WO2018070829A1

WO2018070829A1 - Expression cassette for preparing copper peptide and use thereof

Info

Publication number: WO2018070829A1
Application number: PCT/KR2017/011316
Authority: WO
Inventors: Byung Jo Yu
Original assignee: Korea Institute Of Industrial Technology
Priority date: 2016-10-14
Filing date: 2017-10-13
Publication date: 2018-04-19
Also published as: TWI656212B; TW201823462A; KR101766876B1

Abstract

The present invention relates to an expression cassette for preparing a copper peptide and use thereof, and more specifically, to an expression cassette for preparing a copper peptide comprising a polynucleotide sequence encoding a peptide in which Gly-His-Lys monomers are repeated a plurality of times, an expression vector comprising the expression cassette, a transformant comprising the expression vector, a method for preparing a copper peptide using the transformant, a copper peptide prepared by the method, a pharmaceutical composition, a cosmetic composition, and a quasi-drug composition for preventing hair loss or promoting hair growth comprising the copper peptide. A copper peptide with high purity can be prepared on a large scale at low cost using the expression cassette, expression vector, and transformant containing the copper peptide of the present invention. Additionally, the copper peptide prepared according to the present invention has excellent effects of preventing hair loss and promoting hair growth, and thus can be widely used in industries as materials for cosmetics, quasi-drugs, and pharmaceuticals preventing hair loss and promoting hair growth.

Description

EXPRESSION CASSETTE FOR PREPARING COPPER PEPTIDE AND USE THEREOF

The present invention relates to an expression cassette for preparing a copper peptide and use thereof, and specifically, to an expression cassette for preparing a copper peptide including a polynucleotide sequence encoding a peptide in which Gly-His-Lys monomers are repeated a plurality of times; an expression vector including the expression cassette; a transformant including the expression vector; a method for preparing a copper peptide using the transformant; and a pharmaceutical composition, a cosmetic composition, and a quasi-drug composition for preventing hair loss or promoting hair growth.

Copper peptides are peptides present in the blood plasma of the human body, and are known as peptides having a role in restoring wounded skin by rapid regeneration upon occurrence of a wound in the skin. Copper peptides consist of three amino acids (i.e., glycine, histidine, and lysine) to which copper ions are bound, thereby exhibiting activity.

Recently, it was confirmed that copper peptides have an important role in the synthesis of collagen and elastin, which are the most important components in the dermal layer of the skin, and promote proliferative expansion and cell division of scalp and hair follicle cells. Accordingly, they are contained in hair products including various skin care products and shampoos for use.

Additionally, copper peptides have been reported to have various effects such as stem cell activation, treatment of skin ulcers in diabetic patients, treatment of gastric ulcers, enhancing the functions of digestive organs, anticancer activity, etc. Therefore, studies to develop a technique for the safe and large-scale production of these copper peptides are underway.

At present, copper peptides are mainly produced by chemical synthesis. For example, a method of chemical synthesis of copper peptides is disclosed in International Patent Publication No.　WO 2012/166810. Since copper peptides are in the form of a complex where three short amino acids and copper are bound together, they are mostly prepared by a chemical synthesis method. However, since the copper peptides are materials used in the human body, various toxic substances used during the chemical synthesis process may be incorporated into the copper peptides, and thus the chemical synthesis method requires a high-purity separation/purification process. Therefore, there is a continuing need to develop a technology capable of large-scale preparation of high-purity copper peptides by a safe bioprocess using a yeast fermentation process instead of chemical synthesis.

The present inventors have made many efforts to prepare copper peptides by a bioprocess utilizing a fermentation process of yeast. As a result, they have confirmed that a high-purity copper peptide can be prepared on a large scale at low cost by introducing an expression vector including a polynucleotide sequence encoding a peptide, in which the Gly-His-Lys monomers are repeated a plurality of times, into Pichia pastoris (a yeast species), culturing the yeast, and separating/purifying the expressed peptide, and thereby completed the present invention.

An object of the present invention is to provide an expression cassette for preparing a copper peptide, which includes a polynucleotide sequence encoding a peptide in which the Gly-His-Lys monomers are repeated a plurality of times.

Another object of the present invention is to provide an expression vector for preparing a copper peptide which includes the expression cassette.

