WO2022131406A1 - 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법 - Google Patents

성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법 Download PDF

Info

Publication number
WO2022131406A1
WO2022131406A1 PCT/KR2020/018659 KR2020018659W WO2022131406A1 WO 2022131406 A1 WO2022131406 A1 WO 2022131406A1 KR 2020018659 W KR2020018659 W KR 2020018659W WO 2022131406 A1 WO2022131406 A1 WO 2022131406A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sexually transmitted
primer pair
amplification primer
pair consisting
Prior art date
Application number
PCT/KR2020/018659
Other languages
English (en)
French (fr)
Inventor
이재복
Original Assignee
주식회사 제이에이치바이오홀딩스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제이에이치바이오홀딩스 filed Critical 주식회사 제이에이치바이오홀딩스
Priority to KR1020207036615A priority Critical patent/KR102326566B1/ko
Priority to KR1020217019404A priority patent/KR102466562B1/ko
Priority to PCT/KR2020/018659 priority patent/WO2022131406A1/ko
Publication of WO2022131406A1 publication Critical patent/WO2022131406A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a primer set for diagnosing a sexually transmitted infection using a multipolymerase chain reaction, a diagnostic composition, and a method for diagnosing a sexually transmitted infection using the same.
  • STI sexually Transmitted Infection
  • STI is not diagnosed and treated early, it can lead to complications or sequelae such as infertility, fetal death, ectopic pregnancy, cancer of the anal and reproductive system, premature death, and infection of infants and children, and sometimes life-threatening as a fatal disease.
  • STI has different drugs and treatment processes according to various pathogens for each disease, it is possible to receive prompt treatment with an appropriate drug prescription through accurate diagnosis of the pathogen using the genetic test method of the pathogen, as well as the final diagnosis of infection symptoms and clinical findings. Drug abuse can be prevented by inducing confidence in diagnostic decisions.
  • the previous method for diagnosing these sexually transmitted diseases is to collect the infected area, smear it, and examine it under a microscope. In the case of gonorrhea, gram-negative dicocci are observed, and in the case of Candida fungi and herpes virus, microscopic examination and selection are observed to be gram-positive.
  • There are methods for testing culture identity in the medium but these methods are cumbersome, complicated, and take a long time because they are based on the morphology or growth characteristics of the bacteria. Recently, faster and simpler methods for targeting genes are increasingly being used and developed. In this method, a test method using PCR is developed and used after producing a species-specific primer of a specific nucleotide sequence of a pathogen for a specific gene.
  • PCR is a simple and convenient method that can exponentially amplify a DNA sequence at a specific site with only a very small amount of DNA. It is a test method that can quickly and accurately diagnose even with a small amount of DNA by repeatedly executing denaturation step, annealing step, and extension step using
  • denaturation step annealing step
  • extension step extension step
  • An object of the present invention to solve the above problems is to provide a primer capable of early and effective detection and diagnosis of several types of sexually transmitted infections and a diagnostic method using the same.
  • an object of the present invention is to provide a primer set capable of effectively diagnosing a plurality of sexually transmitted infections at the same time and a diagnostic method using the same by performing conventional PCR without expensive equipment.
  • the present invention for solving the above problems is, 1) a syphilis (Treponema pallidum) amplification primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, 2) Mycoplasma genitalium consisting of SEQ ID NO: 3 and SEQ ID NO: 4 genitalium) amplification primer pair, 3) Neisseria gonorrhoeae amplification primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, 4) Ureaplasma parvum amplification primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, 5 ) Mycoplasma hominis amplification primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, 6) Ureaplasma urealytium amplification primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, 7) SEQ ID NO: Gardnerella vaginalis amplification primer pair consisting of 13 and SEQ ID NO: 14, 8) Chlamydia
  • Herpes simplex virus 2 amplification primer pair consisting of SEQ ID NO: 19 and SEQ ID NO: 20, 11) SEQ ID NO: 21 and SEQ ID NO: Candida albicans amplification primer pair consisting of 22, and 12) SEQ ID NO: 23 and SEQ ID NO: 24
  • Herpes simplex virus 1 consisting of any one or more primers selected from the group consisting of amplification primer pairs to provide.
  • 1) a pair of Treponema pallidum amplification primers consisting of SEQ ID NO: 1 and SEQ ID NO: 2, 2) Mycoplasma genitalium consisting of SEQ ID NO: 3 and SEQ ID NO: 4 ) amplification primer pair, 3) Neisseria gonorrhoeae amplification primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, 4) Ureaplasma parvum amplification primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, 5) A primer set comprising a Mycoplasma hominis amplification primer pair consisting of SEQ ID NOs: 9 and 10, and 6) Ureaplasma urealytium amplification primer pair consisting of SEQ ID NOs: 11 and 12 provides
  • a composition for diagnosing sexually transmitted infections comprising the primer set.
  • the composition may include commonly used components, for example, a buffer solution and the like. Specifically, it may include a DNA polymerase, a dNTP mixture (dATP, dCTP, dGTP, dTTP), a PCR buffer, and a DNA polymerase cofactor.
  • a kit for diagnosing sexually transmitted infections including the primer set.
  • the kit provides a sexually transmitted infection diagnosis kit further comprising a DNA polymerase.
  • the DNA polymerase is Hot Start Taq.
  • a method for diagnosing sexually transmitted infection comprising the step of performing a polymerase chain reaction targeting DNA of a biological sample using the primer set.
  • Diagnosis of sexually transmitted infection is to detect a gene of a pathogen specifically detected by each primer from a biological sample using the primer set of the present invention.
  • biological sample means tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or It may include, but is not limited to, a sample such as urine, and is preferably a sample obtained from genital secretions of sexually transmitted infections.
  • the method for diagnosing whether a sexually transmitted infection is syphilis (Treponema pallidum), Mycoplasma genitalium, Neisseria gonorrhoeae, Ureaplasma parvum (Ureaplasma parvum), Mycoplasma Mycoplasma hominis, Ureaplasma urealytium, Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, herpes simplex virus type 2 (Herpes simplex virus 2), Candida albicans, and herpes simplex virus type 1 (Herpes simplex virus 1) characterized in that any one or more pathogens selected from the detection.
  • syphilis Teponema pallidum
  • Mycoplasma genitalium Neisseria gonorrhoeae
  • Ureaplasma parvum Ureaplasma parvum
  • Mycoplasma Mycoplasma hominis Ureaplasma urealytium
  • the method for diagnosing sexually transmitted infection is syphilis (Treponema pallidum), Mycoplasma genitalium ( Mycoplasma genitalium), Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma hominis, and Ureaplasma urealytium are characterized in that it detects the presence of pathogens at the same time.
