WO2020215017A1 - Materials and methods for protein production - Google Patents

Materials and methods for protein production Download PDF

Info

Publication number
WO2020215017A1
WO2020215017A1 PCT/US2020/028858 US2020028858W WO2020215017A1 WO 2020215017 A1 WO2020215017 A1 WO 2020215017A1 US 2020028858 W US2020028858 W US 2020028858W WO 2020215017 A1 WO2020215017 A1 WO 2020215017A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter element
nucleic acid
seq
mutations
alcohol oxidase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/028858
Other languages
English (en)
French (fr)
Inventor
Martin Andrew HOYT
Xiao Guo
Smita SHANKAR
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Impossible Foods Inc
Original Assignee
Impossible Foods Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2021012671A priority Critical patent/MX2021012671A/es
Priority to SG11202111468SA priority patent/SG11202111468SA/en
Priority to AU2020257270A priority patent/AU2020257270B2/en
Priority to BR112021020727A priority patent/BR112021020727A2/pt
Priority to CN202080041851.4A priority patent/CN114555812A/zh
Priority to PH1/2021/552635A priority patent/PH12021552635A1/en
Priority to CA3137100A priority patent/CA3137100A1/en
Priority to EP20724682.8A priority patent/EP3956454A1/en
Application filed by Impossible Foods Inc filed Critical Impossible Foods Inc
Priority to JP2021561699A priority patent/JP7762567B2/ja
Priority to KR1020217037340A priority patent/KR20210153106A/ko
Publication of WO2020215017A1 publication Critical patent/WO2020215017A1/en
Priority to IL287318A priority patent/IL287318A/en
Anticipated expiration legal-status Critical
Priority to JP2025038452A priority patent/JP2025102798A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795Porphyrin- or corrin-ring-containing peptides
    • C07K14/805Haemoglobins; Myoglobins
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1037Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1086Preparation or screening of expression libraries, e.g. reporter assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/03013Alcohol oxidase (1.1.3.13)

Definitions

  • This disclosure generally relates to DNA constructs and methods of using such DNA constructs to genetically engineer cells, such as yeast cells or methyl otrophic yeast cells.
  • Recombinant expression of products is a common method to produce said products.
  • proteins can be produced by recombinant production.
  • Constructs that can be used to efficiently express one or more products (e.g., proteins) in a cell, such as a yeast cell or a methylotrophic yeast cell, are provided herein.
  • This document is based, at least in part, on the identification of point mutations in the AOX1 promoter that can confer increased expression of linked coding sequences.
  • the mutated AOX1 promoters described herein can be used for efficient expression of operably linked coding sequences in Pichia , for example.
  • nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668- 734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element can include one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688,
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element can include one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:
  • the first alcohol oxidase promoter element can include one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include the mutations T688C, A696T, T702C,
  • the first alcohol oxidase promoter element can be an alcohol oxidase 1 promoter element.
  • the first alcohol oxidase promoter element can have at least 90% sequence identity to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can have at least 95% sequence identity to SEQ ID NO: 28.
  • the nucleic acid construct can further include a nucleotide sequence encoding a first protein, wherein the nucleotide sequence encoding the first protein is operably linked to the first alcohol oxidase promoter element.
  • the first protein can be exogenous to a methylotrophic yeast cell.
  • the first protein can be heterologous to a
  • the first protein can be selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein.
  • the first protein can be a heme-binding protein.
  • the heme-binding protein can be selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • the heme-binding protein can be selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin.
  • the heme-binding protein can be a non-symbiotic hemoglobin.
  • the heme-binding protein can be a leghemoglobin.
  • the heme-binding protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any of SEQ ID NOs: 1-27.
  • the first alcohol oxidase promoter element can include a recognition sequence for a transcription factor.
  • a methylotrophic yeast cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is any nucleic acid construct described herein.
  • the methylotrophic yeast cell can be a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell.
  • the methylotrophic yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell.
  • the methylotrophic yeast cell can be a Pichia pastoris cell.
  • the methylotrophic yeast cell can further include a second nucleic acid construct including a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to the first alcohol oxidase promoter element or to a second promoter element.
  • the nucleotide sequence encoding the second protein can be operably linked to a second promoter element that has the same sequence as the first alcohol oxidase promoter element.
  • the second protein can be a transcription factor.
  • the nucleotide sequence encoding the second protein can be operably linked to a second promoter element that can include a recognition sequence for the transcription factor.
  • the first alcohol oxidase promoter element can include a recognition sequence for the transcription factor.
  • the second protein can be a protein involved in heme biosynthesis.
  • the protein involved in heme biosynthesis can be selected from the group consisting of aminolevulinic acid synthase (ALAS), d-aminolevulinic acid dehydratase (ALAD), porphogilinogen deaminase (PBGD),
  • uroporphyrinogen III synthase UPG3S
  • UPG3D uroporphyrinogen III decarboxylase
  • COPROX coprotoporphyrinogen oxidase
  • PROTOX protoporphyrinogen IX oxidase
  • FC ferrochelatase
  • a method of producing a protein in a methylotrophic yeast cell including expressing a nucleic acid construct including a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • methylotrophic yeast cell including expressing a nucleic acid construct including a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to of T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696, T702, A712, and T714 as compared to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 as compared to SEQ ID NO: 28.
  • a method of producing a protein in a methyl otrophic yeast cell including expressing a nucleic acid construct including a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:
  • the first alcohol oxidase promoter element can include two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can include the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can be an alcohol oxidase 1 promoter element.
  • the first alcohol oxidase promoter element can have at least 90% sequence identity to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element can have at least 95% sequence identity to SEQ ID NO: 28.
  • the first protein can be exogenous to the methyl otrophic yeast cell.
  • the first protein can be heterologous to the methylotrophic yeast cell.
  • the first protein can be selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, and a heme-binding protein.
  • the first protein can be a heme-binding protein.
  • the heme-binding protein can be selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • the heme-binding protein an be selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a
  • flavohemoglobin a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a
  • the heme-binding protein can be a non-symbiotic hemoglobin.
  • the heme-binding protein can be a leghemoglobin.
  • the heme-binding protein can include an amino acid sequence having at least 90% sequence identity to an amino acid sequence in any one of SEQ ID NOs: 1-27.
  • the first alcohol oxidase promoter element can contain one or more recognition sequences for a transcription factor.
  • the method can further include expressing a second nucleic acid construct including a nucleotide sequence encoding a second protein, wherein the nucleotide sequence encoding the second protein is operably linked to the first alcohol oxidase promoter element or to a second promoter element.
  • the nucleotide sequence encoding the second protein can be operably linked to a second promoter element that has the same sequence as the first alcohol oxidase promoter element.
  • the second protein can be a transcription factor.
  • the nucleotide sequence encoding the second protein can be operably linked to a second promoter element that can include a recognition sequence for the transcription factor.
  • the first alcohol oxidase promoter element can include a recognition sequence for the transcription factor.
  • the second protein can be a protein involved in heme biosynthesis.
  • the protein involved in heme biosynthesis can be selected from the group consisting of ALAS, ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, and FC.
  • the method can be carried out in the absence of added methanol.
  • a Pichia pastoris cell including a nucleic acid construct comprising a nucleotide sequence encoding a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the one or more mutations can be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • leghemoglobin in another aspect, also provided herein is a method of producing leghemoglobin, the method including expressing a nucleic acid construct including a nucleotide sequence encoding leghemoglobin operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the method can be carried out in the absence of added methanol.
  • the one or more mutations can be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Pichia pastoris cell including a first nucleic acid construct including a nucleotide sequence with at least 90% sequence identity to SEQ ID NO:
  • the first nucleic acid construct includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the one or more mutations can be selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Figure 1 provides the sequences of exemplary heme-binding proteins (SEQ ID NOs: 1-27).
  • Figure 2 provides the sequences of pAOXl wild-type and mutant sequences (SEQ ID NOs: 28- 29).
  • Figure 3 is an image showing growth of pMx0414 transformants on YPD medium.
  • Figure 4 is a graph plotting the relative expression of GFP in strains MxY0270 and MxY0279 under different growth conditions.
  • Figure 5 is a comparison of portions of the sequence of MxG0038 and MxG0220.
  • Figure 6 is a graph plotting the relative expression of GFP in strains MxY0964, MxY965, and MxY1039.
  • Figure 7 provides the sequences of SEQ ID NOs: 30-37. DETAILED DESCRIPTION
  • this document is related to materials and methods for protein production.
  • this document is related to materials and method for the production of products (e.g., proteins (e.g., plant proteins)) in cells (e.g., yeast (e.g., methylotrophic yeast) using an engineered promoter.
  • products e.g., proteins (e.g., plant proteins)
  • cells e.g., yeast (e.g., methylotrophic yeast) using an engineered promoter.
  • Methylotrophic yeast such as Pichia pastoris , are commonly used to produce
  • Pichia strains are typically able to grow on methanol as the sole carbon source. It will be understood that Pichia pastoris has been reclassified as
  • Komagataella species such as Komagataella phaffii , Komagataella pastoris , or Komagataella pseudopastoris , though the term‘ Pichia pastoris’ is still in use and may refer to any appropriate Komagataella species.
  • laboratory strains of P pastoris are Komagataella phaffii.
  • Methanol utilization can be initiated by the conversion of methanol to formaldehyde by the action of alcohol oxidase.
  • P. pastoris contains two genes for alcohol oxidases, AOX1 and AOX2. Strains with reduced alcohol oxidase activity (“methanol utilization slow” or MutS strains) can usually produce more of a recombinant product (e.g., protein) expressed from the AOX1 promoter than strains that do not have reduced alcohol oxidase activity.
  • the Pichia pastoris promoter for the alcohol oxidase 1 (AOX1) gene, referred to as pAOXl can be used for production of heterologous products (e.g., proteins (e.g., proteins of industrial relevance)).
  • Expression from this promoter can be induced in the presence of methanol, a flammable and toxic compound.
  • the materials and methods described herein can allow for expression of recombinant products (e.g., proteins) at high level from this promoter, or a promoter element therefrom, in the absence of methanol.
  • the materials and methods described herein can allow for expression of recombinant products (e.g., proteins) at high level from this promoter, or a promoter element therefrom, in the absence of added methanol.
  • Expression from pAOXl is typically absent or very poor in the presence of non-inducing carbon sources, such as glucose or glycerol.
  • non-inducing carbon sources such as glucose or glycerol.
  • mutations in pAOXl that allow significant expression from pAOXl in the absence of methanol.
  • mutations in pAOXl that allow significant expression from pAOXl in the absence of added methanol A reference pAOXl sequence is provided in SEQ ID NO: 28 ( Figure 2).
  • Exemplary mutations in pAOXl, as described herein, are provided in SEQ ID NO: 29 ( Figure 2). These mutations can be present individually or in any combination. These mutations can also provide an additional increase in expression from pAOXl when methanol is present.
  • nucleic acid constructs that include a promoter element having a sequence that includes one or more mutations as compared to a reference promoter sequence.
  • a promoter element can be an alcohol oxidase promoter element.
  • a promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element (e.g., SEQ ID NO: 28 or SEQ ID NO: 29).
  • a promoter element can have the sequence of SEQ ID NO: 29.