Still another object of the present invention is to provide a transformant which includes the expression vector.

Still another object of the present invention is to provide a method for preparing a copper peptide which includes culturing the transformant.

Still another object of the present invention is to provide a copper peptide which includes a plurality of the Gly-His-Lys monomers prepared by the above method.

Still another object of the present invention is to provide a pharmaceutical composition for preventing hair loss or promoting hair growth containing the copper peptide.

Still another object of the present invention is to provide a cosmetic composition for preventing hair loss or promoting hair growth containing the copper peptide.

Still another object of the present invention is to provide a quasi-drug composition for preventing hair loss or promoting hair growth containing the copper peptide.

A copper peptide with high purity can be prepared on a large scale at low cost using the expression cassette, expression vector, and transformant containing the copper peptide of the present invention.

Additionally, the copper peptide prepared according to the present invention has excellent effects of preventing hair loss and promoting hair growth, and thus can be widely used in industry as materials for cosmetics, quasi-drugs, pharmaceuticals, etc., preventing hair loss and promoting hair growth.

FIG.　1 is a schematic diagram illustrating an expression cassette designed for high expression/high secretion of a copper peptide of the present invention.

FIG.　2 is a schematic diagram and a photograph illustrating a process for transforming a copper peptide expression vector into yeast and a fermenter for culturing the yeast.

FIG.　3 is a schematic diagram and a photograph illustrating a method for separating and purifying the copper peptide of the present invention from cultured yeast with high efficiency.

FIG.　4 is a result illustrating the spectrum analysis by HPLC with regard to the purity of the copper peptide of the present invention.

FIG.　5 is a result illustrating the spectrum analysis by GC-MS with regard to the purity of the copper peptide of the present invention.

To achieve the above objects, an aspect of the present invention provides an expression cassette for preparing a copper peptide, which includes a polynucleotide sequence encoding a peptide in which the Gly-His-Lys monomers are repeated a plurality of times.

Additionally, the present invention provides a use for preparing of an expression cassette for preparing a copper peptide, which includes a polynucleotide sequence encoding a peptide in which the Gly-His-Lys monomers are repeated a plurality of times.

As used herein, the term "Gly" refers to an amino acid glycine and may be used herein interchangeably with "glycine", "Gly", or "G". Likewise, "His" refers to an amino acid histidine and may be used herein interchangeably with "histidine", "His", or "H"; and "Lys" refers to an amino acid lysine and may be used herein interchangeably with "lysine", "Lys", or "L". The tripeptide Gly-His-Lys, in which the above three amino acids are sequentially bonded together, may be named to be interchangeably used with "GHK".

As used herein, the term "Gly-His-Lys monomers" refers to a tripeptide in which the amino acids glycine, histidine, and lysine are linked in sequence.

As used herein, the term "copper peptide" refers to a compound in which the peptide, in which the Gly-His-Lys monomers are repeated a plurality of times, is bound to copper (Cu) and may be used herein interchangeably with "Cu-GHK" or "GHK-Cu".

As used herein, the term "expression cassette for preparing a copper peptide" refers to an expression construct capable of expressing a peptide in which the Gly-His-Lys monomers are repeated a plurality of times.

In the present invention, the expression cassette may include a polynucleotide sequence which encodes a peptide in which the above monomers are repeated a plurality of times. The peptide may be a Gly-His-Lys multimer in which the above monomers are repeated 3 to 20 times, more specifically 5 to 15 times, and most specifically 6 to 10 times, but the Gly-His-Lys multimer is not limited thereto. When the multimer has less than three of the above monomers, the number of the GHK monomers obtained therefrom becomes too small, thus deteriorating the production efficiency. In contrast, when the multimer has 20 or more of the above monomers, there is a problem in that it reduces the expression efficiency.

Specifically, the polynucleotide sequence encoding a peptide in which the above monomers are repeated a plurality of times may be one which consists of a nucleotide sequence of SEQ ID NO: 1 or 2, but the polynucleotide sequence is not limited thereto.

Considering mutations having biologically equivalent activity, the nucleotide sequences used in the present invention are interpreted to also include sequences showing substantial identity with the sequences listed in the sequence listing.