  • the method for diagnosing whether a sexually transmitted infection is Gardnerella vaginalis, Chlamydia trachoma by using a primer set including six primer pairs consisting of SEQ ID NOs: 13 to 24 Infection with Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans, and Herpes simplex virus 1 pathogens It is characterized in that it detects at the same time.
  • the present invention can detect 12 types of sexually transmitted infections with high efficiency and pathogens present in trace amounts. In addition, it can be easily diagnosed even in the case of sexually transmitted diseases, which are difficult to detect at an early stage because there are no subjective symptoms in the early stages, so it is a very useful method for early prevention. In addition, the present invention can effectively diagnose a plurality of sexually transmitted infections with high sensitivity and specificity and at the same time effectively perform PCR without additional expensive equipment.
  • Primer set 1 is a specificity test result of a diagnostic kit including a primer of the present invention.
  • the best mode of the present invention is a primer set consisting of a primer of SEQ ID NO: 1 to SEQ ID NO: 12, a primer set consisting of a total of 6 primer pairs, a primer of SEQ ID NO: 13 to SEQ ID NO: 24, and a primer set consisting of a total of 6 primer pairs.
  • Treponema pallidum Mycoplasma genitalium, Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma hominis, Ureaplasma uea urealytium
  • Gardnerella vaginalis Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans , and Herpes simplex virus 1 pathogens can be effectively detected simultaneously with high sensitivity and specificity.
  • the present invention uses multiple polymerase chain reaction (M-PCR) to quickly and accurately detect 12 types of pathogens that cause sexually transmitted infections, and specific bases of each pathogen
  • M-PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • the term "sexually transmitted infection” is transmitted from an infected person to the other party through sexual contact. More specifically, diseases with clear clinical signs include sexually transmitted diseases as well as asymptomatic infections without symptoms and symptoms. .
  • primer refers to an oligonucleotide complementary to a 5'-end sequence and a 3'-end sequence adjacent to a target nucleic acid used in a polymerase chain reaction.
  • forward primer and reverse primer refer to primers that bind to the 3' and 5' ends of a specific region of a gene amplified by polymerase chain reaction, respectively. do.
  • the present invention is syphilis (Treponema pallidum), Mycoplasma genitalium (Mycoplasma genitalium), gonorrhea (Neisseria gonorrhoeae), Ureaplasma parvum (Ureaplasma parvum), Mycoplasma hominis (Mycoplasma hominis), ureaplasma uea (Ureaplasma urealytium), Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans albicans), and Herpes simplex virus 1 can be specifically detected.
  • one pair of primers is used in PCR for detecting one pathogen, and therefore 12 pairs, that is, 24 primers, are required to perform PCR for 12 types of targets.
  • 12 pairs that is, 24 primers
  • using 12 pairs of primers it was possible to detect 12 types by applying them to the PCR reaction.
  • the PCR primer When preparing the PCR primer according to the present invention, there are various restrictions such as the A, G, C, T content ratio of the primer, prevention of dimmer formation of the primer, and prohibition of repeating the same nucleotide sequence more than 3 times, and in addition to the PCR reaction Conditions such as template DNA amount, primer concentration, dNTP concentration, Mg 2+ concentration, reaction temperature, and reaction time should be appropriate. Accordingly, it was developed to suitably detect 12 types of prostitution-infected pathogens provided by the present invention.
  • the present invention provides a set of 6 primer pairs consisting of i) SEQ ID NOs: 1 to 12, among 12 pairs of primers, including Treponema pallidum, Mycoplasma genitalium, Neisseria gonorrhoeae), ureaplasma parvum, mycoplasma hominis and ureaplasma urealytium can simultaneously detect pathogen infection, ii) 6 pairs of SEQ ID NOs: 13 to 24 Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2 ), Candida albicans, and Herpes simplex virus 1 have the effect of simultaneously detecting whether or not they are infected.
  • the primers provided in the present invention can rapidly detect pathogens causing each sexually transmitted infection with high specificity and sensitivity while using simple PCR.
  • the following primers were designed to detect 12 pathogens causing sexually transmitted infections.
  • the detection limits are as follows.
  • a total of 26 species (Ureaplasma urealytium, Chlamydia trachomatis, Ureaplasma parvum, Mycoplasma genitalium, Gardnerella vaginalis, Neisseria gonorrhea, Streptococcus agalactiae, Candida albicans, Herpes simplex virus 1, Herpes simplex virus 1, Herpes simplex virus 2 , Treponema pallidum, Enterococcus faecalis, Pseudomonas aeruginosa, E.Coli, Staphylococcus aureus, Enterococcus faecium, Klebsiella oxytoca, Proteus mirabilis, Veillonella parvula, HPV, Cytomegarovirus, Lactobacillus pneumoniae) were tested.
  • the same tester used the same sample twice a day for 20 days, and repeated the test twice for each test.
  • the positive standard low concentration 2.5*103, medium concentration 5*103, high concentration 10*103 and negative standard all showed the same results.
  • the same tester used three different lots with the same sample, twice a day for 5 days, and repeated the test twice for each test.
  • the positive standard low concentration 2.5*103, medium concentration 5*103, high concentration 10*103 and negative standard all showed the same results.
  • a sexually transmitted infection diagnostic kit was prepared with the following configuration.
  • the specific gene of the strain was amplified by PCR reaction using the positive control group of the diagnostic kit prepared above. Specifically, the experiment was conducted in two sets as follows.
  • Experimental Example 1 Experimental Example 2 Template DNA 4 ⁇ l Template DNA 4 ⁇ l STD Primer set 1 1 ⁇ l STD Primer set 2 1 ⁇ l Hot Taq Mastermix 5 ⁇ l Hot Taq Mastermix 5 ⁇ l Total Volume 10 ⁇ l Total Volume 10 ⁇ l
  • the amplified gene product was electrophoresed on 2-3% agarose gel (30-50 minutes at 110-250V in 0.5X TBE Buffer), and the presence or absence of specific gene amplification was checked. As a result of the experiment, it can be confirmed that only the specific primers for each pathogen were heavily bombarded. (See Fig. 1)
  • pathogen Product size (bp) pathogen Product size (bp)
  • the present invention can provide a primer set capable of effectively detecting and diagnosing several types of sexually transmitted infections at an early stage.
  • the present invention may provide a composition for diagnosing sexually transmitted infections comprising the primer and a method for diagnosing sexually transmitted infections using the same. This can be used to quickly and effectively detect pathogens that become sexually transmitted infections that pose a threat to health at an early stage.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 다중중합효소 연쇄 반응을 이용한 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법으로, 구체적으로 총 12개의 성매개 감염의 병원균을 특이적으로 증폭하는 프라이머 12쌍을 제공하고 이를 통해 성매개 감염을 통상적인 PCR을 통해서 효과적으로 신속하게 검출할 수 있다.