  • a single mutation can be present in a promoter element.
  • a single mutation corresponding to a mutation in one of nucleotide positions 668- 734 e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683- 719, or nucleotide positions 688-714
  • SEQ ID NO: 28 can be present in a promoter element.
  • a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A.
  • a promoter element T146C; C154T; T303C; T426A; A433T; A435G; T530A; C572T; T596C; T617C; T688C; A696T; T702C; A709G; A712G; T714G; A790G; A841T; or T862A.
  • a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: 146C; 154T; 303C; 426A; 433T; 435G; 530A; 572T; 596C; 617C; 688C; 696T; 702C; 709G; 712G; 714G; 790G; 841T; or 862A, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T146;
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862.
  • a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: T688C; A696T; T702C; A712G; or T714G.
  • a single mutation corresponding to one of the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: 688C; 696T; 702C; 712G; or 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T688; A696; T702; A712; or T714.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T688; A696; T702; A712; or T714.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T688; A696; T702; A712; or T714.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T688; A696; T702; A712; or T714.
  • a single mutation at a position corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a
  • a promoter element 688; 696; 702; 712; or 714.
  • nucleic acid constructs that include a promoter element having a sequence that includes multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  • At least 2 e.g., at least 3, at least 4, at least 5, at least 10, at least 15, 2 to 5, 2 to 10, 2 to 15, 2 to 20, 5 to 10, 5 to 15, 5 to 20, 10 to 15, 10 to 20, or 15 to 20
  • mutations corresponding to a mutation in nucleotide positions 668-734 e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714
  • SEQ ID NO: 28 can be present in a promoter element.
  • At least 2 e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
  • mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: T146C; C154T; T303C; T426A; A433T;
  • At least 2 e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
  • mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: 146C; 154T; 303C; 426A; 433T; 435G; 530A; 572T; 596C; 617C; 688C; 696T; 702C; 709G; 712G; 714G; 790G; 841T; or 862A, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • At least 2 e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
  • mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T146; Cl 54; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862.
  • At least 2 e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
  • mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter element: 146; 154; 303; 426; 433; 435; 530; 572; 596; 617; 688; 696; 702; 709; 712; 714; 790; 841; or 862.
  • At least 2 e.g., at least 3, at least 4, 2, 3, 4, or 5
  • mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: T688C; A696T; T702C; A712G; or T714G.
  • a promoter element T688C; A696T; T702C; A712G; or T714G.
  • At least 2 (e.g., at least 3, at least 4, 2, 3, 4, or 5) mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter element: 688C; 696T; 702C; 712G; or 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • at least 2 (e.g., at least 3, at least 4, 2, 3, 4, or 5) mutations corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: T688; A696; T702; A712; or T714.
  • At least 2 e.g., at least 3, at least 4, 2, 3, 4, or 5
  • mutations corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a promoter element: 688; 696; 702; 712; or 714.
  • a mutation in a nucleic acid can be an insertion, a deletion or a substitution.
  • a mutation in a nucleic acid can be a substitution (e.g., a guanosine to cytosine mutation).
  • a mutation in a nucleic acid can be in a non-coding sequence.
  • a substitution in a coding sequence e.g., encoding a protein
  • a substitution in a coding sequence can be a nonsynonymous mutation (e.g., a missense mutation or a nonsense mutation).
  • a substitution in a coding sequence can be a missense mutation (e.g., a different amino acid is encoded).
  • a substitution in a coding sequence can be nonsense mutation (e.g., a premature stop codon is encoded). It will be understood that mutations can be used to alter an endogenous nucleic acid, using, for example, CRISPR, TALEN, and/or Zinc-finger nucleases.
  • a mutation in a protein sequence can be an insertion, a deletion, or a substitution. It will be understood that a mutation in a nucleic acid that encodes a protein can cause a mutation in a protein sequence. In some embodiments, a mutation in a protein sequence is a substitution (e.g., a cysteine to serine mutation, or a cysteine to alanine mutation).
  • a“corresponding” nucleic acid position (or substitution) in a nucleic acid sequence different from a reference nucleic acid sequence can be identified by performing a sequence alignment between the nucleic acid sequences of interest. It will be understood that in some cases, a gap can exist in a nucleic acid alignment.
  • a“corresponding” amino acid position (or substitution) in a protein sequence different from a reference protein sequence can be identified by performing a sequence alignment between the protein sequences of interest. It will be understood that in some cases, a gap can exist in a protein alignment.
  • a nucleotide or amino acid position“relative to” a reference sequence can be the corresponding nucleotide or amino acid position in a reference sequence.
  • a reference sequence can be from the same taxonomic rank as a comparator sequence. In some embodiments, a reference sequence can be from the same domain as a comparator sequence. For example, in some embodiments, both a reference sequence and a comparator sequence can be from domain Eukarya. In some embodiments, a reference sequence can be from the same kingdom as a comparator sequence. For example, in some embodiments, both a reference sequence and a comparator sequence can be from the kingdom Fungi. In some embodiments, a reference sequence can be from the same phylum as a comparator sequence. For example, in some embodiments, both a reference sequence and a comparator sequence can be from phylum Ascomycota.
  • a reference sequence can be from the same class as a comparator sequence.
  • both a reference sequence and a comparator sequence can be from the class Saccharomycetes.
  • a reference sequence can be from the same order as a comparator sequence.
  • both a reference sequence and a comparator sequence can be from the order Saccharomycetales.
  • a reference sequence can be from the same family as a comparator sequence.
  • both a reference sequence and comparator sequence can be from the family Saccharomycetaceae .
  • a reference sequence can be from the same genus as a comparator sequence.
  • both a reference sequence and a comparator sequence can be from the genus Pichia.
  • a reference sequence can be from the same species as a comparator sequence.
  • a reference sequence and a comparator sequence can both be from yeast. In some embodiments, a reference sequence and a comparator sequence can both be from methylotrophic yeast.
  • a reference sequence and a comparator sequence can have at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 99%) sequence identity.
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T146C and C154T; T146C and T303C; T146C and T426A; T146C and A433T; T146C and A435G; T146C and T530A; T146C and C572T; T146C and T596C; T146C and T617C; T146C and T688C; T146C and A696T; T146C and T702C; T146C and A709G; T146C and A712G; T146C and T714G; T146C and A790G; T146C and A841T; T146C and T862A; C154T and T303C; C154T and T4
  • A435G and T530A A435G and C572T; A435G and T596C; A435G and T617C; A435G and T688C; A435G and A696T; A435G and T702C; A435G and A709G; A435G and A712G;
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T146C, C154T, and T303C; T146C, C154T, and T426A; T146C, C154T, and A433T; T146C, C154T, and A435G; T146C, C154T, and T530A; T146C, C154T, and C572T; T146C, C154T, and T596C; T146C, C154T, and T617C; T146C, C154T, and T688C; T146C, C154T, and A696T; T146C, C154T, and T702C; T146C, C154T, and A709G; T146C, C154T
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T688C and A696T; T688C and T702C; T688C and A712G; T688C and T714G; A696T and T702C; A696T and A712G; A696T and T714G; T702C and A712G; T702C and T714G; or A712G and T714G
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T688C, A696T, and T702C; T688C, A696T, and A712G; T688C, A696T, and T714G; T688C, T702C, and A712G; T688C, T702C, and T714G; T688C, A712G, and T714G; A696T, T702C, and A712G; A696T, T702C, and T714G; A696T, A712G, and T714G; A696T, A712G, and T714G; or T702C, A712G, and T714G.
  • the nucleotide sequence of a promoter element as provided herein can include four mutations as compared to the nucleotide sequence of a reference promoter element.
  • four mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T688C, A696T, T702C, and A712G; T688C, A696T, T702C, and T714G; T688C, A696T, A712G, and T714G; T688C, T702C, A712G, and T714G; or A696T, T702C, A712G, and T714G.
  • the nucleotide sequence of a promoter element as provided herein can include five mutations as compared to the nucleotide sequence of a reference promoter element.
  • five mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: T688C, A696T, T702C, A712G, and T714G.
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 146C and 154T; 146C and 303C; 146C and 426A; 146C and 433T; 146C and 435G; 146C and 530A; 146C and 572T; 146C and 596C; 146C and 617C; 146C and 688C; 146C and 696T; 146C and 702C; 146C and 709G; 146C and 712G; 146C and 714G; 146C and 790G; 146C and A841T; 146C and 862A; 154T and 303C; 154T and 426A; 154T and 433T; 154T and
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 146C, 154T, and 303C; 146C, 154T, and 426A; 146C, 154T, and 433T; 146C, 154T, and 435G; 146C, 154T, and 530 A; 146C, 154T, and 572T; 146C, 154T, and 596C; 146C, 154T, and 617C; 146C, 154T, and 688C; 146C, 154T, and 696T; 146C, 154T, and 702C; 146C, 154T, and 709G; 146C, 154T, and 712G; 146C,
  • 154T, 303C, and 530A 154T, 303C, and 572T; 154T, 303C, and 596C; 154T, 303C, and 617C; 154T, 303C, and 688C; 154T, 303C, and 696T; 154T, 303C, and 702C; 154T, 303C, and 709G; 154T, 303C, and 712G; 154T, 303C, and 714G; 154T, 303C, and 790G; 154T, 303C, and A841T; 154T, 303C, and 862A; 154T, 426A, and 433T; 154T, 426A, and 435G; 154T, 426A, and 530 A; 154T, 426A, and 572T; 154T, 426A, and 596C; 154T, 426A, and 617C; 154T, 426A
  • 696T, and 702C 433T, 696T, and 709G; 433T, 696T, and 712G; 433T, 696T, and 714G; 433T, 696T, and 790G; 433 T, 696T, and A841T; 433 T, 696T, and 862 A; 433 T, 702C, and 709G;
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 688C and 696T; 688C and 702C; 688C and 712G; 688C and 714G; 696T and 702C; 696T and 712G; 696T and 714G; 702C and 712G; 702C and 714G; or 712G and 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 688C, 696T, and 702C; 688C, 696T, and 712G; 688C, 696T, and 714G; 688C, 702C, and 712G; 688C, 702C, and 714G; 688C, 712G, and 714G; 696T, 702C, and 712G; 696T, 702C, and 714G; 696T, 712G, and 714G; or 702C, 712G, and 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • the nucleotide sequence of a promoter element as provided herein can include four mutations as compared to the nucleotide sequence of a reference promoter element.
  • four mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 688C, 696T, 702C, and 712G; 688C, 696T, 702C, and 714G; 688C, 696T, 712G, and 714G; 688C, 702C, 712G, and 714G; or 696T, 702C, 712G, and 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • the nucleotide sequence of a promoter element as provided herein can include five mutations as compared to the nucleotide sequence of a reference promoter element.
