WO2022154602A1 - 곰취 추출물을 포함하는 가려움증 완화용 조성물 - Google Patents

곰취 추출물을 포함하는 가려움증 완화용 조성물 Download PDF

Info

Publication number
WO2022154602A1
WO2022154602A1 PCT/KR2022/000779 KR2022000779W WO2022154602A1 WO 2022154602 A1 WO2022154602 A1 WO 2022154602A1 KR 2022000779 W KR2022000779 W KR 2022000779W WO 2022154602 A1 WO2022154602 A1 WO 2022154602A1
Authority
WO
WIPO (PCT)
Prior art keywords
extract
gomchwi
composition
present
itching
Prior art date
Application number
PCT/KR2022/000779
Other languages
English (en)
French (fr)
Inventor
정문정
Original Assignee
주식회사 피프틴디그리즈
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 피프틴디그리즈 filed Critical 주식회사 피프틴디그리즈
Priority claimed from KR1020220005906A external-priority patent/KR20220103652A/ko
Publication of WO2022154602A1 publication Critical patent/WO2022154602A1/ko

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/28Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/04Antipruritics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin

Definitions

  • the present invention relates to a composition for relieving itching comprising an extract of Gomchwi as an active ingredient.
  • Itching is the most important symptom of skin diseases, and it is a phenomenon that appears to protect the skin from external harmful or irritating substances as a physiological self-protection function. Itching can be accompanied by pain, and even the same stimulus can cause very different degrees of itching from time to time and from person to person. Itching may occur as a mild symptom by external stimuli, and may also occur in association with various skin diseases or medical and neurological diseases. Itching is caused by various causes, which cause secondary skin lesions such as wounds and rashes, and when itching is scratched, inflammatory factors are simultaneously secreted into the itch-causing substances, creating a vicious cycle in which the itch with pain gets worse.
  • Each peripheral nerve including the skin, has strong itch mediators and receptors, including H4 histamine receptors, PAR-2, cathepsin S, interleukin-31 (IL-31), and transient receptor potentials. These include transient receptor potential vanilloid type 1 (TRPV1), nerve growth factor (NGF) and receptors, acetylcholine, substance P, and the like.
  • TRPV1 transient receptor potential vanilloid type 1
  • NVF nerve growth factor
  • acetylcholine substance P, and the like.
  • IL-31 when IL-31 is overexpressed in lymphocytes, it causes dermatitis along with scratching behavior, and it is known that IL-31 expression is increased in skin lesions of patients with atopic dermatitis or itchy rash.
  • the gene mutation of the IL-31 receptor is involved in the pathogenesis of familial primary amyloidosis accompanied by local itch, and it was found that it induces itch by acting directly on the receptor in the skin nerve fibers.
  • the anti-IL-31 antibody showed the effect of reducing the scratching behavior when a skin lesion occurred in a mouse atopic dermatitis model, confirming that IL-31 is an important mediator for itch.
  • mast cells are cells with abundant granules in the cytoplasm.
  • ligands such as antibodies generated by external stimuli bind to receptors, they produce mediators involved in skin itchiness and rash. will be secreted
  • Histamine is a representative indicator mediator, and there are cytokines, leukotrienes, and prostaglandins (PGEs) that are newly generated and released after receiving a stimulus.
  • PGEs prostaglandins
  • histamine when combined with vascular endothelial cells, the vascular cells contract and the plasma in the blood is exuded into the tissue. NO) may induce the synthesis of substances such as vasodilatation and cause skin reactions such as edema, redness, heat and itching (Yano et al., J Clin Invest., 1989;84:1276-86).
  • the drugs generally used to relieve itching include antihistamines and steroids. If taken for a long time or applied to the skin, tolerance develops and the effect becomes insignificant compared to the amount used, and side effects depending on individual constitution and characteristics This can happen. Therefore, it is necessary to develop a material that effectively controls itching and minimizes side effects, and for this purpose, research using natural materials is being actively conducted.
  • an object of the present invention is to provide a composition comprising an extract of a natural material capable of alleviating or alleviating itching.
  • an object of the present invention is to provide a cosmetic composition and a pharmaceutical composition comprising the composition.
  • Gomchwi Ligularia fischeri
  • Gomchwi is a perennial grass belonging to the dicotyledonous plant of the Asteraceae family of the order Asteraceae, with a stem height of 1 to 2 m, thick rhizomes and hairless, but the leaves on the root have long petioles, and the leaf body is heart-shaped and has a There are even teeth.
  • the front side of the leaf is green and the back side is light green.
  • the stem has three leaves, and the bottom leaf is small and the lower part of the petiole surrounds the stem.
  • the present invention is characterized in that it contains Gomchwi extract as an active ingredient in order to alleviate or alleviate skin itching.
  • One aspect of the present invention provides a composition for relieving itching comprising a gomchwi extract as an active ingredient.
  • Gomchwi extract used in the present invention is an extract obtained by extraction treatment of Gomchwi, a diluted or concentrated liquid of the extract, a dried product obtained by drying the extract, a prepared or purified product of the extract, or a mixture thereof, such as the extract itself and the extract Includes extracts of all formulations that can be formed using
  • the gomchwi extract can use gomchwi extracted from nature or commercially grown and sold, and in this case, gomchwi may be unprocessed raw or may be in a state that has been subjected to processing such as freezing, drying, leaves, petioles, stems, It may be obtained by selectively using roots or the like, or by using all of them, but is not limited thereto.
  • the gomchwi extract may be obtained using an extraction method known in the art without limitation.
  • the extraction method may include, for example, cold extraction, ultrasonic extraction, reflux cooling extraction, hot water extraction, pressure extraction, solvent extraction, and the like, and two or more extraction methods may be used in combination for effective active ingredient extraction.
  • the gomchi extract is water, alcohol having 1 to 4 carbon atoms, propylene glycol, butylene glycol, glycerin, acetone, ethyl acetate, butyl acetate, chloroform, diethyl ether, dichloro It may be extracted with a solvent selected from the group consisting of methane, hexane, and mixtures thereof.
  • the gomchwi extract may be prepared in a powder state by an additional process such as concentration under reduced pressure and freeze-drying or spray-drying.
  • the Gomchwi extract includes not only the extract by the above-described extraction method, but also the extract that has undergone a conventional purification process.
  • a conventional purification process For example, separation using an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (prepared for separation according to size, charge, hydrophobicity, or affinity), etc. Fractions obtained through various purification methods may also be included in the extract of the present invention.
  • the Gomchwi extract is 0.5 to 8 hours (preferably, 1 to 5 hours) after mixing Gomchwi and 1 to 20 times (preferably, 10 to 15 times) of a solvent. After the filtrate is concentrated under reduced pressure, it may be obtained by freeze-drying.
  • This gomchi extract contains a large amount of total flavonoids and polyphenols, and can be usefully used as a composition for alleviating itching by inhibiting the secretion of related factors such as cytokines and histamines that cause itching.
  • the Gomchwi extract contains total polyphenols 113.97 ⁇ 0.37 mg GAE/g and total flavonoids 29.22 ⁇ 2.06 mg QE/g in the case of ethanol extraction, and total polyphenols 4137 ⁇ 195 ⁇ g GAE/g in the case of hot water extraction, total Flavonoid content shows excellent DPPH and ABTS radical scavenging ability, including 1626.7 ⁇ 36.8 ⁇ g QE/g, has no cytotoxicity to mast cells and immune cells secreting itch-inducing substances, and IL-4 and IL secreted from mast cells -31 and histamine, as well as IL-1 ⁇ , IL-6, TNF-a, nitric oxide, and prostaglandin secreted by immune cells, are significantly inhibited at the gene and protein levels to reduce itchiness that may appear throughout the body, including the skin. can be effectively alleviated or alleviated.
  • the gomchwi extract may inhibit the secretion of cytokines (IL-4, IL-31) and histamine that act as a strong mediator of itch.
  • a composition comprising such a gomchi extract can be used to relieve itching of the whole body, including the skin.
  • the composition can be used as a shampoo, body cleanser, soap, foam cleanser, skin, lotion, cream, ointment, spray, toothpaste, wet tissue, animal wipe, pet cleaner, fabric softener, lens cleaner, feminine cleanser, etc. can be used
  • the gomchwi extract can be usefully used as a composition for improving scalp troubles and strengthening hair.
  • the composition may be a composition for skin, scalp, oral cavity, eye or vagina.
  • Another aspect of the present invention provides a cosmetic composition for alleviating itching comprising the composition containing the extract containing Gomchwi.
  • the cosmetic composition can alleviate or improve skin itch by effectively inhibiting the secretion of not only IL-4, IL-31 and histamine, which are itch-inducing factors, but also IL-1 ⁇ , IL-6, nitric oxide, and prostaglandin.
  • the cosmetic composition according to the present invention includes solutions, external ointments, creams, foams, nourishing lotions, softening lotions, packs, soft water, emulsions, makeup bases, essences, soaps, liquid detergents, bathing agents, sunscreen creams, sun oils, suspensions, Emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, patches and sprays can be prepared in a formulation selected from the group consisting of, but not limited to it is not
  • the cosmetic composition may further include one or more cosmetically acceptable carriers to be formulated in general skin cosmetics, and as common ingredients, for example, oil, water, surfactant, Moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, fragrances and the like may be appropriately formulated, but the present invention is not limited thereto.
  • one or more cosmetically acceptable carriers to be formulated in general skin cosmetics, and as common ingredients, for example, oil, water, surfactant, Moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, fragrances and the like may be appropriately formulated, but the present invention is not limited thereto.
  • the cosmetically acceptable carrier included in the cosmetic composition may vary depending on the formulation.
  • the formulation of the cosmetic composition according to an embodiment of the present invention is an ointment, paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, Silicon, bentonite, silica, talc, zinc oxide, or mixtures thereof may be used.
  • the formulation of the cosmetic composition according to an embodiment of the present invention is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide chlorofluorohydrocarbon, propane/butane or di It may contain a propellant such as methyl ether.
  • a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, diethyl carbonate, ethyl acetate, Benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, and oils may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol Fatty acid esters, polyethylene glycol or fatty acid esters of sorbitan may be used.
  • the formulation of the cosmetic composition according to an embodiment of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxy
  • a suspending agent such as ethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth may be used.
  • another aspect of the present invention provides a pharmaceutical composition for preventing or treating itching comprising the composition containing Gomchwi extract.
  • the itch is skin pruritus which is itchy without rash, etc., senile pruritus in which the entire skin is itchy due to age-related changes, menopausal pruritus seen in menopause in women, diabetes, It may be at least one selected from the group consisting of jaundice, pruritus accompanying gastrointestinal disease, anal pruritus occurring around the anus, and female vulvar pruritus caused by menstruation, genitalia (cold), masturbation, and the like.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive.
  • the additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, hydroxycalcium phosphate, lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opa Dry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol and talc, but is not limited thereto.
  • the pharmaceutical composition according to one embodiment of the present invention may include a pharmaceutically acceptable carrier.
  • the carrier is commonly used in the manufacture of pharmaceuticals, lactose, dextrose, sucrose, sorbitol, mannitol, trehalose, hyaluronic acid, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, fine crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but is not limited thereto.
  • the pharmaceutical composition according to one embodiment of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, kaolin, kaolin, kaolin, sorbiol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, a talct, a talct, a talct, a talct, a stevia, glycerin, a stea, stea
  • the pharmaceutical composition of the present invention may be administered in various oral and parenteral formulations during actual clinical administration, and when formulated, commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents such as surfactants or excipients
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium, in the herbal composition with increased fat-soluble polyphenol component of the present invention. It can be prepared by mixing carbonate (calciumcarbonate), sucrose (sucrose), lactose (lactose) or gelatin.