Description

성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법
본 발명은 다중중합효소 연쇄 반응을 이용한 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법에 관한 것이다.
성매개 감염(Sexually Transmitted Infection, STI)은 성적 접촉에 의해 감염자로부터 상대방에게 전염되는 것을 의미한다. 보다 자세하게는 명백한 증후를 갖고 있는 질환을 성 매개성질환(Sexually Transmitted Disease, STD)이라 하고, 증상 및 증후가 없는 무증상 감염까지 포함하는 개념을 성매개 감염(Sexually Transmitted Infection, STI)으로 구분하였지만, 최근에는 STI로 통용되고 있다. STI는 전체 성인남녀의 약 50%가 평생에 한 번 이상 감염될 만큼 흔한 질병으로, 세계보건기구에 따르면 전세계적으로 치료 가능한 STI 환자는 매년 3억4천만 명 이상 새롭게 발생한다고 한다(J Microbiol., 45:453-459. 2007; WHO. Global Strategy for the prevention and control of sexually transmitted infections 2006-2015, 2007).
STI의 조기 진단과 치료가 이루어지지 않을 경우, 불임, 태아 사망, 자궁 외 임신, 항문생식기계통의 암, 미성숙 사망, 영유아 감염과 같은 합병증 또는 후유증을 초래할 수 있으며, 때론 치명적인 질환으로 생명에 위협을 줄 수 있다. STI는 무증상으로 잠복되어 증세가 악화되는 경우가 많고, 재감염이 용이하므로 STI의 진단 대상자인 유흥접객원 및 기타 STI 매개우려자 등에 대해 정기적인 STI 검진을 통한 감염자의 조기 발견과 치료로 STI 전파를 미연에 방지하는 것이 중요하다(Korean J UTII, 3:55-62, 2008).
그러므로 STI 병원체를 조기에 검출하여 무증상의 감염자도 효과적으로 진단할 수 있는 방법의 개발이 중요하다. 또한, STI는 질환별 다양한 병원체에 따른 약제 및 치료 경과가 서로 다르기 때문에 병원체의 유전자 검사법을 이용한 정확한 병원체의 진단을 통해 적합한 약제처방으로 신속한 치료를 받을 수 있을 뿐만 아니라, 감염 증세 및 임상소견의 최종진단 결정에 확신성을 유도하기에 약물 오남용을 막을 수 있다.
이러한 성병을 진단하는 이전의 방법으로는 감염부위를 채취해 도말염색하여 현미경상에서 검사하는 방법으로 임질의 경우 그람음성 쌍구균을 관찰, 칸디다 진균, 헤르페스 바이러스와 같은 경우 그람양성을 관찰하는 현미경 검사와 선택배지에 배양동정 검사하는 방법 등이 있는데 이러한 방법들은 균의 형태학적이나 생장 특성에 근거하고 있어 번거롭고 복잡하며, 장시간이 소요된다는 문제점을 갖고 있다. 최근에는 유전자를 표적으로 하는 빠르면서도 보다 간편한 방법들이 점차 많이 사용되고 개발되고 있다. 이 방법에는 특정 유전자를 대상으로 병원균의 특이적 염기서열의 종 특이적 프라이머를 제작한 후 PCR을 이용한 검사법이 개발 사용되고 있다.
PCR은 아주 적은 양의 DNA 만으로도 특정 부위의 DNA 서열을 기하급수적으로 증폭할 수 있는 간단하고 편리한 방법으로, 증폭하고자 하는 DNA에 특이적으로 결합하는 프라이머와, 고온에서도 안정한 Taq DNA 중합효소(polymerase)를 사용하여 변성(Denaturation step), 결합(Annealing step), 연장(Extension step)을 반복적으로 실행함으로써 소량의 DNA만으로도 신속하고 정확하게 진단해 낼 수 있는 검사법이다. 그러나 하나의 반응기 내에서 한 번의 반응으로 검사가 가능한 대상 병원체 수 및 검사 가능 샘플 수에 제한이 있으며, 각 대상 병원체에 대한 정확한 유전자형 검출이 가능한 유전자와 염기서열 부위 선택이 어렵고, 이에 대한 최적의 PCR 조건 수립에 어려움이 있다(J Microbiol., 45:453-459. 2007; Can J Infect Dis Med Microbiol., 16:73-76, 2005; J Microbiol Methods.,62:245-256, 2005). 나아가 경제적 여건이나 의료 시설 기반이 상대적으로 부족한 나라의 경우 성병 감염 문제가 많음에도 불구하고 성병을 진단하기 위한 검사 장비나 시설 등의 제한을 받게 된다.
따라서, 성병감염 예가 증가되고 여러 종에 의한 감염이 증가함에 따라 이러한 여러 종의 병원균에 의한 감염을 조기에 효과적으로 정확하게 발견해 치료와 예방 할 수 있는 유용한 방법이 절실히 요구되고 있다.
상술한 바와 같은 문제점을 해결하기 위한 본 발명은 여러 종의 성매개 감염을 조기에 효과적으로 검출하고 진단할 수 있는 프라이머 및 이를 이용한 진단 방법을 제공하고자 한다. 또한, 본 발명은 별도의 고가의 장비 없이 통상의 PCR 수행으로 복수의 성매개 감염을 동시에 효과적으로 진단할 수 있는 프라이머 세트 및 이를 이용한 진단 방법을 제공하고자 한다.
상술한 과제를 해결하기 위한 본 발명은, 1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍, 2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움(Mycoplasma genitalium) 증폭 프라이머 쌍, 3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍, 4) 서열번호 7 및 서열번호 8로 이루어진 우레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍, 5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍, 6) 서열번호 11 및 서열번호 12로 이루어진 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 증폭 프라이머 쌍, 7) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍, 8) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍, 9) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍, 10) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형(Herpes simplex virus 2) 증폭 프라이머 쌍, 11) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및 12) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 증폭 프라이머 쌍으로 이루어진 군에서 선택된 어느 하나 이상의 프라이머를 제공한다.
본 발명의 또다른 구현예에 따르면, 1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍, 2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움(Mycoplasma genitalium) 증폭 프라이머 쌍, 3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍, 4) 서열번호 7 및 서열번호 8로 이루어진 우레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍, 5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍, 및 6) 서열번호 11 및 서열번호 12로 이루어진 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 증폭 프라이머 쌍을 포함하는 프라이머 세트를 제공한다.
본 발명의 또다른 구현예에 따르면, 1) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍, 2) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍, 3) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍, 4) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형(Herpes simplex virus 2) 증폭 프라이머 쌍, 5) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및 6) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 증폭 프라이머 쌍을 포함하는 프라이머 세트를 제공한다.