  • five mutations corresponding to the following mutations relative to SEQ ID NO: 28 can be present in a promoter sequence: 688C, 696T, 702C, 712G, and 714G, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T146 and C154; T146 and T303; T146 and T426; T146 and A433; T146 and A435; T146 and T530; T146 and C572; T146 and T596; T146 and T617; T146 and T688; T146 and A696; T146 and T702; T146 and A709; T146 and A712; T146 and T714; T146 and A790; T146 and A841; T146 and T862; C154 and T303; C154 and T426; C154 and A433; C154 and A435; C154 and T530; C154 and C572; Cl 54 and T596; Cl 54;
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T146, C154, and T303; T146, C154, and T426; T146, C154, and A433; T146, C154, and A435; T146, C154, and T530; T146, C154, and C572; T146, C154, and T596; T146, C154, and T617; T146, C154, and T688; T146, C154, and A696; T146, C154, and T702; T146, C154, and A709; T146, C154, and A712; T146, C154, and T714; T146, C154, and A790; T146, C154, and A84
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T688 and A696; T688 and T702; T688 and A712; T688 and T714; A696 and T702; A696 and A712; A696 and T714; T702 and A712; T702 and T714; or A712 and T714.
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T688, A696, and T702; T688, A696, and A712; T688, A696, and T714; T688, T702, and A712; T688, T702, and T714; T688, A712, and T714; A696, T702, and A712; A696, T702, and T714; A696, A712, and T714; or T702, A712, and T714.
  • the nucleotide sequence of a promoter element as provided herein can include four mutations as compared to the nucleotide sequence of a reference promoter element.
  • four mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T688, A696, T702, and A712; T688, A696, T702, and T714; T688, A696, A712, and T714; T688, T702, A712, and T714; or A696, T702, A712, and T714.
  • the nucleotide sequence of a promoter element as provided herein can include five mutations as compared to the nucleotide sequence of a reference promoter element.
  • five mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: T688, A696, T702, A712, and T714.
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 146 and 154; 146 and 303; 146 and 426; 146 and 433; 146 and 435; 146 and 530; 146 and 572; 146 and
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 146, 154, and 303; 146, 154, and 426; 146, 154, and 433; 146, 154, and 435; 146, 154, and 530; 146, 154, and 572; 146, 154, and 596; 146, 154, and 617; 146, 154, and 688; 146, 154, and 696; 146, 154, and 702; 146, 154, and 709; 146, 154, and A712; 146, 154, and 714; 146, 154, and 790; 146,
  • 146, 688, and 702 146, 688, and 709; 146, 688, and A712; 146, 688, and 714; 146, 688, and 790; 146, 688, and 841; 146, 688, and 862; 146, 696, and 702; 146, 696, and 709; 146, 696, and
  • 572, 702, and 790 572, 702, and 841; 572, 702, and 862; 572, 709, and A712; 572, 709, and
  • 617, and 696 596, 617, and 702; 596, 617, and 709; 596, 617, and A712; 596, 617, and 714;
  • the nucleotide sequence of a promoter element as provided herein can include two mutations as compared to the nucleotide sequence of a reference promoter element.
  • two mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 688 and 696; 688 and 702; 688 and A712; 688 and 714; 696 and 702; 696 and A712; 696 and 714; 702 and A712; 702 and 714; or A712 and 714.
  • the nucleotide sequence of a promoter element as provided herein can include three mutations as compared to the nucleotide sequence of a reference promoter element.
  • three mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 688, 696, and 702; 688, 696, and A712; 688, 696, and 714; 688, 702, and A712; 688, 702, and 714; 688, A712, and 714; 696, 702, and A712; 696, 702, and 714; 696, A712, and 714; or 702, A712, and 714.
  • the nucleotide sequence of a promoter element as provided herein can include four mutations as compared to the nucleotide sequence of a reference promoter element.
  • four mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 688, 696, 702, and A712; 688, 696, 702, and 714; 688, 696, A712, and 714; 688, 702, A712, and 714; or 696, 702, A712, and 714.
  • the nucleotide sequence of a promoter element as provided herein can include five mutations as compared to the nucleotide sequence of a reference promoter element.
  • five mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a promoter sequence: 688, 696, 702, A712, and 714.
  • Nucleic acid molecules used in the methods described herein are typically DNA, but RNA molecules can be used under the appropriate circumstances.
  • exogenous refers to any nucleic acid sequence that is introduced into a cell from, for example, the same or a different organism or a nucleic acid generated synthetically (e.g., a codon-optimized nucleic acid sequence).
  • an exogenous nucleic acid can be a nucleic acid from one
  • an exogenous nucleic acid also can be a nucleic acid from a methylotrophic yeast that is introduced recombinantly into a
  • methylotrophic yeast as an additional copy despite the presence of a corresponding native nucleic acid sequence, or a nucleic acid from a methylotrophic yeast that is introduced recombinantly into a methylotrophic yeast containing one or more mutations, insertions, or deletions compared to the sequence native to the methylotrophic yeast.
  • P. pastoris contains an endogenous nucleic acid encoding an ALAS; an additional copy of the P. pastoris ALAS nucleic acid (e.g., introduced recombinantly into P. pastoris ) is considered to be exogenous.
  • an“exogenous” protein is a protein encoded by an exogenous nucleic acid.
  • an exogenous nucleic acid can be a heterologous nucleic acid.
  • a“heterologous” nucleic acid refers to any nucleic acid sequence that is not native to an organism (e.g., a heterologous nucleic acid can be a nucleic acid from one microorganism (e.g., one genus or species of methylotrophic yeast, whether or not it has been codon-optimized) that is introduced into a different genus or species of methylotrophic yeast)).
  • a microorganism e.g., one genus or species of methylotrophic yeast, whether or not it has been codon-optimized
  • heterologous protein is a protein encoded by a heterologous nucleic acid.
  • a nucleic acid molecule is considered to be exogenous to a host organism when any portion thereof (e.g., a promoter sequence or a sequence of an encoded protein) is exogenous to the host organism.
  • a nucleic acid molecule is considered to be heterologous to a host organism when any portion thereof (e.g., a promoter sequence or a sequence of an encoded protein) is heterologous to the host organism.
  • Nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methyl otrophic yeast cell)).
  • a cell e.g., a yeast cell (e.g., a methyl otrophic yeast cell)
  • RNA Recombinantly produced RNAs can be used to modify a function of the cell, for example by RNA interference or as a guide for DNA editing.
  • nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methylotrophic yeast cell)) to produce a product (e.g., a protein).
  • a cell e.g., a yeast cell (e.g., a methylotrophic yeast cell)
  • nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methylotrophic yeast cell)) to produce an exogenous product (e.g., a protein).
  • nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methylotrophic yeast cell)) to produce a heterologous product (e.g., a protein).
  • a nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methylotrophic yeast cell)) to produce a product (e.g., a protein) in the absence of methanol.
  • nucleic acid constructs are provided herein that allow for genetically engineering a cell (e.g., a yeast cell (e.g., a methylotrophic yeast cell)) to increase the expression of a heme-binding protein.
  • a cell e.g., a yeast cell (e.g., a methylotrophic yeast cell)
  • a heme-binding protein e.g., a heme-binding protein
  • a cell can be any appropriate cell.
  • a cell can be a bacterial cell (e.g., an E. coli cell, a B. subtilis cell, or a Lactococcus lactis cell), a fungal cell, an algal cell, a plant cell, an insect cell, or a mammalian cell.
  • a cell can be a yeast cell.
  • Non-limiting examples of yeast cells include Pichia (e.g., Pichia methanolica , Pichia pastoris ), Candida (e.g., Candida boidinii ) cells, Hansenula (e.g., Hansenula polymorphd) cells, Torulopsis cells, and Sacharomyces (e.g., Sacharomyces cerevisae ) cells.
  • a cell can be a methylotrophic yeast cell.
  • Non-limiting examples of methylotrophic yeast cells include Pichia cells, Candida cells, Hansenula cells, and Torulopsis cells.
  • a cell can be a Pichia cell or a Sacharomyces cell.
  • this document provides a cell containing a nucleic acid construct (e.g., a first nucleic acid construct, a second nucleic acid construct, and so forth) including a nucleotide sequence operably linked to a promoter element as described herein.
  • a nucleic acid construct including a nucleotide sequence can include any appropriate nucleotide sequence.
  • “operably linked” means that a promoter or other expression element(s) are positioned relative to a coding sequence in such a way as to direct or regulate expression of the coding sequence (e.g., in-frame).
  • nucleic acid construct including a nucleotide sequence operably linked to any of the promoter elements as described herein can include nucleotide sequence of interest.
  • transcription and/or translation of a nucleotide sequence can result in the production of a product (e.g., protein, DNA, RNA, or a small molecule) of interest.
  • a nucleic acid construct including a nucleotide sequence can be a nucleic acid construct encoding a protein.
  • a nucleic acid construct including a nucleotide sequence can be a nucleic acid construct encoding an RNA (e.g., an mRNA, a tRNA, a ribozyme, a siRNA, miRNA, or a shRNA).
  • a nucleic acid construct including a nucleotide sequence can be a nucleic acid construct encoding a DNA.
  • a nucleic acid construct including a nucleotide sequence can be a nucleic acid construct whose transcription results in or contributes to the production of a small molecule (e.g., heme, ethanol, or a pharmaceutically active agent).
  • a nucleic acid construct (e.g., a first nucleic acid construct, a second nucleic acid construct, and so forth) including a nucleotide sequence can be a nucleic acid construct encoding a protein (e.g., a first protein, a second protein, and so forth).
  • a protein encoded by a nucleic acid construct including a nucleotide sequence operably linked to any of the promoter elements as described herein can be a dehydrin, a phytase, a protease, a catalase, a lipase, a peroxidase, an amylase, a transglutaminase, an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, or a ligase.
  • a protein encoded by a nucleic acid operably linked to any of the promoter elements as described herein can be an antibody or fragment thereof (e.g., adalimumab, rituximab, trastuzumab, bevacizumab, infliximab, or ranibizumab), an enzyme (e.g., a therapeutic enzyme such as alpha-galactosidase A, alpha-L-iduronidase, N- acetylgalactosamine-4-sulfatase, domase alfa, glucocerebrosidase, tissue plasminogen activator, rasburicase, an industrial enzyme (e.g., a catalase, a cellulase, a laccase, a glutaminase, or a glycosidase), or a biocatalyst (e.g., a transaminase, a cytomethyl
  • a regulatory protein e.g., a transcription factor (e.g. Mxrl, Adrl)), a peptide hormone (e.g., insulin, insulin-like growth factor 1, granulocyte colony- stimulating factor, follicle-stimulating hormone, or a growth hormone such as human growth hormone), a blood clotting protein (e.g., Factor VII), a cytokine (e.g., an interferon or erythropoietin), or a cytokine inhibitor (e.g., etanercept).
  • a transcription factor e.g. Mxrl, Adrl
  • a peptide hormone e.g., insulin, insulin-like growth factor 1, granulocyte colony- stimulating factor, follicle-stimulating hormone, or a growth hormone such as human growth hormone
  • a blood clotting protein e.g., Factor VII
  • a cytokine e.g., an interferon or
  • a protein can be a heme-binding protein (e.g., an exogenous or heterologous heme binding protein).
  • a heme-binding protein can be selected from the group consisting of a globin (PF00042 in the Pfam database), a cytochrome (e.g., a cytochrome P450, a cytochrome a, a cytochrome b, a cytochrome c), a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • a heme-binding protein can be selected from the group consisting of a globin (PF00042 in the Pfam database), a cytochrome (e.g., a cytochrome P450, a cytochrome a, a cytochrome b, a cytochrome c), a cytochrome c oxidase
  • a globin can be selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin (e.g., a beta hemoglobin, an alpha hemoglobin), a histoglobin, a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin (e.g., a HbN, a HbO, a Glb3, a cyanoglobin).
