WO2024090872A1 - 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법 - Google Patents

유전자가위 기반 쯔쯔가무시증의 신속 진단 방법 Download PDF

Info

Publication number
WO2024090872A1
WO2024090872A1 PCT/KR2023/015970 KR2023015970W WO2024090872A1 WO 2024090872 A1 WO2024090872 A1 WO 2024090872A1 KR 2023015970 W KR2023015970 W KR 2023015970W WO 2024090872 A1 WO2024090872 A1 WO 2024090872A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
orientia tsutsugamushi
crispr
tsutsugamushi
Prior art date
Application number
PCT/KR2023/015970
Other languages
English (en)
French (fr)
Inventor
송윤재
박범주
Original Assignee
가천대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가천대학교 산학협력단 filed Critical 가천대학교 산학협력단
Publication of WO2024090872A1 publication Critical patent/WO2024090872A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • It relates to a rapid diagnosis method and kit for scrub typhus based on genetic scissors, specifically, using a primer set, guide RNA, and CRISPR-Cas12a specific for Orientia tsutsugamushi , which causes scrub typhus, and CRISPR-Cas12a.
  • a molecular diagnostic method for rapidly detecting and a kit therefor are disclosed.
  • Scrub typhus is a disease caused by infection with a bacterium called Orientia tsutsugamushi ( Orientia tsutsugamushi or O. tsutsugamushi ). It is a febrile disease called tick typhus, bush typhus, meadow fever, and scrub fever. Scrub typhus is known to be transmitted through the blood and lymph fluids when bitten by hair mite larvae infected with Orientia typhus bacteria, including in China, Japan, Thailand, Pakistan, Korea, northern Australia, and some islands in the Indian Ocean and Western Pacific. It is reported to occur in an area called the triangle (PLoS neglected tropical diseases.
  • Orientia typhus is a pleomorphic rod-shaped, Gram-negative bacterium that causes the febrile disease typhus typhus.
  • Strains of Orientia tsutsugamushi are distinguished through the diversity of the immune-dominant 56-kDa TSA gene (tsa56), which is present on the outer membrane surface of Orientia tsutsugamushi and is essential for attachment and penetration into host cells, and are divided into major strains.
  • tsa56 immune-dominant 56-kDa TSA gene
  • ICA immunochromatography
  • IFA antibody detection test
  • PHA passive hemagglutination
  • PCR gene detection test
  • patients are classified into probable patients and confirmed patients according to the standards for each method, and in Korea, they are divided according to the standards of the Korea Centers for Disease Control and Prevention.
  • ICA takes about 15 to 20 minutes and has a specificity and accuracy of over 98%, and if a positive result is obtained, the patient is classified as a probable patient (Journal of Korean medical science. 2016;31(8):1190-6) . If positive results are confirmed through IFA, PCR, and culture tests, the patient is classified as a confirmed patient.
  • IFA is generally considered the standard diagnostic method for O. tsutsugamushi, but its disadvantages are that it requires an expensive fluorescence microscope and cannot test multiple samples at once. In the case of culture testing, it must be conducted in a BSL-3 laboratory, takes several weeks to diagnose, and has a sensitivity of less than 50%, so it is often used for the purpose of isolating bacteria rather than diagnosis (Infection and Chemotherapy. 2009;41(6):315 -22). In the case of PCR, it is known that experiments were conducted through nested-PCR or real-time PCR, and is currently the most commonly used diagnostic method along with IFA (Transactions of the Royal society of tropical medicine and hygiene. 2008;102(2):186 -93).
  • Cas12a from Lachnospiraceae bacteria can recognize target DNA using a guide RNA (gRNA) complementary to the target DNA sequence with a T nucleotide-rich protospacer-adjacent motif (PAM) (Nature 532 7600), 522-526). After recognition, LbCas12a is activated and induces non-specific single-strand DNA cleavage (Science 360, 436-439).
  • gRNA guide RNA
  • PAM protospacer-adjacent motif
  • DETECTR DNA endonuclease-targeted CRISPR trans reporter
  • the present inventors conducted research on a method that can be applied to the field to effectively detect Orientia typhus at an early stage and quickly diagnose scrub typhus, and developed a rapid, sensitive, and on-site method for detecting Orientia tsutsugamushi based on genetic scissors. -An applicable diagnostic method was developed.
  • the purpose of the present invention is to provide a method for quickly and precisely detecting Orientia tsutsugamushi (OT) using a primer set and guide RNA specific for OT and CRISPR-Cas12a.
  • the present invention also aims to provide a kit for detecting OT, including a primer set and guide RNA specific for OT and CRISPR-Cas12a.
  • One aspect of the present invention is a method for detecting Orientia tsutsugamushi (OT) using genetic scissors,
  • Molecular diagnosis by gene scissors is performed by adding guide RNA specific to the 16 rRNA genes of Orientia tsutsugamushi, CRISPR-Cas (CRISPR-associated protein) 12a, and a single-stranded DNA reporter to the product obtained by the isothermal amplification.
  • a method comprising steps is provided.
  • the target gene is the 16S rRNA gene (SEQ ID NO: 9: GenBank Accession No. NR025860), which has a relatively long gene, has a low possibility of gene mutation due to functional change, and is also used for bacterial identification. ) is used.
  • the primer set specific for the 16S rRNA gene of Orientia tsutsugamushi may consist of a primer of SEQ ID NO: 1 and a primer of SEQ ID NO: 2, or a primer of SEQ ID NO: 3 and a primer of SEQ ID NO: 4. there is.
  • the guide RNA specific to the 16S rRNA gene of Orientia tsutsugamushi may target the 16S rRNA gene of Orientia tsutsugamushi having a PAM sequence rich in T-nucleotides.
  • the PAM sequence may be TTTC.
  • the sample may be a sample containing Orientia tsutsugamushi or may be a sample obtained from a subject for which detection of Orientia tsutsugamushi is required.
  • the samples include, but are not limited to, saliva, blood, serum, plasma, urine, aspirates, and biopsy samples.
  • providing the sample may further include heating the sample to remove nuclease activity in the sample and extract RNA.
  • the isothermal amplification step is RT-RPA (Reverse Transcription) using a primer set consisting of the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2, or the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4. -Recombinase Polymerase Amplification).
  • the guide RNA specific to the 16S rRNA gene of Orientia tsutsugamushi may be composed of the sequence of SEQ ID NO: 5 or 6.
  • the guide RNA is designed to allow gene scissors to specifically act on the 16S rRNA gene of Orientia tsutsugamushi strains prevalent in Korea, Kato, Karp, Boryung, JG-related (Ikeda), and Shimokoshi.
  • the guide RNA specific to the 16S rRNA gene of Orientia tsutsugamushi recognizes the PAM sequence of TTTC and specifically binds to a target having a complementary sequence. It may consist of a sequence of 5 or 6.
  • the step of performing the molecular diagnosis includes detection of the target site in the isothermal amplification product by the guide RNA, activation of CRISPR-Cas12a, and cleavage of the single-stranded DNA probe by activated CRISPR-Cas12a. It includes, wherein the single-stranded DNA probe does not hybridize with the guide RNA and may be labeled with a labeling substance.
  • the CRISPR-Cas12a may be LbCas12a derived from Lachnospiraceae bacteria.
  • the step of performing the molecular diagnosis includes determining the presence of OT in the sample by detecting whether the single-stranded DNA probe is cut by fluorescence analysis or lateral flow assay (LFA). can do.
  • LFA lateral flow assay
  • the step of isothermal amplification of the nucleic acid and fluorescence analysis or LFA may be performed at the same temperature.
  • the step of isothermal amplification of the nucleic acid and fluorescence analysis or LFA may be performed at 37°C or 42°C.
  • the single-stranded DNA probe may be double-labeled with a fluorescent substance and a quencher.
  • the single-stranded DNA probe may be double-labeled with biotin and a fluorescent substance.
  • the single-stranded DNA probe allows detection of fluorescence depending on whether or not it is cut by CRISPR-Cas12a.
  • the fluorescent material may be a fluorescent dye including, but not limited to, FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, etc.
  • LFA may be performed on a strip.
  • the method uses an OT-specific primer set consisting of the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 and the OT-specific guide RNA of SEQ ID NO: 5, or the primer of SEQ ID NO: 3 and SEQ ID NO: 4 It can be performed using an OT-specific primer set consisting of primers and the OT-specific guide RNA of SEQ ID NO: 6, or both.
  • kits for detecting OT comprising a primer set specific for OT, guide RNA, CRISPR-Cas12a, and a single-stranded DNA probe, wherein the primer set specific for OT includes the primer of SEQ ID NO: 1 and Provided is a kit consisting of a primer of SEQ ID NO: 2, and/or a primer of SEQ ID NO: 3 and a primer of SEQ ID NO: 4, and the guide RNA is comprised of SEQ ID NO: 5 and/or 6.
  • the kit may be used to detect OT by RT-RPA and CRISPR-Cas12a-based detection.
  • the kit may further include a reagent for detection by fluorescence or LFA.
  • OT refers to Orientia typhus, the causative bacteria causing typhus typhus, and is used interchangeably with “Orientia typhus.”
  • isothermal amplification refers to a method of amplifying nucleic acids by incubation at a single temperature, without a thermocycler, and is used interchangeably with “isothermal nucleic acid amplification.”
  • Isothermal amplification is a nucleic acid amplification that does not rely on thermal denaturation of target nucleic acids during the amplification reaction and does not require rapid changes in temperature, so it can be performed inside and outside of a laboratory environment.
  • Isothermal amplification methods include, but are not limited to, loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), etc.
  • LAMP loop-mediated isothermal amplification
  • RPA recombinase polymerase amplification
  • the term “gene scissors” refers to CRISPR (Clustered Interspaced Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) protein.
  • CRISPR Clustered Interspaced Regularly Interspaced Short Palindromic Repeats
  • CRISPR-associated protein CRISPR-associated protein.
  • Gene scissors-based molecular diagnosis consists of signal amplification, signal conversion, and signal generation. Isothermal amplification such as RPA and LAMP is mainly used for signal amplification, and CRISPR gene scissor technology is used for signal conversion and signal generation. For this purpose, various fluorescent substances or proteins are used.
  • Cas12a is a type of CRISPR-Cas protein and refers to a CRISPR protein that has the activity of randomly cutting non-targeted single-stranded DNA (ssDNA) when activated by detection of target DNA. and is used interchangeably with “CRISPR-Cas12a” or “CRISPR/Cas12a”.