본 발명의 구현예에 따르면, 상기 프라이머 세트를 포함하는 성매개 감염 진단용 조성물을 제공한다. 상기 조성물은 통상적으로 사용될 수 있는 성분, 예를 들면 완충액 등을 포함할 수 있다. 구체적으로, DNA 중합효소, dNTP 혼합물(dATP, dCTP, dGTP, dTTP), PCR 완충액, 및 DNA 중합 효소 조인자를 포함할 수 있다.
본 발명의 구현예에 따르면, 상기 프라이머 세트를 포함하는 성매개 감염 진단 키트를 제공한다.
본 발명의 구현예에 따르면, 상기 키트는 DNA 중합효소를 더 포함하는 성매개 감염 진단 키트를 제공한다. 구체적으로 상기 DNA 중합효소는 Hot Start Taq이다.
본 발명의 구현예에 따르면, 상기 프라이머 세트를 사용하여 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하여 단계를 포함하는 성매개 감염 여부 진단 방법을 제공한다.
본 발명의 성매개 감염 여부 진단은 본 발명의 프라이머 세트를 사용하여 생물학적 샘플로부터 각각 프라이머가 특이적으로 검출하는 병원체의 유전자를 검출하는 것이다.
본 발명에서 용어 "생물학적 샘플"이란 성매개 감염의 병원체로 감염되거나, 감염을 의심받는 개체 또는 성매개 감염 백신으로 백신화된 개체의 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료 등을 포함할 수 있으나, 이에 제한되지 않으며, 바람직하게는 성매개 감염 개체의 생식기 분비물로부터 수득되는 시료이다.
본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 우레아플라즈마 우에아리티움(Ureaplasma urealytium), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 중에서 선택된 어느 하나 이상의 병원체를 검출하는 것을 특징으로 한다.
본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 서열번호 1 내지 12로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis) 및 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 병원체 감염여부를 동시에 검출하는 것을 특징으로 한다.
본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 서열번호 13 내지 24로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체 감염여부를 동시에 검출하는 것을 특징으로 한다.
상기와 같은 본 발명에 따르면, 본 발명은 12종의 성매개 감염을 효율이 높고 미량으로 존재하는 병원균도 검출할 수 있다. 또 초기에 자각 증상이 없기 때문에 초기 발견이 어려운 성병의 경우에도 쉽게 진단해 낼 수 있으므로 조기 예방하는데 아주 유용한 방법이라고 할 수 있다. 또한, 본 발명은 별도의 고가의 장비 없이 통상의 PCR 수행으로 복수의 성매개 감염을 높은 민감도와 특이도를 가지면서도 동시에 효과적으로 진단할 수 있다.
도 1은 본 발명 프라이머를 포함하는 진단 키트의 특이성 시험 결과이다. (a) 프라이머 set 1 전기영동 결과(실험예 1), (b) 프라미어 set 2 전기영동 결과(실험예 2).
본 발명의 최선의 형태는, 서열번호 1 내지 서열번호 12의 프라이머, 총 6개의 프라이머쌍으로 이루어진 프라이머 세트, 서열번호 13 내지 서열번호 24의 프라이머, 총 6개의 프라이머쌍으로 이루어진 프라이머 세트이다. 이를 통해 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 우레아플라즈마 우에아리티움(Ureaplasma urealytium), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체를 높은 민감도와 특이도를 갖고 동시에 효과적으로 검출할 수 있다.
본 발명은 다중중합효소연쇄반응(Multiple Polymerase Chain Reaction; M-PCR)을 이용하여 성매개 감염의 원인이 되는 12종의 병원균을 신속 정확하게 검출해 내는 것으로 각 병원균의 특이적(species-specific) 염기서열의 프라이머를 이용하여 병원균 감염 여부를 진단해 내는 키트 및 방법을 제공한다.
상기 중합효소연쇄반응(PCR)은 특정 DNA 단편을 선별적으로 증폭하는 방법으로서 이에 대한 내용은 Miller, H. I. (WO 89/06700) 및 Davey, C. et al. (EP 329,822))에 개시되어 있으며, 이 문헌은 본 명세서에 참조로써 삽입된다.
본 발명의 용어 "성매개 감염"은 성적 접촉에 의해 감염자로부터 상대방에게 전염되는 것으로, 보다 자세하게는 명백한 임상적 증후를 갖고 있는 질환을 성 매개성질환은 물론 증상 및 증후가 없는 무증상 감염까지 포함한다.
본 발명의 용어 "프라이머(primer)"는 중합효소연쇄반응에서 이용되는 타깃 핵산에 인접해 있는 5'말단 서열 및 3'말단 서열에 상보적인 올리고뉴클레오타이드를 의미한다. 본 발명의 명세서에서 용어 "전방향(forward) 프라이머" 및 "역방향(reverse) 프라이머"는 중합효소연쇄반응에 의해 증폭되는 유전자의 일정 부위의 3'말단 및 5'말단에 각각 결합하는 프라이머를 의미한다.
특히 본 발명은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 우레아플라즈마 우에아리티움(Ureaplasma urealytium), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1)를 특이적으로 검출할 수 있다.
일반적으로 하나의 병원균을 검출하는 PCR에는 1쌍의 프라이머가 이용되며, 따라서 12종류의 표적을 목적으로 PCR을 수행하기 위해서는 12쌍, 즉 24개의 프라이머가 필요하다. 이들을 1번에 확인할 수 있도록 공통의 PCR 반응조건을 갖는 프라이머 개발에 주력하였다. 그 결과 12쌍의 프라이머를 이용하여 이들을 PCR 반응에 적용하여 12종을 검출할 수 있게 되었다. 본 발명에 따른 PCR 프라이머를 제작할 때는 프라이머의 A, G, C, T 함량비, 프라이머의 복합체(dimmer) 형성 방지, 같은 염기서열의 3회 이상 반복 금지 등 여러 가지 제약이 따르고, 그 외에 PCR 반응조건에 있어서 주형(template) DNA 양, 프라이머 농도, dNTP의 농도, Mg2+의 농도, 반응온도, 반응시간 등의 조건이 적정해야 한다. 이에 본 발명에 의해 제공되는 12종의 성매매 감염 병원체의 검출이 적합하도록 개발된 것이다.
특히, 본원발명은 12쌍의 프라이머 중 i) 서열번호 1 내지 12로 이루어진 6쌍의 프라이머 쌍을 세트로 포함하여 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis) 및 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 병원체 감염여부를 동시에 검출할 수 있고, ii) 서열번호 13 내지 24로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체 감염여부를 동시에 검출할 수 있는 효과를 발휘한다.
본원발명에서 제공하는 프라이머는 각 성매개 감염을 일으키는 병원체를 간단한 PCR을 통하면서도 높은 특이도 및 민감도로 신속하게 검출할 수 있다.
이하, 첨부된 도면을 참조하여 본 발명의 실시예를 상세하게 설명한다.
본 명세서에서 사용된 용어는 실시예들을 설명하기 위한 것이며 본 발명을 제한하고자 하는 것은 아니다. 본 명세서에서, 단수형은 문구에서 특별히 언급하지 않는 한 복수형도 포함한다. 명세서에서 사용되는 "포함한다(comprises)" 및/또는 "포함하는(comprising)"은 언급된 구성요소 외에 하나 이상의 다른 구성요소의 존재 또는 추가를 배제하지 않는다.