  • a hemoglobin e.g., a beta hemoglobin, an alpha hemoglobin
  • a histoglobin e.g., a leghemoglobin, a myoglobin
  • a neuroglobin e.g
  • the heme-binding protein can be a non-symbiotic hemoglobin. In some embodiments, the heme-binding protein can be a leghemoglobin. In some embodiments, the heme-binding protein can be soybean leghemoglobin (LegH).
  • LegH soybean leghemoglobin
  • a reference amino acid sequence for LegH is provided in Figure 1 as SEQ ID NO: 4. LegH is a protein that binds to heme, which results in a characteristic absorption at 415 nm and a distinct red color.
  • the LegH protein (also known as LGB2) is naturally found in root nodules of soybean (see, for example, UniprotKB Accession No. P02236). See, also, WO 2014/110539 and WO
  • a heme-binding protein can have an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence set forth in any of SEQ ID NOs: 1-27 ( Figure 1).
  • amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence set forth in any of SEQ ID NOs: 1-27 ( Figure 1).
  • a heme-binding protein is the amino acid sequence set forth in any of SEQ ID NOs: 1-27 ( Figure 1).
  • an alcohol oxidase promoter element from a Pichia species P. pastoris
  • other organisms can be used.
  • an alcohol oxidase promoter element from a different methyl otrophic yeast can be used, such as other species of the Pichia genus or species from any of the Candida , Hansenula , Pichia, and Torulopsis genera.
  • Non-limiting examples of methyl otrophic yeast species include Pichia methanolica , Pichia pastoris , Candida hoidinii , and Hansenula polymorpha (also called Pichia angusta).
  • a promoter element can be an alcohol oxidase promoter element from any of the Candida , Hansenula , Pichia , and Torulopsis genera. In some embodiments, a promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element from any of the Candida , Hansenula , Pichia , and Torulopsis genera. In some embodiments, a promoter element can be an alcohol oxidase promoter element from any of the Candida , Hansenula , Pichia , and Torulopsis genera.
  • a promoter element can be an alcohol oxidase promoter element from Pichia methanolica , Pichia pastoris , Candida hoidinii , or Hansenula polymorpha.
  • a promoter element can have at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%) sequence identity to an alcohol oxidase promoter element from Pichia methanolica , Pichia pastoris , Candida hoidinii , or Hansenula polymorpha.
  • a promoter element can be an alcohol oxidase promoter element from Pichia methanolica , Pichia pastoris , Candida hoidinii , or Hansenula polymorpha.
  • Non-limiting examples of other alcohol oxidase promoters include the AOX2 promoter from Pichia pastoris (see, e.g., Ohi, Hideyuki, et al. Molecular and General Genetics MGG 243.5 (1994): 489-499, incorporated herein by reference in its entirety), the alcohol oxidase (AOD1) promoter from Candida hoidinii (see, for example, GenBank Accession No. YSAAOD1A), the alcohol oxidase (MOX) promoter from Hansenula polymorpha (see, for example, GenBank Accession No.
  • an alcohol oxidase promoter element can be selected from the group consisting of a promoter element from AOX1, AOX2, AOD1, MOX, MODI, and MOD2.
  • an alcohol oxidase promoter element can be a promoter element from AOX1. In some embodiments, an alcohol oxidase promoter element can be a promoter element from AOX2. In some embodiments, an alcohol oxidase promoter element can be a promoter element from AOD1. In some embodiments, an alcohol oxidase promoter element can be a promoter element from MOX. In some embodiments, an alcohol oxidase promoter element can be a promoter element from MODI. In some embodiments, an alcohol oxidase promoter element can be a promoter element from MOD2.
  • any of the cells can include a second nucleic acid construct including a nucleotide sequence, transcription and/or translation of which can result in the production of a product a second product (e.g., a protein, an RNA, a DNA, or a small molecule) operably linked to a promoter element.
  • a second product e.g., a protein, an RNA, a DNA, or a small molecule
  • the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is the same as the promoter element to which the nucleotide sequence of the first nucleic acid construct is operably linked.
  • the promoter element to which the nucleotide sequence of the second nucleic acid construct is operably linked is a second promoter element.
  • a second promoter element can be any of the promoter elements described herein.
  • the second promoter element can have the same sequence as the first promoter element.
  • the second promoter element can include one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO: 28.
  • the second promoter element can include one or more (e.g., 2, 3, 4, 5, 6, 7,
  • mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28. .
  • the second promoter element can include one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530 A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • one or more selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530 A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A
  • one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a second promoter element: T146; Cl 54; T303; T426; A433; A435; T530; C572; T596; T617; T688; A696; T702; A709; A712; T714; A790; A841; or T862.
  • one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28 can be present in a second promoter element: 146; 154; 303; 426;
  • the second promoter element can include one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, or T714G relative to SEQ ID NO: 28.
  • the second promoter element can include one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, or 714G relative to SEQ ID NO: 28, as long as the indicated nucleobase is not the same as the corresponding naturally- occurring nucleobase.
  • one or more (e.g., 2, 3, 4, or 5) mutations corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a second promoter element: T688; A696; T702; A712; or T714.
  • one or more (e.g., 2, 3, 4, or 5) mutations corresponding to one of the following positions relative to SEQ ID NO: 28 can be present in a second promoter element: 688; 696; 702; 712; or 714.
  • the second promoter element can be an inducible promoter element (e.g., a methanol-inducible promoter element) or a constitutive promoter element.
  • inducible promoters can generally be used when genetically engineering cells (e.g., yeast (e.g., methylotrophic yeast).
  • yeast e.g., methylotrophic yeast
  • a methanol-inducible promoter, or a promoter element therefrom can be used.
  • Suitable methanol inducible promoters include pAOXl, as described herein, as well as other methanol -inducible promoters, or promoter elements therefrom. These include, without limitation, the pAOX2 promoter from Pichia pastoris , the alcohol oxidase (AOD1) promoter from Candida boidinii (see, for example, GenBank Accession No.
  • YSAAOD1A the alcohol oxidase (MOX) promoter from Hansenula polymorpha (see, for example, GenBank Accession No. X02425), the MODI or MOD2 promoter from Pichia methanolica (see, for example, Raymond et al., 1998, Yeast , 14: 11-23; and
  • FLD1 formaldehyde dehydrogenase (FLD1) promoter from P. pastoris (see, for example, GenBank Accession No. AF066054), or the PEX8 promoter from P. pastoris (see, for example, Kranthi et al., 2010, Yeast, 27:705-11). All of these promoters are known to be induced by methanol.
  • Suitable constitutive promoters and constitutive promoter elements include, without limitation, the P. pastoris promoter (or a portion thereof) from the transcriptional elongation factor EF-la gene (TEF1), which is strongly transcribed in a constitutive manner.
  • Other suitable constitutive promoters (or promoter elements therefrom) also can be used, including, without limitation, the glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) promoter from P. pastoris (see, for example, GenBank Accession No. U62648 1), the promoter from the potential glycosyl phosphatidyl inositol (GPI)-anchored protein, GCW14p (PAS chrl-4 0586) from P.
  • GPI glycosyl phosphatidyl inositol
  • inducible e.g., methanol -inducible
  • constitutive promoters or promoter elements therefrom
  • a second protein can be any of the proteins as described above.
  • the second protein can be a transcription factor (e.g., Mxrl).
  • any of the promoter elements herein e.g., a first promoter element or a second promoter element
  • a feedback loop may be constructed such that the transcription factor drives the expression of a protein of interest and also expression of additional copies of the transcription factor.
  • the transcription factor can be Mxrl.
  • the second protein can be a protein involved in heme biosynthesis (e.g., a protein selected from the group consisting of aminolevulinic acid synthase (ALAS), d-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and/or ferrochelatase (FC)).
  • a protein involved in heme biosynthesis e.g., a protein selected from the group consisting of aminolevulinic acid synthase (ALAS), d-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrin
  • Nucleic acids encoding one or more of the eight different enzymes involved in heme biosynthesis can be expressed as described herein.
  • a heterologous nucleic acid molecule encoding ALA synthase, ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase can be expressed in the strains (e.g., yeast strains (e.g., methyl otrophic yeast strains)) described herein.
  • yeast e.g., methylotrophic yeast
  • heterologous nucleic acids e.g., transgenes
  • any of the cells e.g., yeast cells (e.g., methylotrophic yeast cells) described herein can include additional nucleic acid constructs as a third, fourth, fifth, and so on, nucleic acid construct, and such constructs can, in some embodiments, be as described above for a second nucleic acid construct.
  • one or more of the genes involved in the heme biosynthetic pathway could be expressed from one or more constitutive promoters (see, e.g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety).
  • a product e.g., a protein
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element.
  • a first promoter element can be any promoter element described herein.
  • the first promoter element includes one or more mutations corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO: 28.
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element includes one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element includes one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, as long as the indicated nucleobase is not the same as the corresponding naturally-occurring nucleobase.
  • a nucleotide sequence e.g., encoding a first protein
  • the first promoter element includes one or more (e.g., 2, 3, 4,
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element includes one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element includes one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element includes one or more (e.g., 2, 3, 4, or 5) mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28, as long as the indicated nucleobase is not the same as the corresponding naturally- occurring nucleobase.
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more one or more (e.g., 2, 3, 4, or 5) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T688; A696; T702; A712; or T714.
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more one or more (e.g., 2, 3, 4, or 5) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: T688; A696; T702; A712; or T714.
  • the methods provided herein can include expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, wherein the promoter element includes one or more one or more (e.g., 2, 3, 4, or 5) mutations at positions corresponding to the following positions relative to SEQ ID NO: 28: 688; 696; 702; 712; or 714.
  • the method can be performed in the absence of added methanol.
  • the primary carbon source for methyl otrophic yeast cells can be dextrose, sucrose, xylose, lactose, maltose, isomaltose, arabinose, sugar alcohols, ethanol, acetate, or glycerol.
  • the primary carbon source can be selected from the group consisting of glucose, sucrose, sorbitol, methanol, and glycerol.
  • the primary carbon source can be selected from the group consisting of glucose, sucrose, sorbitol, and glycerol.
  • the primary carbon source can be an oligosaccharide or a polysaccharide (e.g., a starch, a pectin, cellulose, or hemicellulose).
  • the primary carbon source for a methylotrophic yeast cell can be a mixture of sugars (e.g., derived from cellulosic biomass or starch).
  • the methods provided herein allow for an increase in the titer of a product (e.g., a protein).
  • the titer of a product e.g., a protein
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more) compared to a corresponding method lacking a nucleic acid construct as described herein.
  • the titer of a product e.g., a protein
  • a product e.g., a protein
  • at least 5% e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%,
  • a nucleic acid encoding a first product e.g., a protein
  • a first promoter element operably linked to a first promoter element
  • the first promoter element lacks any mutation in a nucleotide position corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO: 28.
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%,
  • a nucleic acid construct including a nucleotide sequence e.g., encoding a first protein
  • the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28, as long as the indicated nucleobase is not the same as the corresponding naturally- occurring nucleobase.
