각적 검출이 최적화되었고, HCV RNA 검출 및 정량화를 위해 분석 감도 및 검출 시스템의 비교가 기존 실시간 PCR 테스트, Roche cobas 6800 시스템의 cobas HCV 테스트(Roche Molecular Diagnostics International, Rotkreuz, 스위스)와 비교하여 평가되었다.
[최적화]
입자 농도 최적화를 위해 0.5 μl 내지 2 μl 범위의 다양한 입자 농도로 분석을 수행하였으며, 모든 실험은 세 번 이상 수행하였다.
실시예 2. HCV RNA 추출 후 cDNA 합성 및 RT-PCR
2-1. 샘플 수집
2018년 5월부터 2020년 10월까지 서울 아산 병원에서 HCV에 감염된 환자로부터 혈청 샘플을 채취하였다. Roche cobas 6800 시스템(Roche Molecular Diagnostics)으로 일상적인 HCV RNA 테스트 후 남은 또는 잔류 혈청 샘플을 각각 분취하여 -80 ℃에서 보관하였으며, 실험은 서울 아산 병원 윤리 심사위원회의 승인을 받았다(IRB No. 2017-1742).
2-2. RNA 추출
제조업체의 지침에 따라 QIAamp MinElute Viurs Spin Kit(Qiagen, Germantown, MD)를 사용하여 임상 샘플로부터 50 μl의 HCV RNA를 추출하였다. 그런 다음 상기 핵산은 -80 ℃에서 보관하였다.
2-3. cDNA 합성
HCV cDNA 합성은 제조업체의 프로토콜에 따라 Roche Transcriptor First Strand cDNA Synthesis Kit(Roche, Mannheim, 독일)를 사용하여 수행하였다.
즉, 5 μl의 분리된 RNA 샘플을 0.5 μl의 Transcriptor Reverse Transcriptase(Roche), 2 μl의 랜덤 6량체(20 pmol), 2 μl의 데옥시뉴클레오타이드(deoxynucleotide) 혼합물, 0.5 μl의 Protector RNase inhibitor, 6 μl의 뉴클레아제(nuclease)가 없는 물(Roche), 및 상기 물질들의 5x 반응 혼합물 4 μl를 함유하는 20 μl의 역전사(reverse transcription, RT) 반응 혼합물과 혼합하였다. 그런 다음 샘플을 cDNA 합성 프로토콜을 사용하여 FX 열 순환기(Bio-Rad, California, USA)에서 배양하였다(25 ℃에서 10 분 동안, 그 다음 55 ℃에서 30 분 동안, 그런 다음 85 ℃에서 5 분 동안). cDNA 샘플은 PCR 분석까지 -80 ℃에서 보관하였다.
2-4. RT-PCR
HCV mRNA의 단순 시각적 검출을 위한 역전사-중합효소연쇄반응(reverse transcription-polymerase chain reaction, RT-PCR)의 프라이머는 HCV의 5'-비번역 영역(5'-UTR)(Chen, 2016 # 637)에 대해 특이적으로 특별히 설계된 한 쌍의 프라이머를 사용하여 변형되었으며, HCV 앰플리콘의 생성된 산물의 길이는 157 bp였다.
이때, 사용한 프라이머 서열은 하기 표 1에 나타내었다.
Primer Sequence Location PCR target size
Forward primer 5'-biotin-TGCACGGTCTACGAGAC-3′
(서열번호 1)		 322-339† 157 Bp
Reverse primer 5'-Dig_N/CGACCGGGTCCTTTCTTGGAT
(서열번호 2)		 182-203