다른 정의가 없다면, 본 명세서에서 사용되는 모든 용어(기술 및 과학적 용어를 포함)는 본 발명이 속하는 기술분야의 통상의 기술자에게 공통적으로 이해될 수 있는 의미로 사용될 수 있을 것이다. 또한, 일반적으로 사용되는 사전에 정의되어 있는 용어들은 명백하게 특별히 정의되어 있지 않는 한 이상적으로 또는 과도하게 해석되지 않는다.
[실시예1] 프라이머 제작
성매개 감염을 일으키는 12종의 병원체를 검출하기 위하여 다음의 프라이머를 디자인하였다.
병원균 구분 서열 서열번호 mer 수 분자량 Target 유전자
Treponema pallidum Forward CTGCACGTAAGGTAAGCAGCATGGAGAG 1 28 8711.74 treponemal membrane protein B
Reverse CGCACAGAACCGAATTCCTTGAACCTAACCTC 2 32 9682.42
Mycoplasma genitalium Forward AGGATTGGCAATTTTTATGCCTGGTTGCATCTTACTTTC 3 39 11959.88 lipoprotein
Reverse ACGAGTTTGAACTTGGTAGTTCATCTCTTCTGGTTTGG 4 38 11711.70
Neisseria gonorrhea Forward CTTTATCGGCTTGGCAGGCGAATTCGG 5 27 8322.47 putative MafA-like protein
Reverse CAATGGATCGGTATCACTCGCTCTGCCG 6 28 8540.63
Ureaplasma parvum Forward GTCCATTTCAACAAGCACGCAAACTTGCAAAAG 7 33 10083.69 putative lipoprotein
Reverse TGCACCGAATCCTGGTAGTTCTTCAAAATCAGG 8 33 10112.68
Mycoplasma hominis Forward CGCTGTAAGGCGCCACTAAAAGATGAGG 9 28 8671.72 glyceraldehyde 3-phosphate dehydrogenase
Reverse GCTTTCTGACAAGGTACCGTCAGTCTGC 10 28 8555.64
Ureaplasma urealytium Forward GGGGTAACTTTAGTGGGAGCAGGGGTAGTTGCTG 11 34 10689.99 multiple bandedantigen gene
Reverse CAGCTGATGTAATTGCAACATTGAATTCAGCTTCG 12 35 10745.10
Gardnerella vaginalis Forward GAGAACTGGATAGTGGACACGAGTAAGAATAGTGAGAC 13 38 11897.84 rRNA-23S ribosomal RNA
Reverse ACGGTCTGGGCAGATTCACGCGGGATTCCACGAGG 14 35 10838.11
Chlamydia trachomatis Forward GCGCATCTAAAGGAGCTAGCTCGCAACAATGC 15 32 9827.49 putative type III secretion system membrane
Reverse TCAAGCCAAGACCGCAAGTGAATAATGCGGATAC 16 34 10477.93
Trichomonas vaginalis Forward CGAATCCATCCTCGATGTCATCCGTAAGGAAGC 17 33 10082.66 beta-tubulin (btub1) gene
Reverse CGAGCTTACGAAGGTCGGAGTTGAGCTG 18 28 8709.72
Herpes simplex virus 2 Forward GTGATGTTTGCTTGGTCGTTCCTGGTCCTCAAG 19 33 10148.66 envelope protein UL20
Reverse GCTGGCGGTGATCCAATGGAAAAGCCC 20 27 8334.49
Candida albicans Forward GATCTCTTGGTTCTCGCATCGATGAAGAACGCAGC 21 35 10747.08 18S ribosomal RNA gene
Reverse ACCTAAGCCATTGTCAAAGCGATCCCGCCTTAC 22 33 10002.62
Herpes simplex virus 1 Forward GCGGCCAGCACGCTGTGGTTGCTTGGCCTGGACG 23 34 10507.87 capsid triplex subunit 1
Reverse CACGATCCGCGTTGGGTTGGCACAGATCCGTCAG 24 34 10459.87
GAPDH Forward CCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCC 25 36 10882.19 GAPDH
Reverse GCAGAATCCAGATGCTCAAGGCCCTTCATAATATCC 26 36 10973.26
[실시예2] 프라이머의 민감도
상기에서 제조한 프라이머에 대하여 표준검체를 희석하여 95% 이상 검출되는 농도를 확인한 결과 각각 검출 한계는 다음과 같다.
Number Specificity LoD (단위 copies/㎖)
1 우레아플라즈마 우에아리티움 (Ureaplasma urealytium) 2.5*10³
2 클라미디아 트라코마티스 (Chlamydia trachomatis) 2.5*10²
3 우레아플라즈마 파붐 (Ureaplasma parvum) 2.5*10³
4 마이코플라스마 제니탈리움 (Mycoplasma genitalium) 2.5*10³
5 가드네렐라 바지날리스 (Gardnerella vaginalis) 2.5*10³
6 임질구균 (Neisseria gonorrhea) 2.5*10²
7 칸디다 알비칸스 (Candida albicans) 2.5*10³
8 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1) 2.5*10³
9 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2) 2.5*10³
10 마이코플라즈마 호미니스 (Mycoplasma hominis) 2.5*10³
11 트리코모나스 바지날리스 (Trichomonas vaginalis) 2.5*10³
12 매독균(Treponema pallidum) 2.5*10³
[실시예3] 프라이머의 교차반응 여부
교차 반응성을 확인하고자 총 26종(Ureaplasma urealytium, Chlamydia trachomatis, Ureaplasma parvum, Mycoplasma genitalium, Gardnerella vaginalis, Neisseria gonorrhea, Streptococcus agalactiae, Candida albicans, Herpes simplex virus 1, Herpes simplex virus 2, Mycoplasma hominis, Trichomonas vaginalis, Cytomegalovirus, Treponema pallidum, Enterococcus faecalis, Pseudomonas aeruginosa, E.Coli, Staphylococcus aureus, Enterococcus faecium, Klebsiella oxytoca, Proteus mirabilis, Veillonella parvula, HPV, Cytomegarovirus, Klebsiella pneumoniae, Lactobacillus)를 대상으로 실험을 수행하였다.
실험 결과, 모두 교차 반응이 없음을 확인 하였다.
[실시예4] 프라이머의 반복성 검증
1) 반복성 시험
반복성 시험을 위해 동일한 시험자가 동일한 검체를 사용하여 20일간 매일 2회씩 검사마다 2회 반복 시험을 실시 하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.
2) Lot 간 재현성
동일 시험자가 동일한 검체로 3개의 다른 Lot을 사용하여 5일 동안 매일 2회씩 검사마다 2회 반복 시험을 실시하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.
3) 시험자간 재현성
3명의 시험자가 동일한 검체로 동일한 Lot을 사용하여 3일 동안 매일 1회씩 검사마다 2회 반복 시험을 실시하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.
[실시예5] 프라이머의 임상적 성능
A병원에서 타사의 기허가 대조시약 B제품으로 481개의 익명화된 질 도말 검체로 분석되었다.
균종 민감도 특이도
우레아플라즈마 우에아리티움(Ureaplasma urealytium, UU) 99.39 % (163/164) 100 % (317/317)