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation lacks any mutation in a nucleotide position corresponding to nucleotide positions T146, Cl 54, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841,
  • a nucleic acid construct including a nucle
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation lacks any mutation in a nucleotide position corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to a corresponding method that includes expressing a nucleic
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promote
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any
  • the titer of a product e.g., a protein
  • a product e.g., a protein
  • at least 5% e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%
  • nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation lacks any mutation in a nucleotide position corresponding to nucleotide positions T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • nucleotide sequence e.g., encoding a first protein
  • the titer of a product can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more) compared to a corresponding method that includes expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks any mutation lacks any mutation in a nucleotide position corresponding to nucleotide positions 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter
  • a“titer” is the measurement of the amount of a substance in solution.
  • the“titer” of a heme-binding protein refers to the overall amount of the polypeptide, whether or not it is bound to heme, unless otherwise specified.
  • the titer of a product e.g., a protein
  • HPLC high-performance liquid chromatography-mass spectrometry
  • ELISA enzyme-linked immunosorbent assay
  • a“corresponding method” is a method that is essentially identical to a reference method in all ways except for the identified difference.
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations corresponding to a mutation in a nucleotide position corresponding to nucleotide positions 668-734 (e.g., nucleotide positions 673-729, nucleotide positions 678-724, nucleotide positions 683-719, or nucleotide positions 688-714) relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C,
  • A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations included in the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • a nucleotide sequence e.g., encoding
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at a nucleotide position corresponding to nucleotide positions T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations at a nucleotide position corresponding to nucleo
  • a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at a nucleotide position corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688,
  • 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations at a nucleotide position corresponding to nucleotide positions 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • a nucleotide sequence e.g., encoding a first protein
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations included in the group consisting of mutations corresponding to T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • a nucleotide sequence
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations selected from the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations included in the group consisting of mutations corresponding to 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • a nucleotide sequence e.g., encoding a
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at a nucleotide position corresponding to nucleotide positions T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations included in the group consisting of mutations corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • a nucleotide sequence e.g., encoding a first protein
  • a corresponding method for expressing a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element, where the first promoter element lacks one or more mutations at a nucleotide position corresponding to nucleotide positions 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28 would essentially be the same as the reference method in all aspects (e.g., genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a first promoter element that lacks any of the mutations included in the group consisting of mutations corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • a nucleotide sequence e.g., encoding a first protein
  • Genetically engineering a cell typically includes introducing a recombinant nucleic acid molecule (also called a nucleic acid construct) into the cell.
  • a recombinant nucleic acid molecule typically includes an exogenous nucleic acid that encodes a product (e.g., a protein (e.g., a protein involved in heme biosynthesis, a heme-binding protein, or a transcription factor)) operably linked to at least one promoter element (e.g., an inducible or constitutive promoter element).
  • a recombinant nucleic acid molecule can include a linear sequence of two or more protein-coding sequences operably linked to the same or separate promoter elements (e.g., a first promoter operably linked to a first nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) and a second promoter operably linked to a second nucleic acid construct including a nucleotide sequence (e.g., encoding a second protein), or a promoter operably linked to a first nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) and a second nucleic acid construct including a nucleotide sequence (e.g., encoding a second protein)).
  • a recombinant nucleic acid molecule including at least one promoter operably linked to a nucleotide sequence can be called
  • a recombinant nucleic acid can include expression elements.
  • Expression elements include nucleic acid sequences that direct and regulate expression of nucleic acid coding sequences.
  • One example of an expression element is a promoter sequence.
  • Expression elements also can include introns, enhancer sequences, response elements, or inducible elements that modulate expression of a nucleic acid.
  • Expression elements can be of bacterial, yeast, insect, mammalian, or viral origin, and vectors can contain a combination of elements from different origins.
  • Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual. 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683,202;
  • Suitable transcription factors, and nucleic acids encoding transcription factors include, for example, Mxrl from Pichia pastoris.
  • a representative P. pastoris Mxrl nucleic acid sequence can be found, for example, in GenBank Accession No. DQ395124, while a representative P. pastoris Mxrl polypeptide sequence can be found, for example, in GenBank Accession No. ABD57365.
  • the transcription factor can be a Mitl sequence from P. pastoris (see, for example, GenBank Accession No. CAY70887).
  • Suitable transcription factors also can be found in Hansenula polymorpha (e.g., Adrl; see, for example, GenBank Accession No. AEOI02000005, bases 858873 to 862352, for the nucleic acid sequence and GenBank Accession No. ESX01253 for the amino acid sequence) and Candida boidinii (e.g., Trml; see, for example, GenBank Accession No. AB365355 for the nucleic acid sequence and GenBank Accession No. BAF99700 for the amino acid sequence; and Trm2; see, for example, GenBank Accession No. AB548760 for the nucleic acid sequence and GenBank Accession No. BAJ07608 for the amino acid sequence).
  • Hansenula polymorpha e.g., Adrl; see, for example, GenBank Accession No. AEOI02000005, bases 858873 to 862352, for the nucleic acid sequence and GenBank Accession No. ESX01253 for the amino acid sequence
  • Transcription factors such as Mxrl may be normally expressed at low levels.
  • a transcription factor can bind to a promoter element as described herein and activate transcription from the promoter element.
  • a positive feedback loop can be created to help drive expression of other nucleic acid sequences (e.g., protein-encoding nucleic acid sequences) operably linked to the promoter.
  • transcription factors that can be used with an AOX1 promoter (e.g., a mutated AOX1 promoter) include Mxrl, Mitl, Adrl, Trml, Trm2, and combinations thereof.
  • a transcription factor that can be used with an AOX1 promoter can include Mxrl .
  • a non-limiting example of a transcription factor that can be used with an MOX promoter e.g., a mutated MOX promoter
  • Adrl a transcription factor that can be used with an MOX promoter
  • transcription factors that can be used with an AOD1 promoter include Trml, Trm2, or a combination thereof.
  • two methanol -regulated transcription factors e.g., Mxrl and Mitl
  • can be operably linked to a methanol inducible promoter element e.g., pAOXl).
  • the recombinant nucleic acid molecules described herein can be stably integrated into the genome of the cell (e.g., yeast cell (e.g., methyl otrophic yeast cell), or can be
  • a first nucleic acid construct including a nucleotide sequence e.g., encoding a first protein (e.g., a heme-binding protein)
  • a promoter element e.g., a promoter element as described herein
  • a second nucleic acid construct including a nucleotide sequence e.g., encoding a second protein (e.g., a transcription factor)
  • a promoter element e.g., a promoter element as described herein
  • a first nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a promoter element (e.g., a promoter element as described herein) and a second nucleic acid construct including a nucleotide sequence (e.g., encoding a second protein) operably linked to a promoter element (e.g., a promoter element as described herein) can be included in the same nucleic acid construct.
  • a first nucleic acid construct including a nucleotide sequence (e.g., encoding a first protein) operably linked to a promoter element can be contiguous with a second nucleic acid construct including a nucleotide sequence (e.g., encoding a second protein) operably linked to a promoter element.
  • the second nucleic acid construct including a nucleotide sequence e.g., encoding a second protein
  • a single promoter, or promoter element therefrom can be used to drive transcription of both or all of the nucleotide sequences (e.g., a nucleic acid encoding the first protein as well as a second protein).
  • yeast cells e.g., methylotrophic yeast cells
  • methods of introducing nucleic acids into cells include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation.
  • Methods of culturing cells e.g., yeast cells (e.g., methylotrophic yeast cells)
  • yeast cells e.g., methylotrophic yeast cells
  • Methods of culturing cells also are known in the art. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2 nd Ed., Humana Press, Inc.
  • methanol is not required to obtain efficient expression at high levels of one or more products (e.g., proteins) of interest.
  • methanol is not required to obtain efficient expression at high levels of one or more products (e.g., proteins) of interest.
  • the methods provided herein also can include purifying an expressed protein.
  • an“enriched” protein is a protein that accounts for at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more) by dry weight, of the mass of the production cell, or at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99%) by dry weight, the mass of the production cell lysate (e.g., excluding cell wall or membrane material).
  • the mass of the production cell lysate e.g., excluding cell wall or membrane material.
  • a “purified” protein is a protein that has been separated from cellular components that naturally accompany it. Typically, the protein is considered“purified” when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) by dry weight, free from other proteins and naturally occurring molecules with which it is naturally associated.
  • nucleic acids can include DNA and RNA, and includes nucleic acids that contain one or more nucleotide analogs or backbone modifications.
  • a nucleic acid can be single stranded or double stranded, which usually depends upon its intended use. Also provided are nucleic acids and polypeptides that differ from a given sequence.
  • Nucleic acids and polypeptides can have at least 50% sequence identity (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a given nucleic acid or polypeptide sequence.
  • a nucleic acid or polypeptide can have 100% sequence identity to a given nucleic acid or polypeptide sequence.
  • the number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value.
  • the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence. It also will be appreciated that a single sequence can align with more than one other sequence and hence, can have different percent sequence identity values over each aligned region.
  • the alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW and default parameters, which allows alignments of nucleic acid or polypeptide sequences to be carried out across their entire length (global alignment). Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500.
  • ClustalW calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments.
  • the default parameters can be used (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5); for an alignment of multiple nucleic acid sequences, the following parameters can be used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes.
  • word size 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5
  • scoring method percentage
  • number of top diagonals 4
  • gap penalty 5
  • weight transitions yes.
  • word size word size:
  • ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website or at the European Bioinformatics Institute website on the World Wide Web.
  • Changes can be introduced into a nucleic acid molecule, thereby leading to changes in the amino acid sequence of the encoded polypeptide.
  • changes can be introduced into nucleic acid coding sequences using mutagenesis (e.g., site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis, UV mutagenesis or radiation induced mutagenesis) or by chemically synthesizing a nucleic acid molecule having such changes.
  • mutagenesis e.g., site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis, UV mutagenesis or radiation induced mutagenesis
  • Such nucleic acid changes can lead to conservative and/or non-conservative amino acid substitutions at one or more amino acid residues.
  • A“conservative amino acid substitution” is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see, for example, Day
  • Nucleic acid and/or polypeptide sequences may be modified as described herein to improve one or more properties such as, without limitation, increased expression (e.g., transcription and/or translation), tighter regulation, deregulation, loss of catabolite repression, modified specificity, secretion, thermostability, solvent stability, oxidative stability, protease resistance, catalytic activity, and/or color.
  • an“isolated” nucleic acid molecule is a nucleic acid molecule that is free of sequences that naturally flank one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived (e.g., a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion).
  • Such an isolated nucleic acid molecule is generally introduced into a vector (e.g., a cloning vector, or an expression vector) for convenience of manipulation or to generate a fusion nucleic acid molecule, discussed in more detail below.
  • an isolated nucleic acid molecule can include an engineered nucleic acid molecule such as a recombinant or a synthetic nucleic acid molecule.
  • Vectors as described herein can be introduced into a host cell.
  • host cell refers to the particular cell into which the nucleic acid is introduced and also includes the progeny of such a cell that carry the vector.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • nucleic acids can be expressed in bacterial cells such as E. coli , or in insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
  • nucleic acids are known to those skilled in the art.