정방향 프라이머는 5' 말단에서 비오틴화되었고 역방향 프라이머는 5' 말단에서 디곡시게닌으로 표지되었다. 이들은 각각 스트렙타비딘-표지된(streptavidin-labeled) 자성 비드(Dynabead MyOne Streptavidin C1) 및 항-디곡시게닌 항체 코팅된 폴리스티렌 입자(항-디곡시게닌 알파 공여체 비드, PerkinElmer)로 포획하기 위해 준비되었다.
RT-PCR 분석은 QIAGEN Taq PCR Master Mix Kit(Qiagen)를 사용하여 사용 설명서에 따라 수행하였다. 즉, 5 μl의 HCV cDNA를 12.5 μl의 QIAGEN Taq PCR Master Mix(Qiagen)를 포함하는 25 μl의 반응 부피에서 증폭시켰다; 10 μmol/L의 비오틴화된 정방향 프라이머 1 μl; 10 μmol/L의 디곡시게닌 표지된 역방향 프라이머 1 μl 및 증류수(distilled water, DW). 다음 조건에서 Applied Biosystems 7500 기기[AB Sciex, Foster City, CA (이전 Applied Biosystems)]를 이용하여 열 순환을 수행하였다: 94 ℃, 5 분; 95 ℃에서 30초 동안, 56 ℃에서 30초 동안, 72 ℃에서 30초 동안, 및 72 ℃에서 10분 동안 최종 연장(40 cycle). 그런 다음, 2 % 아가로스(agarose) 겔 전기 영동을 사용하여 HCV PCR 산물을 검출하였다.
[실험예]
실험예 1. 분석 최적화: 앰플리콘 포획 및 비앰플리콘 자성 비드의 이동성 차이 확인
마이크로입자(항-디곡시게닌 항체 코팅된 마이크로입자, 스트렙타비딘 코팅된 마이크로입자)의 농도는 앰플리콘 응집의 명확한 시각화를 생성하도록 최적화되었으며, 마이크로입자의 최적 농도는 2 μl의 스트렙타비딘 자성 비드(S-b)/청색 폴리스티렌 입자(Blue-b) 10 mg/ml 및 1 μl의 항-디곡시게닌 알파 입자(alpha-b) 5 mg/ml로 결정되었다. 이러한 마이크로입자의 농도 및 함량에서 응집을 통한 핵산 검출을 위한 결과를 도 3에 나타내었다. 도 3에서는 tapping의 방법이 실험자 마다 차이가 있을 수 있어 mixer(HulaMixer Sample Mixer, Thermo Fisher Scientific)를 10초 정도 사용하여 재현성을 높인 예시를 보여주고 있는데, mixer의 조건을 최적화하여 음성과 응집이 일어난 양성 검체간 구별이 되도록 하였다.
마이크로입자에 대한 접합과 같은 여러 최적화를 피하기 위하여 본 발명에서 재현 가능성을 위해 상업적으로 이용 가능한 항체가 코팅 또는 접합된 마이크로입자를 선택하였다. 시판되는 여러 항-디곡시게닌 입자 중에서, 디곡시게닌 표지된 역방향 프라이머를 포획하기 위해 항-디곡시게닌 폴리스티렌 입자(250-350 nm 크기의 항-디곡시게닌 알파 공여체 비드, PerkinElmer, Waltham, MA, 미국, pH 7.2의 PBS에서 5 mg/ml)를 선택하였다.
기존 보고된 연구인 lateral flow 형태의 분자진단기술에서는 강렬한 적색선을 생성하기 위한 포획 시약의 최소량은 스트렙타비딘 코팅된 마이크로입자 및 항-디곡시게닌 항체 코팅된 마이크로입자 모두에 대해 20 μg을 사용한 반면 본 발명에서는 5-10 μg 정도로 적은 양을 사용할 수 있었다. 또한 기존 lateral flow 형태의 분자진단기술에 필요한 측면 흐름 딥스틱(dipstick), 멤브레인 페이퍼, 선(line) 조제(dispensing)를 위한 조제 시스템은 본 발명에서 필요하지 않았으며, 단백질 차단제, 안정제, 멤브레인에서 포획 시약의 고정이 필요하지 않았다. 기존 lateral flow 형태의 기술을 적용한 검출 과정에는 가열을 포함한 추가 혼성화 단계 등 추가 단계가 필요하지만 본 발명에서는 이러한 추가 과정이 필요없었다.