  • lubricants such as magnesium stearate talc may also be used.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally according to a desired method, and when administered parenterally, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection may be selected.
  • intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection may be selected.
  • the dosage varies according to the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.
  • the composition according to one embodiment of the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the effective amount of the pharmaceutical composition according to one embodiment of the present invention may vary depending on the patient's age, sex, and weight, and generally 0.001 mg to 1,000 mg, 0.01 mg to 100 mg, or 0.1 mg per 1 kg of body weight. To 10 mg may be administered daily or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, the severity of the disease, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any way.
  • Gomchwi extract according to the present invention exhibits excellent radical scavenging ability by total polyphenols and flavonoids, and by significantly inhibiting itch-inducing factors at the gene and protein level, it can effectively relieve itching that can appear throughout the body, including the skin. It can be usefully used as a composition for relief.
  • Figure 2 is a result of measuring the ABTS radical scavenging ability by Gomchwi extract according to an embodiment of the present invention.
  • 3 is a result of measuring the cell viability of MC/9 cells by a gomchwi extract according to an embodiment of the present invention.
  • 5 is a result of measuring the mRNA expression level of the IL31 gene by Gomchwi extract according to an embodiment of the present invention.
  • 11 is a result of measuring the mRNA expression level of the PTGS2 gene by Gomchwi extract according to an embodiment of the present invention.
  • FIG. 13 is a result of measuring the mRNA expression level of IL6 gene by Gomchwi extract according to an embodiment of the present invention.
  • 16 is a result of measuring the protein expression level of JNK by Gomchwi extract according to an embodiment of the present invention.
  • 17 is a result of measuring the protein expression level of P38 by Gomchwi extract according to an embodiment of the present invention.
  • 21 is a result of measuring the amount of IL-6 produced by Gomchwi extract according to an embodiment of the present invention.
  • Gomchwi was grown in the wild in Baekokpo-ri Keungol in Pyeongchang and was harvested in July 2020, and leaves of gomchwi including petioles were used.
  • the total polyphenol content of Gomchwi ethanol extract was 113.97 ⁇ 0.37 mg GAE/g
  • the total flavonoid content was 29.22 ⁇ 2.06 mg QE/g
  • the total polyphenol content of Gomchwi hot water extract was 4137 ⁇ 195 ⁇ g.
  • GAE/g total flavonoid content was found to be 1626.7 ⁇ 36.8 ⁇ g QE/g.
  • the DPPH radical scavenging ability of LFE increased in a concentration-dependent manner, and at this time, it was confirmed that the IC 50 value was 211.32 ⁇ g/ml.
  • the final concentration of Gomchwi extract was diluted to a concentration of 25, 50, 100, 250, 500, and 1000 ⁇ g/ml, and the ABTS solution was 7.4 mM ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-) 6-sulfonic acid)) and 2.6 mM potassium persulphate were mixed, and left in a dark place for one day to form cations (ABTS+). Then, the absorbance was measured at 732 nm and the absorbance value was 1.5.
  • the ABTS radical scavenging ability of LFE increased in a concentration-dependent manner, and it was confirmed that the IC 50 value was 94.34 ⁇ g/ml.
  • MC/9 cells were prepared with 10% FBS, 10% T-stim, 0.05 mM 2-mercaptoethanol (Gibco BRL, USA), 2 mM L-glutamine and 100 ⁇ g/ml penicillin-streptomycin ( Penicillin-streptomycin) containing DMEM medium (Gibco BRL, USA) was used and cultured in a cell incubator maintained at 37° C. and 5% CO 2 conditions, and subcultures were carried out every 2-3 days.
  • MC/9 cells were seeded in a 48-well plate at 1X10 5 cells/well and cultured for 24 hours. After 24 hours, LFE was treated at concentrations of 25, 50, 100, and 200 ⁇ g/ml and cultured for 12 hours again. The sample was treated with ascorbic acid as a positive control and distilled water as a negative control. After incubation, 10 ⁇ l of an EZ-Cytox solution (Daeilab, Korea) was added per 100 ⁇ l of the culture medium and reacted in a cell incubator for 30 minutes. After the reaction, the change in absorbance at 450 nm was measured and the cell viability relative to the control was expressed as a percentage.
  • LFE maintained the cell viability of MC/9 cells at a level of about 100% at a concentration of 100 ⁇ g/ml or less, and the cell viability of MC/9 cells at a concentration of 200 ⁇ g/ml or more. It appeared to be slightly reduced, and it was confirmed that there was no cytotoxicity.
  • MC/9 cells were seeded in a 6-well plate at 2X10 6 cells/well and cultured for 24 hours. After incubation, LFE was treated at concentrations of 25, 50, and 100 ⁇ g/ml, and 1 hour later, 1 ⁇ g/ml of DNP-IgE (Sigma-Aldrich, USA) was added and cultured for 12 hours. Thereafter, RNA was extracted from the cells using a total RNA prep kit (Intronbio, Korea). After centrifugation at 1,200 rpm for 5 minutes, 1 ml of easy blue and 200 ⁇ l of chloroform were added to the obtained cells and vortexed, followed by centrifugation at 13,000 rpm and 4° C. for 10 minutes.
  • 700 ⁇ l of the reaction solution was injected into a column and centrifuged at 13,000 rpm for 30 seconds.
  • 700 ⁇ l of washing buffer A was added to the column, centrifuged at 13,000 rpm for 30 seconds, and 700 ⁇ l of washing buffer B was added, followed by centrifugation in the same manner.
  • 30 ⁇ l of an elution buffer was added to the column, reacted for 1 minute, and centrifuged at 13,000 rpm for 1 minute to extract total RNA.
  • the reverse transcription reaction was performed using a mixture of RT premix kit (AccuPower® CycleScript RT PreMix) (Bioneer, Korea) (reaction buffer, dNTPs mixture, RNase inhibitor, stabilizer and oligomers).
  • (oligo)-dT15 primer was added) to 1 ⁇ g of total RNA, and DEPC-DW was added to a final volume of 20 ⁇ l. After mixing this mixture well, react at 45°C for 60 minutes to synthesize first-strand cDNA, and leave at 95°C for 5 minutes to inactivate M-MLV RT (reverse transcriptase) to inactivate the synthesized cDNA by PCR (polymerase) chain reaction).
  • Primer sequence (5'-3') SEQ ID NO: IL4 forward CAACCCCCAGCTAGTTGTCA One reverse TGTCGCATCCGTGGATATGG 2 IL31 forward TCAGCAGACGAATCAATACAGC 3 reverse TCGCTCAACACTTTGACTTTCT 4 ACTB forward ATCGTGGGGCGCCCCAGGCACCA 5 reverse GGGGTACTTCAGGGTGAGGA 6
  • MC/9 cells were seeded in a 6-well plate at 2X10 6 cells/well and cultured for 24 hours. After incubation, LFE was treated at concentrations of 25, 50, and 100 ⁇ g/ml, and 1 hour later, 1 ⁇ g/ml of DNP-IgE was added and incubated for 6 hours. Thereafter, the cells obtained by centrifugation at 1,200 rpm for 5 minutes were washed twice with D-PBS, and protease inhibitor cocktail I (Sigma-Aldrich, USA), phosphatase inhibitor (Sigma-Aldrich, USA) was added to the cell pellet. Proteins were extracted by adding RIPA buffer (Thermo Fisher, USA) containing phosphatase inhibitors II and III.
  • RIPA buffer Thermo Fisher, USA
  • the extracted protein was quantified using a BCA protein assay kit (Thermo Fisher, USA), mixed with a loading buffer, and reacted at 95° C. for 5 minutes to prepare.
  • the prepared proteins were separated by size by SDS-PAGE through 10% acrylamide gel, and transferred to a PVDF membrane.
  • the protein-transferred membrane was immersed in 3% BSA and reacted at room temperature for 2 hours. After washing with TBS-T buffer, as a primary antibody, IL-4 antibody (Santa Cruz Biotechnology, USA), histamine antibody (LSBio, USA) or IL-31 antibody (LSBio, USA) was added at 4°C was reacted for 16 hours.
  • RAW264.7 cells were cultured in a cell incubator maintained at 37° C. and 5% CO 2 conditions using DMEM medium (Gibco BRL, USA) composed of 10% FBS and 1% penicillin-streptomycin, 2-3 days The experiment was carried out by subculture at regular intervals.
  • DMEM medium Gibco BRL, USA
  • RAW264.7 cells were seeded in a 24-well plate at 1X10 5 cells/well and cultured for 24 hours. After 24 hours, LFE was treated at a concentration of 50, 100, 200, 400 ⁇ g/ml and cultured for another 24 hours. The sample was treated with ascorbic acid as a positive control and distilled water as a negative control. After incubation, 10 ⁇ l of an EZ-Cytox solution (Daeilab, Korea) was added per 100 ⁇ l of the culture medium and reacted in a cell incubator for 30 minutes. After the reaction, the change in absorbance at 450 nm was measured and the cell viability relative to the control was expressed as a percentage.
  • LFE maintained the cell viability of RAW264.7 cells at a concentration of 200 ⁇ g/ml or less at a level of about 100%, and the cell viability of RAW264.7 cells at a concentration of 400 ⁇ g/ml or more. It appeared to be slightly reduced, and it was confirmed that there was no cytotoxicity.
  • RAW264.7 cells were seeded in a 6-well plate at 2X10 6 cells/well and cultured for 24 hours. After culturing, LFE was treated at concentrations of 50, 100, and 200 ⁇ g/ml, and 2 hours later, 100 ng/ml of LPS was treated and incubated for 24 hours again. Thereafter, total RNA extraction, cDNA synthesis, and gene amplification were performed in the same manner as in Experimental Example 3 to measure the gene expression level. The sequences of the primers used here are shown in Table 2 below.
  • Primer sequence (5'-3') SEQ ID NO: NOS2 forward CGAAACGCTTCACTTCCAA 7 reverse TGAGCCTATATTGCTGTGGCT 8 PTGS2 forward AACCGCATTGCCTCTGAAT 9 reverse CATGTTCCAGGAGGATGGAG 10 IL1B forward AAGAAGAGCCCATCCTCTGT 11 reverse GGAGCCTGTAGTGCAGTTGT 12 IL6 forward AGTCCTTCCTACCCCAATTTCC 13 reverse GGTCTTGGTCCTTAGCCACT 14 TNFA forward ATGGCCTCCCCTCTCATCAGT 15 reverse TTTGCTACGACGTGGGCTAC 16 ACTB forward AACCGCATTGCCTCTGAAT 17 reverse CATGTTCCAGGAGGATGGAG 18
  • LFE reduced the mRNA expression levels of NO, prostaglandin, IL-1 ⁇ , IL-6 and TNF-a-related genes that induce itch in a concentration-dependent manner.
  • RAW264.7 cells were seeded in a 6-well plate at 2X10 6 cells/well and cultured for 24 hours. After culturing, LFE was treated at concentrations of 50, 100, and 200 ⁇ g/ml, and 2 hours later, 100 ng/ml of LPS was treated and incubated for 24 hours again. Thereafter, the protein expression level was measured in the same manner as in Experimental Example 3.
  • p44/42 MAPK(Erk1/2)(137F5) Rabbit mAb (Cell signaling, USA; hereinafter the same), Phospho-p44/42 MAPK(Erk1/2)(Thr202/Tyr204)(D13.14.4) E) using XP® Rabbit mAb, SAPK/JNK antibody, Phospho-SAPK/JNK (Thr183/Tyr185) (G9) Mouse mAb, p38 MAPK antibody or Phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP® Rabbit mAb did.
  • LFE reduced the protein expression levels of ERK, JNK and P38, which are involved in the expression of itch-inducing factors such as cytokines and histamine, in a concentration-dependent manner.
  • a NO analysis kit (Intronbio, Korea) was used.
  • RAW264.7 cells were seeded in a 24-well plate at 4X10 4 cells/well, cultured for 24 hours, treated with LFE at a concentration of 50, 100, and 200 ⁇ g/ml, and 2 hours later, 100 ng/ml of LPS was added to 24 again. incubated for hours. After incubation, 100 ⁇ l of the cell culture medium was placed in a 96-well plate, 50 ⁇ l of N1 buffer was added, and reacted at room temperature for 10 minutes. After the reaction, 50 ⁇ l of N2 buffer was added and reacted for 10 minutes at room temperature. After the reaction, the change in absorbance at 540 nm was measured, and the production amount relative to the control was expressed as a percentage.
  • mouse PGE2 ELISA kit R&D Systems, USA
  • mouse IL-1 ⁇ ELISA kit Komabiotech, Korea
  • mouse IL-6 ELISA kit Komabiotech, Korea
  • mouse TNF-a ELISA kit Komabiotech, Korea
  • RAW264.7 cells were aliquoted in a 6-well plate at 2X10 6 cells/well, cultured for 24 hours, treated with LFE at a concentration of 50, 100, and 200 ⁇ g/ml, and 2 hours later, 100 ng/ml of LPS was applied to 24 hours. incubated for hours.
  • Gomchwi shampoo was prepared with the composition shown in Table 3 below using the hot water extract of Gomchwi prepared in Example 1.
  • Gomchwi Shampoo was manufactured in accordance with the Cosmetics Act, and in compliance with the 'Regulations on Cosmetic Safety Standards, etc.' announced by the Ministry of Food and Drug Safety and the 'Types, Standards and Test Methods for Colors in Cosmetics', raw materials that cannot be used in cosmetics were not used. In the case of raw materials requiring restriction of
  • the prepared gomchwi shampoo was stored at 5 ⁇ 25 °C avoiding direct sunlight in a high or low temperature place, and skin irritation evaluation and sensory evaluation were performed.
  • test subjects 31 healthy women without acute or chronic physical diseases including skin diseases were selected, and after wiping the subject's flat back area without pigmentation or skin damage with 70% ethanol and drying, 15 ⁇ l of the sample was selected. patch was applied. After 24 hours, the patch was removed, and after 30 minutes, the test site was visually read by a dermatologist. 24 hours and 48 hours after patch removal, the same dermatologist reads again visually.
  • the skin reaction visual evaluation after patch removal was read according to the criteria in Table 4 below to score the skin reaction.
  • the skin irritation index was calculated according to Equation 3 using the skin reaction scores of the subjects, and the degree of irritation was determined according to the determination table of Table 5 below.
  • the Gomchwi shampoo has similar cleaning power and feeling of use to the existing shampoo, gives a refreshing feeling after use, and is effective in improving scalp troubles such as dandruff and seborrheic scalpitis and strengthening hair.
  • the gomchwi extract according to the present invention contains a large amount of total polyphenols and flavonoids to exhibit antioxidant efficacy, and cytokines (IL-4, IL-31, TNF-a, IL-1 ⁇ and By inhibiting the expression and secretion of IL-6), histamine, nitric oxide and prostaglandin, it is possible to effectively alleviate or alleviate itching that may appear in the whole body including the skin, suggesting that it is effective in improving scalp troubles and strengthening hair.
  • cytokines IL-4, IL-31, TNF-a, IL-1 ⁇