The term "substantial identity" refers to a sequence that exhibited at least 60% homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90% homology, when the sequence of the present invention was aligned to any other sequence so as to match with each other as much as possible and the aligned sequence was analyzed by algorithms commonly used in the art.

Accordingly, the nucleotide sequences which have high sequence identity with those nucleotide sequences of SEQ ID NOS:　1 and 2, for example, those nucleotide sequences which have at least 70% homology, specifically 80% homology, and more specifically 90% homology, must be interpreted to be included within the scope of the present invention as well.

Additionally, the expression cassette may be one in which the polynucleotide sequence is operably linked to a promoter sequence that can be expressed in yeast and a high-level secretory signal sequence.

As a specific embodiment, the promoter may be a promoter of glyceraldehyde 3-phosphate dehydrogenase (GPD), a promoter of threonine dehydrogenase (TDH), a promoter of alcohol dehydrogenase (ADH), a promoter of cytochrome c (CYC1, isoform 1), a STE5 promoter, and a combination thereof, but the promoter is not particularly limited as long as it is a promoter suitable for expression in yeast. With regard to the sequences of the exemplified promoters, those known in the art may be used.

In another specific embodiment, the high-level secretory signal sequence may be the alpha-mating factor pre-sequence of Saccharomyces cerevisiae, but it is not particularly limited so long as the target peptide (a peptide in which the Gly-His-Lys monomers are repeated a plurality of times, i.e., a GHK multimer) for expression is secreted well. As the above-exemplified high-level secretory signal sequence, any sequence known in the art may be used.

Preferably, the promoter and the high-level secretory signal sequence are operably linked to a polynucleotide encoding the target peptide.

As used herein, the term "operably linked" means that the control sequence of a nucleic acid is functionally linked to the sequence of a nucleic acid encoding a target protein or peptide so that general functions can be performed. For example, the nucleic acid sequence encoding a promoter and a protein or peptide may be operably linked to affect the expression of the coding sequence. The operable linkage with the vector may be prepared by a genetic recombination technology well known in the art, and site-specific DNA cleavage and linkage may be easily performed using enzymes, etc., generally well known in the art.

Additionally, the expression cassette may further include 3 to 9 polynucleotides which encode His, GST, or Intein upstream or downstream of the polynucleotide sequence within the expression cassette so as to facilitate the purification of the expressed target peptide. Furthermore, the peptide in which the Gly-His-Lys monomers are repeated a plurality of times is linked to polynucleotides which encode His, GST, or Intein through a lysine (K) linker or an aspartate-aspartate-aspartate-aspartate-lysine (DDDDK) linker. However, it is not particularly limited as long as the expression cassette can facilitate the purification of the target peptide.

Additionally, the expression cassette may further include constituting elements that control the expression of a target peptide, such as transcriptional enhancers, terminators, initiation factors, and other genetic regulatory factors or factors conferring antigenicity or binding affinity of a recombinant target peptide as well as promoters, high-level secretory signal sequences, sequences encoding the target peptide, sequences such as His, etc.

In a specific embodiment of the present invention, an expression cassette for high expression/high secretion of GHK, in which aox promoter, a signal sequence for secretion(α-mating factor pre-sequence of Saccharomyces cerevisiae), a polynucleotide sequence encoding a peptide in which the Gly-His-Lys monomers are repeated 6 or 10 times, a His-tag sequence, and a termination sequence are sequentially inserted, was prepared (FIG.　1).

Another aspect of the present invention provides an expression vector for preparing a copper peptide including the above expression cassette.

In particular, the definitions of "expression cassette" and "copper peptide" are the same as described above.

As used herein, the term "expression vector" refers to a tool for efficiently inducing the expression of a target gene by introducing DNA into a host cell, and specifically, it may refer to a gene construct including an essential control element operably linked to enable the expression of a peptide, in which the Gly-His-Lys monomers are repeated a plurality of times.

In the present invention, the expression vector may include an expression cassette for preparing a copper peptide, which includes a polynucleotide sequence encoding the peptide in which the Gly-His-Lys monomers are repeated a plurality of times, specifically 6 to 10 times.