기존 측면 흐름 방법(lateral flow)에 기반한 DNA 센서의 안정성 또는 저장 수명은 제한되었으며, 원심 미세 유체 플랫폼, 형광 스캐닝 또는 UV 광원을 포함한 복합 설정 및 검출 메커니즘이 요구되었지만 본 발명에서는 전혀 필요하지 않았다.
스마트폰 기반의 PCR 앰플리콘 시각적 검출은 전력, 모터 구동 또는 원심력의 도움 없이 수행되었다.
먼저, 표적 앰플리콘을 포획하는 '양성' 자성 비드와 표적 앰플리콘을 포획하지 않는 '음성' 자성 비드 사이의 입자 응집 차이를 몇 분 내에 관찰하였다.
PCR 반응 튜브에 마이크로입자를 추가한 후, 입자 응집을 스마트폰뿐만 아니라 시각적으로 모니터링하였다. 이 직접적인 육안 관찰은 스마트폰으로 확인되었으며, 도 2에 나타낸 바와 같이 양성 샘플은 특징적인 응집 및 침전을 나타내었고, 음성 대조군은 응집 및 침전 없이 흐려진 용액으로 유지되었다. 또한, 입자 응집을 400x 및 1000x 배율로 확대하여 관찰한 결과, 도 4a에 나타낸 바와 같이 표적 앰플리콘 존재 하에 스트렙타비딘 코팅된 자성 비드 및 항-디곡시게닌 항체 코팅된 알파 공여체 비드 첨가 시 응집이 형성되는 것을 확인하였으며, 표적 앰플리콘이 존재하지 않는 경우 도 4b에 나타낸 바와 같이 응집이 형성되지 않는 것을 확인하였다.
실험예 2. 재현 가능성 및 검출 한계
본 발명에 따른 방법의 정밀도 및 검출 한계(LOD)는 HCV cDNA를 101, 102, 103 및 104 IU/ml 농도로 연속 희석하여 결정되었다. 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서의 재현 가능한 결과는 연속 희석 샘플로 5일 동안 두 번의 실행을 수행하여 얻었다. 상기 바이오센서의 검출 한계는 기존의 연속 희석된 PCR 앰플리콘의 아가로스 겔 방법으로 얻은 결과와 비교함으로써 결정되었다.
그 결과, 도 5에 나타낸 바와 같이, 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서를 이용하여 스트렙타비딘 코팅된 청색 폴리스티렌 입자(A)/자성 비드(B) 및 항-디곡시게닌 항체 코팅된 알파 공여체 비드를 첨가한 후 증폭된 cDNA의 응집을 확인하였을 때, NTC(no template control)에서는 응집이 발생하지 않은 반면, ~101 IU/ml 정도에서도 응집이 선명하게 보이는 것이 관찰되었다. 상기 바이오센서는 기존 PCR 또는 실시간 PCR과 비슷하였고, 15 IU/ml 미만의 낮은 HCV RNA 검출 한계를 가진 분석이 권장되었다.
실험예 3. 민감도, 분석 특이성
본 기술의 분석 특이성을 평가하기 위해, HCV 바이러스 이외 다른 여러 바이러스 균주의 핵산을 사용하였다.
본 발명에 따른 증폭된 HCV 핵산 진단용 마이크로입자 기반 시각적 검출 바이오센서는 다음 8 가지 바이러스의 핵산을 검출하지 않았다; 인간리노바이러스(human rhinovirus, HRV), 인플루엔자(influenza) A, B, 노로바이러스(norovirus), 인간 마타페누모바이러스(matapenumovirus), 파라인프루엔자타입3(parainfluenza virus type 3, PIV3), CoV-229E, 아데노바이러스(adenovirus). DNA 바이오센서 결과는 실시간 PCR 결과와 일치하였다. 비교에 사용된 각 바이러스와 실시간 PCR 결과 (CT(Cycle Threshold))값은 하기 표 2에 나타내었다.