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Botany (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Birds (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Medical Informatics (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 곰취 추출물을 유효성분으로 포함하는 가려움증 완화용 조성물에 관한 것으로, 상기 곰취 추출물은 총 폴리페놀 및 플라보노이드에 의해 우수한 라디칼 소거능을 나타내며, 가려움증 유발 인자를 유전자, 단백질 수준에서 유의미하게 억제함으로써 피부를 비롯한 전신에서 나타날 수 있는 가려움증을 효과적으로 완화시킬 수 있어, 가려움증 완화용 조성물로 유용하게 이용될 수 있다.

Description

곰취 추출물을 포함하는 가려움증 완화용 조성물
본 발명은 곰취 추출물을 유효성분으로 포함하는 가려움증 완화용 조성물에 관한 것이다.
가려움증은 피부 질환에서 가장 주요하게 나타나는 증상이며, 생리적인 자기 보호 기능으로 외부의 유해하거나 자극이 되는 물질로부터 피부를 보호하기 위해 나타나는 하나의 현상이다. 가려움증은 통증을 동반할 수 있고, 동일한 자극이라도 때에 따라, 사람에 따라 매우 다른 정도의 가려움증을 일으킬 수 있다. 가려움증은 외부 자극에 의해 경미한 증상으로서 일어날 수도 있으며, 여러 가지 피부질환이나 내과적, 신경과적 질환과 연관되어 발생하기도 한다. 가려움증은 다양한 원인에 의해 유발되는데, 상처, 발진 등의 이차적인 피부 병변을 유발하며, 가려워서 긁게 되면 가려움증 유발 물질에 염증성 인자가 동시에 분비되어 통증을 동반한 가려움증이 더욱 심해지는 악순환이 발생하게 된다.
피부를 비롯하여 각 말초신경에는 강력한 가려움증의 매개체와 수용체가 존재하는데, 여기에는 H4 히스타민 수용체, PAR-2, 카텝신(cathepsin) S, 인터루킨-31(interleukin-31, IL-31), 일시적 수용체 전위 바닐로이드 타입1 (transient receptor potential vanilloid type 1, TRPV1), 신경성장인자(NGF)와 수용체, 아세틸콜린, substance P 등이 포함된다. 특히, IL-31은 림프구에서 과 발현될 경우 긁는 행동과 더불어 피부염을 유발하며, 아토피 피부염 환자나 가려움 발진 환자의 피부 병변에서 IL-31의 발현이 증가한다고 알려져 있다. 최근 IL-31 수용체의 유전자 변이가 국소적인 가려움증을 동반하는 가족성 원발성 아밀로이드증(primary amyloidosis)의 발생기전에 관여됨이 밝혀졌으며, 피부 신경섬유에 있는 수용체에 직접적으로 작용하여 가려움증을 유발한다고 밝혀졌다. 또한 항 IL-31 항체는 생쥐 아토피 피부염 모델에서 피부 병변 발생시 긁는 행동을 감소시키는 효과를 보여 IL-31이 가려움증에 중요한 매개체임을 확인하였다.
한편, 비만세포(mast cell)는 세포질 내에 과립을 풍부하게 가지고 있는 세포로서 외부 자극에 의해 생성된 항체 등과 같은 리간드(ligand)가 수용체에 결합하게 되면, 피부의 가려움증 및 발진 등에 관여하는 매개체를 생산 분비하게 된다. 대표적인 지표 매개체로 히스타민(histamine)이 있으며, 그 외 자극을 받은 후 새롭게 생성되어 유리되는 사이토카인(cytokine), 류코트리엔(leukotriene), 프로스타글란딘(prostaglandin, PGE) 등이 있다. 특히 히스타민의 경우 혈관 내피세포와 결합하면 혈관세포의 수축이 일어나서 혈액 속의 혈장(plasma)을 조직으로 삼출시키며, 내피세포는 혈관 근육세포를 이완시키는 프로스타사이클린(prostacyclin)과 산화질소(nitric oxide, NO)와 같은 물질의 합성을 유도하여 혈관 팽창을 유발하여 부종, 발적, 열 및 가려움 등의 피부반응을 일으킬 수 있다 (Yano et al., J Clin Invest., 1989;84:1276-86).
현재 일반적으로 가려움증을 완화시키는데 사용되는 약물은 항히스타민과 스테로이드 제제를 들 수 있는데, 장기적으로 복용 또는 피부에 도포할 경우 내성이 생기게 되어 점점 더 사용량에 비해 효과는 미미해지며, 개인적인 체질 및 특성에 따라 부작용이 일어날 수 있다. 따라서 가려움증을 효과적으로 제어하면서 부작용이 최소화된 소재의 개발이 필요한 실정이며, 이를 위해 천연 소재를 이용한 연구가 활발히 진행되고 있다.
[선행기술문헌]
[특허문헌]
한국공개특허 제10-2004-0065498호
상기한 문제점을 해결하기 위해, 본 발명은 가려움증을 완화 또는 경감시킬 수 있는 천연 소재의 추출물을 포함하는 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 조성물을 포함하는 화장료 조성물 및 약학 조성물을 제공하는 것을 목적으로 한다.
곰취(Ligularia fischeri)는 초롱꽃목 국화과의 쌍떡잎식물에 속하는 여러해살이 풀로, 줄기 높이가 1 ~ 2 m이며, 뿌리줄기가 굵고 털이 없으나 뿌리 위에 나는 잎에는 긴 잎자루가 있고, 잎몸은 심장 모양이며 가장자리에 고른 톱니가 있다. 잎 앞면은 녹색이며 뒷면은 엷은 녹색이다. 줄기에는 3개의 잎이 있고, 맨 아래 잎은 작고 잎자루의 밑부분이 줄기를 싸고 있다. 이러한 곰취는 한국을 비롯한 일본, 중국, 사할린 등지에 분포하며, 주로 어린잎은 먹으며 한방에서는 뿌리줄기를 말려 해수, 백일해, 천식, 요통, 관절통, 타박상 등에 처방하는 약재로 사용하는 것이 알려져 있으나, 피부 가려움증 완화 또는 경감을 위해 사용된 바가 보고되지 않았다.
본 발명에서는 피부 가려움증을 완화시키거나 경감하기 위해 곰취 추출물을 유효성분으로 포함하는 것을 특징으로 한다.
본 발명의 일 양상은 곰취 추출물을 유효성분으로 포함하는 가려움증 완화용 조성물을 제공한다.
본 발명에서 사용된 “곰취 추출물”은 곰취의 추출 처리에 의하여 얻어지는 추출액, 추출액의 희석액이나 농축액, 추출액을 건조하여 얻어지는 건조물, 추출액의 조정제물이나 정제물, 또는 이들의 혼합물 등, 추출액 자체 및 추출액을 이용하여 형성 가능한 모든 제형의 추출물을 포함한다.
상기 곰취 추출물은 자연에서 채취하거나 상업적으로 재배, 판매하는 곰취를 이용할 수 있으며, 이때 곰취는 가공하지 않은 날 것이거나 동결, 건조 등의 가공을 거친 상태일 수 있으며, 곰취의 잎, 잎자루, 줄기, 뿌리 등을 선택적으로 사용하거나 또는 이들을 모두 사용하여 얻은 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구체예에 따르면, 상기 곰취 추출물은 당 업계에 공지된 추출 방법을 제한 없이 사용하여 얻은 것일 수 있다. 상기 추출 방법은 일례로, 냉침 추출, 초음파 추출, 환류 냉각 추출, 열수 추출, 가압 추출, 용매 추출 등을 들 수 있으며, 효과적인 활성성분 추출을 위해 2종 이상의 추출 방법을 조합하여 사용할 수 있다.
본 발명의 일 구체예에 따르면, 상기 곰취 추출물은 물, 탄소수 1 내지 4개의 알코올, 프로필렌글라이콜, 부틸렌글라이콜, 글리세린, 아세톤, 에틸아세테이트, 부틸아세테이트, 클로로포름, 다이에틸에테르, 다이클로로메탄, 헥산 및 이들의 혼합물로 이루어진 군에서 선택되는 용매로 추출된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 곰취 추출물은 감압 농축 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 곰취 추출물은 상술한 추출 방법에 의한 추출물뿐만 아니라 통상적인 정제 과정을 거친 추출물도 포함한다. 예를 들어, 일정한 분자량 컷-오프(cut-off) 값을 갖는 한외 여과막을 이용한 분리, 다양한 크로마토그래피 (크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등, 추가적으로 실시한 다양한 정제 방법을 통해 얻어진 분획도 본 발명의 추출물에 포함될 수 있다.
본 발명의 일 실시예에 따르면, 상기 곰취 추출물은 곰취와 1 내지 20배 (바람직하게는, 10 내지 15배)의 용매를 혼합한 후 0.5 내지 8시간 (바람직하게는, 1 내지 5시간) 추출한 후 여과액을 감압 농축하고, 동결 건조하여 얻은 것일 수 있다.
이러한 곰취 추출물은 총 플라보노이드 및 폴리페놀을 다량 함유하며, 가려움증을 유발하는 사이토카인, 히스타민 등 관련 인자의 분비를 억제함으로써 가려움증을 완화시키는 조성물로 유용하게 사용될 수 있다.
보다 구체적으로, 상기 곰취 추출물은 에탄올 추출인 경우 총 폴리페놀 113.97±0.37 ㎎ GAE/g 및 총 플라보노이드 29.22±2.06 ㎎ QE/g을, 열수 추출인 경우 총 폴리페놀 4137±195 μg GAE/g, 총 플라보노이드 함량은 1626.7±36.8 μg QE/g을 포함하여 우수한 DPPH 및 ABTS 라디칼 소거능을 나타내며, 가려움증 유발 물질을 분비하는 비만세포와 면역세포에 대해 세포 독성이 없고, 비만세포에서 분비하는 IL-4, IL-31 및 히스타민과, 면역세포에서 분비하는 IL-1β, IL-6, TNF-a, 산화질소, 프로스타글란딘을 유전자 및 단백질 수준에서 발현을 유의적으로 억제하여 피부를 비롯한 전신에서 나타날 수 있는 가려움증을 효과적으로 완화 또는 경감시킬 수 있다.
본 발명의 일 구체예에 따르면, 상기 곰취 추출물은 가려움증의 강력한 매개체로 작용하는 사이토카인 (IL-4, IL-31) 및 히스타민 분비를 억제하는 것일 수 있다.
이러한 곰취 추출물을 포함하는 조성물은 피부를 비롯한 전신의 가려움증을 완화하는 용도로 사용될 수 있다. 예를 들어, 상기 조성물은 샴푸, 바디클렌져, 비누, 폼클렌져, 스킨, 로션, 크림, 연고, 스프레이, 치약, 물티슈, 동물용 물티슈, 애완동물용 세정제, 섬유유연제, 렌즈 세정제, 여성용 청결제 등으로 사용될 수 있다.
또한, 상기 곰취 추출물은 두피 트러블 개선 및 모발 강화를 위한 조성물로도 유용하게 사용될 수 있다.
본 발명의 일 구체예에 따르면, 상기 조성물은 피부용, 두피용, 구강용, 안구용 또는 질(膣)용 조성물인 것일 수 있다.
본 발명의 다른 양상은 상기 곰취 추출물 함유 조성물을 포함하는 가려움증 완화용 화장료 조성물을 제공한다.
상기 화장료 조성물은 가려움증 유발 인자인 IL-4, IL-31 및 히스타민뿐만 아니라 IL-1β, IL-6, 산화질소, 프로스타글란딘의 분비를 효과적으로 억제함으로써 피부 가려움을 완화 또는 개선할 수 있다.
본 발명에 따른 화장료 조성물은 용액, 외용연고, 크림, 폼, 영양화장수, 유연화장수, 팩, 유연수, 유액, 메이크업베이스, 에센스, 비누, 액체 세정료, 입욕제, 선 스크린크림, 선오일, 현탁액, 유탁액, 페이스트, 겔, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션, 패취 및 스프레이로 이루어진 군으로부터 선택되는 제형으로 제조할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 화장료 조성물은 일반 피부 화장료에 배합되는 화장품학적으로 허용 가능한 담체를 1 종 이상 추가로 포함할 수 있으며, 통상의 성분으로 예를 들면 유분, 물, 계면활성제, 보습제, 저급 알코올, 증점제, 킬레이트제, 색소, 방부제, 향료 등을 적절히 배합할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 화장료 조성물에 포함되는 화장품학적으로 허용 가능한 담체는 제형에 따라 다양할 수 있다.