  • Cas12a from the bacterium Lachnospiraceae recognizes its target DNA using a guide RNA complementary to the target DNA sequence and a T nucleotide-rich PAM (protospacer-adjacent motif) on the target, and after recognition, it is activated.
  • LbCas12a not only catalyzes target DNA cleavage, but also promotes non-specific ssDNA cleavage (Chen et al., 2018, Science 360, 436-439).
  • a molecular diagnostic method based on gene scissors is being developed using the activity of Cas12a.
  • the term “molecular diagnosis” refers to DETECTR, a molecular diagnosis technology based on CRISPR-Cas12a.
  • the DETECTR DNA endonuclease-targeted CRISPR trans reporter
  • HPV human papillomavirus
  • DETECTR utilizes the activity of Cas12a to recognize target DNA and randomly cleave single-stranded DNA when activated, using a guide RNA that specifically binds to the target site and a single-stranded DNA probe or reporter that does not bind to the target site. This is a method of diagnosing the presence of target DNA by generating a fluorescent signal that can be easily measured.
  • single-stranded DNA probe refers to a reporter used to confirm the presence or absence of a target nucleic acid by DETECTR, and may be a single-stranded DNA of a sequence that does not hybridize to the target site. It may be labeled with a fluorophore-quencher pair, etc. to produce a detectable signal when cleaved by activated Cas12a.
  • a single-stranded DNA probe can be a single-stranded DNA reporter labeled at both ends by a fluorophore-quencher pair (FQ reporter) or a single-stranded DNA reporter labeled at both ends by a fluorophore-biotin pair (FB reporter).
  • FQ reporter fluorophore-quencher pair
  • FB reporter fluorophore-biotin pair
  • a fluorescent signal When one end of a single-stranded DNA reporter is labeled with a fluorescent substance and the other end is labeled with a quencher and cleaved by activated Cas12a, a fluorescent signal can be detected.
  • LFA used herein, also called lateral flow assay, is a technology well known as a pregnancy diagnosis kit and refers to an analysis method that enables rapid detection without skilled personnel or expensive equipment.
  • a sample solution such as blood onto a strip-like device
  • bacteria or viruses in the sample can be detected within a short period of time using lateral flow and specific target binding such as antigen-antibody reaction, and fluorescent/chromogenic labeling is mainly done using a sandwich method. Nanoparticles are used.
  • LFA has high field applicability because it produces results that can be confirmed with the naked eye.
  • the method and kit for rapidly detecting Orientia typhus (OT), which causes scrub typhus, using genetic scissors uses isothermal amplification and CRISPR-Cas12 in the field to quickly and , enabling detection with high sensitivity, enabling early diagnosis of typhus typhus without special expertise, technology, equipment, or infrastructure.
  • Figure 1 shows the target region of the Orientia tsutsugamushi 16S rRNA gene for Orientia tsutsugamushi DETECTR according to an embodiment of the present invention and gRNA OT1, OT2, and primers OT-F1, OT-R1, and OT for recognition and amplification thereof. -Shows the positions of F2 and OT-R2.
  • FIG. 2 shows a schematic diagram of CRISPR-Cas12a-based Orientia tsutsugamushi DETECTR combined with a fluorescence assay or lateral flow assay (LFA) according to one embodiment of the present invention.
  • the FQ-reporter is a single-stranded DNA probe in which both ends are labeled with a fluorescent substance and a quencher, respectively
  • the FB-reporter is a single-stranded DNA probe in which both ends are labeled with a fluorescent substance and biotin, respectively.
  • Figure 3 shows the detection of Orientia tsutsumamushi by Two-pot DETECTR combined with fluorescence analysis according to one embodiment of the present invention.
  • A is the result confirmed using gRNA (OT1) of SEQ ID NO: 5
  • B is the gRNA (OT2) of SEQ ID NO: 6 (NTC: no template control).
  • Figure 4 shows the sensitivity (LoD) of the Orientia tsutsugamushi Two-pot DETECTR analysis method according to an embodiment of the present invention.
  • Figures 5a and 5b show the results of applying Orientia tsutsugamushi Two-pot DETECTR to OT-positive clinical samples according to an embodiment of the present invention.
  • Figures 5a and 5b show the extraction of RNA from a patient's plasma sample, amplification of nucleic acid of Orientia tsutsugamushi through RT-RPA using a primer set specific for the Orientia tsutsugamushi 16S rRNA gene, and gRNA OT1 (5a) corresponding to Orientia tsutsugamushi.
  • Figures 6a and 6a show the results of applying Orientia tsutsugamushi Two-pot DETECTR to OT-negative clinical samples according to an embodiment of the present invention.
  • Figures 6a and 6b each extract RNA from a plasma sample of an OT-negative patient, amplify the nucleic acid of Orientia tsutsugamushi through RT-RPA using a primer set specific for the Orientia tsutsugamushi 16S rRNA gene, and gRNA corresponding to Orientia tsutsugamushi
  • the results of detecting RT-RPA amplicon by Orientia tsutsugamushi Two-pot DETECTR combined with fluorescence analysis and LFA using OT1 (6a) and OT2 (6b) are shown.
  • Figure 7 shows the detection of Orientia tsutsugamushi by One-pot DETECTR combined with fluorescence analysis according to one embodiment of the present invention. The detection results were confirmed by real-time fluorescence analysis (NTC: no template control).
  • the 16S rRNA of O. tsutsugamushi for use in the experiment was the 16S rRNA of Orientia tsutsugamushi strain Karp (Gen bank accession numbers: NR025860), and the entire 16s rRNA sequence (1459 bp) was synthesized (Macrogen, Seoul, Korea). .
  • the 16S rRNA gene was amplified through PCR using primers of SEQ ID NOs: 7 and 8 containing the T7 promoter, and the obtained product was subjected to IVT ( In vitro transcription) (Invitrogen, Waltham, MA, USA). proceeded.
  • IVT In vitro transcription
  • the 16S rRNA sequence prepared through IVT was purified using RNA Clean and Concentrator-5 (Zymo research, Irvine, CA, USA). The primers used are shown in Table 1.
  • TCEP and EDTA were added to the samples to final concentrations of 100 mM and 1 mM, respectively. Samples were incubated at 50°C for 5 minutes followed by 5 minutes at 64°C using a thermocycler. To prevent solidification of the mixture after HUDSON, RNase-free water was added at a ratio of 1:4.
  • RT-RPA was a two-pot DETECTR by adding 29.5 ⁇ l rehydration buffer, 2.4 ⁇ l forward and reverse primers (10 ⁇ M each), 1 ⁇ l TOPscriptTM Reverse Transcriptase (Enzynomics, Daejeon, Korea), and 1 ⁇ l RNase inhibitor (Enzynomics).
  • a dedicated master mix was prepared and RNA sample and nuclease-free water were added to the reaction mixture to obtain a final volume of 48.5 ⁇ l.
  • For HUDSON-treated patient plasma 5 ⁇ l of sample was added. Afterwards, 2.5 ⁇ l of 280 mM magnesium acetate was additionally added and incubated at 42°C for 40 minutes.
  • LbCas12a trans-cleavage analysis was performed (Broughton et al., 2020, Nature Biotechnology 38, 870-774).
  • LbCas12a and gRNA were added to 1 ⁇ NEBuffer 2.1 at a final concentration of 50 nM and 62.5 nM, respectively, and incubated at 37°C for 30 minutes.
  • RT-RPA product For fluorescence analysis, 2 ⁇ l of RT-RPA product, 80 ⁇ l NEBuffer 2.1, 18 ⁇ l LbCas12a-gRNA complex, and 2 ⁇ l of 10 ⁇ M Fluorophore Quencher (FQ)-labeled reporter (/56-FAM/TTATT/3IABkFQ/, Integrated DNA Technologies, Coralville, IA) was added directly to the 96-well microplate. After incubation at 37°C for 20 minutes, the results were confirmed by analyzing the fluorescence values ( ⁇ ex, 485 nm; ⁇ em, 535 nm).
  • FQ Fluorophore Quencher
  • RT-RPA product For LFA, 2 ⁇ l RT-RPA product was mixed with 40 ⁇ l 1x NEBuffer 2.1, 36 ⁇ l LbCas12a-gRNA complex, and 2 ⁇ l 10 ⁇ M lateral flow cleavage reporter (/56-FAM/TTATT/3Bio/ , Integrated DNA Technologies) and incubated at 37°C for 20 minutes. Afterwards, a LF strip (lateral flow strip) (Milenia HybriDetect 1, TwistDx) was applied to the incubated sample, and the results were read after 2 minutes.
  • a LF strip lateral flow strip
  • RT-RPA process and the LbCas12a trans-cleavage analysis process were designed to be performed in one tube.
  • One-pot DETECTR was performed, similar to the method disclosed by Rose A. Lee (Rose A. Lee et al., 2020, PNAS 117 (41) 25722-25731).
  • RNA sample was added to the freeze-dried master mix, incubated at 42°C for 20 minutes, and the results were confirmed by analyzing the fluorescence value ( ⁇ ex, 485 nm; ⁇ em, 535 nm).
  • Example 1 Detection of O. tsutsugamushi using Two-pot DETECTR.
  • Diagnostic samples containing O. tsutsugamushi were lysed through HUDSON, and nucleic acids were amplified using reverse transcription recombinase polymerase amplification (RT-RPA) using a primer set specific for the 16S rRNA gene.
  • the forward and reverse primers for RPA for detection of 16S rRNA are SEQ ID NO: 1 and 2, or SEQ ID NO: 3 and 4, respectively, at positions 550 to 579 and 636 of the 16S rRNA gene (SEQ ID NO: 9: NCBI GenBank Accession No. NR025860). It corresponded to bases 665 to 757, 757 to 786, and 891 to 920.
  • RT-RPA amplicons were incubated with gRNA targeting the LbCas12a and 16S rRNA genes and analyzed by fluorescence analysis using a ssDNA-fluorescein (FAM) quencher (FQ)-labeled reporter or by LFA using a ssDNA-FAM-biotin reporter.
  • FAM ssDNA-fluorescein
  • FQ quencher
  • the trans-cleavage activity of LbCas12a was determined.
  • the gRNAs designed for LbCas12a trans-cleavage analysis were SEQ ID NOs: 5 and 6, named OT1 and OT2, and corresponded to bases 615 to 635 and 791 to 810 of the 16S rRNA gene (Bioneer, Daejeon, Korea) .
  • Table 2 shows the primers used, gRNA sequences, and PAM sequences.
  • Orientia tsutsugamushi was detected by performing Orientia tsutsugamushi DETECTR on Orientia tsutsugamushi 16S rRNA obtained through in vitro transcription. Specifically, Orientia scrub two-pot DETECTR was performed using 16S rRNA samples at different concentrations from 10 0 to 10 3 copies/reaction to determine the detection limit. The results are shown in Figure 4.
  • Orientia tsutsugamushi DETECTR using OT1 gRNA was able to detect up to 10 2 RNA copies per reaction
  • Orientia tsutsugamushi DETECTR using OT2 gRNA was able to detect in vitro transcribed RNA up to 10 1 RNA copies per reaction.
  • Orientia scrub 16S rRNA was detected in patient plasma samples using the Orientia scrub two-pot DETECTR, and the results were compared with those of a Nested-PCR diagnostic test.
  • 29 positive clinical samples and 54 negative clinical samples confirmed by Nested-PCR were used.
  • Two-pot DETECTR results for positive and negative clinical samples are shown in Figures 5 and 6, respectively.
  • Figure 5a shows the results using OT1 gRNA
  • Figure 5b shows the results using OT2 gRNA
  • Figure 6a shows the results using OT1 gRNA
  • Figure 6b shows the results using OT2 gRNA.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

