WO2021002739A1 - 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물 - Google Patents

인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2021002739A1
WO2021002739A1 PCT/KR2020/095041 KR2020095041W WO2021002739A1 WO 2021002739 A1 WO2021002739 A1 WO 2021002739A1 KR 2020095041 W KR2020095041 W KR 2020095041W WO 2021002739 A1 WO2021002739 A1 WO 2021002739A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
inflammatory skin
vector
polynucleotide encoding
preventing
Prior art date
Application number
PCT/KR2020/095041
Other languages
English (en)
French (fr)
Inventor
홍진태
이용선
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Publication of WO2021002739A1 publication Critical patent/WO2021002739A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74—Biological properties of particular ingredients

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating inflammatory skin diseases comprising interleukin-32 protein as an active ingredient.
  • the skin is the outermost organ of the human body and acts as a barrier to protect the human body by protecting moisture in the body and blocking intrusion factors from the outside.
  • Factors that cause skin inflammation include physicochemical stimulation, allergens, ultraviolet rays, oxidative stress, and infections caused by pathogens.
  • the general pathway of skin inflammatory reaction is an immune response to protect the human body from external stimuli, and the control of inflammation through inhibition of the inflammatory reaction has become a major target of inflammatory skin diseases.
  • cytokines and chemokines generated during the invasion of inflammatory cells such as T cells or eosinophils expressing skin lymphocyte-related antigens into the lesion are involved.
  • inflammatory cells such as T cells or eosinophils expressing skin lymphocyte-related antigens into the lesion
  • related receptors are expressed in cells such as inflammatory cells, keratinocytes, fibroblasts, and the like.
  • Atopic dermatitis one of such inflammatory skin diseases, is caused by genetic and environmental factors, and is accompanied by symptoms such as severe itching, dry skin, and skin lesions.
  • various inflammatory cytokines are expressed in keratinocytes, thereby inducing an inflammatory response mediated by T helper type 2 cells.
  • Type 2 T helper cells secrete interleukin-4, interleukin-13, etc., thereby increasing the secretion of immunoglobulin E (IgE).
  • IgE immunoglobulin E
  • interleukin-32 (IL-32) protein is a cytokine produced by immune cells such as various types of epithelial cells, T lymphocytes, NK cells, and monocytes.
  • the gene encoding the IL-32 protein is located on human chromosome 16p13.3, which generates six selective splicing variants ( ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , ⁇ ) after transcription.
  • An object of the present invention is to provide an interleukin-32 protein or a polynucleotide encoding the same for preventing, improving or treating inflammatory skin diseases.
  • the present invention provides a pharmaceutical composition for preventing or treating inflammatory skin diseases, including interleukin-32 (IL-32) protein or a polynucleotide encoding the same as an active ingredient.
  • IL-32 interleukin-32
  • the present invention provides a cosmetic composition for preventing or improving inflammatory skin diseases comprising IL-32 protein or a polynucleotide encoding the same as an active ingredient.
  • the present invention provides a skin external preparation for preventing or improving inflammatory skin diseases comprising IL-32 protein or a polynucleotide encoding the same as an active ingredient.
  • the present invention provides a vector comprising a polynucleotide encoding the IL-32 protein or a pharmaceutical composition for the prevention or treatment of inflammatory skin diseases comprising cells containing the vector as an active ingredient.
  • the present invention provides a vector comprising a polynucleotide encoding the IL-32 protein or a cosmetic composition for preventing or improving inflammatory skin diseases comprising cells containing the vector as an active ingredient.
  • the present invention provides a vector containing a polynucleotide encoding the IL-32 protein or a skin external preparation for preventing or improving inflammatory skin diseases, including cells containing the vector as an active ingredient.
  • the present invention provides a method for preventing, improving or treating inflammatory skin diseases comprising administering to an individual an IL-32 protein or a polynucleotide encoding the same.
  • the present invention provides the use of an IL-32 protein or a polynucleotide encoding the same for use in the manufacture of a medicament for the prevention or treatment of inflammatory skin disease.
  • the present invention provides a vector comprising a polynucleotide encoding IL-32 protein or a method for preventing, improving or treating inflammatory skin diseases comprising administering the vector to an individual.
  • the present invention provides a vector containing a polynucleotide encoding IL-32 protein or a use of the vector for use in the manufacture of a medicament for the prevention or treatment of inflammatory skin diseases.
  • the interleukin-32 protein of the present invention relieves inflammation of the skin in an animal model of atopic dermatitis, inhibits the increase of skin thickness and mast cells, suppresses the blood level and expression of inflammatory cytokines, and also inhibits inflammatory cytokines in skin keratinocytes. By suppressing the increase of, it can be usefully used in the treatment of inflammatory skin diseases.
  • FIG. 1 is a diagram showing a mouse animal model experiment plan according to an embodiment of the present invention.
  • Figure 2 is a diagram showing the results of confirming that the recombinant IL-32 ⁇ protein inhibits skin inflammation in an animal model caused by atopic dermatitis in an embodiment of the present invention (Con: untreated control group, PA: PA application group, PA+rhIL -32 ⁇ : Experimental group in which IL-32 ⁇ protein was administered by injection after PA application).
  • FIG. 3 is a graph showing results of visual observation and evaluation of the inhibition of skin inflammation of the recombinant IL-32 ⁇ protein in an animal model induced by atopic dermatitis in an embodiment of the present invention (Con: untreated control group, PA: PA application Group, PA+rhIL-32 ⁇ : an experimental group in which IL-32 ⁇ protein was administered by injection after PA application).
  • FIG. 4 is a photograph and graph as a result of confirming by H&E staining that the recombinant IL-32 ⁇ protein inhibits the increase in epidermal thickness in an animal model caused by atopic dermatitis in an embodiment of the present invention
  • Cons untreated control group
  • PA PA application group
  • PA+rhIL-32 ⁇ an experimental group in which IL-32 ⁇ protein was administered by injection after PA application.
  • FIG. 5 is a photograph and graph of a result of confirming that the recombinant IL-32 ⁇ protein inhibits the increase of mast cells in an animal model caused by atopic dermatitis in an embodiment of the present invention by a toluidine blue staining method (Con: no Treatment control, PA: PA application group, PA+rhIL-32 ⁇ : experiment group in which IL-32 ⁇ protein was administered by injection after PA application).
  • FIG. 6 is a graph showing the results of confirming by ELISA method that the recombinant IL-32 ⁇ protein inhibits the increase of the inflammatory cytokines IL-4, IL-13 and IgE in the animal model induced by atopic dermatitis in an embodiment of the present invention.
  • Con untreated control group
  • PA PA application group
  • PA+rhIL-32 ⁇ experiment group in which IL-32 ⁇ protein was administered by injection after PA application.
  • FIG. 8 is a graph showing the results of confirming by qRT-PCR method that the recombinant IL-32 ⁇ protein inhibits the increase of inflammatory cytokines TARC, MDC, TNF- ⁇ and IL-1 ⁇ in skin keratinocytes in an embodiment of the present invention. .
  • FIG. 9 is a diagram showing the results of confirming that skin inflammation is improved after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention (WT: wild-type mouse, IL-32 ⁇ : IL- 32 ⁇ overexpressing mice, Non: untreated group, PA: PA coated group).
  • FIG. 10 is a graph showing the results of evaluating as a clinical index by observing that skin inflammation is improved after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention
  • WT untreated wild type Mice
  • IL-32 ⁇ untreated IL-32 ⁇ overexpressing mice
  • WT+PA wild-type mice coated with PA
  • IL-32 ⁇ +PA IL-32 ⁇ overexpressing mice coated with PA
  • FIG. 11 is a photograph of a result of confirming by H&E staining that an increase in epidermal thickness was inhibited after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention (WT: wild-type mouse, IL -32 ⁇ : IL-32 ⁇ overexpressing mouse, Non: untreated group, PA: PA coated group).
  • FIG. 12 is a graph showing the results of confirming by H&E staining that an increase in epidermal thickness was inhibited after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention
  • WT untreated wild-type mouse
  • IL-32 ⁇ untreated IL-32 ⁇ overexpressing mice
  • WT+PA wild-type mice coated with PA
  • IL-32 ⁇ +PA IL-32 ⁇ overexpressing mice coated with PA
  • FIG. 13 is a graph showing a result of confirming that the increase of mast cells is inhibited by a toluidine blue staining method after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention
  • WT untreated wild type Mice
  • IL-32 ⁇ untreated IL-32 ⁇ overexpressing mice
  • WT+PA wild-type mice coated with PA
  • IL-32 ⁇ +PA IL-32 ⁇ overexpressing mice coated with PA
  • FIG. 14 is a graph showing a result of confirming by qRT-PCR that the increase in type 2 T helper cytokine is inhibited after inducing atopic dermatitis in an animal model overexpressing the recombinant IL-32 ⁇ protein in an embodiment of the present invention
  • WT untreated wild type mouse
  • IL-32 ⁇ untreated IL-32 ⁇ overexpressing mouse
  • WT+PA PA coated wild type mouse
  • IL-32 ⁇ +PA PA coated IL-32 ⁇ overexpressing mouse
  • 16 is an increase in IL-4, IL-13, TNF- ⁇ , IL-1 ⁇ and IgE proteins in blood after inducing atopic dermatitis in an animal model overexpressing a recombinant IL-32 ⁇ protein in an embodiment of the present invention Is a graph of the results confirmed by the ELISA method (WT: untreated wild-type mouse, IL-32 ⁇ : untreated IL-32 ⁇ overexpressing mouse, WT+PA: PA coated wild-type mouse, IL-32 ⁇ +PA: PA coated IL-32 ⁇ overexpressing mice).