연구검체번호 날짜 비교에 이용한 바이러스 CT 값
AMC-0001 190403 HRV 33.59
AMC-0002 190403 Flu B 30.16
AMC-0003 190403 Flu A(H3) 32.08
AMC-0015 190408 Norovirus 23.95
AMC-0021 190411 hMPV 23.17
AMC-0022 190411 PIV 3 18.08
AMC-0033 190418 CoV-229E 19.87
AMC-0058 　 ADV 20.03
이와 같이, 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 분석 특이성을 가지는 것을 알 수 있었다.
또한, 본 발명에 따른 바이오센서의 민감도를 확인하기 위해, 실제 임상 검체(HCV 양성 4, 5, 6; 음성 N4, N5, N6)로 전기영동한 결과와 본 발명에 따른 방법으로 스트렙타비딘 코팅된 마이크로입자(S-b) 및 항-디곡시게닌 항체 코팅된 알파 공여체 비드(alpha-b)를 첨가하였을 때의 응집 결과를 비교한 결과, 도 6에 나타낸 바와 같이 HCV 양성(4, 5, 6) 검체에서 응집이 일어나는 것을 관찰하였다.
이에 더하여, 기존 핵산 증폭 검출방법과 비교했을 때, 도 7에 나타낸 바와 같이 기존 핵산 증폭 검출방법을 이용한 경우 PCR 40회 사이클에서의 전기영동 결과에서는 밴드가 관찰되지 않고(도 7의 상단 도면 내 화살표), 45회 사이클에서의 전기영동 결과에서만 밴드가 관찰되는 것을 확인한 반면, 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출방법을 이용한 경우 PCR 40회 사이클 수행시에도 선명한 응집(양성) 반응을 나타내는 것을 확인하였다(도 7의 하단 도면).
따라서, 상기 결과로부터 본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출방법을 이용할 경우, 높은 민감도로 표적 핵산의 증폭산물을 검출할 수 있음을 확인하였다.
실험예 4. 임상 샘플과의 비교
본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 Roche Cobas 6800 HCV 테스트(Roche HPV; Roche Molecular Diagnostics, Pleasanton, CA, 미국)의 결과와 비교되었다. 54개의 냉동 샘플 중 32개는 Roche HCV 키트와 비교하여 상기 바이오센서에 의해 HCV에 대해 양성으로 확인되었고 22 개는 음성으로 확인되었다. 모두 100% 기존 결과와 일치하였다.
실험예 5. 시각적 검출 시스템의 장점
본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 특히 측면 흐름 기반 검출과 비교하여 DNA 센서 중에서 가장 간단한 시각적 검출 시스템 중 하나였다. 이는 또한 임상 등급 HCV real-time PCR에 비교하여 견고하고 민감하였다. 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 기존 실시간 PCR에 비교하여 고감도로 여러 번의 배양, 흡착/용리 및 세척 단계 없이 몇 분 안에 HCV 앰플리콘을 검출할 수 있었다.