유전자 가위 기반 쯔쯔가무시증의 신속 진단 방법 및 키트에 관한 것으로, 구체적으로, 쯔쯔가무시증을 유발하는 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi)에 특이적인 프라이머 세트와 가이드 RNA, 및 CRISPR-Cas12a를 이용하여, 오리엔티아 쯔쯔가무시를 신속하게 검출하는 분자진단 방법 및 그를 위한 키트가 개시된다.

Description

유전자가위 기반 쯔쯔가무시증의 신속 진단 방법
유전자 가위 기반 쯔쯔가무시증의 신속 진단 방법 및 키트에 관한 것으로, 구체적으로, 쯔쯔가무시증을 유발하는 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi)에 특이적인 프라이머 세트와 가이드 RNA, 및 CRISPR-Cas12a를 이용하여, 오리엔티아 쯔쯔가무시를 신속하게 검출하는 분자진단 방법 및 그를 위한 키트가 개시된다.
쯔쯔가무시증은 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi 또는 O. tsutsugamushi)라고 불리는 박테리아에 감염되어 걸리는 질병이며 진드기 티푸스, 덤불 티푸스, 초원열, 잡목열 등으로 불리는 발열성 질환이다. 쯔쯔가무시증은 오리엔티아 쯔쯔가무시 박테리아에 감염된 털 진드기 유충에 물렸을 때, 혈액과 림프액을 통해 발생하는 것으로 알려져 있으며 중국, 일본, 태국, 파키스탄, 한국, 호주 북부, 및 인도양과 서태평양의 일부 섬을 포함한 일명 쯔쯔가무시 트라이앵글이라고 불리는 지역에서 발생하는 것으로 보고되고 있다 (PLoS neglected tropical diseases. 2017;11(9):e0005838; PLoS neglected tropical diseases. 2017;11(11):e0006062; 및 Tropical medicine and infectious disease. 2018;3(1):11). 하지만 최근 논문에 따르면 글로벌화로 인하여 쯔쯔가무시 트라이앵글 이외의 지역인 아프리카나 유럽에서도 발견되고 있다 (Tropical medicine and infectious disease. 2018;3(1):8).
오리엔티아 쯔쯔가무시는 발열성 질환인 쯔쯔가무시증을 유발하는 다형태성 간상(pleomorphic rod-shape), 그람 음성 박테리아이다. 오리엔티아 쯔쯔가무시의 외막 표면에 존재하며 숙주세포에 부착하고 침투하는데 필수적인 면역-우성(immune-dominant) 56-kDa TSA 유전자(tsa56)의 다양성 통해 오리엔티아 쯔쯔가무시의 스트레인(strain)을 구분하며 주요 스트레인으로는 Karp, Kato, Gilliam, Boryong, Ikeda, TA716, TA763, TA686, Kawasaki, Kuroki, Saitama, Shimokoshi가 있다 (Trends in Microbiology. 2020;28(9):780-1; 및 The American journal of tropical medicine and hygiene. 2010;83(3):658). 한국에서는 Kato, Karp, Boryong, JG-related (Ikeda), Shimokoshi 순으로 발견되고 있다 (Microorganisms. 2021;9(8):1563).
진드기에 물려 쯔쯔가무시증에 감염되면 진드기에 물린 자리에 가피(eschar)가 형성되며 발진과 고열이 동반되는 것이 쯔쯔가무시증의 특징적인 병리 소견이다. 이후 두통, 기침, 구토, 오한, 근육통, 복통 및 인후염과 같은 임상 징후가 관찰되며 결막 충혈, 수막염, 파종성 혈관 내 응고 및 다발성 장기 부전과 같은 심각한 합병증을 동반하기도 한다 (PLoS neglected tropical diseases. 2017;11(11):e0006062; JAPI. 2005;53(955):269; Journal of Bacteriology and Virology. 2016;46(4):275-82). 쯔쯔가무시증에 감염될 경우 치료하지 않으면 6%의 사망률을 보이며, 적절한 치료 시 1.5%의 사망률을 보인다. 합병증을 일으키는 경우 사망률이 증가하게 되는데 뇌 감염의 경우 14%, 다발성 장기부진의 경우는 24%까지 사망률이 증가하며 임신한 사람이 걸릴 경우에는 유산될 확률이 증가된다고 알려져 있다 (PLoS neglected tropical diseases. 2017;11(9):e0005838; PLoS neglected tropical diseases. 2017;11(11):e0006062; 및 PLoS neglected tropical diseases. 2015;9(8):e0003971). 따라서, 조기 진단 및 그에 따른 신속한 치료가 사망률을 낮추는 가장 중요한 방법으로 판단되고 있다.
기존의 O. tsutsugamushi를 진단하는 방법으로는 면역크로마토그래피 (ICA), 배양검사, 항체 검출 검사 (IFA), 수동 혈구 응집법 (PHA), 유전자 검출 검사 (PCR)가 있다. 일반적으로, 각 방법별 기준에 따라, 환자를 추정환자 및 확진환자로 분류하며, 한국의 경우 질병관리본부의 기준에 따라 나눠진다. ICA는 약 15분 내지 20분의 시간이 소요되며 98% 이상의 특이도와 정확도를 보이고 양성의 결과가 나올 경우 추정환자로 분류한다 (Journal of Korean medical science. 2016;31(8):1190-6). IFA, PCR, 및 배양 검사를 통해 양성인 것이 확인되면 확진환자로 분류한다. IFA의 경우 일반적으로 O. tsutsugamushi의 표준 진단 방식으로 간주되지만 고가의 형광현미경을 필요로 하며 한 번에 다수의 샘플을 검사할 수 없다는 것이 단점이다. 배양 검사의 경우 BSL-3 실험실에서 진행해야 하고 진단에 수주가 걸리며 민감도도 50% 미만으로 낮아서, 진단보다는 균을 분리하기 위한 목적으로 많이 이용된다 (Infection and Chemotherapy. 2009;41(6):315-22). PCR의 경우 Nested-PCR 또는 Real-time PCR을 통해 실험을 진행한 것으로 알려져 있으며 현재 IFA와 함께 가장 많이 쓰이는 진단 방법이다 (Transactions of the Royal society of tropical medicine and hygiene. 2008;102(2):186-93). PHA (passive hemagglutination assay)의 경우에는 2시간 내에 결과를 육안으로 확인할 수 있어서, 많은 검사실과 병원에서 이용할 수 있지만 실제 임상에서 사용시 민감도가 42%로 비교적 낮다는 단점이 있다. 또한, O. tsutsugamushi 항체에 대한 ELISA 실험이 개발되고 있는 것으로 알려져 있다 (Frontiers in immunology. 2021:4230).
최근에, CRISPR(clustered, regularly interspaced, short palindromic repeats) 및 Cas(CRISPR-associated) 시스템을 이용한 현장응용성이 높은 신속 진단 기법이 도입되었다(Cell discovery 4(1), 1-4; Nature communications 10(1), 1-9). 라크노스피라세애(Lachnospiraceae) 박테리아로부터의 Cas12a는 T 뉴클레오티드-풍부 PAM(protospacer-adjacent motif)을 갖는 표적 DNA 서열에 상보적인 가이드 RNA (gRNA)를 이용하여 표적 DNA를 인식할 수 있다 (Nature 532(7600), 522-526). 인식 후에, LbCas12a가 활성화되어 비특이적 단일-가닥 DNA 절단을 유도한다(Science 360, 436-439). LbCas12a의 트랜스-절단 활성 및 등온 핵산 증폭에 기반하여, DETECTR(DNA endonuclease-targeted CRISPR trans reporter)로 명명된 신규한 분자 진단 방법이 개발되었고 (Science 360, 436-439) SARS-CoV-2(severe acute respiratory syndrome coronavirus 2), HPV(human papilloma virus), IAV(influenza A virus) 및 IBV(influenza virus)를 포함한 바이러스 감염의 진단에 성공적으로 적용되었다 (Broughton et al. 2020; Chen et al. 2018; Park et al. 2021).
본 발명자들은 현장에 적용하여 오리엔티아 쯔쯔가무시를 조기에 효과적으로 검출하여 쯔쯔가무시증을 신속하게 진단할 수 있는 방법에 대한 연구를 수행하여, 유전자 가위에 기반한 오리엔티아 쯔쯔가무시 검출을 위한 신속하고, 민감하며, 현장-적용가능한 진단 방법을 개발하였다.
본 발명은 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi: OT)에 특이적인 프라이머 세트 및 가이드 RNA와 CRISPR-Cas12a를 이용하여 OT를 신속하고 정밀하게 검출하는 방법을 제공하는 것을 목적으로 한다.
본 발명은 또한, OT에 특이적인 프라이머 세트 및 가이드 RNA와 CRISPR-Cas12a를 포함하는 OT 검출용 키트를 제공하는 것을 목적으로 한다.
본 발명의 일 양태는 유전자 가위를 이용하여 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi: OT)를 검출하는 방법으로서,
시료를 제공하는 단계,
오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트를 이용하여 시료 중 핵산을 등온증폭시키는 단계, 및