  • the present invention provides a pharmaceutical composition for preventing or treating inflammatory skin diseases, including interleukin-32 (IL-32) protein or a polynucleotide encoding the same as an active ingredient.
  • IL-32 interleukin-32
  • interleukin-32 (IL-32) protein is one of the cytokine proteins and has a molecular weight of about 14.9 to 26.7 kDa.
  • the IL-32 protein is located on human chromosome 16p13.3 and is composed of 8 exons, and after transcription, by 6 selective splicing, IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ are produced.
  • the IL-32 protein according to the present invention may be any one or more selected from the group consisting of IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ .
  • the IL-32 protein may be IL-32 ⁇ .
  • the IL-32 ⁇ may include all amino acid sequences well known in the art, and specifically, the IL-32 ⁇ may be a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 17.
  • the polypeptide may include variants or fragments having different sequences by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein. Amino acid exchanges in proteins or peptides that do not totally alter the activity of the molecule are well known in the art. Thus, the polypeptide may have 70%, 80%, 90%, 95% or 97% or more homology with the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 17. The polypeptide may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylaton, farnesylation, etc., depending on the case.
  • the polynucleotide may be composed of a polynucleotide sequence encoding the IL-32 protein.
  • the polynucleotide sequence includes not only the polynucleotide sequence encoding the amino acid sequence of the IL-32 protein, but also a polynucleotide having substantially the same nucleotide sequence as the polynucleotide, and fragments thereof.
  • a polynucleotide having substantially the same nucleotide sequence may have 80%, 90%, 95% or more homology with the polynucleotide of the present invention.
  • the polynucleotide of the present invention may include a variant in which one or more nucleotide sequences are substituted, deleted or inserted as long as it encodes a protein having the same activity.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus or papular urticaria, and specifically atopic dermatitis.
  • the pharmaceutical composition according to the present invention may contain 10 to 95% by weight of an active ingredient, interleukin-32 protein, or a polynucleotide encoding it, based on the total weight of the composition.
  • the pharmaceutical composition of the present invention may further include one or more active ingredients exhibiting the same or similar functions in addition to the active ingredients.
  • the pharmaceutical composition of the present invention may contain a carrier, a diluent, an excipient, or a mixture thereof commonly used in biological preparations.
  • Any pharmaceutically acceptable carrier can be used as long as it is suitable for delivering the composition in vivo.
  • the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture thereof.
  • conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be added.
  • the composition of the present invention may be formulated as an oral or parenteral formulation.
  • Oral formulations may include solid formulations and liquid formulations.
  • the solid preparation may be a tablet, a pill, a powder, a granule, a capsule, or a troche, and the solid preparation may be prepared by adding at least one excipient to the composition.
  • the excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or a mixture thereof.
  • the solid preparation may contain a lubricant, examples of which include magnesium stearate and talc.
  • the liquid formulation may be a suspension, a liquid formulation, an emulsion or a syrup. At this time, the liquid formulation may contain excipients such as wetting agents, sweetening agents, fragrances, preservatives, and the like.
  • the parenteral preparations may include injections, suppositories, powders for respiratory inhalation, aerosols for sprays, powders and creams.
  • the injection may include a sterilized aqueous solution, a non-aqueous solvent, a suspension solvent, an emulsion, and the like.
  • the non-aqueous solvent or suspension solvent vegetable oils such as propylene glycol, polyethylene glycol, and olive oil, or injectable esters such as ethyl oleate may be used.
  • the present invention provides a cosmetic composition for preventing or improving inflammatory skin diseases comprising IL-32 protein or a polynucleotide encoding the same as an active ingredient.
  • the IL-32 protein contained in the cosmetic composition according to the present invention or a polynucleotide encoding the same may have the characteristics as described above.
  • the IL-32 protein may be any one or more selected from the group consisting of IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ , and specifically IL-32 ⁇ .
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the cosmetic composition of the present invention may contain 0.1 to 50% by weight, specifically 1 to 10% by weight, of the IL-32 protein or a polynucleotide encoding it.
  • the cosmetic composition may be applied directly to the fractured portion for the purpose of preventing or improving inflammatory skin diseases.
  • the cosmetic composition may be formulated in a conventionally prepared cosmetic formulation.
  • the cosmetic composition may be formulated as a solution, suspension, emulsion, paste, gel, lotion, cream, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray.
  • it may be a flexible lotion, nutritional lotion, nutritional cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, or powder.
  • the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or And mixtures thereof.
  • the formulation of the cosmetic composition is a powder or spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or a mixture thereof may be included.
  • it may further include chlorofluorohydrocarbon, propane/butane, or dimethyl ether.
  • a solvent, a solvating agent, an emulsifying agent, or a mixture thereof may be included as a carrier.
  • a solvent, a solvating agent, an emulsifying agent, or a mixture thereof examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, sorbitan fatty acid ester, and the like.
  • the formulation of the cosmetic composition of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth, or mixtures thereof.
  • the formulation of the cosmetic composition is a surfactant containing cleansing, as a carrier, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid Amide ethersulfate, alkalamidobetaine, fatty alcohols, fatty acid glycerides, fatty diethanolamides, vegetable oils, lanolin derivatives, ethoxylated glycerol fatty acid esters or mixtures thereof.
  • the cosmetic composition of the present invention may contain an antioxidant, a stabilizer, a solubilizer, a moisturizing agent, a pigment, a fragrance, a sunscreen agent, a color developing agent, a surfactant, or a mixture thereof as an auxiliary agent.
  • the adjuvant can be used as long as it is a material commonly used in the manufacture of cosmetic compositions.
  • the present invention provides a skin external preparation for preventing or improving inflammatory skin diseases comprising IL-32 protein or a polynucleotide encoding the same as an active ingredient.
  • the IL-32 protein contained in the cosmetic composition according to the present invention or a polynucleotide encoding the same may have the characteristics as described above.
  • the IL-32 protein may be any one or more selected from the group consisting of IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ , and specifically IL-32 ⁇ .
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the external preparation for skin of the present invention may include a pharmaceutically acceptable carrier and excipient.
  • the carrier and excipient may include preservatives, stabilizers, wetting agents, emulsification accelerators and buffers.
  • the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone, or a mixture thereof.
  • the external preparation for skin may be appropriately prepared according to a method well known in the art.
  • the external preparation for skin may be prepared in the form of powder, gel, ointment, cream, liquid and aerosol.
  • the present invention provides a vector comprising a polynucleotide encoding the IL-32 protein or a pharmaceutical composition for the prevention or treatment of inflammatory skin diseases comprising cells containing the vector as an active ingredient.
  • the polynucleotide encoding the IL-32 protein may have the characteristics as described above.
  • the vector may include a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoter, start codon, stop codon, polyadenylation signal and enhancer, and may be prepared in various ways according to the purpose. have.
  • the vector must exhibit an action in an individual when a polynucleotide encoding a target protein including a start codon and a stop codon is inserted, and must be in frame with the coding sequence.
  • the cell containing the vector may be a non-human host cell.
  • the host cell may be transfected or transformed with a vector containing a polynucleotide encoding the IL-32 protein.
  • the host cell may include any cell as long as it can be used as a cell therapy agent in the art.
  • the transfection or transformation may be performed according to a method known in the art, and the method may be appropriately modified by a person skilled in the art.
  • the transfection or transformation method includes an electric shock gene transfer method (eletroporation), a protoplasm fusion method, a calcium phosphate (CaPO 4 ) precipitation method, and a calcium chloride (CaCl 2 ) precipitation method.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the pharmaceutical composition may have the characteristics as described above.
  • the present invention provides a vector comprising a polynucleotide encoding the IL-32 protein or a cosmetic composition for preventing or improving inflammatory skin diseases comprising cells containing the vector as an active ingredient.
  • the polynucleotide encoding the IL-32 protein included in the cosmetic composition according to the present invention may have the above-described characteristics.
  • the vector or a cell containing the vector may have the same characteristics as described above.