마이코플라즈마 호미니스(Mycoplasma hominis, MH) 100 % (149/149) 99.39 % (330/332)
우레아플라즈마 파붐 (Ureaplasma parvum, UP) 98.85 % (172/174) 100 % (307/307)
임질구균(Neisseria gonorrhea, NG) 100 % (62/62) 99.76 % (418/419)
마이코플라스마 제니탈리움 ((Mycoplasma genitalium, MG) 100 % (74/74) 99.75 % (406/407)
매독균(Treponema pallidum) 100 % (31/31) 100 % (450/450)
단순 헤르페스 바이러스 1형 (Herpes simplex virus 1, HSV1) 100 % (33/33) 100 % (448/448)
칸디다 알비칸스(Candida albicans, CA) 98.63 % (145/147) 99.70 % (333/334)
단순 헤르페스 바이러스 2형 (Herpes simplex virus 2, HSV2) 100 % (46/46) 99.54 % (433/435)
트리코모나스 바지날리스 (Trichomonas vaginalis, TV) 100 % (37/37) 99.77 % (443/444)
클라미디아 트라코마티스 (Chlamydia trachomatis, CT) 100 % (99/99) 99.73 % (381/382)
가드네렐라 바지날리스(Gardnerella vaginalis, GV) 98.23 % (222/226) 100 % (255/255)
[실시예6] 성매개 감염 진단 키트 제작
다음과 같은 구성으로 성매개 감염 진단 키트를 제작하였다
구분 명칭 원재료 및 성분명
1 Hot Taq Mastermix Hot Start Taq (1,000U/Λ)*(2.5unit/λ) , Tris-HCl(pH9.0), (NH4)2SO4,MgCl2, BSA, DMSO, 25mM MgCl2, 100% glycerol, dNTP(dATP, dCTP, dGTP, dTTP, dUTP), 0.4% Bromophenol Blue
2 STDPrimer set1 Treponema pallidum Forward Primer (서열번호:1)
Treponema pallidum Reverse Primer (서열번호:2)
Mycoplasma genitalium Forward Primer (서열번호:3)
Mycoplasma genitalium Reverse Primer (서열번호:4)
Neisseria gonorrhea Forward Primer (서열번호:5)
Neisseria gonorrhea Reverse Primer (서열번호:6)
Ureaplasma parvum Forward Primer (서열번호:7)
Ureaplasma parvum Reverse Primer (서열번호:8)
Mycoplasma hominis Forward Primer (서열번호:9)
Mycoplasma hominis Reverse Primer (서열번호:10)
Ureaplasma urealytium Forward Primer (서열번호:11)
Ureaplasma urealytium Reverse Primer (서열번호:12)
GAPDH Forward Primer (서열번호:25)
GAPDH Reverse Primer (서열번호:26)
TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)
3 STDPrimer set 2 Gardnerella vaginalis Forward Primer (서열번호:13)
Gardnerella vaginalis Reverse Primer (서열번호:14)
Chlamydia trachomatis Forward Primer (서열번호:15)
Chlamydia trachomatis Reverse Primer (서열번호:16)
Trichomonas vaginalis Forward Primer (서열번호:17)
Trichomonas vaginalis Reverse Primer (서열번호:18)
Herpes simplex virus 2 Forward Primer (서열번호:19)
Herpes simplex virus 2 Reverse Primer (서열번호:20)
Candida albicans Forward Primer (서열번호:21)
Candida albicans Reverse Primer (서열번호:22)
Herpes simplex virus 1 Forward Primer (서열번호:23)
Herpes simplex virus 1 Reverse Primer (서열번호:24)
GAPDH Forward Primer (서열번호:25)
GAPDH Reverse Primer (서열번호:26)
TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)
4 STD 양성 대조군 Treponema pallidum DNA
Mycoplasma genitalium DNA
Neisseria gonorrhea DNA
Ureaplasma parvum DNA
Mycoplasma hominis DNA
Ureaplasma urealytium DNA
Gardnerella vaginalis DNA
Chlamydia trachomatis DNA
Trichomonas vaginalis DNA
Herpes simplex virus 2 DNA
Candida albicans DNA
Herpes simplex virus 1 DNA
TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)
5 STD 음성 대조군 RNase-free water
[실시예7] 진단 키트의 특이성 시험
상기에서 제조한 진단 키트의 양성대조군을 사용하여 PCR 반응시켜 균주의 특이 유전자를 증폭하였다. 구체적으로, 다음과 같이 2 셋트로 실험을 진행하였다.
실험예 1 실험예 2
Template DNA 4㎕ Template DNA 4㎕
STD Primer set 1 1㎕ STD Primer set 2 1㎕
Hot Taq Mastermix 5㎕ Hot Taq Mastermix 5㎕
Total Volume 10㎕ Total Volume 10㎕
PCR 조건으로는 충분히 변성시키기 위해 다음의 조건으로 수행하였다.
Segment Cycles Temperature Duration
1 1 95℃ 10.0min
2 35 95℃ 0.5min
67℃ 1.0min
72℃ 1.0min
3 1 72℃ 5.0min
반응 후 증폭된 유전자 산물을 2~3% 아가로스 젤상에서 전기영동한 후 (0.5X TBE Buffer에서 110~250V로 30~50분), 특이 유전자의 증폭유무를 확인하였다. 실험 결과, 병원체별 특이 프라이머만이 중폭된 것을 확인 할 수 있다. (도 1 참조)
Lane 실험예 1 실험예 2
병원균 산물크기(bp) 병원균 산물크기(bp)
1 Treponema pallidum 646 Gardnerella vaginalis 660
2 Mycoplasma genitalium 530 Chlamydia trachomatis 523
3 Neisseria gonorrhea 435 Trichomonas vaginalis 420
4 Ureaplasma parvum 350 Herpes simplex virus 2 320
5 Mycoplasma hominis 300 Candida albicans 250
6 Ureaplasma urealytium 220 Herpes simplex virus 1 200
이상, 첨부된 도면을 참조로 하여 본 발명의 실시예를 설명하였지만, 본 발명이 속하는 기술분야의 통상의 기술자는 본 발명이 그 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 그러므로, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며, 제한적이 아닌 것으로 이해해야만 한다.
본 발명은 여러 종의 성매개 감염을 조기에 효과적으로 검출하고 진단할 수 있는 프라이머 세트를 제공할 수 있다. 본 발명은 상기 프라이머를 포함하는 성매개 감염 진단 조성물 및 이를 이용한 성매개 감염 진담 방법을 제공할 수 있다. 이를 통해 건강에 위협이 되는 성매개 감염이 되는 병원균을 조기에 신속하고 효과적으로 검출하는데 사용될 수 있다.