HCV 감염으로 진단받은 사람의 수를 개선하는 것은 바이러스성 간염을 제거하는 데 중요하며, HCV 스크리닝 및 진단을 위해 POC를 포함한 기존 HCV 검사에 대한 대안이 시급히 필요하다.
본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서를 통해 증폭된 DNA를 식별할 때 몇 가지 장점이 있는데, 상기 시스템은 특별한 정교한 기기, 고정화 기술, 표면 플라즈몬(plasmon) 공명과 같은 변환 기술(Qiu, 2020 # 688), 전기 화학적 변환(Abad-Valle, 2005 # 689), 및 표면 강화 Raman 산란(SERS) 기반 바이오센서(Wang, 2019 # 686)를 필요로 하지 않았다. 또한, 마이크로입자만 눈에 띄기 때문에 색상이나 신호 발생 과정이 필요하지 않았으며, 시각화가 생성되는 PCR 반응 튜브로 인해 구동력이나 미세 유체 작동이 필요하지 않았다. 이전 연구에서 PASS-DNA(Yang, 2019 # 608)의 주요 한계는 검출을 위한 분리막의 필요성이었다.
금 나노입자(AuNP)는 표면 플라즈몬 공명(SPR)과 같은 특성을 가지며 가시적인 색상과 스펙트럼 변화를 겪는다(Ghasemi, 2018 # 699). 따라서, pH, 이온 강도, 촉매 DNA 회로 또는 전하 의존적 방식에 의해 유도된 가교, 비가교 또는 변형되지 않은 전하 기반 응집에 기반한 금 나노입자 응집은 핵산 검출을 위한 비색 분석에 널리 사용되어왔다(Ghasemi, 2018 # 699; Mohammed, 2019 # 697; Ravan, 2020 # 698; Shawky, 2017 # 696). 그러나 콜로이드 용액이 적색에서 청색으로 변색되기 위해서는 금 나노입자의 응집을 유도하기 위한 정교한 노력이 필요하다.
일반적으로, 특히 실시간 PCR 형식에서 프로브 기반 검출과 같은 추가 특정 검출 설계를 고려하지 않는 한, 프라이머-다이머(primer-dimer)는 문제가 되는 거짓 양성을 생성할 수 있다. 그러나 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 프라이머-다이머와 같은 매우 짧은 서열로 입자가 닫힐 수 없기 때문에 프라이머-다이머에 의한 영향을 최소화한다.
자성 나노입자 기반 포획은 우수한 분산, 저렴한 비용, 간편한 분리, 버퍼 시스템의 정제 및 신호 검출로 인해 DNA 센서에 널리 사용되어 왔다(Tang, 2020 # 701). 그러나 그들의 신호 검출에는 형광, 전기 화학 또는 화학 발광을 위한 추가 신호 개발 프로세스가 요구되었다(Zhuang, 2019 # 702; Cortina, 2016 # 704; Ali, 2016 # 703).
본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 방법에서는 자성으로 제어 가능한 응집, 정제 및 분리를 위해 자성 나노입자의 특성을 사용하지 않았다. 자성 입자의 역할은 그들이 응집될 때 육안으로만 볼 수 있다. 이는 상기 방법에서 스트렙타비딘 코팅된 청색 입자의 역할과 동일하다.