  • the vector may allow expression of a polynucleotide encoding a target protein including a start codon and a stop codon in an individual.
  • the cells may be cells transfected or transformed with the vector as described above.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the cosmetic composition may have the characteristics as described above.
  • the present invention provides a vector containing a polynucleotide encoding IL-32 protein or a skin external preparation for preventing or improving inflammatory skin diseases, including cells containing the vector as an active ingredient.
  • the polynucleotide encoding the IL-32 protein contained in the external preparation for skin according to the present invention may have the characteristics as described above.
  • the vector or a cell containing the vector may have the same characteristics as described above.
  • the vector may allow expression of a polynucleotide encoding a target protein including a start codon and a stop codon in an individual.
  • the cells may be cells transfected or transformed with the vector as described above.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the external preparation for skin may have the characteristics as described above.
  • the present invention provides a method for preventing, improving or treating inflammatory skin diseases comprising administering to an individual an IL-32 protein or a polynucleotide encoding the same.
  • the IL-32 protein or a polynucleotide encoding it used in the method for preventing, improving or treating inflammatory skin diseases according to the present invention may have the above-described characteristics.
  • the IL-32 protein may be any one or more selected from the group consisting of IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ , and specifically IL-32 ⁇ .
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the individual may be a mammal, and specifically, may be a human.
  • the administration may be oral or parenteral according to the desired method.
  • Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.
  • the administration may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, the severity, the activity of the drug, the patient's sensitivity to the drug, the administration time, the administration route, the treatment period, and the drugs used at the same time.
  • the active ingredient according to the present invention may be administered in an amount of 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg, and the administration may be once or several times a day.
  • administration may be performed alone or in combination with other therapeutic agents.
  • administration may be sequential or simultaneous.
  • the present invention provides the use of an IL-32 protein or a polynucleotide encoding the same for use in the manufacture of a medicament for the prevention or treatment of inflammatory skin disease.
  • the IL-32 protein or a polynucleotide encoding the IL-32 protein used in the manufacture of a medicament for the prevention or treatment of inflammatory skin diseases according to the present invention may have the above-described characteristics.
  • the IL-32 protein may be any one or more selected from the group consisting of IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ , IL-32 ⁇ and IL-32 ⁇ , and specifically IL-32 ⁇ . I can.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the present invention provides a vector comprising a polynucleotide encoding IL-32 protein or a method for preventing, improving or treating inflammatory skin diseases comprising administering the vector to an individual.
  • the polynucleotide encoding the IL-32 protein used in the method for preventing, improving or treating inflammatory skin diseases according to the present invention may have the above-described characteristics.
  • the vector or a cell containing the vector may have the same characteristics as described above.
  • the vector may allow expression of a polynucleotide encoding a target protein including a start codon and a stop codon in an individual.
  • the cells may be cells transfected or transformed with the vector as described above.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • the individual may be a mammal, and specifically, may be a human.
  • the method of preventing, improving, or treating inflammatory skin diseases may have the above-described characteristics.
  • the present invention provides a vector containing a polynucleotide encoding IL-32 protein or a use of the vector for use in the manufacture of a medicament for the prevention or treatment of inflammatory skin diseases.
  • the polynucleotide encoding the IL-32 protein may have the characteristics as described above.
  • the vector or a cell containing the vector may have the same characteristics as described above.
  • the vector may allow expression of a polynucleotide encoding a target protein including a start codon and a stop codon in an individual.
  • the cells may be cells transfected or transformed with the vector as described above.
  • the inflammatory skin disease may be atopic dermatitis, acne, psoriasis, inflammatory dermatitis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.
  • Interleukin-32 ⁇ (IL-32 ⁇ ) was applied to an animal model in which atopic dermatitis was induced, and it was confirmed whether or not the inflammation generated on the skin was improved.
  • the PA-coated mice had severe inflammation on the skin, whereas the experimental mice coated with the recombinant IL-32 ⁇ protein before PA application significantly alleviated the resulting inflammation (FIG. 2).
  • Example 1 the back skin of the experimental group mice coated with the recombinant IL-32 ⁇ protein was collected and fixed in 10% formalin. The fixed sample was embedded in paraffin, and it was sectioned to a thickness of 5 ⁇ m. The sectioned skin tissue was stained with H&E (hematoxylin & eosin) dye.
  • H&E hematoxylin & eosin
  • the epidermal thickness increased by the PA treatment was decreased by the recombinant IL-32 ⁇ protein (Fig. 4).
  • H&E dye instead of H&E dye, except for dyeing with toluidine blue dye, the skin tissue of the mouse was stained in the same manner and conditions as in Example 2, and the number of mast cells penetrating into the skin was confirmed.
  • ELISA enzyme-linked immunosorbent
  • T helper type 2 cytokines mainly involved in the immune response against atopic dermatitis. assay
  • the cytokine levels of IL-4, IL-13 and IgE increased by PA were decreased by the recombinant IL-32 ⁇ protein (FIG. 6).
  • IL-4, IL-13, and TSLP thymic stromal lymphopoietin
  • qRT-PCR quantitative real-time PCR
  • RNA was extracted from the back skin tissue of the mice in the experimental group coated with the recombinant IL-32 ⁇ protein in Example 1 using a riboEX RNA extraction kit (GeneAll Biotechnology, Korea) according to the manufacturer's protocol.
  • cDNA was synthesized using a high capacity RNA-to-cDNA kit (Applied biosystems, USA).
  • the expression result of mRNA was normalized through 18S and expressed as a value relative to the untreated control value.
  • a human keratinocyte line a HaCaT cell line
  • a DMEM medium containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 ⁇ g/ml streptomycin. Incubation was performed under conditions of 37°C and 5% CO 2 .
  • an expression vector expressing the recombinant IL-32 ⁇ protein was constructed by a conventional method using pcDNA3.1(+)-6xMyc plasmid.
  • the prepared HaCaT cell line was dispensed into a 6-well plate by a conventional method, and the prepared recombinant IL-32 ⁇ was prepared using a lipofectamine 3000 transfection reagent and an Opti-MEM reagent.
  • the expression vector expressing the protein was transfected.
  • the vector-transfected cells were treated with 20 ng/ml of TNF- ⁇ and IFN- ⁇ , respectively.
  • qRT-PCR was performed using this in the method and conditions described in Example 4-2, and the inflammatory cytokines TARC (thymus and activation regulated chemokine, CCL17), MDC (macrophage) were performed.
  • -derived chemokine, CCL22), TNF- ⁇ and IL-1 ⁇ expression changes were confirmed.
  • a cell line transfected with pcDNA3.1(+)-6xMyc plasmid was used as a control.
  • Example 6 Improvement of symptoms of atopic dermatitis by overexpression of interleukin-32 ⁇
  • IL-32 ⁇ -overexpressing mice were prepared with reference to the literature of Oh JH et al., Oncogene, 2011;30(30):3345-3359 (doi:10.1038/onc.2011.52).
  • the back of the prepared IL-32 ⁇ overexpressing mouse was depilated, and a mixture of 5%w/v of PA (phthalate anhydride) was applied to a solvent in which acetone and olive oil were mixed in a volume ratio of 4:1 on the epilated back skin. I did.
  • Application was performed 3 times a week for a total of 4 weeks. At this time, as a control group, a group treated with PA was used as an untreated control group and an untreated control group.
  • the degree of inflammation formed on the skin such as mice by treatment with the recombinant IL-32 ⁇ protein was visually observed and evaluated as none (0), slight (1), moderate (2), or severe (3).
  • a photograph of observing the degree of atopic dermatitis of the skin such as a mouse is shown in FIG. 9 and a graph of the result of evaluating the degree of inflammation is shown in FIG.
  • Example 6 Except for using the IL-32 ⁇ overexpressing mice coated with PA in Example 6, the change in the thickness of the epidermis of the mice was confirmed in the same conditions and methods as in Example 2. As a result, the results of H&E staining are shown in FIG. 11 and a graph of the results of measuring the skin thickness is shown in FIG.
  • Example 6 Except that the IL-32 ⁇ -overexpressing mouse coated with PA in Example 6 was used, the skin tissue of the mouse was stained in the same manner and conditions as in Example 3, and the number of mast cells penetrating into the skin was confirmed.
  • Experiments were carried out in the same manner and conditions as in Example 4-2 using the primers shown in Table 1, except that IL-32 ⁇ overexpressing mice coated with PA in Example 6 were used. As a result, the result of confirming the change in mRNA expression of cytokines is shown in Figs. 14 and 15.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Birds (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물에 관한 것이다. 구체적으로, 본 발명의 인터루킨-32 단백질은 아토피 피부염 동물모델에서 피부의 염증을 완화시키고, 피부 두께 및 비만세포의 증가를 억제하며, 염증성 사이토카인의 혈중 수준 및 발현을 억제하고, 피부각질세포에서도 염증성 사이토카인의 증가를 억제함으로써, 염증성 피부질환의 치료에 유용하게 사용될 수 있다.