Claims (10)

  1. 다음 군에서 선택된 어느 하나 이상의 프라이머 쌍을 포함하는 성매개 감염 진단용 프라이머 세트;
    1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍,
    2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움 (Mycoplasma genitalium) 증폭 프라이머 쌍,
    3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍,
    4) 서열번호 7 및 서열번호 8로 이루어진 우레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍,
    5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍,
    6) 서열번호 11 및 서열번호 12로 이루어진 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 증폭 프라이머 쌍,
    7) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍,
    8) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍,
    9) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍,
    10) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2) 증폭 프라이머 쌍,
    11) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및
    12) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1) 증폭 프라이머 쌍.
  2. 제1항에 있어서, 상기 프라이머 세트는 1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍, 2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움(Mycoplasma genitalium) 증폭 프라이머 쌍, 3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍, 4) 서열번호 7 및 서열번호 8로 이루어진 우레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍, 5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍, 및 6) 서열번호 11 및 서열번호 12로 이루어진 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 증폭 프라이머 쌍을 포함하는 프라이머 세트.
  3. 제1항에 있어서, 상기 프라이머 세트는 1) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍, 2) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍, 3) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍, 4) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형(Herpes simplex virus 2) 증폭 프라이머 쌍, 5) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및 6) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 증폭 프라이머 쌍을 포함하는 프라이머 세트.
  4. 제1항 내지 제3항 중 어느 하나에 따른 프라이머 세트를 포함하는 성매개 감염 진단용 조성물.
  5. 제1항 내지 제3항 중 어느 하나에 따른 프라이머 세트를 포함하는 성매개 감염 진단 키트.
  6. 제5항에 있어서, 상기 키트는 DNA 중합효소를 더 포함하는 성매개 감염 진단 키트.
  7. 제1항 내지 제3항 중 어느 하나에 따른 프라이머 세트를 사용하여 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하는 단계를 포함하는 성매개 감염 여부 진단 방법.
  8. 제7항에 있어서, 상기 방법은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움 (Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 우레아플라즈마 우에아리티움(Ureaplasma urealytium), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 중에서 선택된 어느 하나 이상의 병원체를 검출하는 것을 특징으로 하는 성매개 감염 여부 진단 방법.
  9. 제2항에 따른 프라이머 세트를 사용하여 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하는 단계를 포함하는 성매개 감염 여부 진단 방법으로, 상기 방법은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움 (Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 우레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis) 및 우레아플라즈마 우에아리티움(Ureaplasma urealytium) 병원체 감염여부를 동시에 검출하는 성매개 감염 여부 진단 방법.
  10. 제3항에 따른 프라이머 세트를 사용하여 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하는 단계를 포함하는 성매개 감염 여부 진단 방법으로, 상기 방법은 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1) 병원체 감염 여부를 동시에 검출하는 성매개 감염 여부 진단 방법.
PCT/KR2020/018659 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법 WO2022131406A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
KR1020207036615A KR102326566B1 (ko) 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법
KR1020217019404A KR102466562B1 (ko) 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법
PCT/KR2020/018659 WO2022131406A1 (ko) 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/018659 WO2022131406A1 (ko) 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법

Publications (1)

Publication Number Publication Date
WO2022131406A1 true WO2022131406A1 (ko) 2022-06-23

Family

ID=78717131

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/018659 WO2022131406A1 (ko) 2020-12-18 2020-12-18 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법

Country Status (2)

Country Link
KR (2) KR102326566B1 (ko)
WO (1) WO2022131406A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070047269A (ko) * 2007-04-16 2007-05-04 김연수 다중-중합효소연쇄반응과 자동화전기영동 시스템을 통한성전파질환 원인균 고감도 검출 방법
KR20080020475A (ko) * 2006-08-30 2008-03-05 김연수 다중-중합효소연쇄반응에 의한 성전파질환 원인균 검출을위한 신규한 유형 특이적 프라이머와 이를 이용한 검출방법
KR20100058919A (ko) * 2008-11-25 2010-06-04 굿젠 주식회사 성교전파성질환 원인균의 탐지, 유전자형 분석 및 항생제 내성 유전자형의 분석용의 ｄｎａ 칩, 키트, 및 이것을 이용한 탐지 및 유전자형의 분석방법
KR20120103801A (ko) * 2011-03-11 2012-09-20 (주)팸메드 성인성질환?유발 미생물 동시 검출방법
KR20140099798A (ko) * 2013-02-05 2014-08-13 (주)다이오진 리퀴드 비드 어레이와 다중중합효소연쇄반응법을 이용한 성전파 질환 원인균 검출 방법