  • Many methods for introducing nucleic acids into host cells are well known to those skilled in the art and include, without limitation, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.
  • electroporation calcium phosphate precipitation
  • PEG polyethylene glycol
  • heat shock heat shock
  • lipofection lipofection
  • microinjection microinjection
  • viral-mediated nucleic acid transfer include, without limitation, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.
  • Nucleic acids can be isolated using techniques routine in the art. For example, nucleic acids can be isolated using any method including, without limitation, recombinant nucleic acid technology, and/or the polymerase chain reaction (PCR). General PCR techniques are described, for example in PCR Primer: A Laboratory Manual Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate a nucleic acid. Isolated nucleic acids also can be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides.
  • PCR polymerase chain reaction
  • Polypeptides can be purified from natural sources (e.g., a biological sample) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography.
  • a polypeptide also can be purified, for example, by expressing a nucleic acid in an expression vector.
  • a purified polypeptide can be obtained by chemical synthesis. The extent of purity of a polypeptide can be measured using any appropriate method, e.g., column
  • a construct or vector containing a nucleic acid construct as described herein (e.g., a nucleotide sequence that encodes a polypeptide operably linked to a promoter element as described herein) also is provided.
  • Constructs or vectors, including expression constructs or vectors, are commercially available or can be produced by recombinant DNA techniques routine in the art.
  • a construct or vector containing a nucleic acid can have expression elements operably linked to such a nucleic acid, and further can include sequences such as those encoding a selectable marker (e.g., an antibiotic resistance gene).
  • a construct or vector containing a nucleic acid can encode a chimeric or fusion polypeptide (i.e., a polypeptide operatively linked to a heterologous polypeptide, which can be at either the N-terminus or C-terminus of the
  • heterologous polypeptides are those that can be used in purification of the encoded polypeptide (e.g., 6xHis tag, glutathione S-transferase (GST)).
  • Nucleic acids also can be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57). Sambrook et al. discloses suitable Southern blot conditions for oligonucleotide probes less than about 100 nucleotides (Sections 11.45-11.46).
  • the Tm between a sequence that is less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46.
  • Sambrook et al. additionally discloses Southern blot conditions for oligonucleotide probes greater than about 100 nucleotides (see Sections 9.47-9.54).
  • the Tm between a sequence greater than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Sections 9.50-9.51 of Sambrook et al.
  • the conditions under which membranes containing nucleic acids are prehybridized and hybridized, as well as the conditions under which membranes containing nucleic acids are washed to remove excess and non-specifically bound probe, can play a significant role in the stringency of the hybridization.
  • Such hybridizations and washes can be performed, where appropriate, under moderate or high stringency conditions.
  • washing conditions can be made more stringent by decreasing the salt concentration in the wash solutions and/or by increasing the temperature at which the washes are performed.
  • high stringency conditions typically include a wash of the membranes in 0.2X SSC at 65°C.
  • interpreting the amount of hybridization can be affected, for example, by the specific activity of the labeled oligonucleotide probe, by the number of probe-binding sites on the template nucleic acid to which the probe has hybridized, and by the amount of exposure of an autoradiograph or other detection medium.
  • any number of hybridization and washing conditions can be used to examine hybridization of a probe nucleic acid molecule to immobilized target nucleic acids, it is more important to examine hybridization of a probe to target nucleic acids under identical hybridization, washing, and exposure conditions.
  • the target nucleic acids are on the same membrane.
  • a nucleic acid molecule is deemed to hybridize to a nucleic acid but not to another nucleic acid if hybridization to a nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) greater than hybridization to another nucleic acid.
  • the amount of hybridization can be quantitated directly on a membrane or from an
  • Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • An antibody can be polyclonal or monoclonal.
  • An antibody having specific binding affinity for a polypeptide can be generated using methods well known in the art.
  • the antibody can be attached to a solid support such as a microtiter plate using methods known in the art. In the presence of a polypeptide, an antibody-polypeptide complex is formed.
  • Detection e.g., of an amplification product, a hybridization complex, or a polypeptide is usually accomplished using detectable labels.
  • label is intended to encompass the use of direct labels as well as indirect labels.
  • Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • Methods are described herein that can be used to generate a strain that lacks sequences for selection (i.e., that lacks a selectable marker). These methods include using a circular plasmid DNA vector and a linear DNA sequence; the circular plasmid DNA vector contains a selection marker and an origin of DNA replication (also known as an autonomously replicating sequence (ARS)), and the linear DNA sequence contains sequences for integration into the Pichia genome by homologous recombination.
  • ARS autonomously replicating sequence
  • a linear DNA molecule additionally can include nucleic acid sequences encoding one or more proteins of interest such as, without limitation, heme-bound LegH, a dehydrin, a phytase, a protease a catalase, a lipase, a peroxidase, an amylase, a transglutaminase, an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, a ligase, one or more enzymes involved in the pathway for production of small molecules, such as ethanol, lactic acid, butanol, adipic acid or succinic acid, or an antibody against any such proteins.
  • Cells e.g., yeast cells (e.g., methylotrophic yeast cells (e.g., Pichia))
  • yeast cells e.g., methylotrophic yeast cells (e.g., Pichia)
  • Transformants then can be screened for integration of the linear DNA molecule into the genome using, for example, PCR.
  • the cells can be grown in the absence of selection for the circular plasmid. Because the marker-bearing plasmid is not stably maintained in the absence of selection, the plasmid is lost, often very quickly, after selection is relaxed. The resulting strain carries the integrated linear DNA in the absence of heterologous sequences for selection.
  • strains e.g., Pichia strains
  • a selectable marker e.g., a heterologous selection marker
  • Embodiment l is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 2 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions
  • Embodiment 3 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions
  • Embodiment 4 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions
  • Embodiment 5 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions
  • Embodiment 6 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions
  • Embodiment 7 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions
  • Embodiment 8 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions
  • Embodiment 9 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions
  • Embodiment 10 is the nucleic acid construct of embodiment 1, wherein the first alcohol oxidase promoter has the sequence of SEQ ID NO: 29.
  • Embodiment 11 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 12 is the nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, Cl 54, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 13 is the nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 14 is the nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 15 is the nucleic acid construct of embodiment 11, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, Cl 54, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 16 is the nucleic acid construct of any one of embodiments 11-15, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 17 is the nucleic acid construct of any one of embodiments 11-15, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 18 is the nucleic acid construct of any one of embodiments 11-15, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 19 is the nucleic acid construct of any one of embodiments 11-15, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 20 is the nucleic acid construct of any one of embodiments 11-15, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 21 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 22 is the nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 23 is the nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 24 is the nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 25 is the nucleic acid construct of embodiment 21, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 26 is the nucleic acid construct of any one of embodiments 21-25, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • Embodiment 27 is the nucleic acid construct of any one of embodiments 21-25, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • Embodiment 28 is the nucleic acid construct of any one of embodiments 21-25, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • Embodiment 29 is the nucleic acid construct of any one of embodiments 21-25, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • Embodiment 30 is the nucleic acid construct of any one of embodiments 21-25, wherein the first alcohol oxidase promoter element comprises mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 relative to SEQ ID NO: 28.
  • Embodiment 31 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • Embodiment 32 is the nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A
  • Embodiment 33 is the nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A
  • Embodiment 34 is the nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A
  • Embodiment 35 is the nucleic acid construct of embodiment 31, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A
  • Embodiment 36 is the nucleic acid construct of any one of embodiments 1-35, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 37 is the nucleic acid construct of any one of embodiments 1-35, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 38 is the nucleic acid construct of any one of embodiments 1-35, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 39 is the nucleic acid construct of any one of embodiments 1-35, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 40 is the nucleic acid construct of any one of embodiments 1-35, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 41 is a nucleic acid construct comprising a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435 G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862 A relative to SEQ ID NO: 28.
  • Embodiment 42 is the nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 43 is the nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 44 is the nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 45 is the nucleic acid construct of embodiment 41, wherein the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element comprises five or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 46 is the nucleic acid construct of any one of embodiments 1-45, wherein the first alcohol oxidase promoter element comprises one or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 47 is the nucleic acid construct of any one of embodiments 1-45, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 48 is the nucleic acid construct of any one of embodiments 1-45, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 49 is the nucleic acid construct of any one of embodiments 1-45, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 50 is the nucleic acid construct of any one of embodiments 1-45, wherein the first alcohol oxidase promoter element comprises the mutations 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 51 is the nucleic acid construct of any one of embodiments 1-50, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MODI, and MOD2.
  • the first alcohol oxidase promoter element is an alcohol oxidase promoter element from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MODI, and MOD2.
  • Embodiment 52 is the nucleic acid construct of any one of embodiments 1-51, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element.
  • AOX1 alcohol oxidase 1
  • Embodiment 53 is the nucleic acid construct of any one of embodiments 1-52, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO: 28.
  • Embodiment 54 is the nucleic acid construct of any one of embodiments 1-52, wherein the first alcohol oxidase promoter element has at least 95% sequence identity to SEQ ID NO: 28.
  • Embodiment 55 is the nucleic acid construct of any one of embodiments 1-54, further comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to the first alcohol oxidase promoter element.
  • Embodiment 56 is the nucleic acid construct of embodiment 55, wherein the nucleotide sequence encodes a first protein.
  • Embodiment 57 is the nucleic acid construct of embodiment 56, wherein the first protein is exogenous to a methyl otrophic yeast cell.
  • Embodiment 58 is the nucleic acid construct of embodiment 56 or embodiment 57, wherein the first protein is heterologous to a methylotrophic yeast cell.
  • Embodiment 59 is the nucleic acid construct of any one of embodiments 56-58, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, a cytokine inhibitor, and a heme-binding protein.
  • Embodiment 60 is the nucleic acid construct of any one of embodiments 56-59, wherein the first protein is a heme-binding protein.
  • Embodiment 61 is the nucleic acid construct of embodiment 60, wherein the heme binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • the heme binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • Embodiment 62 is the nucleic acid construct of embodiment 60, wherein the heme binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin.
  • the heme binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a leghemoglob
  • Embodiment 63 is the nucleic acid construct of embodiment 60, wherein the heme binding protein is a non-symbiotic hemoglobin.
  • Embodiment 64 is the nucleic acid construct of embodiment 60, wherein the heme binding protein is a leghemoglobin.
  • Embodiment 65 is the nucleic acid construct of embodiment 60, wherein the heme binding protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any of SEQ ID NOs: 1-27.
  • Embodiment 66 is the nucleic acid construct of any one of embodiments 1-65, wherein the first alcohol oxidase promoter element comprises a recognition sequence for a transcription factor.
  • Embodiment 67 is a cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is the nucleic acid construct of any one of embodiments 1-66.
  • Embodiment 68 is the cell of embodiment 67, wherein the cell is a yeast cell.
  • Embodiment 69 is the cell of embodiment 68, wherein the yeast cell is a methylotrophic yeast cell.
  • Embodiment 70 is the cell of embodiment 69, wherein the methylotrophic yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell.
  • the methylotrophic yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell.
  • Embodiment 71 is the cell of embodiment 69 or embodiment 70, wherein the
  • methylotrophic yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell.
  • Embodiment 72 is the cell of any one of embodiments 69-71, wherein the methylotrophic yeast cell is a Pichia pastoris cell.