Description

인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물
본 발명은 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물에 관한 것이다.
피부는 인체의 가장 외부에 존재하는 기관으로, 체내 수분을 보호하고 외부로부터 침입인자를 막아 인체를 보호하는 장벽역할을 한다. 피부에 염증을 일으키는 인자로는 물리화학적 자극, 알러젠(allergen), 자외선, 산화 스트레스, 병원균에 의한 감염 등이 있다. 피부 염증반응의 일반적인 경로는 외부 자극으로부터 인체를 보호하기 위한 면역반응으로, 염증반응 억제를 통한 염증의 조절이 염증성 피부질환의 주요 표적이 되고있다.
피부염증 병변에서 염증반응의 시작과 유지에는 피부 림프구 관련 항원을 발현하는 T 세포나 호산구 등과 같은 염증세포가 병변에 침윤하는 과정에서 발생하는 사이토카인 및 케모카인이 관여한다. 또한, 이와 관련된 수용체가 염증세포, 각질형성세포, 섬유아세포 등과 같은 세포에서 발현하는 것으로 알려져 있다.
현재 염증성 피부질환의 치료제로는 스테로이드 제제, 국소 면역억제제, 국소 항생제 및 항히스타민 등이 사용되고 있으나, 이를 장기로 사용하는 경우 살이 트는 팽창선조, 피부위축, 모세혈관 확장, 스테로이드성 여드름, 다모증, 자반 등의 부작용이 일어날 수 있다. 특히, 스테로이드제를 광범위한 부위에 바르면 피부를 통해 약제가 전신으로 흡수되어 소아의 성장을 방해할 수 있고, 성인은 골다공증과 같은 전신 부작용이 나타날 수 있다. 따라서, 부작용이 적으면서 효과적으로 염증성 피부질환을 치료하기 위한 물질의 개발이 연구되고 있으며, 대한민국 특허등록 제10-1847128호는 니파야자 꽃대 추출물이 지속적인 보습 효과를 제공하고, 부작용 없이 항염증 활성을 나타냄으로써 염증성 피부질환을 치료하는데 사용될 수 있음을 개시하고 있다.
이와 같은 염증성 피부질환의 하나인 아토피성 피부염은 유전적 및 환경적 요인에 의해 발생하며, 심한 가려움, 피부건조, 피부 병변 등의 증상을 동반한다. 아토피성 피부염에서 피부 장벽에 이상이 생기면 각질세포에서 다양한 염증성 사이토카인(inflammatory cytokine)을 발현되고, 그에 따라 2형 T 헬퍼(T helper type 2) 세포가 매개하는 염증반응을 유발한다. 2형 T 헬퍼세포는 인터루킨-4, 인터루킨-13 등을 분비하고, 이들에 의해 면역글로불린 E(immunoglobulin E, IgE)의 분비도 증가한다. 이후, 만성적인 상태에서는 다양한 T 세포가 피부에 침투되고 자가면역반응이 더해져서 영구적인 피부염증이 일어난다.
한편, 인터루킨-32(interleukin-32, IL-32) 단백질은 다양한 종류의 상피세포, T 림프구, NK 세포 및 단핵구와 같은 면역세포에 의해 생성되는 사이토카인이다. IL-32 단백질을 암호화하는 유전자는 인간의 염색체 16p13.3상에 위치하고 있으며, 상기 염색체는 전사후 6개의 선택적 스플라이싱 변이체(α, β, γ, δ, ε, ζ)를 생성한다.
본 발명의 목적은 인터루킨-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드의 염증성 피부질환의 예방, 개선 또는 치료 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 인터루킨-32(interleukin-32, IL-32) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물을 제공한다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제를 제공한다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물을 제공한다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제를 제공한다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법을 제공한다.
또한, 본 발명은 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드의 용도를 제공한다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법을 제공한다.
나아가, 본 발명은 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터의 용도를 제공한다.
본 발명의 인터루킨-32 단백질은 아토피 피부염 동물모델에서 피부의 염증을 완화시키고, 피부 두께 및 비만세포의 증가를 억제하며, 염증성 사이토카인의 혈중 수준 및 발현을 억제하고, 피부각질세포에서도 염증성 사이토카인의 증가를 억제함으로써, 염증성 피부질환의 치료에 유용하게 사용될 수 있다.
도 1은 본 발명의 일 실시예에 따라 마우스 동물모델 실험 계획을 보여주는 도면이다.
도 2는 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 피부 염증을 억제하는 것을 확인한 결과 도면이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 3은 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 피부 염증을 억제하는 것을 육안으로 관찰하여 평가한 결과 그래프이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 4는 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 표피두께의 증가를 억제하는 것을 H&E 염색법으로 확인한 결과 사진 및 그래프이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 5는 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 비만세포의 증가를 억제하는 것을 톨루이딘 블루(toluidine blue) 염색법으로 확인한 결과 사진 및 그래프이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 6은 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 염증성 사이토카인인 IL-4, IL-13 및 IgE의 증가를 억제하는 것을 ELISA 방법으로 확인한 결과 그래프이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 7은 본 발명의 일 실시예에서 아토피 피부염이 유발된 동물모델에서 재조합 IL-32γ 단백질이 염증성 사이토카인인 IL-4, IL-13 및 TSLP의 증가를 억제하는 것을 qRT-PCR 방법으로 확인한 결과 그래프이다(Con: 무처리 대조군, PA: PA 도포군, PA+rhIL-32γ: PA 도포 후, IL-32γ 단백질을 주사로 투여한 실험군).
도 8은 본 발명의 일 실시예에서 피부 각질세포에서 재조합 IL-32γ 단백질이 염증성 사이토카인인 TARC, MDC, TNF-α 및 IL-1β의 증가를 억제하는 것을 qRT-PCR 방법으로 확인한 결과 그래프이다.
도 9는 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 피부 염증이 개선되는 것을 확인한 결과 도면이다(WT: 야생형 마우스, IL-32γ: IL-32γ 과발현 마우스, Non: 무처리군, PA: PA 도포군).
도 10은 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 피부 염증이 개선되는 것을 관찰하여 임상 지표로 평가한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
도 11은 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 표피두께의 증가가 억제되는 것을 H&E 염색법으로 확인한 결과 사진이다(WT: 야생형 마우스, IL-32γ: IL-32γ 과발현 마우스, Non: 무처리군, PA: PA 도포군).
도 12는 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 표피두께의 증가가 억제되는 것을 H&E 염색법으로 확인한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
도 13은 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 비만세포의 증가가 억제되는 것을 톨루이딘 블루 염색법으로 확인한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
도 14는 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 2형 T 헬퍼 사이토카인의 증가가 억제되는 것을 qRT-PCR 방법으로 확인한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
도 15는 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 1형 및 17형 T 헬퍼 사이토카인의 증가가 억제되는 것을 qRT-PCR 방법으로 확인한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
도 16은 본 발명의 일 실시예에서 재조합 IL-32γ 단백질을 과발현하는 동물모델에 아토피 피부염을 유발시킨 뒤, 혈중에서 IL-4, IL-13, TNF-α, IL-1β 및 IgE 단백질의 증가가 억제되는 것을 ELISA 방법으로 확인한 결과 그래프이다(WT: 무처리 야생형 마우스, IL-32γ: 무처리 IL-32γ 과발현 마우스, WT+PA: PA 도포한 야생형 마우스, IL-32γ+PA: PA 도포한 IL-32γ 과발현 마우스).
이하, 본 발명을 상세히 설명한다.
본 발명은 인터루킨-32(interleukin-32, IL-32) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물을 제공한다.
본 명세서에서 사용된 용어, "인터루킨-32(interleukin-32, IL-32) 단백질"은 사이토카인 단백질 중의 하나로서, 약 14.9 내지 26.7 kDa의 분자량을 갖는다. 상기 IL-32 단백질은 인간 염색체 16p13.3에 위치하며 8개의 엑손(exon)으로 구성되고, 전사후 6개의 선택적 스플라이싱에 의해 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ가 생성된다.