본 발명의 일 구체예에 따른 화장료 조성물의 제형이 연고, 페이스트, 크림 또는 젤인 경우에는, 담체 성분으로서 동물성 유, 식물성 유, 왁스, 파라핀, 전분, 트라가칸트, 셀룰로오스 유도체, 폴리에틸렌글라이콜, 실리콘, 벤토나이트, 실리카, 탈크, 징크옥사이드 또는 이들의 혼합물이 이용될 수 있다.
본 발명의 일 구체예에 따른 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는, 담체 성분으로서 락토오스, 탈크, 실리카, 알루미늄하이드록사이드, 칼슘실리케이트, 폴리아마이드 클로로플루오로하이드로카본, 프로판/부탄 또는 다이메틸에터와 같은 추진제를 포함할 수 있다.
본 발명의 일 구체예에 따른 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는, 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되며, 예컨대 물, 에탄올, 아이소프로판올, 다이에틸카보네이트, 에틸아세테이트, 벤질알코올, 벤질벤조에이트, 프로필렌글라이콜, 1,3-부틸렌글라이콜, 오일이 이용될 수 있으며, 특히, 목화씨 오일, 땅콩 오일, 옥수수 배종 오일, 올리브오일, 피마자 오일 및 참깨 오일, 글리세롤지방족에스터, 폴리에틸렌글라이콜 또는 솔비탄의 지방산 에스터가 이용될 수 있다.
본 발명의 일 구체예에 따른 화장료 조성물의 제형이 현탁액인 경우에는, 담체 성분으로서 물, 에탄올 또는 프로필렌글라이콜과 같은 액상의 희석제, 에톡실화 아이소스테아릴알코올, 폴리옥시에틸렌 솔비톨에스터 및 폴리옥시에틸렌 솔비탄 에스터와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄메타하드록사이드, 벤토나이트, 아가 또는 트라가칸트 등이 이용될 수 있다.
또한, 본 발명의 다른 양상은 상기 곰취 추출물 함유 조성물을 포함하는 가려움증 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 일 구체예에 따르면, 상기 가려움증은 발진(發疹) 등은 없고 가렵기만 한 피부소양증, 노인성 변화에 의하여 피부 전체가 가려워지는 노인성 소양증, 여성의 갱년기에 볼 수 있는 갱년기 소양증, 당뇨병, 황달, 위장병 등에 수반되는 소양증, 항문 주위에 일어나는 항문 소양증 및 월경, 대하(냉), 수음(手淫) 등에 의한 여성 외음부 소양증으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 약학 조성물은 약제학적으로 허용 가능한 첨가제를 더 포함할 수 있다. 상기 첨가제는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이드실리콘다이옥사이드, 하이드록시칼슘포스페이트, 락토오스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말 셀룰로오스, 하이드록시프로필셀룰로오스, 오파드라이, 전분글라이콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당, 덱스트로스, 솔비톨 및 탈크 등일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구체예에 따른 약학 조성물은 약학적으로 허용되는 담체를 포함할 수 있다. 상기 담체는 약제의 제조시에 통상적으로 이용되는 것으로, 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 트레할로스, 하이알루로닉애씨드, 전분, 아카시아고무, 칼슘포스페이트, 알지네이트, 젤라틴, 칼슘실리케이트, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸셀룰로오스, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘스테아레이트 및 미네랄오일 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따른 약학 조성물은 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (22th ed., 2013)에 상세히 기재되어 있다.
본 발명의 약학 조성물은 실제 임상 투여 시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 본 발명의 지용성 폴리페놀 성분이 증가된 생약 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로오스(sucrose), 락토오스(lactose) 또는 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용될 수 있다.
본 발명의 약학 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여할 수 있으며, 비경구 투여시 복강내 주사, 직장내 주사, 피하 주사, 정맥 주사, 근육내 주사 또는 흉부내 주사 주입방식을 선택할 수 있다. 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 다양하다.
본 발명의 약학 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에서 "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수 혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 일 구체예에 따른 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요 소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로, 본 발명의 일 구체예에 따른 약학 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1kg 당 0.001 ㎎ 내지 1,000 ㎎, 0.01 ㎎ 내지 100 ㎎, 또는 0.1 ㎎ 내지 10 ㎎을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 질환의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명에 따른 곰취 추출물은 총 폴리페놀 및 플라보노이드에 의해 우수한 라디칼 소거능을 나타내며, 가려움증 유발 인자를 유전자, 단백질 수준에서 유의미하게 억제함으로써 피부를 비롯한 전신에서 나타날 수 있는 가려움증을 효과적으로 완화시킬 수 있어, 가려움증 완화용 조성물로 유용하게 이용될 수 있다.
도 1은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 DPPH 라디칼 소거능을 측정한 결과이다.
도 2는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 ABTS 라디칼 소거능을 측정한 결과이다.
도 3은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 MC/9 세포의 세포생존율을 측정한 결과이다.
도 4는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL4 유전자의 mRNA 발현량을 측정한 결과이다.
도 5는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL31 유전자의 mRNA 발현량을 측정한 결과이다.
도 6은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL-4의 단백질 발현량을 측정한 결과이다.
도 7은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL-31의 단백질 발현량을 측정한 결과이다.
도 8은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 히스타민의 단백질 발현량을 측정한 결과이다.
도 9는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 RAW264.7 세포의 세포생존율을 측정한 결과이다.
도 10은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 NOS2 유전자의 mRNA 발현량을 측정한 결과이다.
도 11은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 PTGS2 유전자의 mRNA 발현량을 측정한 결과이다.
도 12는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL1B 유전자의 mRNA 발현량을 측정한 결과이다.
도 13은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL6 유전자의 mRNA 발현량을 측정한 결과이다.
도 14는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 TNFA 유전자의 mRNA 발현량을 측정한 결과이다.
도 15는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 ERK의 단백질 발현량을 측정한 결과이다.
도 16은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 JNK의 단백질 발현량을 측정한 결과이다.
도 17은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 P38의 단백질 발현량을 측정한 결과이다.
도 18은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 NO 생성량을 측정한 결과이다.
도 19는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 PGE2 생성량을 측정한 결과이다.
도 20은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL-1β 생성량을 측정한 결과이다.
도 21은 본 발명의 일 실시예에 따른 곰취 추출물에 의한 IL-6 생성량을 측정한 결과이다.
도 22는 본 발명의 일 실시예에 따른 곰취 추출물에 의한 TNF-a 생성량을 측정한 결과이다.
도 23은 본 발명의 일 실시예에 따른 곰취 삼푸의 피부 자극 지수를 계산한 결과이다.
도 24는 본 발명의 일 실시예에 따른 곰취 샴푸의 관능 평가 결과이다.
이하, 첨부된 도면을 참조하며 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 곰취 추출물의 제조
곰취는 평창 백옥포리 큰골에서 야생으로 키워져 2020년 7월에 수확한 것으로, 잎자루를 포함한 곰취 잎을 사용하였다.
1-1. 곰취 에탄올 추출물
-4℃에서 2일간 냉동건조한 곰취 40 g에 70% 에탄올 500 ㎖를 넣고 3시간 동안 환류 추출한 후, 여과액을 회전 진공 농축기(rotary vacuum evaporator) (EYELA FDU-540, 일본)로 감압 농축하였으며, 농축된 용액을 동결건조기(freeze dryer) (일신바이오베이스, 한국)로 동결 건조하여 곰취 에탄올 추출물을 수득하였다. 곰취 에탄올 추출물로 3.84 g (수율 9.60%)의 분말을 획득하여 초저온 냉동고 (-80℃)에서 보관하면서 실험에 필요한 농도로 증류수에 희석해 사용하였다.
1-2. 곰취 열수 추출물
곰취 생물 100 g에 효소 펙티나아제(pectinase) (Aspergillus niger 유래, 145 Unit/mg, Danisco) 20 g을 처리한 후 정제수 400 mL를 첨가하여 추출기 (경서 코스모스, COSMOS-660)에서 25℃, 3시간 동안 추출하였다. 추출액을 원심분리 및 여과하였고, 여과액을 진공 동결건조기 (PVTFD1-R, 일신바이오베이스)로 동결 건조하여 분말을 수득하였다. 분말은 -20℃에서 보관하면서 시료로 사용하였다. 이후, 분말에 10 ~ 20배의 물을 넣고 수냉식 냉각 방식으로 감압 추출하여 끓는점 65 ~ 90℃에서 20 ~ 72시간 추출하여 곰취 열수 추출물을 수득하였다. 곰취 열수 추출물은 초저온 냉동고 (-80℃)에서 보관하면서 실험에 필요한 농도로 증류수에 희석해 사용하였다.