분자 검출에 있어 단순하고 저렴하며 복잡한 기기가 필요하지 않기 때문에 자원이 제한된 환경에서 분자 POC 용 DNA 바이오센서 개발이 촉진되었으며(Sayad, 2018 # 681), 측면 유동 면역분석법(lateral flow immunoassay, LFIA)은 이러한 요구를 충족한다. HCV를 검출하기 위해 PCR과 LFIA를 결합한 여러 연구가 발표되었으나(Zhuang, 2019 # 702), LFIA에 의해 증폭된 DNA의 검출은 다소 복잡한 설정이며 포획 올리고(oligo)(Liu, # 532; Gao, # 534; Abad-Valle, 2005 # 689) 또는 항체(Rosa, #533), 및 정교한 검출 프로브 또는 서열 디자인(Kalogianni, 2006 # 679)과 같은 센서의 표면에 대한 기술이 필요하다. 또한, 타겟과의 혼성화를 위해서는 가열 공정도 필요하다(Kalogianni, 2006 # 679). 포획된 DNA를 검출하기 위해서는 형광 스캐닝(Dou, 2014 # 682) 또는 청색광 조명 하에 시각적 RT-LAMP-CRISPR 검출(Wang, 2021 # 690)을 포함한 신호 검출 단계를 필요로 한다.
마이크로입자에 대한 접합과 같은 여러 최적화를 피하거나 최적화 중에 예상치 못한 가변성을 제거하기 위하여, 상업적으로 이용 가능한 항체가 코팅 또는 접합된 마이크로입자를 비오틴 또는 디곡시게닌 표지된 프라이머를 포획하기 위해 선택하여 준비하였다. 시판되는 여러 항-디곡시게닌 입자 중에서 PerkinElmer 알파 공여체 입자는 스트렙타비딘 코팅된 마이크로입자와 함께 DNA 앰플리콘의 응집을 성공적으로 생성하였다. 항-디곡시게닌 알파 공여체 입자는 250-350 nm 크기의 항-디곡시게닌 라텍스(latex) 기반 입자였으며(Yu, 2015 # 683), 원래 동질(세척 없음) 비드 기반 샌드위치 면역 분석에 사용되었다.
스마트폰 기반 PCR 앰플리콘의 시각적 검출은 전력, 모터 구동 또는 원심력의 도움 없이 처음으로 달성되었다(Gou, 2018 # 685). 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 바이오센서는 스마트폰 기반 검출에서도 검출되며, 이는 육안으로 응집을 시각화하는 것보다 더 식별 가능하고 정량적이었다. 또한 Sample-in-answer-out 기능이 있는 완전히 통합된 마이크로입자 기반 NAT가 저렴하고 사용자 친화적이며 빠르고 강력하고 자원 제한 설정에서 POCT의 구현을 상당히 개선할 것으로 예상되었다.
개념 증명을 위해, 핵산 증폭을 위한 기존의 2 단계 PCR을 사용하였다. 그러나 RT-qPCR의 시간 소모적인 장애를 극복하기 위해 등온 DNA 증폭 기술이 개발되어 현장에서 감염성 사망의 분자 진단을 제공하였다. 등온 증폭 방법(예: 재조합 효소 중합 효소 증폭(recombinase polymerase amplification, RPA) 및 루프 매개 등온 증폭(loop-mediated isothermal amplification, LAMP) 및 헬리카제 의존 증폭(helicase-dependent amplification, HDA)도 본 발명에 따른 증폭된 cDNA의 마이크로입자 기반 시각적 검출 시스템과 호환된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야 한다.
본 발명에 따른 마이크로입자 기반 핵산 증폭산물 검출 방법은 표적 핵산을 증폭시킨 다음 마이크로입자의 첨가만으로 별도의 과정이나 장치 없이 마이크로입자에 포획된 핵산 증폭산물의 응집을 육안으로 검출할 수 있으며, 높은 민감도로 쉽고 빠르게 표적 핵산의 증폭산물을 검출할 수 있어, 여러 가지 감염성 질환을 신속하게 진단하고 치료하는 데에 유용하게 이용될 것으로 기대되는 바, 산업상 이용가능성이 있다.