In a specific embodiment, the expression vector may include a plasmid vector, cosmid vector, bacteriophage vector, viral vector, etc. More specific examples of the expression vector may include E. coli-derived plasmids (pBR322, pBR325, pUC118, pUC119, pET30a, pET30c, or pGEX - GST), Bacillus subtilis -derived plasmids (pUB110 or pTP5), yeast-derived plasmids (YEp13, YEp24, YCp50, pPINKα -HC, pPink -HC, or pPink -LC), Ti plasmid, etc., and animal viruses such as retrovirus, adenovirus, vaccinia virus, etc., and insect viruses or plant viruses such as baculovirus may be used, and binary vectors such as pPZP-, pGA-, and pCAMBIA-series may be used.

In a more specific embodiment, the vector may be a yeast-derived plasmid, pPINKα -HC, but the vector is not limited thereto as long as it can introduce an expression cassette of the present invention into a host cell.

Additionally, the expression vector may be functionally linked to an expression control sequence. In a specific embodiment, the expression vector may include a signal sequence or leader sequence for membrane targeting or secretion in addition to an expression control element such as a promoter, operator, initiation codon, stop codon, polyadenylation signal, and enhancer, but the expression vector is not limited thereto and may be prepared in various ways according to the purpose of the present invention. Additionally, the expression vector may include selectivity markers, which may be self-replicating or integrated into host DNA. Additionally, the expression vector may include a selectable marker and may be self-replicating or integrated into host DNA. The vector of the present invention may be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage may be performed using enzymes generally known in the art.

In a specific embodiment of the present invention, the expression vector for preparing a copper peptide was prepared by inserting the expression cassette for preparing a copper peptide into pPINKα -HC, an expression vector, through the conventional restriction enzyme treatment method and ligation (Example 2).

Additionally, still another aspect of the present invention provides a transformant including the expression vector.

In particular, the definition of the "vector" is the same as described above.

As used herein, the term "transformant" refers to an organism whose genetic traits have been altered by the introduction of a foreign genetic material.

In a specific embodiment, the transformant may be Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris, but the transformant is not particularly limited as long as it can express a peptide in which the Gly-His-Lys monomers are repeated a plurality of times, i.e., a GHK multimer.

As used herein, the term "Pichia pastoris" refers to a yeast strain which is most widely used for the production of recombinant proteins along with Saccharomyces cerevisiae. The yeast strain has an advantage in that the strain is easy to genetically manipulate, has a variety of expression systems, and enables large-scale culture. Additionally, the yeast strain has advantages in that it can perform a function of extracellularly secreting proteins and a function of post-translational modification such as glycosylation when producing recombinant proteins derived from higher cells such as human protein. Secretory production of a recombinant protein causes a target protein to artificially fuse with a protein secretion signal and thereby enables extracellular secretion of the target protein. Through the secretion process of the target protein, protein folding, disulfide bond formation, and glycosylation processes proceed, and thus, there is an advantage in that a recombinant protein having a biologically complete activity can be produced. Additionally, since biologically active proteins can be obtained directly from the medium, there is no need for grinding or refolding economically inefficient cells, and thus they are very economical.

In a specific embodiment of the present invention, the expression vector for preparing a copper peptide was introduced into a Pichia pastoris strain by electroporation to prepare a transformant (Example 2).

Another aspect of the present invention provides a method for preparing a copper peptide including culturing the transformant.

In particular, the definitions with regard to the transformant and copper peptide are the same as described above.

In the present invention, the transformant may be cultured considering the nutritional requirement of the transformant. In a specific embodiment, Pichia pastoris is a methyl auxotrophic yeast cell, and a buffered complex methanol medium (BMMY), a buffered minimal methanol medium (BMM), etc., may be used for its cultivation, but the medium is not limited thereto and may be appropriately selected by those skilled in the art according to the purpose of the invention.

Additionally, the recovery of a target peptide from the culture of the transformant can be performed by methods known in the art. Specifically, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), etc., but the methods are not particularly limited as long as they can recover the GHK multimer of the present invention.

The method of the present invention may further include (a) purifying the peptide expressed from the cultured transformant; (b) treating the purified peptide with a protease to separate the Gly-His-Lys monomers from the peptide; and (c) reacting the Gly-His-Lys monomers with copper to prepare a copper peptide.