실험예 1. 곰취 추출물의 총 폴리페놀 및 플라보노이드 함량
실시예 1에서 제조된 곰취 에탄올 추출물 및 곰취 열수 추출물에 대하여 총 폴리페놀(polyphenol) 및 플라보노이드(flavonoid) 함량을 측정하였다.
총 폴리페놀 측정을 위하여, 곰취 추출물 1 ㎖ (농도 20 ㎎/㎖)에 50% 페놀 시약(folin-Ciocalteu's phenol reagent) (Merck, 독일) 0.5 ㎖를 가하여 실온에서 3분간 반응시켰다. 반응용액에 Na2CO3 포화용액 1 ㎖와 증류수 7.5 ㎖를 차례로 혼합하여 30분간 정치시킨 뒤, 14,000 g에서 10분간 원심분리한 후 상등액을 취해 760 ㎚ 파장에서 흡광도를 측정하였다. 총 페놀 함량은 갈산(gallic acid, GAE) (Sigma, 미국)을 표준물질로 이용하여 작성한 검량선에 따라 함량을 구하였다.
총 플라보노이드 측정을 위하여, 곰취 추출물 0.1 ㎖ (농도 20 ㎎/㎖)과 80% 에탄올 0.9 ㎖을 혼합한 혼합물 0.5 ㎖에 10% 질산알루미늄(aluminium nitrate)와 1M 아세트산칼륨(potassium acetate) 0.1 ㎖ 그리고 80% 에탄올 4.3 ㎖을 가하여 실온에 40분 방치한 뒤 415 ㎚ 파장에서 흡광도를 측정하였으며, 퀘르세틴(quercetin, QE)을 이용하여 작성한 표준곡선으로부터 함량을 구하였다.
그 결과, 곰취 에탄올 추출물의 총 폴리페놀 함량은 113.97±0.37 ㎎ GAE/g, 총 플라보노이드 함량은 29.22±2.06 ㎎ QE/g인 것으로 나타났으며, 곰취 열수 추출물의 총 폴리페놀 함량은 4137±195 μg GAE/g, 총 플라보노이드 함량은 1626.7±36.8 μg QE/g인 것으로 나타났다.
이후 실험예 2 ~ 4에서는 곰취 에탄올 추출물(이하 'LFE'라 함)을 이용하여 곰취 추출물에 의한 가려움증 개선 효과를 확인하였다.
실험예 2. 곰취 추출물의 항산화 효능
곰취 추출물의 항산화력을 평가하기 위하여, 라디칼 소거능(radical scavenging ability)을 측정하였다.
2-1. DPPH 라디칼 소거능 측정
LFE의 최종 농도가 25, 50, 100, 250, 500, 1000 ㎍/㎖의 농도로 될 수 있게 증류수로 희석시켰으며, 에탄올에 용해시킨 0.2 mM의 DPPH(1,1-diphenyl-2-picryl-hydrazyl) 용액 150 ㎕와 시료를 100 ㎕씩 혼합하여 37℃에서 30분간 반응시켰다. 반응 후 마이크로 플레이트 측정기(micro plate reader) (Molecular Devices, U.S.A.)를 통해 517 ㎚ 파장에서 흡광도를 측정하였다. 시료의 양성대조군으로는 아스코르브산(ascorbic acid)을, 음성대조군으로는 증류수를 넣었으며, DPPH 용액의 대조군으로는 에탄올을 넣어 보정 값을 얻었다. DPPH 자유라디칼 소거율은 하기 수학식 1에 따라 계산하였다.
[수학식 1]
Figure PCTKR2022000779-appb-I000001
그 결과, 도 1을 참조하면, LFE의 DPPH 라디칼 소거능은 농도 의존적으로 증가하였으며, 이때 IC50 값은 211.32 ㎍/㎖인 것으로 확인되었다.
2-2. ABTS 라디칼 소거능 측정
곰취 추출물의 최종 농도가 25, 50, 100, 250, 500, 1000 ㎍/㎖의 농도로 될 수 있게 희석시켰으며, ABTS 용액은 7.4 mM ABTS(2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid))와 2.6 mM 과황산칼륨(potassium persulphate)을 혼합한 후, 암소(dark place)에 하루 동안 방치하여 양이온 (ABTS+)을 형성시킨 다음 732 ㎚에서 흡광도를 측정하여 흡광도 값이 1.5 이하가 나오도록 증류수로 희석하고, 희석된 ABTS+ 용액 150 ㎕와 시료 5 ㎕를 혼합하고, 실온에서 10분간 반응시킨 후, 마이크로 플레이트 측정기를 통해 732 ㎚ 파장에서 흡광도를 측정하였다. LFE의 항산화능은 하기 수학식 2와 같이, 증류수를 대조군으로 하여 대조군에 대한 ABTS 라디칼 소거능을 백분율로 나타내었다.
[수학식 2]
Figure PCTKR2022000779-appb-I000002
그 결과, 도 2를 참조하면, LFE의 ABTS 라디칼 소거능은 농도 의존적으로 증가하였으며, 이때 IC50 값이 94.34 ㎍/㎖인 것으로 확인되었다.
실험예 3. 비만세포를 이용한 곰취 추출물의 항가려움증 효능
비만세포인 MC/9 세포를 이용하여 곰취 추출물의 세포 독성, 가려움증 유발 인자의 유전자 및 단백질 발현량을 측정하였다.
3-1. 비만 세포 독성
MC/9 세포는 10% FBS, 10% T-stim, 0.05 mM 2-메르캅토에탄올(mercaptoethanol) (Gibco BRL, 미국), 2 mM L-글루타민(glutamine) 및 100 ㎍/㎖ 페니실린-스트렙토마이신(penicillin-streptomycin)이 함유된 DMEM 배지 (Gibco BRL, 미국)를 사용하여 37℃, 5% CO2 조건이 유지되는 세포배양기에서 배양하였으며, 2 ~ 3일 주기로 계대 배양하여 실험을 진행하였다.
이후, MC/9 세포를 48웰 플레이트(48-well plate)에 1X105 cells/well로 분주하여 24시간 동안 배양하였다. 24시간 후, LFE를 25, 50, 100, 200 ㎍/㎖의 농도로 처리하여 다시 12시간 동안 배양하였다. 시료의 양성대조군으로는 아스코르브산(ascorbic acid)을, 음성대조군으로 증류수를 처리하였다. 배양 후 배양액 100 ㎕당 EZ-Cytox 용액 (Daeilab, 한국) 10 ㎕을 첨가하여 세포배양기에서 30분간 반응시켰다. 반응 후 450 ㎚에서 흡광도의 변화를 측정하여 대조군에 대한 세포생존율을 백분율로 표시하였다.
그 결과, 도 3을 참조하면, LFE는 100 ㎍/㎖ 이하의 농도에서 MC/9 세포의 세포생존율을 약 100% 수준으로 유지하였으며, 200 ㎍/㎖ 이상의 농도에서 MC/9 세포의 세포생존율을 약간 감소시킨 것으로 나타나, 세포 독성이 없는 것으로 확인되었다.
3-2. 유전자 발현량 측정
6웰 플레이트에 MC/9 세포를 2X106 cells/well로 분주하여 24시간 동안 배양하였다. 배양 후 LFE를 25, 50, 100 ㎍/㎖의 농도로 처리하고 1시간 뒤, 1 ㎍/㎖의 DNP-IgE (Sigma-Aldrich, 미국)를 추가하여 12시간 동안 배양하였다. 이 후, 총 RNA 추출 키트(total RNA prep kit) (Intronbio, 한국)를 이용하여 세포의 RNA를 추출하였다. 1,200 rpm에서 5분 동안 원심분리하여 얻은 세포에 easy blue 1 ㎖와 클로로포름(chloroform) 200 ㎕를 넣고 볼텍싱(vortexing)한 후, 13,000 rpm, 4℃에서 10분 동안 원심분리하였다. 상층액 400 ㎕와 결합 완충액(binding buffer) 400 ㎕를 실온에서 1분 동안 반응시킨 뒤 반응액 700 ㎕를 컬럼(column)에 주입하여 13,000 rpm에서 30초 동안 원심분리하였다. 컬럼에 세척 완충액(washing buffer) A를 700 ㎕ 넣고 13,000 rpm에서 30초 동안 원심분리 후, 세척 완충액 B를 700 ㎕ 넣고 동일하게 원심분리하였다. 컬럼 하단을 1.5 ㎖ 튜브(tube)로 교체한 후, 컬럼에 용출 완충액(elution buffer)을 30 ㎕ 넣고 1분 동안 반응시킨 뒤 13,000 rpm에서 1분 동안 원심분리하여 총 RNA를 추출하였다.
역전사(reverse transcription) 반응은 RT 프리믹스 키트 (AccuPower® CycleScript RT PreMix) (Bioneer, 한국)의 혼합물(mixture) (반응 완충액(reaction buffer), dNTPs 혼합물, RNase 억제제(inhibitor), 안정제(stabilizer) 및 올리고(oligo)-dT15 프라이머 포함)에 총 RNA를 1 ㎍ 넣고 DEPC-DW을 최종 부피가 20 ㎕가 되도록 첨가하였다. 이 혼합액을 잘 섞은 후, 45℃에서 60분 반응시켜 first-strand cDNA를 합성하고, 95℃에서 5분 동안 방치하여 M-MLV RT(reverse transcriptase)를 불활성화 시켜 합성이 완료된 cDNA를 PCR(polymerase chain reaction)에 사용하였다.
합성이 완료된 cDNA를 증폭시키기 위하여 real-time PCR을 진행하였으며, real-time 전용 튜브에 cDNA 1 ㎕, 각 프라이머 2 ㎕, SYBR Green (Qiagen, 독일) 10 ㎕, DEPC-DW 5 ㎕씩 넣어 95℃에서 2분 동안 반응시키고 다음 95℃에서 5초, 62.5℃에서 30초를 40회 반복하여 유전자를 증폭시켰다. 유전자 발현량은 대조군과 비교하여 계산하였으며, 사용된 프라이머의 서열은 하기 표 1과 같다.
유전자 프라이머 프라이머 서열 (5'-3') 서열번호
IL4 정방향 CAACCCCCAGCTAGTTGTCA 1
역방향 TGTCGCATCCGTGGATATGG 2
IL31 정방향 TCAGCAGACGAATCAATACAGC 3
역방향 TCGCTCAACACTTTGACTTTCT 4
ACTB 정방향 ATCGTGGGGCGCCCCAGGCACCA 5
역방향 GGGGTACTTCAGGGTGAGGA 6
실험 결과는 SPSS 21.0를 이용하여 평균±표준오차(mean±standard error of mean)으로 나타내었으며, ANOVA를 사용하여 다중 비교하였고 Tukey's HSD test를 통해 p<0.05, p<0.01 및 p<0.001 수준에서 유의성을 검정하였다. 이후 실험 결과에 대해서도 동일한 방법으로 유의성을 검정하였다.
그 결과, 도 4 및 5를 참조하면, LFE는 농도 의존적으로 가려움증을 유발하는 IL-4 및 IL-31 유전자의 mRNA 발현량을 감소시킨 것으로 나타났다.
3-3. 단백질 발현량 측정
6웰 플레이트에 MC/9 세포를 2X106 cells/well로 분주하여 24시간 동안 배양하였다. 배양 후 LFE를 25, 50, 100 ㎍/㎖의 농도로 처리하고 1시간 뒤, 1 ㎍/㎖의 DNP-IgE를 추가하여 6시간 동안 배양하였다. 이후, 1,200 rpm에서 5분 동안 원심분리하여 얻은 세포를 D-PBS로 2회 세척하고 세포 펠렛(pellet)에 프로테아제 억제제 칵테일(protease inhibitor cocktail) Ⅰ (Sigma-Aldrich, 미국), 포스파타아제 억제제(phosphatase inhibitor) Ⅱ 및 Ⅲ가 포함된 RIPA 완충액(buffer) (Thermo Fisher, 미국)을 넣어 단백질을 추출하였다. 추출한 단백질은 BCA 단백질 정량 키트(proein assay kit) (Thermo Fisher, 미국)를 이용하여 정량하였으며, 로딩(loading) 완충액과 섞어 95℃에서 5분간 반응시켜 준비하였다. 준비된 단백질은 10% 아크릴아마이드겔(acrylamide gel)을 통해 SDS-PAGE하여 크기별로 분리하였으며, PVDF 막(membrane)에 이동시켰다. 단백질이 옮겨진 막을 3% BSA에 담가 상온에서 2시간 반응시켰다. TBS-T 완충액을 이용하여 세척하고 1차 항체(primary antibody)로서 IL-4 항체 (Santa Cruz Biotechnology, 미국), 히스타민 항체 (LSBio, 미국) 또는 IL-31 항체 (LSBio, 미국)를 넣어 4℃에서 16시간 반응시켰다. 다시 3회 세척하고 2차 항체(secondary antibody) (Jackson immunoresearch, 미국)를 넣어 상온에서 1시간 반응시켰으며, 다시 세척하고 ECL 용액(solution)을 통해 단백질을 발색시켰다. 이후, chemidoc fusion FX (Vilber Lourmat, 프랑스)를 통해 단백질 발현량을 분석하였다.