  • Embodiment 73 is the cell of any one of embodiments 67-72, further comprising a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence is operably linked to the first alcohol oxidase promoter element or to a second promoter element.
  • Embodiment 74 is the cell of embodiment 73, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to a second promoter element that has the same sequence as the first alcohol oxidase promoter element.
  • Embodiment 75 is the cell of any one of embodiments 73-74, wherein the nucleotide sequence of the second nucleic acid construct encodes a second protein.
  • Embodiment 76 is the cell of embodiment 75, wherein the second protein is a
  • Embodiment 77 is the cell of embodiment 76, wherein the nucleotide sequence encoding the second protein is operably linked to a second promoter element that comprises a recognition sequence for the transcription factor.
  • Embodiment 78 is the cell of embodiment 76 or embodiment 77, wherein the first alcohol oxidase promoter element comprises a recognition sequence for the transcription factor.
  • Embodiment 79 is the cell of any one of embodiments 75-78, wherein the second protein is a protein involved in heme biosynthesis.
  • Embodiment 80 is the cell of embodiment 79, wherein the protein involved in heme biosynthesis is selected from the group consisting of aminolevulinic acid synthase (ALAS), d- aminolevulinic acid dehydratase (ALAD), porphogilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and ferrochelatase (FC).
  • aminolevulinic acid synthase (ALAS), d- aminolevulinic acid dehydratase (ALAD), porphogilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3
  • Embodiment 81 is a method of producing a product in a cell comprising:
  • nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 82 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 673-729 relative to SEQ ID NO: 28.
  • Embodiment 83 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 678-724 relative to SEQ ID NO: 28.
  • Embodiment 84 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 683-719 relative to SEQ ID NO: 28.
  • Embodiment 85 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 688-714 relative to SEQ ID NO: 28.
  • Embodiment 86 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 87 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises three or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 88 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises four or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 89 is the method of embodiment 81, wherein the first alcohol oxidase promoter element comprises five or more mutations at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 90 is the method of any one of embodiments 81-89, wherein a titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises a mutation at one or more nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28 is greater than a titer of the product produced expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutation at nucleotide positions corresponding to any of nucleotide positions 668-734 relative to SEQ ID NO: 28.
  • Embodiment 91 is a method of producing a product in a cell comprising:
  • a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO:
  • Embodiment 92 is the method of embodiment 91, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 93 is the method of embodiment 91, wherein the first alcohol oxidase promoter element includes three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 94 is the method of embodiment 91, wherein the first alcohol oxidase promoter element includes four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 95 is the method of embodiment 91, wherein the first alcohol oxidase promoter element includes five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28.
  • Embodiment 96 is the method of any one of embodiments 91-95, wherein the first alcohol oxidase promoter element includes one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to of T688, A696,
  • T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 97 is the method of any one of embodiments 91-95, wherein the first alcohol oxidase promoter element includes two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696,
  • T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 98 is the method of any one of embodiments 91-95, wherein the first alcohol oxidase promoter element includes three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696,
  • T702, A712, and T714 relative to SEQ ID NO: 28.
  • Embodiment 99 is the method of any one of embodiments 91-95, wherein the first alcohol oxidase promoter element includes four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of T688, A696,
  • T702, A712, and T714 as compared to SEQ ID NO: 28.
  • Embodiment 100 is the method of any one of embodiments 91-95, wherein the first alcohol oxidase promoter element includes mutations at nucleotide positions corresponding to T688, A696, T702, A712, and T714 as compared to SEQ ID NO: 28.
  • Embodiment 101 is the method of any one of embodiments 91-100, wherein a titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to T146, C154, T303, T426, A433, A435, T530, C572, T596, T617, T688, A696, T702, A709, A712, T714, A790, A841, and T862 relative to SEQ ID NO: 28 is greater than a titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any
  • Embodiment 102 is a method of producing a product in a cell comprising:
  • nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688,
  • Embodiment 103 is the method of embodiment 102, wherein the first alcohol oxidase promoter element comprises two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 104 is the method of embodiment 102, wherein the first alcohol oxidase promoter element includes three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 105 is the method of embodiment 102, wherein the first alcohol oxidase promoter element includes four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 106 is the method of embodiment 102, wherein the first alcohol oxidase promoter element includes five or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28.
  • Embodiment 107 is the method of any one of embodiments 102-106, wherein the first alcohol oxidase promoter element includes one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to of 688, 696, 702,
  • Embodiment 108 is the method of any one of embodiments 102-106, wherein the first alcohol oxidase promoter element includes two or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of 688, 696, 702,
  • Embodiment 109 is the method of any one of embodiments 102-106, wherein the first alcohol oxidase promoter element includes three or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of 688, 696, 702,
  • Embodiment 110 is the method of any one of embodiments 102-106, wherein the first alcohol oxidase promoter element includes four or more mutations at nucleotide positions selected from the group consisting of nucleotide positions corresponding to of 688, 696, 702,
  • Embodiment 111 is the method of any one of embodiments 102-106, wherein the first alcohol oxidase promoter element includes mutations at nucleotide positions corresponding to 688, 696, 702, 712, and 714 as compared to SEQ ID NO: 28.
  • Embodiment 112 is the method of any one of embodiments 102-111, wherein a titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element comprises one or more mutations at a nucleotide position selected from the group consisting of nucleotide positions corresponding to 146, 154, 303, 426, 433, 435, 530, 572, 596, 617, 688, 696, 702, 709, 712, 714, 790, 841, and 862 relative to SEQ ID NO: 28 is greater than a titer of the product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element lacks any mutations at a nu
  • Embodiment 113 is a method of producing a product in a cell comprising:
  • a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element
  • the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO:
  • Embodiment 114 is the method of embodiment 113, wherein the first alcohol oxidase promoter element includes two or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • Embodiment 115 is the method of embodiment 113, wherein the first alcohol oxidase promoter element includes three or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • Embodiment 116 is the method of embodiment 113, wherein the first alcohol oxidase promoter element includes four or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • Embodiment 117 is the method of embodiment 113, wherein the first alcohol oxidase promoter element includes five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28.
  • the first alcohol oxidase promoter element includes five or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A7
  • Embodiment 118 is the method of any one of embodiments 113-117, wherein the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to T146C, C154T, T303C, T426A, A433T, A435G, T530A, C572T, T596C, T617C, T688C, A696T, T702C, A709G, A712G, T714G, A790G, A841T, and T862A relative to SEQ ID NO: 28 is greater than the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter
  • Embodiment 119 is the method of any one of embodiments 81-118, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 120 is the method of any one of embodiments 81-118, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 121 is the method of any one of embodiments 81-118, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 122 is the method of any one of embodiments 81-118, wherein the first alcohol oxidase promoter element comprises the mutations T688C, A696T, T702C, A712G, and T714G relative to SEQ ID NO: 28.
  • Embodiment 123 is a method of producing a product in a cell comprising:
  • a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 84 IT, and 862 A relative to SEQ ID NO: 28.
  • Embodiment 124 is the method of embodiment 123, wherein the first alcohol oxidase promoter element includes two or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 125 is the method of embodiment 123, wherein the first alcohol oxidase promoter element includes three or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 126 is the method of embodiment 123, wherein the first alcohol oxidase promoter element includes four or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 127 is the method of embodiment 123, wherein the first alcohol oxidase promoter element includes five or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28.
  • Embodiment 128 is the method of any one of embodiments 123-127, wherein the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element includes one or more mutations selected from the group consisting of mutations corresponding to 146C, 154T, 303C, 426A, 433T, 435G, 530A, 572T, 596C, 617C, 688C, 696T, 702C, 709G, 712G, 714G, 790G, 841T, and 862A relative to SEQ ID NO: 28 is greater than the titer of a product produced by expressing a nucleic acid construct comprising a nucleotide sequence encoding a first protein operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element
  • Embodiment 129 is the method of any one of embodiments 81-128, wherein the first alcohol oxidase promoter element comprises two or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 130 is the method of any one of embodiments 81-128, wherein the first alcohol oxidase promoter element comprises three or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 131 is the method of any one of embodiments 81-128, wherein the first alcohol oxidase promoter element comprises four or more mutations selected from the group consisting of 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 132 is the method of any one of embodiments 81-128, wherein the first alcohol oxidase promoter element comprises the mutations 688C, 696T, 702C, 712G, and 714G relative to SEQ ID NO: 28.
  • Embodiment 133 is a method of producing a product in a cell comprising:
  • nucleic acid construct comprising a nucleotide sequence operably linked to a first alcohol oxidase promoter element, wherein the first alcohol oxidase promoter element is the nucleic acid construct of any one of embodiments 1-54.
  • Embodiment 134 is the method of any one of embodiments 81-133, wherein the first alcohol oxidase promoter element is an alcohol oxidase promoter element from a promoter selected from the group consisting of AOX1, AOX2, AOD1, MOX, MODI, and MOD2.
  • Embodiment 135 is the method of any one of embodiments 81-134, wherein the first alcohol oxidase promoter element is an alcohol oxidase 1 (AOX1) promoter element.
  • AOX1 alcohol oxidase 1
  • Embodiment 136 is the method of any one of embodiments 81-135, wherein the first alcohol oxidase promoter element has at least 90% sequence identity to SEQ ID NO: 28.
  • Embodiment 137 is the method of any one of embodiments 55-135, wherein the first alcohol oxidase promoter element has at least 95% sequence identity to SEQ ID NO: 28.
  • Embodiment 138 is the method of any one of embodiments 81-137, wherein the first alcohol oxidase promoter element has the sequence of SEQ ID NO: 29.
  • Embodiment 139 is the method of any one of embodiments 81-138, wherein the cell is a yeast cell.
  • Embodiment 140 is the method of embodiment 139, wherein the yeast cell is a methylotrophic yeast cell.
  • Embodiment 141 is the method of any one of embodiments 81-140, wherein the nucleotide sequence operably linked to the first alcohol oxidase promoter element encodes a first protein.
  • Embodiment 142 is the method of embodiment 141, wherein the first protein is exogenous to the cell.
  • Embodiment 143 is the method of any one of embodiments 141-142, wherein the first protein is heterologous to the cell.
  • Embodiment 144 is the method of any one of embodiments 141-143, wherein the first protein is selected from the group consisting of an antibody or fragment thereof, an enzyme, a regulatory protein, a peptide hormone, a blood clotting protein, a cytokine, and a heme-binding protein.
  • Embodiment 145 is the method of any one of embodiments 141-144, wherein the first protein is a heme-binding protein.
  • Embodiment 146 is the method of embodiment 145, wherein the heme-binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • the heme-binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.
  • Embodiment 147 is the method of embodiment 145, wherein the heme-binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin.
  • the heme-binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, a flavohemoglobin, a globin E, a globin X, a globin Y, a hemoglobin, a histoglobin, a leghemo
  • Embodiment 148 is the method of embodiment 145, wherein the heme-binding protein is a non-symbiotic hemoglobin.
  • Embodiment 149 is the method of embodiment 145, wherein the heme-binding protein is a leghemoglobin.
  • Embodiment 150 is the method of embodiment 145, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to an amino acid sequence in any one of SEQ ID NOs: 1-27.