Specifically, when His, GST, or Intein proteins are present at the N-terminus or C-terminus of the peptide in the range of 3 or more and 9 or less, step (a) of purifying the peptide may further include treating with a protease that degrades the proteins. In particular, for the seperation and purification of the peptide expressed from the cultured transformant, a Ni-column, gel chromatography, or boiling method may be used, but the method is not limited thereto and can be appropriately selected by those skilled in the art according to the purpose of the invention.

Additionally, step (b) of separating the Gly-His-Lys monomers may be a step of separating the Gly-His-Lys monomers into each monomer by treating the purified peptide with a protease. In a specific embodiment, the protease may include trypsin, enterokinase, thrombin, etc., but the protease is not particularly limited thereto as long as it can recognize Lys and cleave immediately behind the Lys.

In a specific embodiment of the present invention, a Pichia pastoris transformant including an expression vector for the preparation of a copper peptide was cultured in a methanol-containing medium, and the GHK-multimer was collected and separated by dissolving it. Additionally, the GHK-multimer was purified by Ni-affinity chromatography, and the GHK monomers obtained by treating the purified GHK-multimer with a protease was reacted with copper to finally obtain a copper peptide (FIG.　3). Furthermore, it was confirmed that the purity of the finally-obtained copper peptide was 95% or higher and the concentration of the copper peptide production exhibits a yield of 100　mg or more per 1　L of a culture liquid (FIGS.　4 and 5).

This suggests that the expression cassette, expression vector, and transformant containing the same for preparing a copper peptide according to the present invention can be effectively used for the preparation of a copper peptide.

Still another aspect of the present invention provides a copper peptide containing a plurality of Gly-His-Lys monomers prepared by the above method.

In particular, the definition of the Gly-His-Lys monomers is the same as described above.

In a specific embodiment, the copper peptide may be a compound having the structure of Formula 1 below.

[Formula 1]

Additionally, the copper peptide of the present invention may be in the form of a metal complex in which Cu² ⁺ ions coordinate with the N of the amino group of glycine, the N of the amino group of histidine, and the N of the imidazole ring of the histidine residue.

Still another aspect of the present invention provides a pharmaceutical composition for preventing hair loss or promoting hair growth containing the copper peptide.

The copper peptide prepared according to the preparation method of the present invention can exhibit effects such as skin regeneration, wound healing, enlargement of hair follicles, etc., and particularly among these, excellent effects of preventing hair loss or promoting hair growth by promoting the activity of scalp and hair follicle cells, and thus the copper peptide can be effectively used as a pharmaceutical composition for preventing hair loss or promoting hair growth.

Examples of the hair to which the pharmaceutical composition of the present invention can be applied may include various kinds of body hair such as hair on the head, eyebrows, eyelashes, pubic hair, underarm hair, chest hair, nose hair, leg hair, etc.

The pharmaceutical composition of the present invention may be prepared in the form of a pharmaceutical composition for preventing hair loss or promoting hair growth, which further contains an appropriate carrier, excipient, or diluent conventionally used in the preparation of pharmaceutical compositions. In particular, the carrier may include a non-naturally occurring carrier.

Specifically, the pharmaceutical composition may be formulated in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterilized injection solutions according to conventional methods, respectively. In particular, the carrier may include various amorphous carriers, microspheres, nanofibers, etc.

The carrier, excipient, or diluent to be contained in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, polycaprolactone (PCL), poly lactic acid (PLA), poly- L-lactic acid (PLLA), mineral oil, etc.

For formulations, the composition may be prepared using a diluents or excipient such as a filler, extender, binder, humectant, disintegrant, surfactant, etc.

Solid formulations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid formulations may be prepared by adding at least one excipient, e.g., starch, calcium carbonate, sucrose or lactose, gelatin, etc. Additionally, a lubricant, such as magnesium stearate, talc, etc., may be used, in addition to the simple excipient.

Liquid formulations for oral administration may include suspensions, liquid medicines for internal use, emulsions, syrups, etc., and various excipients such as humectants, sweeteners, fragrances, preservatives, etc., may be used, in addition to the simple diluents such as water and liquid paraffin.

Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, etc. Examples of the non-aqueous solvents and suspensions may include vegetable oils such as propylene glycol, polyethylene glycol, and olive oil, an injectable ester such as ethyl oleate, etc.

Examples of the bases for suppositories may include Witepsol, macrogol, Tween 61, cacao butter, laurinum, glycerogelatin, etc.

The pharmaceutical composition of the present invention may contain the copper peptide in an amount of in an amount of 0.0001　wt% to 50　wt%, and more specifically 0.01　wt% to 20　wt% based on the weight of the final composition, but the amount is not particularly limited thereto.

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient for the prevention or treatment of diseases at a reasonable benefit/risk ratio applicable to a medical treatment without causing any adverse effects, and the level of the effective dose may be determined based on the factors including the kind of subject, severity of illness, drug activity, age, body weight, health conditions, sex, drug sensitivity of a patient, administration time, administration route and dissolution rate, and length of treatment of the composition of the present invention used, factors including drug(s) to be used simultaneously in combination, and other factors well known in the medical field.

The pharmaceutical composition of the present invention may be administered alone or in combination with other therapeutic agents. It is important to administer an amount to obtain the maximum effect with a minimum amount without adverse effects considering the factors described above.

The administration dose of the pharmaceutical composition of the present invention may be determined by those skilled in the art considering the purpose of use, severity of disease, age, body weight, sex, and medical history of a patient, the kind of materials used as an active ingredient, etc. For example, the pharmaceutical composition of the present invention may be administered in an amount of about 0.1　ng/kg to about 100　mg/kg per adult, and specifically about 1　ng/kg to about 10　mg/kg. The composition of the present invention may be administered once daily or in several divided doses, but the frequency of administration is not particularly limited thereto. The dosage should not limit the scope of the invention in any manner.

Still another aspect of the present invention provides a cosmetic composition for preventing hair loss or promoting hair growth containing the copper peptide.

The copper peptide prepared according to the preparation method of the present invention can exhibit effects such as skin regeneration, wound healing, enlargement of hair follicles, etc., and particularly among these, excellent effects of preventing hair loss or promoting hair growth by promoting the activity of scalp and hair follicle cells, and thus the copper peptide can be effectively used as a cosmetic composition for preventing hair loss or promoting hair growth.

Examples of the hair to which the cosmetic composition of the present invention can be applied may include various kinds of body hair such as hair on the head, eyebrows, eyelashes, pubic hair, underarm hair, chest hair, nose hair, leg hair, etc.

The cosmetic composition of the present invention may contain the copper peptide in an amount of 0.0001　wt% to 50　wt%, and more specifically 0.01　wt% to 10　wt% based on the weight of the final composition, but the amount is not particularly limited thereto. The cosmetic composition has an advantage in that it exhibits excellent effects of preventing hair loss and promoting hair growth within the above range, and also an advantage in that it stabilizes formulations of the composition.

The cosmetic composition of the present invention may be prepared into a formulation selected from the group consisting of a solution, an ointment for external use, a cream, a foam, a nutrition emollient, a soft emollient, a pack, a soft water, a latex, a makeup base, an essence, lip balm, a soap, a liquid cleansing agent, a bath preparation, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, powders, a surfactant-containing cleansing agent, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray, but the formulation is not limited thereto.

The cosmetic composition of the present invention may further contain at least one kind of a cosmetically acceptable carrier to be mixed into a common cosmetic composition for the skin, and for example, commonly used ingredients such as a fat content, water, a surfactant, a humectant, a lower alcohol, a thickener, a chelating agent, a pigment, a preservative, a perfume, etc., may be appropriately mixed therein, but the additional ingredient is not limited thereto.

The cosmetically acceptable carriers contained in the cosmetic composition of the present invention may vary according to the formulation of the cosmetic composition.