그 결과, 도 6 내지 8을 참조하면, LFE는 농도 의존적으로 IL-4, IL-31 및 히스타민의 단백질 발현량을 감소시킨 것으로 나타났다.
실험예 4. 면역세포를 이용한 곰취 추출물의 항가려움증 효능
면역세포로서 대식세포인 RAW264.7 세포를 이용하여 곰취 추출물의 세포 독성, 가려움증 유발 인자의 유전자 및 단백질 발현량, 생성량을 측정하였다.
4-1. 세포 독성
RAW264.7 세포는 10% FBS와 1% 페니실린-스트렙토마이신으로 조성된 DMEM 배지 (Gibco BRL, 미국)를 사용하여 37℃, 5% CO2 조건이 유지되는 세포배양기에서 배양하였으며, 2 ~ 3일 주기로 계대 배양하여 실험을 진행하였다.
이후, RAW264.7 세포를 24웰 플레이트에 1X105 cells/well로 분주하여 24시간 동안 배양하였다. 24시간 후, LFE를 50, 100, 200, 400 ㎍/㎖의 농도로 처리하여 다시 24시간 동안 배양하였다. 시료의 양성대조군으로는 아스코르브산(ascorbic acid)을, 음성대조군으로 증류수를 처리하였다. 배양 후 배양액 100 ㎕당 EZ-Cytox 용액 (Daeilab, 한국) 10 ㎕을 첨가하여 세포배양기에서 30분간 반응시켰다. 반응 후 450 ㎚에서 흡광도의 변화를 측정하여 대조군에 대한 세포생존율을 백분율로 표시하였다.
그 결과, 도 9를 참조하면, LFE는 200 ㎍/㎖ 이하의 농도에서 RAW264.7 세포의 세포생존율을 약 100% 수준으로 유지하였으며, 400 ㎍/㎖ 이상의 농도에서 RAW264.7 세포의 세포생존율을 약간 감소시킨 것으로 나타나, 세포 독성이 없는 것으로 확인되었다.
4-2. 유전자 발현량 측정
RAW264.7 세포를 6웰 플레이트에 2X106 cells/well로 분주하여 24시간 동안 배양하였다. 배양 후 LFE를 50, 100, 200 ㎍/㎖의 농도로 처리하고 2시간 후, 100 ng/㎖의 LPS를 처리하여 다시 24시간 동안 배양하였다. 이후, 실험예 3과 동일한 방법으로 총 RNA 추출, cDNA 합성, 유전자 증폭하여 유전자 발현량을 측정하였다. 여기서 사용된 프라이머의 서열은 하기 표 2와 같다.
유전자 프라이머 프라이머 서열 (5'-3') 서열번호
NOS2 정방향 CGAAACGCTTCACTTCCAA 7
역방향 TGAGCCTATATTGCTGTGGCT 8
PTGS2 정방향 AACCGCATTGCCTCTGAAT 9
역방향 CATGTTCCAGGAGGATGGAG 10
IL1B 정방향 AAGAAGAGCCCATCCTCTGT 11
역방향 GGAGCCTGTAGTGCAGTTGT 12
IL6 정방향 AGTCCTTCCTACCCCAATTTCC 13
역방향 GGTCTTGGTCCTTAGCCACT 14
TNFA 정방향 ATGGCCTCCCTCTCATCAGT 15
역방향 TTTGCTACGACGTGGGCTAC 16
ACTB 정방향 AACCGCATTGCCTCTGAAT 17
역방향 CATGTTCCAGGAGGATGGAG 18
그 결과, 도 10 내지 14를 참조하면, LFE는 농도 의존적으로 가려움증을 유발하는 NO, 프로스타글란딘, IL-1β, IL-6 및 TNF-a 관련 유전자의 mRNA 발현량을 감소시킨 것으로 나타났다.
4-3. 단백질 발현량 측정
RAW264.7 세포를 6웰 플레이트에 2X106 cells/welll로 분주하여 24시간 동안 배양하였다. 배양 후 LFE를 50, 100, 200 ㎍/㎖의 농도로 처리하고 2시간 후, 100 ng/㎖의 LPS를 처리하여 다시 24시간 동안 배양하였다. 이후, 실험예 3과 동일한 방법으로 단백질 발현량을 측정하였다. 여기서 1차 항체로 p44/42 MAPK(Erk1/2)(137F5) Rabbit mAb (Cell signaling, 미국; 이하 동일함), Phospho-p44/42 MAPK(Erk1/2)(Thr202/Tyr204)(D13.14.4E) XP® Rabbit mAb, SAPK/JNK 항체, Phospho-SAPK/JNK(Thr183/Tyr185)(G9) Mouse mAb, p38 MAPK 항체 또는 Phospho-p38 MAPK(Thr180/Tyr182)(D3F9) XP® Rabbit mAb를 사용하였다.
그 결과, 도 15 내지 19을 참조하면, LFE는 농도 의존적으로 사이토카인, 히스타민 등과 같은 가려움증 유발 인자의 발현에 관여하는 ERK, JNK 및 P38의 단백질 발현량을 감소시킨 것으로 나타났다.
4-4. 바이오마커 생성량 측정
NO 생성량을 측정하기 위하여, NO 분석 키트 (Intronbio, Korea)를 사용하였다. RAW264.7 세포를 24웰 플레이트에 4X104 cells/welll로 분주하여 24시간 동안 배양하고 50, 100, 200 ㎍/㎖ 농도의 LFE를 처리하고 2시간 후, 100 ng/㎖의 LPS를 하여 다시 24시간 동안 배양하였다. 배양 후 96웰 플레이트에 세포배양액 100 ㎕를 넣고 N1 완충액 50 ㎕를 추가하여 상온에서 10분간 반응시켰으며, 반응 후 N2 완충액 50 ㎕를 추가하여 상온에서 10분간 반응시켰다. 반응 후, 540 ㎚에서 흡광도의 변화를 측정하여 대조군에 대한 생성량을 백분율로 표시하였다.
PGE2, IL-1β, IL-6 및 TNF-a 생성량을 측정하기 위하여, 각각 mouse PGE2 ELISA kit (R&D Systems, 미국), mouse IL-1β ELISA kit (Komabiotech, 한국), mouse IL-6 ELISA kit (Komabiotech, 한국), mouse TNF-a ELISA kit (Komabiotech, 한국)를 사용하였다. RAW264.7 세포를 6웰 플레이트에 2X106 cells/welll로 분주하여 24시간 동안 배양하고 50, 100, 200 ㎍/㎖ 농도의 LFE를 처리하고 2시간 후, 100 ng/㎖의 LPS를 하여 다시 24시간 동안 배양하였다. 이후, 1,200 rpm에서 5분 동안 원심분리하여 얻은 세포배양액을 100 ㎕씩 넣고 상온에서 2시간 반응시켰다. 반응 후 플레이트에 있는 시약을 버리고 세척 완충액을 넣어 4회 세척하였다. 세척 후 검출 항체(detection antibody)를 100 ㎕씩 추가하여 상온에서 2시간 반응시켰다. 반응 후 플레이트에 스트렙트아비딘(streptavidin)-HRP 100 ㎕씩 추가하여 상온에서 30분 반응시켰다. 반응 후 TMB 또는 pink-ONE solution 100 ㎕씩 각 웰에 넣은 후 15분간 반응시키고 반응 정지액(stop solution) 100 ㎕를 추가하여 마이크로 플레이트 측정기를 통해 450 ㎚에서 흡광도를 측정하였으며, 표준곡선(standard curve)를 기준으로 절대값으로 나타내었다.
그 결과, 도 17 내지 22를 참조하면, LFE는 농도 의존적으로 NO, PGE2, IL-1β, IL-6 및 TNF-a 생성량을 감소시킨 것으로 나타났다.
실시예 2. 곰취 샴푸의 제조
실시예 1에서 제조된 곰취 열수 추출물을 이용하여 하기 표 3의 조성으로 곰취 샴푸를 제조하였다.
전성분 배합량
1 곰취 열수 추출물 41.837
2 다이소듐라우레스설포석시네이트 32.000
3 소듐코코일이세티오네이트 12.000
4 데실글루코사이드 5.000
5 코카미도프로필베타인 5.000
6 글리세린 2.000
7 구아하이드록시프로필트라이모늄클로라이드 0.200
8 폴리쿼터늄-10 0.200
9 덱스판테놀 0.200
10 멘톨 0.300
11 살리실릭애씨드 0.250
12 향료 0.2500
13 페퍼민트오일 0.2000
14 다이소듐이디티에이 0.100
15 프로판다이올 0.100
16 펜틸렌글라이콜 0.100
17 코코넛야자열매추출물 0.100
18 구주소나무잎추출물 0.100
19 시트릭애씨드 0.050
20 판테놀 0.010
21 트레할로오스 0.001
22 바이오틴 0.001
23 리모넨 0.001
합계 100.000
곰취 샴푸는 화장품법에 따라 제조되었으며, 식품의약품안전처 고시 '화장품 안전기준 등에 관한 규정' 및 '화장품의 색소 종류와 기준 및 시험방법'을 준수하여 화장품에 사용할 수 없는 원료는 사용하지 않았으며, 사용상의 제한이 필요한 원료의 경우 규정된 사용 한도 및 그 사용 기준을 준수하였다.
제조된 곰취 샴푸는 고온 또는 저온의 장소에서 직사광선을 피하여 5 ~ 25℃에서 보관하였고, 이에 대한 피부 자극 평가 및 관능평가를 실시하였다.
실험예 5. 곰취 샴푸의 피부 자극 평가
곰취 샴푸의 피부 자극을 평가하기 위해, 대한피부과학연구소에 의뢰하여 24시간 피부 첩포를 통한 일차 자극 평가 시험을 수행하였다.
시험 대상자로는 피부 질환을 포함한 급성 또는 만성 신체 질환이 없는 건강한 여성 31명을 선정하였고, 대상자의 착색이나 피부 손상이 없는 평평한 등 부위를 70% 에탄올로 닦아낸 뒤 건조시킨 후 시료 15 ㎕를 포함한 패치를 적용하였다. 24시간 후 패치를 제거하였고, 30분 뒤 시험 부위를 피부과 전문의가 육안으로 판독하였다. 패치 제거 후 24시간 및 48시간 후에 동일한 피부과 전문의가 다시 육안으로 판독하였다.
패치 제거 후 피부 반응 육안 평가는 하기 표 4의 판정기준에 따라 판독하여 피부 반응 점수를 매겼다.
점수 판정기준
0점 염증 소견이 없는 정상 피부
0.5점 의심스럽거나 경미한 반응
1점 경미한 홍반
2점 부분적인 부종 또는 구진(papule) 유무에 관계없이 중간 정도의 홍반
3점 확산 부종이 있는 중간 정도의 홍반
4점 소수포가 있는 확산 부종을 동반한 강한 홍반
대상자들의 피부 반응 점수를 이용하여 하기 수학식 3에 따라 피부 자극 지수를 계산하였고, 하기 표 5의 판정표에 따라 자극 정도를 판정하였다.
[수학식 3]
Figure PCTKR2022000779-appb-I000003
피부 자극 지수 (I) 자극성 평가
0 ≤ I < 0.02 무자극
0.02 ≤ I < 0.25 저자극
0.25 ≤ I < 1 경자극
1 ≤ I < 2.5 중자극
2.5 ≤ I 강자극
그 결과, 도 23을 참조하면, 곰취 샴푸를 1% 희석액 상태로 24시간 첩포 시험을 실시하여 패치 제거 후 30분, 24시간, 48시간에 각각 일차 피부 자극 유무를 피부과 전문의가 판정하였을 때 피부 자극 지수 0.027점을 얻어 저자극 시료로 판단되었다.
실험예 6. 곰취 샴푸의 관능 평가
곰취 샴푸의 관능 평가를 실시하였다. 20대부터 60대 이상의 남녀 총 112명을 대상으로 곰취 샴푸를 일주일 이상 사용하게 한 후 모발 및 두피 상태에 대해 5점 평점법으로 평가하였다. 여기서 점수가 5점에 가까울수록 매우 개선 또는 우수한 것이며, 점수가 1점에 가까울수록 상태가 나빠지거나 개선 효과가 없는 것을 나타낸다.
그 결과, 도 24를 참조하면, 곰취 샴푸는 기존 샴푸와 유사한 세정력 및 사용감이 있으며, 사용 후 상쾌한 느낌을 주고, 비듬, 지루성 두피염 등의 두피 트러블 개선 및 모발 강화에도 효과가 있는 것으로 확인되었다.
이러한 결과를 종합하면, 본 발명에 따른 곰취 추출물은 총 폴리페놀 및 플라보노이드를 다량 함유하여 항산화 효능을 나타내며, 가려움증을 유발하는 사이토카인 (IL-4, IL-31, TNF-a, IL-1β 및 IL-6), 히스타민, 산화질소 및 프로스타글란딘의 발현, 분비를 억제함으로써 피부를 비롯한 전신에서 나타날 수 있는 가려움증을 효과적으로 완화 또는 경감시킬 수 있으며, 두피 트러블 개선 및 모발 강화에도 효과가 있음을 시사한다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (6)