상기 등온증폭에 의해 수득된 산물에 오리엔티아 쯔쯔가무시의 16 rRNA 유전자에 특이적인 가이드 RNA와 CRISPR-Cas(CRISPR-associated protein) 12a, 및 단일가닥 DNA 리포터를 첨가하여 유전자 가위에 의한 분자진단을 수행하는 단계를 포함하는 것인 방법을 제공한다.
본 발명에서 오리엔티아 쯔쯔가무시의 검출을 위해, 표적 유전자로 유전자의 길이가 비교적 길고, 기능변화에 따른 유전자 변이 가능성이 낮으며 박테리아의 동정에도 사용되는 16S rRNA 유전자(서열번호 9: GenBank Accession No. NR025860)를 이용한다.
본 발명의 일 구체예에서, 상기 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트는 서열번호 1의 프라이머 및 서열번호 2의 프라이머, 또는 서열번호 3의 프라이머 및 서열번호 4의 프라이머로 구성될 수 있다.
본 발명의 일 구체예에서, 상기 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 가이드 RNA는 T-뉴클레오티드가 풍부한 PAM 서열을 갖는 오리엔티아 쯔쯔가무시의 16S rRNA 유전자를 표적으로 하는 것일 수 있다.
본 발명의 일 구체예에서, 상기 PAM 서열은 TTTC일 수 있다.
본 발명의 일 구체예에서, 상기 시료는 오리엔티아 쯔쯔가무시를 포함하는 시료일 수 있고, 오리엔티아 쯔쯔가무시의 검출이 필요한 대상으로부터 수득된 시료일 수 있다. 상기 시료는 타액, 혈액, 혈청, 혈장, 소변, 흡입물, 및 생검 시료를 포함하나, 이에 한정되지 않는다.
본 발명의 일 구체예에서, 상기 시료를 제공하는 단계는 상기 시료를 가열하여 상기 시료 중 핵산분해효소 활성을 제거하고 RNA를 추출하는 단계를 더 포함할 수 있다.
본 발명의 일 구체예에서, 상기 등온증폭시키는 단계는 서열번호 1의 프라이머 및 서열번호 2의 프라이머, 또는 서열번호 3의 프라이머 및 서열번호 4의 프라이머로 이루어진 프라이머 세트를 이용한 RT-RPA(Reverse Transcription-Recombinase Polymerase Amplification)에 의해 수행되는 것일 수 있다.
본 발명의 일 구체예에서, 상기 분자진단을 수행하는 단계에서 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 가이드 RNA는 서열번호 5 또는 6의 서열로 구성되는 것일 수 있다. 상기 가이드 RNA는 한국에서 유행하는 오리엔티아 쯔쯔가무시 스트레인, Kato, Karp, Boryung, JG-related (Ikeda), Shimokoshi의 16S rRNA 유전자에 유전자 가위가 특이적으로 작용할 수 있게 하도록 설계된 것이다.
본 발명의 일 구체예에서, 상기 분자진단을 수행하는 단계에서 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 가이드 RNA는 TTTC의 PAM 서열을 인식하고 상보적인 서열을 갖는 표적에 특이적으로 결합하는 서열번호 5 또는 6의 서열로 구성될 수 있다.
본 발명의 일 구체예에서, 상기 분자진단을 수행하는 단계는 상기 가이드 RNA에 의한 등온증폭 산물 중 표적 부위의 검출, CRISPR-Cas12a의 활성화, 및 활성화된 CRISPR-Cas12a에 의한 단일가닥 DNA 프로브의 절단을 포함하며, 상기 단일가닥 DNA 프로브는 상기 가이드 RNA와 혼성화되지 않고, 표지 물질로 표지된 것일 수 있다.
본 발명의 일 구체예에서, 상기 CRISPR-Cas12a는 라크노스피라세애(Lachnospiraceae) 박테리아로부터 유래된 LbCas12a일 수 있다.
본 발명의 일 구체예에서, 상기 분자진단을 수행하는 단계는 단일가닥 DNA 프로브의 절단 여부를 형광 분석이나 LFA(lateral flow assay)에 의해 검출하여 상기 시료 중 OT의 존재 여부를 결정하는 단계를 포함할 수 있다.
본 발명의 일 구체예에서, 상기 핵산을 등온증폭시키는 단계와 형광 분석 또는 LFA는 동일한 온도에서 수행될 수 있다.
본 발명의 일 구체예에서, 상기 핵산을 등온증폭시키는 단계와 형광 분석 또는 LFA는 37℃ 또는 42℃에서 수행될 수 있다.
본 발명의 일 구체예에서, 상기 단일가닥 DNA 프로브는 형광물질과 소광물질로 이중 표지될 수 있다.
본 발명의 일 구체예에서, 상기 단일가닥 DNA 프로브는 비오틴과 형광물질에 의해 이중 표지될 수 있다.
본 발명의 일 구체예에서, 상기 단일가닥 DNA 프로브는 CRISPR-Cas12a에 의한 절단여부에 따라 형광을 검출할 수 있게 한다.
본 발명의 일 구체예에서, 상기 형광물질은 FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, 등을 포함하나 이에 한정되지 않는 형광 염료일 수 있다.
본 발명의 일 구체예에서, LFA는 스트립 상에서 수행되는 것일 수 있다.
본 발명의 일 구체예에서, 상기 방법은 서열번호 1의 프라이머 및 서열번호 2의 프라이머로 이루어진 OT 특이적 프라이머 세트와 서열번호 5의 OT 특이적 가이드 RNA, 또는 서열번호 3의 프라이머 및 서열번호 4의 프라이머로 이루어진 OT 특이적 프라이머 세트와 서열번호 6의 OT 특이적 가이드 RNA, 또는 이들 모두를 이용하여 수행될 수 있다.
본 발명의 또 다른 양태는 OT에 특이적인 프라이머 세트와 가이드 RNA, CRISPR-Cas12a, 및 단일가닥 DNA 프로브를 포함하는, OT 검출용 키트로서, 상기 OT에 특이적인 프라이머 세트는 서열번호 1의 프라이머와 서열번호 2의 프라이머, 및/또는 서열번호 3의 프라이머와 서열번호 4의 프라이머로 구성되고, 상기 가이드 RNA는 서열번호 5 및/또는 6으로 구성되는 것인 키트를 제공한다.
본 발명의 일 구체예에서, 상기 키트는 RT-RPA 및 CRISPR-Cas12a 기반 검출에 의해 OT를 검출하기 위해 이용되는 것일 수 있다.
본 발명의 일 구체예에서, 상기 키트는 형광법 또는 LFA에 의한 검출을 위한 시약을 더 포함하는 것일 수 있다.
본 명세서에서 사용되는 용어는 다르게 정의되지 않는 한, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 갖는다.
본 명세서에서 사용된 용어, "OT"는 쯔쯔가무시증을 유발하는 원인균인 오리엔티아 쯔쯔가무시를 의미하며, "오리엔티아 쯔쯔가무시"와 호환적으로 사용된다.
본 명세서에서 사용된 용어, "등온 증폭"은 써모사이클러 없이, 단일 온도에서의 인큐베이션에 의해 핵산을 증폭하는 방법을 의미하며, "등온 핵산 증폭"과 호환적으로 사용된다. 등온 증폭은 증폭 반응 동안 표적 핵산의 열 변성에 의존하지 않으며, 온도의 빠른 변화를 필요로 하지 않는 핵산 증폭이므로, 실험실 환경 내부 및 외부에서 수행될 수 있다. 등온 증폭 방법은 루프-매개 등온 증폭(LAMP), 재조합효소 중합효소 증폭(RPA), 등을 포함하나, 이에 한정되지 않는다.
본 명세서에서 사용된 용어, "유전자가위"는 크리스퍼(CRISPR: Clustered Interspaced Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) 단백질을 의미한다. 유전자가위 기반 분자진단은 신호 증폭, 신호 변환, 및 신호 발생으로 구성되며, 신호 증폭을 위해 주로 RPA 및 LAMP와 같은 등온 증폭이 이용되고, 신호 변환을 위해 크리스퍼 유전자 가위 기술이 이용되며, 신호 발생을 위해 다양한 형광 물질이나 단백질이 이용된다.
본 명세서에서 사용된 용어, "Cas12a"는 CRISPR-Cas 단백질의 일종으로, 표적 DNA의 검출에 의해 활성화되면 비표적화된 단일가닥 DNA(ssDNA)를 무작위적으로 절단하는 활성을 갖는 크리스퍼 단백질을 의미하며, "CRISPR-Cas12a" 또는 "CRISPR/Cas12a"와 호환적으로 사용된다. 라크노스피라세애(Lachnospiraceae) 박테리아로부터의 Cas12a는 표적 DNA 서열에 상보적인 가이드 RNA 및 표적에 있는 T 뉴클레오티드-풍부 PAM(protospacer-adjacent motif)을 이용하여 그의 표적 DNA를 인식하고, 인식 후에, 활성화된 LbCas12a는 표적 DNA 절단을 촉매할 뿐 아니라, 비특이적 ssDNA 절단을 촉진한다(Chen et al., 2018, Science 360, 436-439). 이러한 Cas12a의 활성을 이용하여 유전자가위에 기반한 분자진단방법이 개발되고 있다.
본 명세서에서 사용된 용어, "분자진단"은 CRISPR-Cas12a에 기반한 분자진단 기술인 DETECTR를 의미한다. DETECTR(DNA endonuclease-targeted CRISPR trans reporter) 분석법은 LbCas12a의 트랜스-절단 활성 및 RPA와 같은 등온 핵산 증폭 기술을 이용하여, 임상 시료 중 HPV(human papillomavirus)의 신속하고 특이적인 검출을 위해 개발되었다(Chen et al., 2018, Science 360, 436-439). DETECTR는 Cas12a가 표적 DNA를 인지하여 활성화되었을 때 단일가닥 DNA를 무작위로 절단하는 활성을 이용하여, 표적 부위에 특이적으로 결합하는 가이드 RNA와 표적 부위에 결합하지 않는 단일가닥 DNA 프로브 또는 리포터를 이용하여 표적 DNA의 존재 여부를 용이하게 측정가능한 형광 신호의 발생으로 진단하는 방법이다.