따라서, 본 발명에 따른 IL-32 단백질은 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있다. 본 발명의 일 실시예에서, 상기 IL-32 단백질은 IL-32γ일 수 있다. 상기 IL-32γ는 통상의 기술분야에 잘 알려진 모든 아미노산 서열을 포함할 수 있고, 구체적으로, 상기 IL-32γ는 서열번호 17로 기재된 아미노산 서열로 구성되는 폴리펩티드일 수 있다.
상기 폴리펩티드는 단백질의 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환, 또는 이들의 조합에 의해 상이한 서열을 갖는 변이체 또는 단편을 포함할 수 있다. 분자의 활성을 전체적으로 변경시키지 않는 단백질 또는 펩티드에서의 아미노산 교환은 통상의 기술분야에 잘 알려져 있다. 따라서, 상기 폴리펩티드는 서열번호 17로 기재된 아미노산 서열로 구성되는 폴리펩티드와 70%, 80%, 90%, 95% 또는 97% 이상의 상동성을 가질 수 있다. 상기 폴리펩티드는 경우에 따라서 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylaton), 파네실화(farnesylation) 등으로 수식(modification)될 수 있다.
상기 폴리뉴클레오티드는 IL-32 단백질을 암호화하는 폴리뉴클레오티드 서열로 구성될 수 있다. 상기 폴리뉴클레오티드 서열은 IL-32 단백질의 아미노산 서열을 코딩하는 폴리뉴클레오티드 서열뿐만 아니라, 상기 폴리뉴클레오티드와 실질적으로 동일한 염기서열을 갖는 폴리뉴클레오티드 및 이의 단편을 포함한다. 실질적으로 동일한 염기서열을 갖는 폴리뉴클레오티드는 본 발명의 폴리뉴클레오티드와 80%, 90%, 95% 이상의 상동성을 가질 수 있다. 상술한 바와 같이, 본 발명의 폴리뉴클레오티드는 이와 동등한 활성을 갖는 단백질을 코딩하는 한, 하나 이상의 염기서열이 치환, 결실 또는 삽입된 변이체를 포함할 수 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있고, 구체적으로 아토피 피부염일 수 있다.
본 발명에 따른 약학적 조성물은 조성물 전체 중량에 대하여 유효성분인 인터루킨-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 약학적 조성물은 상기 유효성분 이외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 포함할 수 있다.
본 발명의 약학적 조성물은 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 이의 혼합물을 포함할 수 있다. 약학적으로 허용가능한 담체는 조성물을 생체 내에 전달하는데 적합한 것이면 모두 사용할 수 있다. 구체적으로, 상기 담체는 Merck Index, 13th ed., Merck & Co. Inc.에 기재된 화합물, 식염수, 멸균수, 링거액, 덱스트로스 용액, 말토덱스트린 용액, 글리세롤, 에탄올 또는 이의 혼합물일 수 있다. 또한, 필요에 따라 항산화제, 완충액, 정균제 등과 같은 통상의 첨가제를 첨가할 수 있다.
상기 조성물을 제제화하는 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 첨가할 수 있다.
본 발명의 조성물은 경구용 제제 또는 비경구용 제제로 제형화될 수 있다. 경구용 제제로는 고형 제제 및 액상 제제가 포함될 수 있다. 상기 고형 제제는 정제, 환제, 산제, 과립제, 캡슐제 또는 트로키제일 수 있고, 이러한 고형 제제는 상기 조성물에 적어도 하나 이상의 부형제를 첨가하여 조제할 수 있다. 상기 부형제는 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 또는 이의 혼합물일 수 있다. 또한, 상기 고형 제제는 윤활제를 포함할 수 있고, 그 예로는 마그네슘 스티레이트, 탈크등이 있다. 한편, 상기 액상 제제는 현탁제, 내용액제, 유제 또는 시럽제일 수 있다. 이때, 상기 액상 제제에는 습윤제, 감미제, 방향제, 보존제 등과 같은 부형제가 포함될 수 있다.
상기 비경구용 제제는 주사제, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 파우더 및 크림 등을 포함할 수 있다. 상기 주사제는 멸균된 수용액, 비수성용제, 현탁용제, 유제 등을 포함할 수 있다. 이때, 비수성용제 또는 현탁용제로서는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름이나, 에틸올레이트와 같이 주사가능한 에스테르 등이 사용될 수 있다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물을 제공한다.
본 발명에 따른 화장료 조성물에 포함되는 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 IL-32 단백질은 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있고, 구체적으로 IL-32γ일 수 있다. 또한, 상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
본 발명의 화장료 조성물은 상기 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 0.1 내지 50 중량%, 구체적으로 1 내지 10 중량%로 포함할 수 있다. 상기 화장료 조성물은 염증성 피부질환의 예방 또는 개선을 목적으로 파부에 직접 도포될 수 있다.
상기 화장표 조성물은 통상적으로 제조되는 화장료 제형으로 제제화될 수 있다. 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 로션, 크림, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있다. 구체적으로는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더일 수 있다.
본 발명의 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라가칸트, 셀룰로오스 유도체, 폴리에틸렌글리콜, 실리콘, 벤토나이트, 실리카, 탈크, 산화아연 또는 이의 혼합물을 포함할 수 있다. 또한, 상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 락토스, 탈크, 실리카, 알루미늄 하이드록시드, 칼슘 실리케이트, 폴리아미드 파우더 또는 이의 혼합물을 포함할 수 있다. 특히, 스프레이인 경우에는 추가로 클로로플루오로하이드로카본, 프로판/부탄 또는 디메틸에테르 등을 더 포함할 수 있다.
본 발명의 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체로서 용매, 용매화제, 유탁화제 또는 이의 혼합물을 포함할 수 있다. 이의 예로는, 물, 에탄올, 이소프로판올, 에틸카보네이트, 에틸아세테이트, 벤질알코올, 벤질벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜, 소르비탄 지방산 에스테르 등이 있다.
본 발명의 화장료 조성물의 제형이 현탁액인 경우에는 담체로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미세결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가, 트라가칸트 또는 이의 혼합물을 포함할 수 있다. 또한, 상기 화장료 조성물의 제형이 계면활성제 함유 클렌징인 경우에는 담체로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르설페이트, 알칼아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체, 에톡실화 글리세롤 지방산 에스테르 또는 이의 혼합물을 포함할 수 있다.
본 발명의 화장료 조성물은 담체 성분 이외에도, 보조제로서 항산화제, 안정화제, 용해화제, 보습제, 안료, 향료, 자외선 차단제, 발색제, 계면활성제 또는 이의 혼합물을 포함할 수 있다. 상기 보조제는 화장료 조성물의 제조에 통상적으로 사용되는 물질이라면 모두 사용가능하다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제를 제공한다.
본 발명에 따른 화장료 조성물에 포함되는 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 IL-32 단백질은 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있고, 구체적으로 IL-32γ일 수 있다. 또한, 상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
본 발명의 피부외용제는 약학적으로 허용가능한 담체 및 부형제를 포함할 수 있다. 상기 담체 및 부형제는 방부제, 안정화제, 수화제, 유화 촉진제 및 완충제 등을 포함할 수 있다. 구체적으로, 상기 부형제는 유당, 덱스트린, 전분, 만니톨, 소르비톨, 글루코스, 사카로스, 미세결정 셀룰로스, 젤라틴, 폴리비닐피롤리돈 또는 이의 혼합물일 수 있다. 상기 피부외용제는 당업계에 잘 알려진 방법에 따라 적절히 제조될 수 있다. 상기 피부외용제는 파우더, 젤, 연고, 크림, 액체 및 에어로졸의 형태로 제조될 수 있다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물을 제공한다.
상기 IL-32 단백질을 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다.
상기 벡터는 프로모터, 개시코돈, 종결코돈, 폴리아데닐화 신호 및 인핸서 같은 발현조절 요소(element) 외에도 막 표적화 또는 분비를 위한 신호서열 또는 리더서열을 포함할 수 있고, 목적에 따라 다양하게 제조될 수 있다. 상기 벡터는 개시코돈 및 종결코돈을 포함하는 표적 단백질을 암호화하는 폴리뉴클레오티드가 삽입되었을 때 개체에서 반드시 작용을 나타내야 하며, 암호화 서열과 인프레임(in frame)에 있어야 한다.