  1. 곰취 추출물을 유효성분으로 포함하는 가려움증 완화용 조성물.
  2. 청구항 1에 있어서,
    상기 곰취 추출물은 물, 탄소수 1 내지 4개의 알코올, 프로필렌글라이콜, 부틸렌글라이콜, 글리세린, 아세톤, 에틸아세테이트, 부틸아세테이트, 클로로포름, 다이에틸에테르, 다이클로로메탄, 헥산 및 이들의 혼합물로 이루어진 군에서 선택되는 용매로 추출된 것인, 조성물.
  3. 청구항 1에 있어서,
    상기 곰취 추출물은 사이토카인 및 히스타민 분비를 억제하는 것인, 조성물.
  4. 청구항 1에 있어서,
    상기 조성물은 피부용, 두피용, 구강용, 안구용 또는 질(膣)용인 것인, 조성물.
  5. 청구항 1 내지 4 중 어느 한 항의 조성물을 포함하는 가려움증 완화용 화장료 조성물.
  6. 청구항 1 내지 4 중 어느 한 항의 조성물을 포함하는 가려움증 예방 또는 치료용 약학 조성물.
PCT/KR2022/000779 2021-01-15 2022-01-14 곰취 추출물을 포함하는 가려움증 완화용 조성물 WO2022154602A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210006158 2021-01-15
KR10-2021-0006158 2021-01-15
KR1020220005906A KR20220103652A (ko) 2021-01-15 2022-01-14 곰취 추출물을 포함하는 가려움증 완화용 조성물
KR10-2022-0005906 2022-01-14