When the formulation of the present invention is an ointment, paste, cream, or gel, there may be used as a carrier ingredient; an animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc., but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc. may be used as a carrier ingredient. In particular, when the formulation is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane/butane, and dimethyl ether, but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent, emulsifying agent, etc. (e.g., water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc.) may be used as a carrier ingredient, and in particular, cottonseed oil, peanut oil, corn seed oil, olive oil, castor oil, sesame oil, glycerol aliphatic esters, fatty acid esters of polyethylene glycol or sorbitan may be used, but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol, and propylene glycol; a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester; microcrystalline cellulose; aluminum metahydroxide; bentonite; agar; tragacanth; etc. may be used as a carrier ingredient, but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

When the formulation of the present invention is a suspension, an alkali metal salt of fatty acid, fatty acid hemiester salt, fatty acid protein hydrolizate, isethionate, lanolin derivative, aliphatic alcohol, vegetable oil, glycerol, saccharide, etc. may be used as a carrier ingredient, but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosite, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, etc. there may be used as a carrier ingredient, but the carrier ingredient is not limited thereto. These carrier ingredients may be used alone or by mixing two or more kinds.

Still another aspect of the present invention provides a quasi-drug composition for preventing hair loss or promoting hair growth containing the copper peptide.

The copper peptide prepared according to the preparation method of the present invention can exhibit effects such as skin regeneration, wound healing, enlargement of hair follicles, etc., and particularly among these, excellent effects of preventing hair loss or promoting hair growth by promoting the activity of scalp and hair follicle cells, and thus the copper peptide can be effectively used as a quasi-drug composition for preventing hair loss or promoting hair growth.

Examples of the hair to which the quasi-drug composition of the present invention can be applied may include various kinds of body hair such as hair on the head, eyebrows, eyelashes, pubic hair, underarm hair, chest hair, nose hair, leg hair, etc.

The quasi-drug composition of the present invention may be prepared into a formulation selected from the group consisting of a body cleanser, soap, hand wash, hair cleanser, hair softener, and hair tonic, but the formulation is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to the following Examples. However, these Examples are for illustrative purposes only and the invention is not intended to be limited by these Examples.

Example 1: Preparation of expression cassette for expression of peptide (GHK multimer ) where Gly -His- Lys monomers are repeated a plurality of times

As shown in FIG.　1, an expression cassette for expression in Pichia pastoris, a yeast strain (GRAS strain) approved as a safe strain for production was prepared. A P. pastoris-customized promoter and a secretory signal sequence were selected for high expression/high secretion. In particular, aox promoter was used as the promoter and the α-mating factor pre-sequence of Saccharomyces cerevisiae was used as the secretory signal sequence. Then, a target polynucleotide sequence (a peptide in which Gly-His-Lys monomers are repeated 6 to 10 times) was arranged downstream thereof, and again, a His-tag sequence for high efficiency separation/purification was arranged downstream thereof, and finally an expression cassette for high expression/high secretion of GHK in which a terminator sequence was inserted was prepared. Additionally, a polynucleotide sequence encoding the target peptide was obtained by codon optimization.

The specific nucleotide sequence encoding the GHK multimer is shown in Table 1 below.

Category	Nucleotide Sequence (5' 3')
Six Repetition of GHK	CATCATCATCATCATCATACCGGTCATAAGGGTCATAAGGGTCATAAGGGTCATAAGGGTCACAAGGGTCACAAG(SEQ ID NO:　1)
Ten Repetition of GHK	CATCATCATCATCATCATACCGGTCATAAGGGTCATAAGGGTCATAGGGTCATAAGGGTCACAAGGGTCATAAGGGTCATAAGGGTCATAAGGTCATAAGGGTCACAAGTA(SEQ ID NO:　2)

Example 2: Preparation of expression vector and cultivation of yeast introduced with expression vector

As shown in FIG.　2, the expression cassette prepared in Example 1 was inserted into the expression vector pPinkα -HC (Invitrogen) by the conventional methods of restriction enzyme treatment, ligation, etc. in a transformation buffer solution (0.67% yeast nitrogen base without any amino acid, 0.076% yeast synthetic drop-out adenine, and 2% glucose) at 30°C to prepare a transformation vector pBJY _ GHK6 or pBJY _ GHK10. The vectors were respectively introduced (transformed) into a P. pastoris strain by the method of electroporation to prepare a transformant, and the transformant was cultured using a methanol-containing medium.