한편, 상기 벡터를 포함하는 세포는 비-인간 숙주세포일 수 있다. 상기 숙주세포는 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터로 형질감염 또는 형질전환된 것일 수 있다. 구체적으로, 상기 숙주세포는 통상의 기술분야에서 세포치료제로서 사용될 수 있는 세포라면 어떤 세포라도 포함할 수 있다.
상기 형질감염 또는 형질전환은 통상의 기술분야에 알려진 방법에 따라 수행될 수 있고, 상기 방법은 통상의 기술자에 의해 적절히 변형될 수 있다. 일례로, 상기 형질감염 또는 형질전환 방법은 전기충격 유전자 전달법(eletroporation), 원형질 융합법, 인산칼슘(CaPO 4) 침전법 및 염화칼슘(CaCl 2) 침전법 등이 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
상기 약학적 조성물은 상술한 바와 같은 특징을 가질 수 있다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물을 제공한다.
본 발명에 따른 화장료 조성물에 포함되는 IL-32 단백질을 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 벡터 또는 상기 벡터를 포함하는 세포도 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 벡터는 개시코돈 및 종결코돈을 포함하는 표적 단백질을 암호화하는 폴리뉴클레오티드가 개체에서 발현되게 할 수 있다. 또한, 상기 세포는 상술한 바와 같은 벡터가 형질감염 또는 형질전환된 세포일 수 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
또한, 상기 화장료 조성물은 상술한 바와 같은 특징을 가질 수 있다.
나아가, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제를 제공한다.
본 발명에 따른 피부외용제에 포함되는 IL-32 단백질을 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 벡터 또는 상기 벡터를 포함하는 세포도 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 벡터는 개시코돈 및 종결코돈을 포함하는 표적 단백질을 암호화하는 폴리뉴클레오티드가 개체에서 발현되게 할 수 있다. 또한, 상기 세포는 상술한 바와 같은 벡터가 형질감염 또는 형질전환된 세포일 수 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
또한, 상기 피부외용제는 상술한 바와 같은 특징을 가질 수 있다.
또한, 본 발명은 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법을 제공한다.
본 발명에 따른 염증성 피부질환 예방, 개선 또는 치료방법에 사용되는 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 IL-32 단백질은 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있고, 구체적으로 IL-32γ일 수 있다. 또한, 상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
상기 개체는 포유동물일 수 있고, 구체적으로 인간일 수 있다.
상기 투여는 목적하는 방법에 따라 경구 또는 비경구 투여일 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다. 또한, 상기 투여는 약학적으로 유효한 양으로 투여될 수 있다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 환자의 민감도, 투여 시간, 투여 경로, 치료기간, 동시에 사용되는 약물 등에 따라 달라질 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 유효성분은 0.0001 내지 1,000 ㎎/㎏, 구체적으로 0.001 내지 500 ㎎/㎏의 양으로 투여될 수 있고, 상기 투여는 하루에 1회 또는 수회일 수 있다.
또한, 상기 투여는 단독 또는 다른 치료제와 병용하여 수행될 수 있다. 병용 투여시, 투여는 순차적 또는 동시일 수 있다.
또한, 본 발명은 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드의 용도를 제공한다.
본 발명에 따른 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용되는 IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 IL-32 단백질은 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있고, 구체적으로 IL-32γ일 수 있다. 또한, 상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
또한, 본 발명은 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법을 제공한다.
본 발명에 따른 염증성 피부질환 예방, 개선 또는 치료방법에 사용되는 IL-32 단백질을 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 벡터 또는 상기 벡터를 포함하는 세포도 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 벡터는 개시코돈 및 종결코돈을 포함하는 표적 단백질을 암호화하는 폴리뉴클레오티드가 개체에서 발현되게 할 수 있다. 또한, 상기 세포는 상술한 바와 같은 벡터가 형질감염 또는 형질전환된 세포일 수 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
상기 개체는 포유동물일 수 있고, 구체적으로 인간일 수 있다. 상기 염증성 피부질환의 예방, 개선 또는 치료방법은 상술한 바와 같은 특징을 가질 수 있다.
나아가, 본 발명은 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터의 용도를 제공한다.
상기 IL-32 단백질을 암호화하는 폴리뉴클레오티드는 상술한 바와 같은 특징을 가질 수 있다. 또한, 상기 벡터 또는 상기 벡터를 포함하는 세포도 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 벡터는 개시코돈 및 종결코돈을 포함하는 표적 단백질을 암호화하는 폴리뉴클레오티드가 개체에서 발현되게 할 수 있다. 또한, 상기 세포는 상술한 바와 같은 벡터가 형질감염 또는 형질전환된 세포일 수 있다.
상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기일 수 있다.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다, 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 이들에 의해 본 발명이 제한되는 것은 아니다. 본 발명의 청구범위에 기재된 기술적 사상과 실질적으로 동일한 구성을 갖고 동일한 작용 효과를 이루는 것은 어떠한 것이라도 본 발명의 기술적 범위에 포함된다.
실시예 1. 인터루킨-32γ의 아토피 피부염 증상 개선 확인
아토피 피부염이 유발된 동물모델에 인터루킨-32γ(IL-32γ)를 도포하여, 피부에 생성된 염증이 개선되는지 여부를 확인하였다.
먼저, 8주령의 C57BL/C 마우스(대한바이오링크사, 한국)의 등을 제모하고, 제모된 등 피부에 아세톤 및 올리브 오일이 4:1의 부피비로 혼합된 용매에 5% w/v의 PA(phthalate anhydride)를 혼합한 혼합물을 도포하였다. 도포는 주 3회씩 총 4주 동안 수행하였다. 한편, PA 도포 3주차부터 4주 동안 실험군 마우스에는 재조합 IL-32γ 단백질(YBDY 테크놀로지사, 한국)을 피하주사하였다. 재조합 IL-32γ 단백질은 PA 도포 3시간 전에 마우스 당 1 ㎍의 양으로 투여되었다(도 1). 이때, 대조군으로서는 아무것도 처리하지 않은 무처리 대조군 및 PA만 도포한 PA 도포군을 사용하였다. 재조합 IL-32γ 단백질의 처리에 의한 마우스 등 피부에 형성된 염증의 정도를 육안으로 관찰하여 없음(0), 약간(1), 중간(2) 또는 심함(3)으로 평가하였다. 그 결과, 마우스 등 피부의 아토피 피부염 정도를 관찰한 사진을 도 2에, 염증의 정도를 평가한 결과 그래프를 도 3에 나타내었다.
도 2에 나타난 바와 같이, PA 도포군인 마우스는 피부에 염증이 심하게 생성된 반면, PA 도포전에 재조합 IL-32γ 단백질을 도포한 실험군 마우스에서는 생성된 염증이 현저히 완화되었다(도 2). 또한, 염증의 정도를 평가한 그래프에서도 동일하게 나타났다(도 3).
실시예 2. 인터루킨-32γ에 의한 표피두께 변화 확인
실시예 1에서 재조합 IL-32γ 단백질을 도포한 실험군 마우스의 등 피부를 채취하여 10% 포르말린에 고정하였다. 고정된 샘플을 파라핀에 포매하고, 이를 5 ㎛의 두께로 절편화하였다. 절편화된 피부 조직을 H&E(hematoxylin & eosin) 염색약으로 염색하였다.
그 결과, 도 4에 나타난 바와 같이, PA 처리에 의해 증가한 표피두께가 재조합 IL-32γ 단백질에 의해 감소하였다(도 4).
실시예 3. 인터루킨-32γ에 의한 비만세포 수 변화 확인
H&E 염색약 대신, 톨루이딘 블루(toluidine blue) 염색약으로 염색한 것을 제외하고는, 상기 실시예 2와 동일한 방법 및 조건으로 마우스의 피부 조직을 염색하여 피부로 침투한 비만세포의 수를 확인하였다.
그 결과, 도 5에 나타난 바와 같이, PA 처리에 의해 증가한 비만세포의 수가 재조합 IL-32γ 단백질에 의해 감소하였다(도 5).
실시예 4. 인터루킨-32γ에 의한 사이토카인 발현 변화 확인
4-1. 사이토카인 단백질의 수준 변화 확인
아토피 피부염에 대한 면역반응에 주로 관여하는 2형 T 헬퍼(T helper type 2) 사이토카인인 IL-4, IL-13 및 IgE의 재조합 IL-32γ 단백질에 의한 혈중 수준 변화를 ELISA(enzyme-linked immunosorbent assay) 방법으로 확인하였다.
구체적으로, 실시예 1에서 재조합 인터루킨-32γ 단백질을 도포한 실험군 마우스로부터 혈액을 채취하고, 혈청을 분리하였다. 분리된 혈청을 이용하여 IL-4, IL-13 및 IgE의 발현 수준을 각 사이토카인에 대한 ELISA 키트(고마바이오테크사, 한국)를 이용하여 제조사의 프로토콜에 따라 측정하고, 측정된 결과를 도 6에 나타내었다.