Claims (17)

  1. 하기 단계를 포함하는, 마이크로입자 기반 핵산 증폭산물 검출 방법:
    (a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
    (b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
    (c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
    (d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
    단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
  2. 제1항에 있어서,
    상기 프라이머 세트는 비오틴 및 디곡시게닌으로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머 및 역방향 프라이머로 구성되는 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  3. 제1항에 있어서,
    상기 마이크로입자는 스트렙타비딘 또는 항-디곡시게닌 항체로 코팅된 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  4. 제1항에 있어서,
    상기 시료는 전혈, 혈청, 혈장, 소변, 대변, 및 타액으로 이루어진 군으로부터 선택되는 하나 이상인 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  5. 제1항에 있어서,
    상기 (b) 단계에서 프라이머 세트는 핵산 증폭산물의 크기가 100 내지 200 bp가 되도록 제작된 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  6. 제1항에 있어서,
    상기 (b) 단계에서 증폭은 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 및 등온 증폭 방법으로 이루어진 군으로부터 선택되는 하나 이상의 방법에 의해 이루어지는 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  7. 제6항에 있어서,
    상기 등온 증폭 방법은 재조합 효소 중합 효소 증폭(recombinase polymerase amplification, RPA), 루프 매개 등온 증폭(loop-mediated isothermal amplification, LAMP), 및 헬리카제 의존 증폭(helicase-dependent amplification, HDA)으로 이루어진 군으로부터 선택되는 하나 이상인 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  8. 제1항에 있어서,
    상기 (c) 단계에서 마이크로입자의 직경은 0.25 내지 10 μm인 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  9. 제1항에 있어서,
    상기 (c) 단계에서 마이크로입자는 자성 비드(magnetic bead) 또는 폴리스티렌(polystyrene) 입자인 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  10. 제1항에 있어서,
    상기 cDNA의 검출 한계 농도는 1 내지 15 IU/ml인 것을 특징으로 하는, 마이크로입자 기반 핵산 증폭산물 검출 방법.
  11. 하기 단계를 포함하는, 감염성 질환의 진단을 위한 정보제공방법:
    (a) 피검체로부터 채취된 시료에서 RNA를 분리하여 cDNA를 합성하는 단계;
    (b) 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트를 이용하여 상기 cDNA를 증폭시키는 단계;
    (c) 상기 증폭된 cDNA에 스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 첨가하는 단계; 및
    (d) 상기 마이크로입자에 포획된 핵산 증폭산물의 응집을 검출하는 단계.
    단, 상기 (c) 단계와 (d) 단계 사이에 원심분리 단계는 포함하지 않음.
  12. 제11항에 있어서,
    상기 감염성 질환은 C형 간염, B형 간염, 인플루엔자, 인간 면역결핍 바이러스(HIV) 유도 에이즈(AIDS), 결핵, 중증 급성 호흡기 증후군 코로나 바이러스(SARS-CoV) 감염증, 및 코로나 바이러스 감염증-19(COVID-19)으로 이루어진 군으로부터 선택되는 하나 이상인 것을 특징으로 하는, 감염성 질환의 진단을 위한 정보제공방법.
  13. 비오틴(biotin), 디곡시게닌(digoxigenin), 항원, 표적분자 및 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머(forward primer) 및 역방향 프라이머(reverse primer)로 구성되고, 검출하고자 하는 핵산에 특이적으로 결합하는 프라이머 세트; 및
    스트렙타비딘(streptavidin), 아비딘(avidin), 상기 프라이머에 결합된 디곡시게닌 또는 항원에 항원-항체 반응을 통해 결합될 수 있는 항체, 상기 프라이머에 결합된 표적분자에 특이적으로 결합하는 앱타머(aptamer) 및 상기 프라이머에 결합된 올리고뉴클레오타이드에 상보적인 올리고뉴클레오타이드로 이루어진 군에서 선택되는 어느 하나로 코팅된 마이크로입자(microparticle)를 포함하는, 마이크로입자 기반 핵산 검출용 키트로서,
    상기 키트는 원심분리 없이 마이크로입자에 포획되는 핵산의 응집을 검출하기 위해 사용되는 것을 특징으로 하는, 키트.
  14. 제13항에 있어서,
    상기 프라이머 세트는 비오틴 및 디곡시게닌으로 이루어진 군에서 선택되는 어느 하나로 각각 표지된 정방향 프라이머 및 역방향 프라이머로 구성되는 것을 특징으로 하는, 마이크로입자 기반 핵산 검출용 키트.
  15. 제13항에 있어서,
    상기 마이크로입자는 스트렙타비딘 또는 항-디곡시게닌 항체로 코팅된 것을 특징으로 하는, 마이크로입자 기반 핵산 검출용 키트.
  16. 제13항에 있어서,
    상기 마이크로입자의 직경은 0.25 내지 10 μm인 것을 특징으로 하는, 마이크로입자 기반 핵산 검출용 키트.
  17. 제13항에 있어서,
    상기 마이크로입자는 자성 비드(magnetic bead) 또는 폴리스티렌(polystyrene) 입자인 것을 특징으로 하는, 마이크로입자 기반 핵산 검출용 키트.
PCT/KR2022/004617 2021-04-20 2022-03-31 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법 WO2022225220A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210051131A KR102625074B1 (ko) 2021-04-20 2021-04-20 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법
KR10-2021-0051131 2021-04-20