본 명세서에서 사용된 용어, "단일가닥 DNA 프로브"는 DETECTR에 의해 표적 핵산의 존재 여부를 확인하기 위해 이용되는 리포터를 의미하며, 표적 부위와 혼성화되지 않는 서열의 단일가닥 DNA일 수 있다. 활성화된 Cas12a에 의해 절단될 때 검출가능한 신호를 생성할 수 있도록 형광-소광물질(Fluorophore-Quencher) 쌍 등에 의해 표지될 수 있다. 예를 들면, 단일가닥 DNA 프로브는 형광물질-소광물질 쌍에 의해 양 말단이 표지된 단일가닥 DNA 리포터 (FQ 리포터) 또는 형광물질-비오틴 쌍에 의해 양 말단이 표지된 단일가닥 DNA 리포터 (FB 리포터)의 형태일 수 있다. 단일가닥 DNA 리포터의 일 말단이 형광 물질에 의해 표지되고, 나머지 말단이 소광물질에 의해 표지되어, 활성화된 Cas12a에 의해 절단되면 형광 신호를 검출할 수 있다.
본 명세서에서 사용된 용어, "LFA"는 측방 유동 분석(lateral flow assay)으로도 불리며, 임신 진단 키트로 잘 알려진 기술로서 숙련된 인력이나 값비싼 장비 없이도 빠른 검출을 가능하게 하는 분석법을 의미한다. 혈액과 같은 시료 용액을 스트립과 같은 장치에 떨어뜨리기만 하면 측방 유동과 항원항체 반응과 같은 특이적 표적 결합을 이용해 단시간 내에 시료 중의 박테리아나 바이러스를 검출할 수 있고, 주로 샌드위치 방식으로 형광/발색 표지나 나노입자가 사용된다. 특히, LFA는 육안으로 확인가능한 결과를 도출하므로 현장응용성이 높다.
본 발명의 일 구체예에 따른 유전자 가위를 이용하여 쯔쯔가무시증을 유발하는 오리엔티아 쯔쯔가무시 (OT)를 신속하게 검출하는 방법 및 키트는 현장에서 등온 증폭 및 CRISPR-Cas12를 이용하여 오리엔티아 쯔쯔가무시를 신속하고, 높은 민감도로 검출할 수 있게 하여, 특별한 전문지식이나 기술, 기기, 기반시설이 없어도 쯔쯔가무시증을 조기에 진단할 수 있게 한다.
도 1은 본 발명의 일 구체예에 따른 오리엔티아 쯔쯔가무시 DETECTR를 위한 오리엔티아 쯔쯔가무시 16S rRNA 유전자의 표적 부위 및 그의 인식 및 증폭을 위한 gRNA OT1, OT2, 및 프라이머 OT-F1과 OT-R1, 및 OT-F2와 OT-R2의 위치를 보여준다.
도 2는 본 발명의 일 구체예에 따른 형광 분석법 또는 LFA(lateral flow assay)와 결합된, CRISPR-Cas12a-기반 오리엔티아 쯔쯔가무시 DETECTR의 개략도를 보여준다. FQ-리포터는 단일가닥 DNA 프로브의 양말단이 각각 형광물질과 소광물질로 표지된 것이고, FB-리포터는 단일가닥 DNA 프로브의 양말단이 각각 형광물질과 비오틴으로 표지된 것이다.
도 3은 본 발명의 일 구체예에 따른 형광분석과 결합된 Two-pot DETECTR에 의한 오리엔티아 쯔쯔마무시의 검출을 보여준다. (A)는 서열번호 5의 gRNA (OT1), (B)는 서열번호 6의 gRNA (OT2)를 이용하여 확인한 결과이다(NTC: 주형 불포함 대조군 (no template control)).
도 4는 본 발명의 일 구체예에 따른 오리엔티아 쯔쯔가무시 Two-pot DETECTR 분석법의 민감도(LoD)를 보여준다. 상이한 농도의 체외 전사가 이루어진 오리엔티아 쯔쯔가무시 16S rRNA 유전자로 오리엔티아 쯔쯔가무시 16S rRNA 유전자에 특이적인 프라이머 세트를 이용한 RT-RPA를 통해 증폭시키고, 오리엔티아 쯔쯔가무시의 주요 유전형 변이체에 상응하는 gRNA OT1(A) 및 OT2(B)를 이용하여 형광분석과 결합된 오리엔티아 쯔쯔가무시 DETECTR에 의해 RT-RPA 앰플리콘을 검출한 결과를 나타낸다. 형광분석 결과는 20분 경과 시에 평가했다. 값들은 평균 ± 표준 편차 (오류 막대)로 표시된다 (n = 3개의 재현물; NTC, 주형 불포함 대조군).
도 5a 및 5b는 본 발명의 일 구체예에 따른 오리엔티아 쯔쯔가무시 Two-pot DETECTR를 OT 양성 임상 시료에 적용한 결과를 보여준다. 도 5a 및 5b는 각각 환자 혈장 시료로부터 RNA 추출하여 오리엔티아 쯔쯔가무시 16S rRNA 유전자에 특이적인 프라이머 세트를 이용한 RT-RPA를 통해 오리엔티아 쯔쯔가무시의 핵산을 증폭하고, 오리엔티아 쯔쯔가무시에 상응하는 gRNA OT1(5a) 및 OT2(5b)를 이용하여, 형광분석 및 LFA와 결합된 오리엔티아 쯔쯔가무시 Two-pot DETECTR에 의해 RT-RPA 앰플리콘을 검출한 결과를 나타낸다. 형광분석 결과(도 5a 및 5b 각각의 상단)는 20분 경과 시에 평가했으며 LFA 결과(도 5a 및 5b 각각의 하단)는 스트립을 20분 인큐베이션 시킨 시료와 반응시킨 후 2분 경과 시에 평가했다. 값들은 평균 ± 표준 편차 (오류 막대)로 표시된다 (NC, 주형 불포함 대조군).
도 6a 및 6a는 본 발명의 일 구체예에 따른 오리엔티아 쯔쯔가무시 Two-pot DETECTR를 OT 음성 임상 시료에 적용한 결과를 보여준다. 도 6a 및 6b는 각각 OT 음성 환자의 혈장 시료로부터 RNA 추출하여 오리엔티아 쯔쯔가무시 16S rRNA 유전자에 특이적인 프라이머 세트를 이용한 RT-RPA를 통해 오리엔티아 쯔쯔가무시의 핵산을 증폭하고, 오리엔티아 쯔쯔가무시에 상응하는 gRNA OT1(6a) 및 OT2(6b)를 이용하여 형광분석 및 LFA와 결합된 오리엔티아 쯔쯔가무시 Two-pot DETECTR에 의해 RT-RPA 앰플리콘을 검출한 결과를 나타낸다. 형광분석결과(도 6a 및 6b 각각의 상단)는 20분 경과 시에 평가했으며 LFA 결과(도 6a 및 6b 각각의 하단)는 스트립을 20분 인큐베이션 시킨 시료와 반응시킨 후 2분 경과 시에 평가했다 (NC, 주형 불포함 대조군).
도 7은 본 발명의 일 구체예에 따른 형광 분석과 결합된 One-pot DETECTR에 의한 오리엔티아 쯔쯔가무시의 검출을 보여준다. 검출 결과는 실시간 형광분석으로 확인하였다(NTC: 주형 불포함 대조군).
하기에서, 본 발명은 첨부된 도면을 참조하여, 실시예를 통해 더 설명된다. 그러나, 실시예는 단지 본 발명을 설명하기 위한 것이며, 본 발명을 한정하는 것으로 해석되지 않는다.
재료 및 방법
1. 오리엔티아 쯔쯔가무시 (O. tsutsugamushi: OT)의 16S rRNA 합성
실험에 사용하기 위한 O. tsutsugamushi의 16S rRNA는 오리엔티아 쯔쯔가무시 스트레인 Karp의 16S rRNA (Gen bank accession numbers: NR025860)를 사용했고, 16s rRNA 서열 전체(1459 bp)를 합성했다 (Macrogen, Seoul, Korea).
합성된 서열을 이용하여 T7 프로모터를 포함하는 서열번호 7 및 8의 프라이머를 이용하여 16S rRNA 유전자를 PCR을 통해 증폭시키고, 수득된 산물로 IVT (In vitro transcription) (Invitrogen, Waltham, MA, USA)을 진행하였다. IVT를 통해 제조된 16S rRNA 서열을 RNA Clean and Concentrator-5 (Zymo research, Irvine, CA, USA)를 이용하여 정제했다. 표 1에 사용된 프라이머가 표시된다.
T7 프로모터 +
오리엔티아 쯔쯔가무시 (OT)		 서열 (서열번호)
정방향 TAATACGACTCACTATAGGGAGAAACGAACGCTGGCG (서열번호 7)
역방향 GCAGGTTCCCCTACGGCTACCTTGTTACGACTTTAC (서열번호 8)
2. 시료 제조
Myhrvold 등에 의해 개시된 바와 같이, 16S rRNA를 포함하는 시료를 HUDSON(Heating Unextracted Diagnostic Samples to Obliterate Nucleases)을 이용하여 용해시켰다(Myhrvold et al., Science 360(6387), 444-448). 시료 중 RNase를 불활성화시키기 위해 각각 TCEP(tris(2-carboxyethyl)phosphine) 및 EDTA를 100 mM 및 1 mM의 최종 농도로 첨가했다. 반응 혼합물을 써모사이클러를 이용하여 하기의 순서로 인큐베이션시켰다: 50℃에서 20분, 및 95℃에서 5분. 혈액 혈장에서 RNase를 불활성화시키기 위해, 시료에 TCEP 및 EDTA를 각각 100 mM 및 1 mM의 최종 농도로 첨가했다. 시료를 써모사이클러를 이용하여 50℃에서 5분, 뒤이어 64℃에서 5분 인큐베이션시켰다. HUDSON 후 혼합물의 고형화를 방지하기 위해 RNase-불포함 물을 1:4의 비율로 첨가했다.
3. Two-pot DETECTR
제조사의 매뉴얼에 따라 설계된 프라이머를 이용하여, TwistAmp Basic 키트 (TwistDx, Cambridge,　UK)를 이용하여 RT-RPA를 통해 16S rRNA를 증폭시켰다. RT-RPA는 29.5 ㎕ 재수화 완충액, 2.4 ㎕ 정방향 및 역방향 프라이머(각각 10 μM), 1 ㎕ TOPscript™ Reverse Transcriptase (Enzynomics, Daejeon, Korea), 1 ㎕ RNase 억제제 (Enzynomics)를 첨가하여 Two-pot DETECTR 전용 매스터 믹스(master mix)를 제조하고, 이에 RNA 시료 및 뉴클레아제-불포함 물을 반응 혼합물에 첨가하여 48.5 ㎕의 최종 부피를 얻었다. HUDSON-처리 환자 혈장의 경우, 5 ㎕의 시료를 첨가했다. 이후 2.5 ㎕의 280 mM 마그네슘 아세테이트를 추가로 넣은 뒤 42℃에서 40분 동안 인큐베이션시켰다.