First, P. pastoris colonies were inoculated into a glucose-containing YPD medium to prepare a first culture, and allowed the first culture to grow in a shaking flask (shaken at 280　rpm at 29℃ to 30℃) to a nearly confluent state. Then, the first culture was inoculated into a buffered glycerol complex medium (BMGY) to prepare a second culture and the second culture was allowed to grow to 8.0 OD₆₀₀, and the resulting second culture was centrifuged to obtain a pellet. The pellet was resuspended in each of BMMY and BMM to prepare a third culture. The third culture was charged with methanol to a final concentration of 0.6% at 24-hour intervals for 120 to 144 hours to maintain the induction of a target peptide.

Example 3: High efficiency/high purity separation and purification of target peptide expressed in cultured yeast

After collecting the cultured yeast, the yeast cells were lysed by a general method and a GHK multimer, which is a target peptide, was separated from the lysate. The peptide was separated using a physical/chemical separation/purification technology. However, since a His-tag sequence was included in the expression cassette prepared in Example 1, the target peptide was purified by Ni-affinity chromatography in which His can be well adsorbed (FIG.　3).

Additionally, as shown in FIG.　3, the GHK monomers were separated by treating the target peptide with trypsin, and the separated GHK monomers wWere reacted with copper to finally obtain a copper peptide.

Spectra indicating the purity of the GHK analyzed by HPLC and GC-MS are shown in FIGS.　4 and 5, respectively. By the analyses, it was confirmed that the finally-obtained copper peptide had a purity of 95% or more. Additionally, as a result of the calculation of the concentration of the copper peptide production, it was confirmed that the yield was 100　mg or more per 1　L of the culture solution.

From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.

Claims

An expression cassette for preparing a copper peptide comprising a polynucleotide sequence encoding a peptide in which Gly-His-Lys monomers are repeated a plurality of times.
The expression cassette of claim 1, wherein the peptide in which Gly-His-Lys monomers are repeated a plurality of times is a Gly-His-Lys multimer in which Gly-His-Lys monomers are repeated 6 to 10 times.
The expression cassette of claim 1, wherein the polynucleotide sequence is operably linked to a promoter sequence expressed in yeast and a high-level secretory signal sequence.
The expression cassette of claim 3, wherein the promoter is GPD, TDH, ADH, CYC1, or STE5 promoter.
The expression cassette of claim 3, wherein the high-level secretory signal sequence is an α-mating factor pre-sequence of Saccharomyces cerevisiae.
The expression cassette of claim 1, wherein the expression cassette further comprises 3 to 9 polynucleotides which encode His, GST, or Intein upstream or downstream of the polynucleotide sequence within the expression cassette.
The expression cassette of claim 6, wherein the peptide in which Gly-His-Lys monomers are repeated a plurality of times is linked to polynucleotides encoding His, GST, or Intein through a K linker or DDDDK linker.
An expression vector for preparing a copper peptide comprising the expression cassette according to any one of claims 1 to 7.
A transformant comprising the expression vector of claim 8.
The transformant of claim 9, which is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris.
A method for preparing a copper peptide comprising culturing the transformant of claim 10.
The method of claim 11, further comprising:

(a) purifying the peptide expressed from the cultured transformant;

(b) treating the purified peptide with a protease to separate the Gly-His-Lys monomers from the peptide; and

(c) reacting the Gly-His-Lys monomers with copper to prepare a copper peptide.
The method of claim 12, wherein, when His, GST, or Intein proteins are present at the N-terminus or C-terminus of the peptide in the range of 3 or more and 9 or less, step (a) of purifying the peptide comprises treating with a protease that degrades the proteins.
The method of claim 12, wherein the protease is trypsin, enterokinase, or thrombin.
A copper peptide comprising a plurality of Gly-His-Lys monomers prepared by the method of claim 12.
A pharmaceutical composition for preventing hair loss or promoting hair growth comprising the copper peptide of claim 15.
A cosmetic composition for preventing hair loss or promoting hair growth comprising the copper peptide of claim 15.
The cosmetic composition of claim 17, wherein the cosmetic is at least one cosmetic for hair selected from the group consisting of hair tonics, hair creams, hair lotions, hair shampoos, hair rinses, hair conditioners, hair sprays, hair aerosols, pomades, powders, gels, sol-gels, emulsions, oils, waxes, and aerosols.
A quasi-drug composition for preventing hair loss or promoting hair growth comprising the copper peptide of claim 15.