Publications (1)

Publication Number Publication Date
WO2022225220A1 true WO2022225220A1 (ko) 2022-10-27

Family

ID=83722440

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004617 WO2022225220A1 (ko) 2021-04-20 2022-03-31 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법

Country Status (2)

Country Link
KR (1) KR102625074B1 (ko)
WO (1) WO2022225220A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005010181A1 (ja) * 2003-07-25 2005-02-03 Credia Japan Co., Ltd. 核酸検出方法
EP0837946B1 (en) * 1995-07-13 2009-03-11 Applera Corporation Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
KR20100090730A (ko) * 2003-05-02 2010-08-16 하이 캉 라이프 코포레이션 리미티드 핵산 검출 방법
JP6623324B2 (ja) * 2015-09-07 2019-12-25 株式会社ファスマック 等温増幅反応産物の多項目同時検出方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101507914B1 (ko) 2013-04-26 2015-04-07 서울대학교산학협력단 신규한 바이페닐다이아마이드 유도체, 이의 약학적으로 허용 가능한 염 또는 이의 광학 이성질체, 이의 제조방법 및 이를 유효성분으로 함유하는 c형 간염 바이러스 관련 간질환의 예방 또는 치료용 약학적 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0837946B1 (en) * 1995-07-13 2009-03-11 Applera Corporation Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
KR20100090730A (ko) * 2003-05-02 2010-08-16 하이 캉 라이프 코포레이션 리미티드 핵산 검출 방법
WO2005010181A1 (ja) * 2003-07-25 2005-02-03 Credia Japan Co., Ltd. 核酸検出方法
JP6623324B2 (ja) * 2015-09-07 2019-12-25 株式会社ファスマック 等温増幅反応産物の多項目同時検出方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CAMPUZANO SUSANA, YÁÑEZ-SEDEÑO PALOMA, PINGARRÓN JOSÉ MANUEL: "Electrochemical Biosensing for the Diagnosis of Viral Infections and Tropical Diseases", CHEMELECTROCHEM, WILEY, CHICHESTER, vol. 4, no. 4, 1 April 2017 (2017-04-01), Chichester , pages 753 - 777, XP055979003, ISSN: 2196-0216, DOI: 10.1002/celc.201600805 *

Also Published As

Publication number Publication date
KR102625074B1 (ko) 2024-01-16
KR20220144608A (ko) 2022-10-27

Similar Documents

Publication Publication Date Title
Islam et al. An update on molecular diagnostics for COVID-19
CN111321251B (zh) 检测引起呼吸道感染的病原体并分型的组合物、试剂盒、方法及用途
CA2424867C (en) A kit for detecting non-pathogenic or pathogenic influenza a subtype h5 virus
JP3091492B2 (ja) 非放射性ハイブリダイゼーションアッセイおよびキット
Wang et al. Detection of nucleic acids and elimination of carryover contamination by using loop-mediated isothermal amplification and antarctic thermal sensitive uracil-DNA-glycosylase in a lateral flow biosensor: application to the detection of Streptococcus pneumoniae
Borchers et al. Prevalence of equine herpesvirus type 2 (EHV-2) DNA in ocular swabs and its cell tropism in equine conjunctiva
WO2010102460A1 (zh) 定性定量检测病原微生物遗传物质的方法及其试剂盒
WO2022095731A1 (zh) 用于检测新型冠状病毒的试剂盒及方法
Chen et al. A rapid water bath PCR combined with lateral flow assay for the simultaneous detection of SARS-CoV-2 and influenza B virus
CN110904198A (zh) 基于恒温扩增与基因编辑的核酸一步检测方法
WO2022225220A1 (ko) 마이크로입자 기반 핵산 검출용 키트 및 핵산 증폭산물 검출 방법
CN104726606A (zh) 一种pcr酶联双杂交法检测病原微生物检测方法
US10041945B2 (en) Methods of diagnosing and treating tuberculosis
WO2019059644A1 (ko) Esat6에 특이적으로 결합하는 dna 압타머 및 이의 용도
Aryee et al. Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey
Yang et al. Distinguishing Four HCV Genotypes by Loop Mediated Isothermal Amplification Assay.
Chen et al. Rapid and visual identification of HIV-1 using reverse transcription loop-mediated isothermal amplification integrated with a gold nanoparticle-based lateral flow assay platform
WO2019088429A1 (ko) 동형2기능성 이미도에스터를 이용한 액체생검 유래 생체물질의 추출 방법
WO2019059643A1 (ko) Cfp10에 특이적으로 결합하는 dna 압타머 및 이의 용도
JP6593335B2 (ja) 幹細胞の分化状態の判定方法及びこれに用いられる新規な分化マーカー
Alpen et al. Molecular diagnostics in low-grade gastric marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue type after Helicobacter pylori eradication therapy
CN115820818B (zh) 一种一步法核酸检测方法及其应用
RU2133472C1 (ru) Способ диагностики активной стадии цитомегаловирусной инфекции человека
WO2022177066A1 (ko) 유전자가위 기반 인플루엔자 바이러스 타입의 신속 검출
WO2024090872A1 (ko) 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22791920

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22791920

Country of ref document: EP

Kind code of ref document: A1