도 6에 나타난 바와 같이, PA에 의해 증가된 IL-4, IL-13 및 IgE의 사이토카인 수준이 재조합 IL-32γ 단백질에 의해 감소하였다(도 6).
4-2. 사이토카인 mRNA의 발현 변화 확인
아토피 피부염에 대한 면역반응에 주로 관여하는 2형 T 헬퍼 사이토카인인 IL-4, IL-13 및 TSLP(thymic stromal lymphopoietin)의 mRNA 발현 변화를 qRT-PCR(quantitative real-time PCR) 방법으로 확인하였다.
실시예 1에서 재조합 IL-32γ 단백질을 도포한 실험군 마우스의 등 피부 조직으로부터 리보EX RNA 추출 키트(riboEX RNA extraction kit, GeneAll Biotechnology, 한국)를 사용하여 제조사의 프로토콜에 따라 RNA를 추출하였다. 추출된 RNA를 주형으로 하이 카파시티 RNA-투-cDNA 키트(high capacity RNA-to-cDNA kit, Applied biosystems, 미국)를 이용하여 cDNA를 합성하였다. 합성된 cDNA를 주형으로하고, 하기 표 1에 기재된 프라이머를 사용하여 통상적인 방법으로 qPCR을 수행함으로써 IL-4, IL-13 및 TSLP의 mRNA 발현 변화를 확인하였다. mRNA의 발현 결과는 18S를 통해 정규화(normalize)하였고, 무처리 대조군 값에 대해 상대적인 값으로 나타내었다.
프라이머 서열 서열번호
18S forward(5'→3') AGGAATTGACGGAAGGGCACCA 서열번호 1
18S reverse(3'→5') GTGCAGCCCCGGACATCTAAG 서열번호 2
TSLP forward(5'→3') ACGGATGGGGCTAACTTACAA 서열번호 3
TSLP reverse(3'→5') AGTCCTCGATTTGCTCGAACT 서열번호 4
IL-4 forward(5'→3') GGTCTCAACCCCCAGCTAGT 서열번호 5
IL-4 reverse(3'→5') GCCGATGATCTCTCTCAAGTGAT 서열번호 6
IL-13 forward(5'→3') CCTGGCTCTTGCTTGCCTT 서열번호 7
IL-13 reverse(3'→5') GGTCTTGTGTGATGTTGCTCA 서열번호 8
TARC forward(5'→3') GTCTTGAAGCCTCCTCACCC 서열번호 9
TARC reverse(3'→5') GGATCTCCCTCACTGTGGCT 서열번호 10
MDC forward(5'→3') GTTGTCCTCGTCCTCCTTGC 서열번호 11
MDC reverse(3'→5') GGAGTCTGAGGTCCAGTAGAAGTG 서열번호 12
TNF-α forward(5'→3') CCTCTCTCTAATCAGCCCTCTG 서열번호 13
TNF-α reverse(3'→5') GAGGACCTGGGAGTAGATGAG 서열번호 14
IL-1β forward(5'→3') CGAGGCACAAGGCACAAC 서열번호 15
IL-1β reverse(3'→5') GCCACTGTAATAAGCCATCATTT 서열번호 16
IL-5 forward(5'→3') CACCGAGCTCTGTTGACAAGC 서열번호 17
IL-5 reverse(3'→5') GAGTAGGGACAGGAAGCCTCATC 서열번호 18
IL-31 forward(5'→3') CACACAGGAACAACGAAGCC 서열번호 19
IL-31 reverse(3'→5') CGATATTGGGGCACCGAAG 서열번호 20
IL-33 forward(5'→3') TCCAACTCCAAGATTTCCCCG 서열번호 21
IL-33 reverse(3'→5') CATGCAGTAGACATGGCAGAA 서열번호 22
IL-6 forward(5'→3') GAGGATACCACTCCCAACAGACC 서열번호 23
IL-6 reverse(3'→5') AAGTGCATCATCGTTGTTCATACA 서열번호 24
IL-17A forward(5'→3') TTTAACTCCCTTGGCGCAAAA 서열번호 25
IL-17A reverse(3'→5') CTTTCCCTCCGCATTGACAC 서열번호 26
그 결과, 도 7에 나타난 바와 같이, PA에 의해 증가된 IL-4, IL-13 및 TSLP의 mRNA 발현이 재조합 IL-32γ 단백질에 의해 감소하였다(도 6).
실시예 5. 피부 각질세포에서의 사이토카인 발현 변화 확인
재조합 IL-32γ 단백질이 피부 각질세포에서도 염증성 사이토카인의 발현을 조절하는지 다음과 같은 실험을 통해 확인하였다.
먼저, 사람의 각질세포주인 HaCaT 세포주를 10% 소태아혈청(fetal bovine serum), 100 units/㎖의 페니실린 및 100 ㎍/㎖의 스트렙토마이신을 포함하는 DMEM 배지로 배양하여 준비하였다. 배양은 37℃, 5% CO 2 조건하에서 수행되었다. 한편, 재조합 IL-32γ 단백질을 발현하는 발현벡터를 pcDNA3.1(+)-6xMyc 플라스미드를 사용하여 통상적인 방법으로 제작하였다. 준비된 HaCaT 세포주를 통상적인 방법으로 6웰 플레이트에 분주하고, 리포펙타민 3000 트랜스펙션 리에이전트(lipofectamine 3000 transfection reagent) 및 옵티-MEM(opti-MEM) 시약을 이용하여 상기 제작된 재조합 IL-32γ 단백질을 발현하는 발현벡터를 형질감염(transfection)시켰다. 다음날, 벡터가 형질감염된 세포에 20 ng/㎖의 TNF-α 및 IFN-γ를 각각 처리하였다. 4시간 후, 6웰 플레이트에서 세포만을 취하고, 이를 이용하여 실시예 4-2에 기재된 방법 및 조건으로 qRT-PCR을 수행하여 염증성 사이토카인인 TARC(thymus and activation regulated chemokine, CCL17), MDC(macrophage-derived chemokine, CCL22), TNF-α 및 IL-1β의 발현 변화를 확인하였다. 이때, 대조군으로서는 pcDNA3.1(+)-6xMyc 플라스미드를 형질감염시킨 세포주를 사용하였다.
그 결과, 도 8에 나타난 바와 같이, 염증유도물질인 TNF-α 및 IFN-γ에 의해 증가된 TARC, MDC, TNF-α 및 IL-1β의 mRNA 발현이 재조합 IL-32γ 단백질에 의해 감소하였다(도 8).
실시예 6. 인터루킨-32γ 과발현에 의한 아토피 피부염 증상 개선 확인
아토피 피부염이 유발된 동물모델에 IL-32γ를 과발현시키면 피부에 생성된 염증이 개선되는지 여부를 확인하였다.
먼저, IL-32γ 과발현 마우스를 Oh JH 외, Oncogene, 2011;30(30):3345-3359(doi:10.1038/onc.2011.52)의 문헌을 참조하여 제조하였다. 제조된 IL-32γ 과발현 마우스의 등을 제모하고, 제모된 등 피부에 아세톤 및 올리브 오일이 4:1의 부피비로 혼합된 용매에 5%w/v의 PA(phthalate anhydride)를 혼합한 혼합물을 도포하였다. 도포는 주 3회씩 총 4주 동안 수행하였다. 이때, 대조군으로서는 무처리 대조군 및 무처리 대조군에 PA를 처리한 군을 사용하였다. 재조합 IL-32γ 단백질의 처리에 의한 마우스 등 피부에 형성된 염증의 정도를 육안으로 관찰하여 없음(0), 약간(1), 중간(2) 또는 심함(3)으로 평가하였다. 그 결과, 마우스 등 피부의 아토피 피부염 정도를 관찰한 사진을 도 9에, 염증의 정도를 평가한 결과 그래프를 도 10에 나타내었다.
도 9에 나타난 바와 같이, PA 도포에 의해 생성된 피부 염증이 과발현된 IL-32γ에 의해 완화되었고(도 9), 이는 염증의 정도를 평가한 결과 그래프에서도 동일하게 나타났다(도 10).
실시예 7. 인터루킨-32γ 과발현에 의한 표피두께 변화 확인
실시예 6에서 PA를 도포한 IL-32γ 과발현 마우스를 사용한 것을 제외하고는, 실시예 2와 동일한 조건 및 방법으로 마우스의 표피두께 변화를 확인하였다. 그 결과, H&E 염색 결과를 도 11에, 표피두께를 측정한 결과 그래프를 도 12에 나타내었다.
도 11 및 12에 나타난 바와 같이, PA 도포에 의해 증가한 표피두께가 과발현된 IL-32γ에 의해 완화되었다(도 11 및 12).
실시예 8. 인터루킨-32γ 과발현에 의한 비만세포 수 변화 확인
실시예 6에서 PA를 도포한 IL-32γ 과발현 마우스를 사용한 것을 제외하고는, 실시예 3과 동일한 방법 및 조건으로 마우스의 피부 조직을 염색하여 피부로 침투한 비만세포의 수를 확인하였다.
그 결과, 도 13에 나타난 바와 같이, PA 도포에 의해 증가한 비만세포의 수가 과발현된 IL-32γ에 의해 감소하였다(도 13).
실시예 9. 인터루킨-32γ 과발현에 의한 사이토카인 발현 변화 확인
9-1. 사이토카인 mRNA의 발현 변화 확인
2형 T 헬퍼 사이토카인인 IL-4, IL-5, IL-13, IL-31 및 IL-33, TSLP와 1형 및 17형 T 헬퍼 사이토카인인 TNF-α, IL-1β, IL-6 및 IL-17A의 mRNA 발현 변화를 qRT-PCR 방법으로 확인하였다. 실험은 실시예 6에서 PA를 도포한 IL-32γ 과발현 마우스를 사용한 것을 제외하고는, 상기 표 1에 기재된 프라이머를 사용하여 실시예 4-2와 동일한 방법 및 조건으로 수행되었다. 그 결과, 사이토카인의 mRNA 발현 변화를 확인한 결과 그래프를 도 14 및 15에 나타내었다.
도 14 및 15에 나타난 바와 같이, PA 도포에 의해 증가한 2형, 1형 및 17형 T 헬퍼 사이토카인의 mRNA 발현이 과발현된 IL-32γ에 의해 유의적으로 감소하였다(도 14 및 15).
9-2. 사이토카인 단백질의 수준 변화 확인
마우스의 혈청에서 2형 T 헬퍼 사이토카인인 IL-4 및 IL-13과 1형 T 헬퍼 사이토카인인 TNF-α 및 IL-1β 단백질의 혈중 수준 변화를 혈중 IgE의 수준 변화와 함께 ELISA 방법으로 확인하였다. 실험은 실시예 6에서 PA를 도포한 IL-32γ 과발현 마우스를 사용한 것을 제외하고는, 실시예 4-1과 동일한 방법 및 조건으로 수행되었다. 그 결과, 사이토카인 단백질 및 혈중 IgE의 수준 변화를 확인한 결과 그래프를 도 16에 나타내었다.
도 16에 나타난 바와 같이, PA 도포에 의해 증가한 IL-4, IL-13, TNF-α, IL-1β 및 IgE의 수준이 과발현된 IL-32γ에 의해 유의적으로 감소하였다(도 16).