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070099208A (ko) * 2006-04-03 2007-10-09 (주)우먼바이오텍 중합효소 연쇄 반응을 이용한 성병 검출방법 및 진단 키트
KR101225522B1 (ko) * 2009-10-16 2013-01-23 (주)지노첵 성적인 접촉에 의해 감염되는 질병을 일으키는 병원성 미생물 검사용 프로브, 그리고 이를 이용한 병원성 미생물 검사 칩, 검사키트 및 검사방법
KR101890472B1 (ko) * 2016-06-20 2018-08-21 주식회사 티씨엠생명과학 성매개성 감염을 일으키는 다종의 병원체를 검출할 수 있는 등온증폭반응용 프라이머 세트 및 프라이머 조성물과 이를 이용하여 성매개성 감염을 시각적으로 신속하게 진단하는 방법
KR102114469B1 (ko) * 2018-04-25 2020-05-25 주식회사 이원생명과학연구원 성매개 감염원인체 검출용 키트
KR101915211B1 (ko) 2018-05-25 2018-11-05 김연수 멜팅 피크 분석을 이용한 하부요로 생식기 감염균 검출 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080020475A (ko) * 2006-08-30 2008-03-05 김연수 다중-중합효소연쇄반응에 의한 성전파질환 원인균 검출을위한 신규한 유형 특이적 프라이머와 이를 이용한 검출방법
KR20070047269A (ko) * 2007-04-16 2007-05-04 김연수 다중-중합효소연쇄반응과 자동화전기영동 시스템을 통한성전파질환 원인균 고감도 검출 방법
KR20100058919A (ko) * 2008-11-25 2010-06-04 굿젠 주식회사 성교전파성질환 원인균의 탐지, 유전자형 분석 및 항생제 내성 유전자형의 분석용의 ｄｎａ 칩, 키트, 및 이것을 이용한 탐지 및 유전자형의 분석방법
KR20120103801A (ko) * 2011-03-11 2012-09-20 (주)팸메드 성인성질환?유발 미생물 동시 검출방법
KR20140099798A (ko) * 2013-02-05 2014-08-13 (주)다이오진 리퀴드 비드 어레이와 다중중합효소연쇄반응법을 이용한 성전파 질환 원인균 검출 방법

Also Published As

Publication number Publication date
KR102466562B1 (ko) 2022-11-11
KR20220088629A (ko) 2022-06-28
KR102326566B1 (ko) 2021-11-16

Similar Documents

Publication Publication Date Title
US10584392B2 (en) Method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system
WO2018012896A1 (ko) 결핵균 및 비결핵균 동시 진단용 멀티플렉스 pcr 프라이머 세트, 프라이머 세트를 포함하는 조성물 및 키트
KR20060100339A (ko) 다중-중합효소연쇄반응에 의한 성전파질환 원인균 검출을위한 신규한 유형 특이적 프라이머와 이를 이용한 검출방법
US20110287965A1 (en) Methods and compositions to detect clostridium difficile
KR20170142730A (ko) 성매개성 감염을 일으키는 다종의 병원체를 검출할 수 있는 등온증폭반응용 프라이머 세트 및 프라이머 조성물과 이를 이용하여 성매개성 감염을 시각적으로 신속하게 진단하는 방법
WO2019088702A1 (ko) 퀀타매트릭스 어세이 플랫폼 기반 헬리코박터 파이로리균 및 그 균의 항생제 내성에 관련된 유전자의 검출을 확인할 수 있는 진단법 및 그 응용
WO2009093856A2 (ko) 생물학적 의약품으로부터 마이코플라즈마를 검출하기 위한 ｐｃｒ 프라이머 세트 및 이를 포함하는 마이코플라즈마 검출용 키트
WO2011115465A2 (ko) 멀티플렉스 리퀴드 어레이 시스템을 이용한 여성 생식기 병원체 검출 방법 및 키트
WO2022131406A1 (ko) 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법
US11884984B2 (en) Kits and methods for assessing a condition or a risk of developing a condition, and related methods of treatment
WO2021015452A1 (ko) 표적 물질의 검출용 키트 및 이를 이용하여 표적 물질을 검출하는 방법
KR102444179B1 (ko) Hpv 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 hpv 감염 진단을 위한 정보제공방법
WO2021075655A1 (ko) 마이코플라즈마 폐렴균 및 마이코플라즈마 폐렴균 돌연변이 동시 검출용 프라이머와 프로브 및 이의 용도
KR20180082401A (ko) 성매개성 감염을 일으키는 다종의 병원체를 검출할 수 있는 등온증폭반응용 프라이머 세트 및 프라이머 조성물과 이를 이용하여 성매개성 감염을 시각적으로 신속하게 진단하는 방법
WO2023204614A1 (ko) 성 매개 감염증 유발 병원체 검출용 키트 및 이를 이용한 성 매개 감염증 유발 병원체의 검출방법
KR101742016B1 (ko) 클라미디아 트라코마티스 및/또는 나이세리아 고노로이에 탐지용 올리고뉴클레오타이드 및 이를 포함하는 키트
KR101649306B1 (ko) 클라미디아 트라코마티스 및/또는 나이세리아 고노로이에 탐지용 올리고뉴클레오타이드 및 이를 포함하는 키트
CN117305489A (zh) 一种用于检测普氏立克次体的引物组及试剂盒
CN116287444A (zh) 检测猴痘病毒的组合物、试剂盒、方法及其用途
WO2020161651A1 (en) Early detection of multiple resistances to anti-bacterial treatment
Michuki A Metagenomic characterisation of vaginal Flora and the relationship of bacteriophage, Bifidobacterium and Oenococcus with bacterial vaginosis in HIV infected women
CN116732208A (zh) 生殖泌尿系统病原体联检并区分的组合物、试剂盒及用途
CN117947196A (zh) 一种用于检测猪支原体和衣原体的核酸组合物、试剂盒及检测方法
CN116622865A (zh) 金黄色葡萄球菌耐药性rpa检测组合物及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20966060

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20966060

Country of ref document: EP

Kind code of ref document: A1