Publications (1)

Publication Number Publication Date
WO2022154602A1 true WO2022154602A1 (ko) 2022-07-21

Family

ID=82448582

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000779 WO2022154602A1 (ko) 2021-01-15 2022-01-14 곰취 추출물을 포함하는 가려움증 완화용 조성물

Country Status (1)

Country Link
WO (1) WO2022154602A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080101821A (ko) * 2008-08-27 2008-11-21 김선일 홍화 분획물를 포함하는 피부 외용제 조성물
KR20100016450A (ko) * 2007-05-10 2010-02-12 김선일 피부 외용제 조성물
KR20100019737A (ko) * 2008-08-11 2010-02-19 김선일 폐각의 알카리 칼슘용액을 포함하는 피부 외용제 조성물
KR20110048236A (ko) * 2009-11-02 2011-05-11 한국과학기술연구원 자생 식물 추출물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
KR20110118748A (ko) * 2011-09-14 2011-11-01 한국과학기술연구원 한대리곰취 추출물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100016450A (ko) * 2007-05-10 2010-02-12 김선일 피부 외용제 조성물
KR20100019737A (ko) * 2008-08-11 2010-02-19 김선일 폐각의 알카리 칼슘용액을 포함하는 피부 외용제 조성물
KR20080101821A (ko) * 2008-08-27 2008-11-21 김선일 홍화 분획물를 포함하는 피부 외용제 조성물
KR20110048236A (ko) * 2009-11-02 2011-05-11 한국과학기술연구원 자생 식물 추출물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
KR20110118748A (ko) * 2011-09-14 2011-11-01 한국과학기술연구원 한대리곰취 추출물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Similar Documents

Publication Publication Date Title
WO2020246766A1 (ko) 찹쌀떡버섯으로 발효한 홍경천 추출물을 함유하는 피부노화 예방 또는 개선용 조성물
WO2015156439A1 (ko) 천심련추출물 또는 안드로그라폴라이드 또는 이의 염을 포함하는 피부상태 개선용 조성물
KR102612071B1 (ko) 곰보배추 추출물 및 병풀 추출물을 포함하는 항산화 및 항염증용 조성물
KR101262813B1 (ko) 소태나무 추출물을 유효성분으로 포함하는 아토피 피부염 또는 알러지성 피부질환의 예방 및 치료를 위한 조성물
WO2022260454A1 (ko) 장수만리화 추출물을 포함하는 아토피 피부염 치료용 또는 피부 장벽 강화용 또는 노화 방지용 조성물
KR20220123618A (ko) 울산도깨비바늘 추출물을 유효성분으로 포함하는 민감성 피부용 조성물
WO2018111042A2 (ko) 한약재 추출물을 유효성분으로 포함하는 화장료 조성물
CN113350232B (zh) 含马齿苋、艾叶及红景天的混合提取物作为有效成分的皮肤保护及刺激缓解用化妆品组合物
US20230321181A1 (en) Composition for prevention, improvement or treatment of allergic disease or itching comprising pentapeptide as active ingredient
WO2024123024A1 (ko) 중대가리풀 추출물을 포함하는 항염 및 자가면역 질환 예방 및 치료용 조성물 및 이의 제조 방법
WO2022085858A1 (ko) 황칠 추출물을 포함하는 미백 또는 주름 개선용 조성물
WO2022154602A1 (ko) 곰취 추출물을 포함하는 가려움증 완화용 조성물
WO2017119535A1 (ko) 카노신, 대두 펩타이드 및 천심련 추출물을 포함하는 항노화용 조성물
WO2016122091A1 (ko) 심비디움(cymbidium) 추출물을 유효성분으로 함유하는 알레르기 질환 또는 접촉성 피부염 예방 및 치료용 약학조성물
KR102514502B1 (ko) 꽃송이버섯, 동충하초, 및 송로버섯의 복합 추출물을 유효성분으로 함유하는 아토피 피부염, 가려움증, 및 염증 개선용 조성물
KR20180017974A (ko) 복합생약추출물을 유효성분으로 함유하는 여드름 예방 또는 치료용 화장료 조성물
KR102050470B1 (ko) 식물 추출물을 포함하는 피부 가려움증 완화용 화장료 조성물
KR20200040402A (ko) 택란 추출물을 유효성분으로 포함하는 아토피 피부염의 예방 또는 치료용 조성물
KR20220103652A (ko) 곰취 추출물을 포함하는 가려움증 완화용 조성물
WO2024101570A1 (ko) 스테비아 추출물을 유효성분으로 포함하는 항산화, 항염 및 항알레르기용 조성물
WO2017213310A1 (ko) 디프테로카푸스 인트리카투스 추출물을 이용한 피부 주름 개선용 조성물
US20230059068A1 (en) Composition for anti-oxidation and anti-inflammation comprising salvia plebeia r br extract and centella asiatica extract
KR102502443B1 (ko) 달맞이꽃의 열수 추출물을 유효성분으로 포함하는 튼살 예방, 개선, 또는 치료를 위한 조성물
WO2023128630A1 (ko) 담팔수 추출물을 포함하는 피부 개선용 화장료 조성물
WO2024172471A1 (ko) Cndh106 벼 품종 유래 미강 및 쌀겨 추출물을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22739794

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22739794

Country of ref document: EP

Kind code of ref document: A1