Broughton 등에 의해 개시된 방법과 유사하게, LbCas12a 트랜스-절단 분석을 수행했다(Broughton et al., 2020, Nature Biotechnology 38, 870-774). RT-RPA 산물로부터 LbCas12a-gRNA 복합체를 형성하기 위해, LbCas12a 및 gRNA를 각각 1Х NEBuffer 2.1에 50 nM 및 62.5 nM의 최종 농도로 넣고, 37℃에서 30분 동안 인큐베이션시켰다.
LbCas12a 트랜스-절단 분석의 결과를 확인하기 위해 형광 분석법과 LFA 두가지를 진행하였다.
형광 분석을 위해, 2 ㎕의 RT-RPA 산물, 80 ㎕ NEBuffer 2.1, 18 ㎕ LbCas12a-gRNA 복합체, 및 2 ㎕의 10 μM FQ(Fluorophore Quencher)-표지 리포터(/56-FAM/TTATT/3IABkFQ/, Integrated DNA Technologies, Coralville, IA)를 직접 96-웰 마이크로플레이트에 첨가했다. 37℃에서 20분 동안 인큐베이션시킨 후에, 형광 값을 분석하여 결과를 확인했다 (λex, 485 nm; λem, 535 nm).
LFA를 위해, 2 ㎕ RT-RPA 산물을 40 ㎕의 1x NEBuffer 2.1, 36 ㎕ LbCas12a-gRNA 복합체, 및 2 ㎕ 10 μM 측방 유동 절단 리포터(lateral flow cleavage reporter)(/56-FAM/TTATT/3Bio/, Integrated DNA Technologies)와 37℃에서 20분 동안 인큐베이션시켰다. 그후, LF 스트립(lateral flow strip) (Milenia HybriDetect 1, TwistDx)을 인큐베이션한 시료에 적용하고, 2분 후에 결과를 판독했다.
4. One-pot DETECTR
실험의 편의성 및 현장진단의 가능성을 높이기 위해서 RT-RPA 과정과 LbCas12a 트랜스-절단 분석 과정을 한 튜브에서 진행할 수 있도록 설계했다. Rose A. Lee에 의해 개시된 방법과 유사하게, One-pot DETECTR를 수행했다(Rose A. Lee et al., 2020, PNAS 117 (41) 25722-25731). One-pot DETECTR를 진행하기 위해 5 ㎕ 1 μM LbCas12a, 1 ㎕ 10 μM gRNA, 4 ㎕ 10x NEBuffer 2.1, 1 ㎕ SuperScript IV Reverse Transcriptase (Invitrogen, Waltham, Massachusetts, USA), 1 ㎕ RNase 억제제 (Enzynomics), 0.5 ㎕ 100 μM FQ(Fluorophore Quencher)-표지 리포터(/56-FAM/TTATT/3IABkFQ/, Integrated DNA Technologies, Coralville, IA), 2.5㎕ 280 mM 마그네슘 아세테이트, 29.5 ㎕ 재수화 완충액, 2.4 ㎕ 정방향 및 역방향 프라이머(각각 10 μM)를 한 튜브에 첨가하여 One-pot DETECTR 전용 매스터 믹스(master mix)를 제조하고 이후 매스터 믹스가 건조될 때까지 동결건조를 수행했다. 이후 동결건조 된 매스터 믹스에 RNA 시료를 50 ㎕ 첨가하고 42℃에서 20분동안 인큐비에션 시키며 형광 값을 분석하여 결과를 확인했다 (λex, 485 nm; λem, 535 nm).
실시예 1. Two-pot DETECTR를 이용한 O. tsutsugamushi의 검출.
신속하고 민감한 진단을 구현하기 위해, 오리엔티아 쯔쯔가무시의 16S rRNA의 검출을 위한 Two-pot DETECTR를 설계했다. 도 1에 RPA 프라이머 및 gRNA의 설계가 도시되고, 도 2에 형광 분석 또는 LFA와 결합된 DETECTR의 개략도가 도시된다. Two-pot DETECTR는 RT-RPA에 의한 시료의 증폭과 검출을 위한 형광 분석 또는 LFA를 별개의 용기에서 수행하는 것이다.
O. tsutsugamushi를 포함하는 진단용 시료를 HUDSON을 통해 용해시키고, 16S rRNA 유전자에 특이적인 프라이머 세트에 의한 RT-RPA(reverse transcription recombinase polymerase amplification)를 이용하여 핵산을 증폭시켰다. 16S rRNA의 검출을 위한 RPA용 정방향 및 역방향 프라이머는 서열번호 1 및 2, 또는 서열번호 3과 4로 각각 16S rRNA 유전자(서열번호 9: NCBI GenBank Accession No. NR025860)의 550번 내지 579번, 636번 내지 665번 염기, 757번 내지 786번, 891번 내지 920번 염기에 해당했다.
RT-RPA 앰플리콘을 LbCas12a 및 16S rRNA 유전자를 표적으로 하는 gRNA와 인큐베이션시키고 ssDNA-형광물질 (FAM) 소광물질 (FQ)-표지 리포터를 이용한 형광 분석 또는 ssDNA-FAM-비오틴 리포터를 이용한 LFA에 의해 LbCas12a의 트랜스-절단 활성을 결정했다. LbCas12a 트랜스-절단 분석을 위해 설계된 gRNA는 OT1 및 OT2로 명명된 서열번호 5 및 6이었고, 16S rRNA 유전자의 615번 내지 635번, 및 791번 내지 810번 염기에 해당했다 (Bioneer, Daejeon, Korea).
표 2에 사용된 프라이머와 gRNA 서열 및 PAM 서열이 표시된다.
박테리아 서열 PAM
오리엔티아 쯔쯔가무시 16S rRNA
프라이머		 OT-F1 GGCTTAACCCTGGAACTGCTTCTAAAACTG (서열번호 1)
OT-R1 CTTTCGCCACTGGTGTTCCTTCTAATATCT (서열번호 2)
OT-F2 GTGCTAGATATTGGGGGATTTTTCTTTCAG (서열번호 3)
OT-R2 TTGGTAAGGTTTTTCGCGGATCATCGAATT (서열번호 4)
16S rRNA gRNA OT1 TAGTGTAGAGGTAAAATTCT(서열번호 5) TTTC
OT2 GTAGCTAACGCATTAAGCAC(서열번호 6) TTTC
형광 분석과 결합된 OT Two-pot DETECTR는 설계된 프라이머 및 gRNA가 오리엔티아 쯔쯔가무시를 검출할 수 있다는 것을 보여주었다. 결과가 도 3(y축은 형광 강도를 의미하는지 확인 요망) 에 표시된다. (A)는 OT1 gRNA에 의한 결과이고, (B)는 OT2 gRNA에 의한 결과이다. 임상 시료로부터 RNA 추출 및 Two-pot DETECTR를 위해 요구되는 최소 반응 시간은 각각 20분 및 60분(FQ-리포터) 또는 62분(FB-리포터)이었다(도 2). LFA는 결과 해석을 위해 추가적으로 2분을 더 소요했다. 따라서, 본 발명에 따른 OT Two-pot DETECTR 시스템은 형광 분석 및 LFA에 의해 각각 80분 및 82분 내에 진단용 시료로부터 오리엔티아 쯔쯔가무시를 효과적으로 검출할 수 있다.
실시예 2. O. tsutsugamushi Two-pot DETECTR 분석의 민감도 (LoD) 결정
체외 전사 (In vitro transcription)을 통해 획득한 오리엔티아 쯔쯔가무시 16S rRNA를 대상으로 오리엔티아 쯔쯔가무시 DETECTR를 수행하여 오리엔티아 쯔쯔가무시를 검출했다. 구체적으로, 100 내지 103 카피/반응의 상이한 농도의 16S rRNA 시료를 이용하여 오리엔티아 쯔쯔가무시 Two-pot DETECTR를 수행하여 검출 한계를 결정하였다. 그 결과가 도 4에 도시된다. OT1 gRNA를 사용한 오리엔티아 쯔쯔가무시 DETECTR는 반응당 102 RNA 카피까지, OT2 gRNA를 사용한 오리엔티아 쯔쯔가무시 DETECTR는 반응당 101 RNA 카피까지 체외 전사된 RNA를 검출할 수 있었다.
실시예 3. O. tsutsugamushi Two-pot DETECTR의 임상 시료로의 적용
임상 적용성을 평가하기 위해, 오리엔티아 쯔쯔가무시 Two-pot DETECTR를 이용하여 환자 혈장 시료에서 오리엔티아 쯔쯔가무시 16S rRNA를 검출하고, 결과를 Nested-PCR 진단 테스트의 결과와 비교했다. 임상 적용성 평가에는 Nested-PCR로 확인된 양성 임상 시료 29개와 음성 임상 시료 54개를 사용했다. 양성 임상 시료 및 음성 임상 시료에 대한 Two-pot DETECTR 결과가 각각 도 5 및 도 6에 도시된다. 도 5a는 OT1 gRNA에 의한 결과이고, 도 5b는 OT2 gRNA에 의한 결과이고, 도 6a는 OT1 gRNA에 의한 결과이고, 도 6b는 OT2 gRNA에 의한 결과이다. Nested-PCR 결과와 일치되게, OT1 및 OT2 gRNA를 이용한 형광 분석 및 LFA와 결합한 오리엔티아 쯔쯔가무시 Two-pot DETECTR도 양성으로 확인된 동일한 시료에서만 감염을 확인했다. 이러한 결과는 오리엔티아 쯔쯔가무시 Two-pot DETECTR가 임상 시료에서 오리엔티아 쯔쯔가무시 검출에 대해 Nested-PCR과 유사한 민감도를 갖는다는 것을 명확하게 보여준다.
실시예 4. One-pot DETECTR를 이용한 O. tsutsugamushi 검출
실험의 편의성 및 현장진단의 가능성을 위해, 오리엔티아 쯔쯔가무시의 16S rRNA의 검출을 위한 One-pot DETECTR를 설계했다. 체외 전사 (In vitro transcription)을 통해 획득한 오리엔티아 쯔쯔가무시 16S rRNA를 대상으로 오리엔티아 쯔쯔가무시 One-pot DETECTR를 수행하여 오리엔티아 쯔쯔가무시를 검출했다. 형광 분석과 결합된 One-pot DETECTR는 Two-pot DETECTR와 마찬가지로 설계된 프라이머 및 gRNA를 사용하여 오리엔티아 쯔쯔가무시를 20분 이내로 검출할 수 있다는 것을 보여주었다. 도 7에 결과가 도시된다.