Claims (13)

  1. 인터루킨-32(interleukin-32, IL-32) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 IL-32는 IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε 및 IL-32ζ로 구성된 군으로부터 선택되는 어느 하나 이상인, 염증성 피부질환 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 상기 IL-32는 IL-32γ이고, 상기 IL-32γ는 서열번호 17로 기재된 아미노산 서열로 구성되는 폴리펩티드인, 염증성 피부질환 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서, 상기 염증성 피부질환은 아토피 피부염, 여드름, 건선, 염증성 피부염, 지루성 피부염, 접촉 피부염, 홍반성 루프스 또는 구진상 두드러기인, 염증성 피부질환 예방 또는 치료용 약학적 조성물.
  5. IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물.
  6. IL-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제.
  7. IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물.
  8. IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 화장료 조성물.
  9. IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 포함하는 세포를 유효성분으로 포함하는 염증성 피부질환 예방 또는 개선용 피부외용제.
  10. 인터루킨-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법.
  11. 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 인터루킨-32 단백질 또는 이를 암호화하는 폴리뉴클레오티드의 용도.
  12. IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터를 개체에 투여하는 단계를 포함하는 염증성 피부질환 예방, 개선 또는 치료방법.
  13. 염증성 피부질환의 예방 또는 치료를 위한 약제의 제조에 사용하기 위한 IL-32 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터 또는 상기 벡터의 용도.
PCT/KR2020/095041 2019-07-01 2020-03-18 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물 WO2021002739A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190078609A KR102230371B1 (ko) 2019-07-01 2019-07-01 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물
KR10-2019-0078609 2019-07-01

Publications (1)

Publication Number Publication Date
WO2021002739A1 true WO2021002739A1 (ko) 2021-01-07

Family

ID=74100933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/095041 WO2021002739A1 (ko) 2019-07-01 2020-03-18 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR102230371B1 (ko)
WO (1) WO2021002739A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110132735A (ko) * 2010-06-03 2011-12-09 건국대학교 산학협력단 인터페론-감마를 저해하는 새로운 인터루킨-32, 그의 유전자, 그의 염기 서열 그리고 그들의 제조방법
KR20160106952A (ko) * 2015-03-03 2016-09-13 충북대학교 산학협력단 IFN-γ 및 IL-32γ를 유효성분으로 포함하는 항암용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101847128B1 (ko) 2016-11-16 2018-04-12 농업회사법인주식회사니파바이오 니파야자 꽃대의 추출물을 함유하는 염증성 피부질환 개선용 화장료 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110132735A (ko) * 2010-06-03 2011-12-09 건국대학교 산학협력단 인터페론-감마를 저해하는 새로운 인터루킨-32, 그의 유전자, 그의 염기 서열 그리고 그들의 제조방법
KR20160106952A (ko) * 2015-03-03 2016-09-13 충북대학교 산학협력단 IFN-γ 및 IL-32γ를 유효성분으로 포함하는 항암용 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BO-RAM BANG, HYOUK-SOO KWON, SOO-HYUN KIM, SUN-YOUNG YOON, JI-DA CHOI, GYONG HWA HONG, SUNJOO PARK, TAE-BUM KIM, HEE-BOM MOON, YOU: "Interleukin-32γ Suppresses Allergic Airway Inflammation in Mouse Models of Asthma", AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY., AMERICAN LUNG ASSOCIATION, NEW YORK, NY, US, vol. 50, no. 6, 1 June 2014 (2014-06-01), NEW YORK, NY, US, pages 1021 - 1030, XP055771230, ISSN: 1044-1549, DOI: 10.1165/rcmb.2013-0234OC *
LEE YONG SUN; HAN SANG-BAE; HAM HYEON JOO; PARK JU HO; LEE JONG SUNG; HWANG DAE YEON; JUNG YOUNG SUK; YOON DO YOUNG; HONG JIN TAE: "IL-32γ suppressed atopic dermatitis through inhibition of miR-205 expression via inactivation of nuclear factor-kappa B", JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 146, no. 1, 10 January 2020 (2020-01-10), AMSTERDAM, NL, pages 156 - 168, XP086207320, ISSN: 0091-6749, DOI: 10.1016/j.jaci.2019.12.905 *
RODRIGO SAAR GOMES, MURIEL VILELA TEODORO SILVA, JÉSSICA CRISTINA DOS SANTOS, LUCAS LUIZ DE LIMA SILVA, ALINE CARVALHO BATISTA, JU: "IL-32γ promotes the healing of murine cutaneous lesions caused by Leishmania braziliensis infection in contrast to Leishmania amazonensis", PARASITES & VECTORS, vol. 10, no. 1, 1 December 2017 (2017-12-01), XP055771239, DOI: 10.1186/s13071-017-2268-4 *
TONG XIN, MO CHEN, LIWEI DUAN, YANLING XU, PENG GAO: "Interleukin-32: its role in asthma and potential as a therapeutic agent", RESPIRATORY RESEARCH, vol. 19, no. 1, 1 December 2018 (2018-12-01), XP055771244, DOI: 10.1186/s12931-018-0832-x *

Also Published As

Publication number Publication date
KR102230371B1 (ko) 2021-03-22
KR20210002835A (ko) 2021-01-11

Similar Documents

Publication Publication Date Title
WO2019103203A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2021033829A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2020171285A1 (ko) 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
WO2018070829A1 (en) Expression cassette for preparing copper peptide and use thereof
WO2019103541A1 (ko) 그래핀 나노구조체를 포함하는 항염증용 조성물
WO2020085698A2 (ko) 낙지 방어단백질로부터 유도된 항균 펩타이드 또는 이의 단편, 및 이를 포함하는 항균 조성물
WO2021002739A1 (ko) 인터루킨-32 단백질을 유효성분으로 포함하는 염증성 피부질환 예방 또는 치료용 약학적 조성물
WO2017119756A1 (ko) 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
WO2023055007A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2020159191A1 (ko) Mls-stat3를 포함하는 면역질환의 예방 또는 치료용 조성물
WO2020116810A1 (ko) Ｆａｓ 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물
WO2013042811A1 (ko) 카페오일알파네오엔돌핀 펩타이드 유도체 및 이의 항가려움 및 항아토피 소재로의 활용
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2022131820A1 (ko) 아토피 피부염 예방 또는 치료용 항염증 펩타이드
WO2023054817A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2019143145A1 (ko) 레졸빈 d2를 유효성분으로 함유하는 피부 염증 치료용 조성물
WO2022050634A1 (ko) 펩타이드 및 이를 포함하는 화장료 조성물 및 약학 조성물
WO2020138674A1 (ko) 근육 이완용 조성물
WO2020241925A1 (ko) 세포투과성 물질이 융합된 앱타이드가 포집된 지질 나노 입자 복합체 및 이의 용도
WO2014038882A1 (ko) 신규 화합물 및 이의 인터루킨-1베타 또는 인터루킨-6 저해 용도
WO2021256751A1 (ko) 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
WO2021251790A1 (ko) 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도
WO2021045520A1 (ko) 섬유아세포 성장 인자 17을 포함하는 화장료 조성물
WO2017105081A1 (ko) 폐질환 치료용 또는 증상완화용 약학조성물
WO2021107381A1 (ko) 페룰산 및 이의 유사체를 포함하는 유전자 돌연변이에 의한 피부질환 예방 및 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20835607

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20835607

Country of ref document: EP

Kind code of ref document: A1