Claims (15)

  1. 유전자 가위를 이용하여 오리엔티아 쯔쯔가무시 (Orientia tsutsugamushi)를검출하는 방법으로서,
    시료를 제공하는 단계,
    오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트를 이용하여 시료 중 핵산을 등온증폭시키는 단계, 및
    상기 등온증폭에 의해 수득된 산물에 오리엔티아 쯔쯔가무시의 16 rRNA 유전자에 특이적인 가이드 RNA와 CRISPR-Cas(CRISPR-associated protein) 12a, 및 단일가닥 DNA 리포터를 첨가하여 유전자 가위에 의한 분자진단을 수행하는 단계를 포함하는 것인 방법.
  2. 청구항 1에 있어서, 상기 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트는 서열번호 1의 프라이머 및 서열번호 2의 프라이머, 또는 서열번호 3의 프라이머 및 서열번호 4의 프라이머로 구성되는 것인 방법.
  3. 청구항 1에 있어서, 상기 가이드 RNA는 T-뉴클레오티드가 풍부한 PAM 서열을 갖는 오리엔티아 쯔쯔가무시의 16S rRNA 유전자를 표적으로 하는 것인 방법.
  4. 청구항 1에 있어서, 상기 시료를 제공하는 단계는 상기 시료를 가열하여 상기 시료 중 핵산분해효소 활성을 제거하고 RNA를 추출하는 단계를 더 포함하는 것인 방법.
  5. 청구항 1에 있어서, 상기 등온증폭시키는 단계는 서열번호 1과 2, 또는 서열번호 3과 4로 이루어진 프라이머 세트를 이용한 RT-RPA(Reverse Transcription-Recombinase Polymerase Amplification)에 의해 수행되는 것인 방법.
  6. 청구항 1에 있어서, 상기 가이드 RNA는 서열번호 5 또는 6의 서열로 구성되는 것인 방법.
  7. 청구항 1에 있어서, 상기 분자진단을 수행하는 단계는 상기 가이드 RNA에 의한 등온증폭 산물 중 표적 부위의 검출, CRISPR-Cas12a의 활성화, 및 활성화된 CRISPR-Cas12a에 의한 단일가닥 DNA 리포터의 절단을 포함하며, 상기 단일가닥 DNA 리포터는 상기 가이드 RNA와 혼성화되지 않고 표지 물질로 표지된 것인 방법.
  8. 청구항 7에 있어서, 상기 CRISPR-Cas12a는 라크노스피라세애(Lachnospiraceae) 박테리아로부터 유래된 LbCas12a인 것인 방법.
  9. 청구항 1에 있어서, 상기 분자진단을 수행하는 단계는 단일가닥 DNA 프로브의 절단 여부를 형광 분석이나 LFA(lateral flow assay)에 의해 검출하여 상기 시료 중 오리엔티아 쯔쯔가무시의 존재 여부를 결정하는 단계를 포함하는 것인 방법.
  10. 청구항 9에 있어서, 상기 LFA는 스트립 상에서 수행되는 것인 방법.
  11. 청구항 9에 있어서, 상기 등온증폭시키는 단계와 형광 분석 또는 LFA는 동일한 온도에서 수행되는 것인 방법.
  12. 청구항 11에 있어서, 상기 온도는 37℃ 또는 42℃인 것인 방법.
  13. 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트와 가이드 RNA, CRISPR-Cas12a, 및 단일가닥 DNA 프로브를 포함하는, 오리엔티아 쯔쯔가무시 검출용 키트로서, 상기 오리엔티아 쯔쯔가무시의 16S rRNA 유전자에 특이적인 프라이머 세트는 서열번호 1로 구성된 프라이머 및 서열번호 2로 구성된 프라이머, 및/또는 서열번호 3으로 구성된 프라이머 및 서열번호 4로 구성된 프라이머로 구성되고, 상기 가이드 RNA는 서열번호 5 및/또는 6으로 구성되는 것인 키트.
  14. 청구항 13에 있어서, 상기 키트는 RT-RPA 및 CRISPR-Cas12a 기반 검출에 의해 오리엔티아 쯔쯔가무시를 검출하여 쯔쯔가무시증의 진단에 필요한 정보를 제공하는 것인 키트.
  15. 청구항 13에 있어서, 상기 키트는 형광법 또는 LFA에 의한 검출을 위한 시약을 더 포함하는 것인 키트.
PCT/KR2023/015970 2022-10-26 2023-10-17 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법 WO2024090872A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0139433 2022-10-26
KR20220139433 2022-10-26

Publications (1)

Publication Number Publication Date
WO2024090872A1 true WO2024090872A1 (ko) 2024-05-02

Family

ID=90831126

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/015970 WO2024090872A1 (ko) 2022-10-26 2023-10-17 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법

Country Status (1)

Country Link
WO (1) WO2024090872A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110139905A (ko) * 2010-06-24 2011-12-30 조선대학교산학협력단 쯔쯔가무시병 진단용 프라이머 및 이를 이용한 쯔쯔가무시병의 진단 방법
US20210269858A1 (en) * 2018-11-19 2021-09-02 The Regents Of The University Of California Methods for detecting and sequencing a target nucleic acid
US20210371926A1 (en) * 2018-01-29 2021-12-02 The Broad Institute, Inc. Crispr effector system based diagnostics
US20220325363A1 (en) * 2019-06-18 2022-10-13 Mammoth Biosciences, Inc. Assays and methods for detection of nucleic acids

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110139905A (ko) * 2010-06-24 2011-12-30 조선대학교산학협력단 쯔쯔가무시병 진단용 프라이머 및 이를 이용한 쯔쯔가무시병의 진단 방법
US20210371926A1 (en) * 2018-01-29 2021-12-02 The Broad Institute, Inc. Crispr effector system based diagnostics
US20210269858A1 (en) * 2018-11-19 2021-09-02 The Regents Of The University Of California Methods for detecting and sequencing a target nucleic acid
US20220325363A1 (en) * 2019-06-18 2022-10-13 Mammoth Biosciences, Inc. Assays and methods for detection of nucleic acids

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide 11 March 2019 (2019-03-11), ANONYMOUS: "Orientia tsutsugamushi strain Karp 16S ribosomal RNA, partial sequence", XP093164466, retrieved from NCBI Database accession no. NR_025860.1 *

Similar Documents

Publication Publication Date Title
US10689716B1 (en) Materials and methods for detecting coronavirus
EP4202064A1 (en) Kit and method for isothermal rapid detection of sars-cov-2 virus nucleic acid
CA2542787C (en) Method and kit for primer based multiplex amplification of nucleic acids
CN111118228A (zh) 一种用于新型冠状病毒covid-19核酸检测试剂盒及其使用方法
CN113234856B (zh) 一种基于CRISPR/Cas12a和恒温扩增的DENV一步法核酸检测方法
JP7374377B2 (ja) チフス菌の検査キット、その製造方法及びその用途
JP2015536676A (ja) 糞便サンプル中のヘリコバクターピロリｄｎａを検出するための方法
TW202219272A (zh) SARS-CoV-2之偵測
WO2023207909A1 (zh) 基于crispr的核酸检测试剂盒及其应用
WO2024090872A1 (ko) 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법
US8785133B2 (en) Oligonucleotides and process for detection of swine flu virus
WO2013132447A1 (en) Real time pcr detection of m. tuberculosis resistant/susceptible to rifampicin and/or isoniazid
WO2013128405A1 (en) Real time pcr detection of respiratory syncytial virus
US9593384B2 (en) Metronidazole resistance in trichomonas vaginalis and single nucleotide polymorphisms
CN115838834A (zh) 一种基于RT-RAA和CRISPR/Cas12a的人鼻病毒A型和C型检测体系
KR20230016230A (ko) 표적 물질의 검출용 키트 및 이를 이용하여 표적 물질을 검출하는 방법
CN115992273A (zh) 用于检测肺炎链球菌的核酸分子、试剂盒及检测方法
KR102267326B1 (ko) 코로나 바이러스 진단방법 및 진단용 키트
EP3885455A1 (en) Method and kit for the detection of sars-cov-2 virus in a sample based on reverse transcription loop-mediated isothermal amplification (rt-lamp)
CN114410799A (zh) 一种基于PCR-CRISPR/Cas13a的梅毒螺旋体检测方法
KR20240083163A (ko) 유전자가위 기반 쯔쯔가무시증의 신속 진단 방법
CN114807435A (zh) 一种用于呼吸道合胞病毒检测的试剂盒及其应用
EP2971083B1 (en) Detection of neisseria gonorrhoeaes
KR20140064918A (ko) 분자 검출 분석법
WO2022177066A1 (ko) 유전자가위 기반 인플루엔자 바이러스 타입의 신속 검출