  • Embodiment 151 is the method of any one of embodiments 81-150, wherein the first alcohol oxidase promoter element contains one or more recognition sequences for a transcription factor.
  • Embodiment 152 is the method of any one of embodiments 81-151, further comprising expressing a second nucleic acid construct comprising a nucleotide sequence, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to the first alcohol oxidase promoter element or to a second promoter element.
  • Embodiment 153 is the method of embodiment 152, wherein the nucleotide sequence of the second nucleic acid construct is operably linked to a second promoter element that has the same sequence as the first alcohol oxidase promoter element.
  • Embodiment 154 is the method of any one of embodiments 152-153, wherein the nucleotide sequence of the second nucleic acid construct encodes a second protein.
  • Embodiment 155 is the method of embodiment 154, wherein the second protein is a transcription factor.
  • Embodiment 156 is the method of embodiment 155, wherein the nucleotide sequence encoding the second protein is operably linked to a second promoter element that comprises a recognition sequence for the transcription factor.
  • Embodiment 157 is the method of embodiment 155, wherein the first alcohol oxidase promoter element comprises a recognition sequence for the transcription factor.
  • Embodiment 158 is the method of 154, wherein the second protein is a protein involved in heme biosynthesis.
  • Embodiment 159 is the method of embodiment 158, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALAS, AL D, PBGD, EIPG3S, UPG3D, COPROX, PROTOX, and FC.
  • Embodiment 160 is the method of any one of embodiments 81-159, wherein the method is carried out in the absence of added methanol.
  • DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat # 12033-015) by electroporation using MicroPulser (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat # 165-2089); after a pulse, 1 ml SOC (super optimal broth with catabolite repression) was added to cells and cells were incubated at 37°C for 1 h with shaking at 200 rpm. 10 m ⁇ of recovery mixture was plated on LB (lysogeny broth) agar plates containing ampicillin at a concentration of 100 pg/ml. Plates were incubated overnight at 37°C. Plasmids were isolated and purified using a
  • YPD yeast extract-peptone-dextrose
  • Selected strains of P. pastoris were grown to mid-exponential growth phase (about 2 OD) in 25 ml YPD (yeast extract-peptone-dextrose) medium. Cells were collected by centrifugation at 930xg- for 15 minutes. The cell pellet was resuspended in 2 ml of a solution of 80% YPD and 200 mM HEPES (4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid), pH 6.8. 75 pi of 1 M DTT (dithiothreitol) was added. The resuspended cell pellet was mixed at 100 rpm at 30° C for 25 minutes.
  • HEPES 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid
  • a 40 ml volume of ice cold, sterile water was added to the suspension, and the cells were collected by centrifugation at 1125 xg for 15 minutes and placed on ice.
  • the cell pellet was resuspended in 40 ml ice cold water and collected as before for two additional wash steps.
  • the cell pellet was then resuspended in 20 ml of ice cold 1 M sorbitol and collected by centrifugation as before.
  • the final cell pellet was suspended in 0.3 ml ice cold, sterile 1M sorbitol, ali quoted, and frozen at -80° C.
  • plasmid DNA 50-100 ng of plasmid DNA was transformed into 30 m ⁇ of electrocompetent P. pastoris cells using a 1 mm gap GenePulser cuvette (BioRad) with a GenePulser (BioRad) set at 1.15 kV.
  • 1 ml of YPD/1M sorbitol was added and mixed at a 1 : 1 ratio to the cells.
  • the cells were allowed to recover for 3 h at 30° C with shaking at 100 rpm.
  • 100 m ⁇ of the recovery mixture was plated on a YPD plate containing the appropriate antibiotic (primary transformation plate), and the rest of the transformed cells were plated on a second YPD plate with the appropriate antibiotic. Plates were incubated at 30° C for 48 hours.
  • GFP Green Fluorescent Protein
  • AOX1 methanol-inducible alcohol oxidase 1
  • the open reading frame encoding the Dasher GFP variant protein was amplified by PCR from the pJ1214-03c plasmid vector obtained from DNA2.0 Inc. (Newark, Calif.).
  • the Dasher GFP open reading frame was amplified from pJ1214-03c with primers MxO0560
  • the amplified Dasher GFP PCR product and the pGAB vector were digested with 10 units of FastDigest Eco31I restriction endonuclease (ThermoFisher Scientific) for 1 hour at 37°
  • the Eco311-digested fragment containing the Dasher GFP open reading frame was introduced into pGAB at an Eco3 II site immediately downstream of the AOX1 promoter by ligation.
  • a mixture containing 72 ng of Eco311-digested DNA encoding the Dasher GFP open reading frame and 35 ng of Eco311-digested pGAB was incubated with 400 units of T4 DNA ligase (New England Biolabs) in 1 x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCk, 1 mM ATP, 10 mM DTT, pH 7.5 @ 25° C) at 16° C, for 2 hours in a 20 pi reaction. Electrocompetent E.
  • coli DH10B cells were transformed with 2 m ⁇ of the ligation reaction and antibiotic resistant transformants were selected on LSB (listeria special broth) agar plates supplemented with 100 pg/m ⁇ ampicillin. Plates were incubated overnight at 37° C. Colonies were screened for the presence of the insert by PCR using primers MxO0560 and MxO0561. The sequence of the final vector was confirmed by DNA sequencing.
  • the resulting vector, pMx0369 included the P. pastoris AOX1 promoter followed consecutively by the Dasher GFP open reading frame and the P. pastoris FDH1 terminator.
  • TTTTTCTAGAACCTTATCAAGATAGCTAGAAATAGAAATGGTTGC SEQ ID NO: 33
  • the primers introduced BamHI and Xbal restriction sites to the 5’ and 3’ ends, respectively, of the amplified AOX1 promoter- Dasher GFP-FDH1 terminator DNA fragment. These restriction sites were used to clone the Dasher GFP and the sequences required for its expression into the pIL75 episomal vector.
  • the pIL75 vector carries a panARS autonomous replication sequence (Liachko & Dunham, 2014, FEMS Yeast Res., 14:364-7), which allows for maintenance of the plasmid vector without integration into the genome of the transformed cells, and a kanMX marker for selection of transformants with the antibiotic G418.
  • Both the amplified Dasher GFP expression DNA fragment and the pIL75 vector DNA were digested with 10 units of BamHI and 10 units of Xbal restriction endonucleases (New England Biolabs) in lx CutSmart buffer (New England Biolabs) for 1 hour at 37° C.
  • the BamHI-Xbal-digested DNA fragments were separated by electrophoresis on a 1% agarose gel in I c TBE buffer, visualized using SYBR Safe DNA gel stain and the desired DNA fragments were excised from the agarose gel and the DNA was recovered using the Zymoclean Gel DNA Recovery Kit.
  • the DNA fragment containing the P. pastoris AOX1 promoter, the Dasher GFP open reading frame, and the P. pastoris FDH1 terminator was introduced into the similarly digested pIL75 vector by ligation.
  • a mixture containing 48 ng of the BamHI-Xbal-digested DNA fragment containing sequences for the expression of Dasher GFP and 15 ng of the BamHI-Xbal- digested pIL75 DNA was incubated with 400 units of T4 DNA ligase (New England Biolabs) in 1 x T4 DNA ligase reaction buffer in a 20 pi reaction at 16° C, for 2 hours. Electrocompetent E.
  • coli DH10B cells were transformed with 2 m ⁇ of the ligation reaction and antibiotic resistant transformants were selected on LSB agar plates supplemented with 100 pg/m ⁇ ampicillin. Plates were incubated overnight at 37° C. Colonies were screened for the presence of the insert by PCR using primers MxO0513 and MxO0514. The sequence of the final vector was confirmed by DNA sequencing. The resulting episomal vector, containing sequences encoding the Dasher GFP variant whose expression is under the control of the AOX1 promoter was designated pMx0379.
  • the pMx0379 vector carrying the Dasher GFP reporter under the control of the AOX1 promoter, was introduced into Pichia pastoris host strain MxY0051 by transformation.
  • the MxY0051 strain is a MutS strain, but contains no other modification.
  • Transformants were selected, and the plasmid was maintained, by growth on medium containing the antibiotic G418. Plates were incubated at 30° C for 48 hours. Individual clones were patched onto YPD plates with G418 antibiotic and the patches were used to inoculate cultures in subsequent experiments.
  • Error-prone mutagenesis of the AOX1 promoter The pMx0369 vector was used as a template for error-prone PCR amplification of the AOX1 promoter. Error-prone PCR was carried out as described in McCullum, et al. (2010, Methods in Molecular Biology, 634: 103-9).
  • the pAOXl promoter was amplified using primers MxO0569 (TCCTGCAGCCCGGGGGATCCAACATCCAAAGA; SEQ ID NO: 34) and MxO0570 (CTTCAGTTAAAGCTGTCATCGTTTCGAATAATTAGT; SEQ ID NO: 35) in a reaction containing 1 mM of each primer, 50 ng of template DNA, 1 mM dCTP and dTTP, 0.2 mM dATP and dGTP, 5.5 mM MgCh, and 0.5 mM MnCh, and 5U Taq DNA polymerase, in IX reaction buffer (Invitrogen).
  • the reaction conditions for error-prone amplification were as follows:
  • the pMx0379 vector excluding the pAOXl promoter sequence, was amplified under standard PCR amplification conditions, as described in Example 1, using primers MxO0571 (AACAACTAATTATTCGAAACGATGACAGCTTTAACT; SEQ ID NO: 36) and MxO0572 (ACCTTTCGTCTTTGGATGTTGGATCCCCCGGG; SEQ ID NO: 37).
  • the pAOXl promoter generated by error-prone amplification and the amplified pMx0379 vector DNA were each separated by electrophoresis on a 1% agarose gel in 1 xTBE buffer and visualized using SYBR Safe DNA gel stain. The desired DNA fragments were excised from the agarose gel and the DNA was recovered using the ZYMOCLEANTM Gel DNA Recovery Kit as described herein.
  • the pAOXl promoter sequences (600 ng) and vector DNA (200 ng) were assembled using Gibson assembly reactions (New England Biolabs). The assembly reactions were used to transform ElectroMax DH10B competent cells as described in Example 3.
  • the transformants were pooled in 50 ml LB liquid medium containing ampicillin at a concentration of 100 pg/ml and grown for 4 hours at 37°C with shaking at 250 rpm.
  • plasmid DNA was recovered using a QIAGEN Plasmid Midi kit (Qiagen Inc.). The resulting DNA consisted of pMx0379 vectors containing a variety of mutated pAOXl promoter sequences.
  • the pAOXl promoter library consisting of pAOXl promoters generated by error-prone PCR driving expression of a GFP reporter, was introduced into strain MxY0051 by
  • Transformants were selected and maintained by growth on YPD plates containing the antibiotic G418. Plates were incubated at 30°C for 72 hours and colonies were screened for fluorescence using a Li-Cor Odyssey Fc imaging system (Li-Cor Biosciences, Lincoln, NE). A colony that showed significant fluorescence on the YPD was identified. This colony was subcultured onto a fresh YPD plate along with strain MxY0270 as a wild type pAOXl reference, and confirmed to show increased GFP expression relative to the reference. This strain was designated MxY0279.
  • Plasmid DNA was recovered from transformed P. pastoris cells by resuspending a MxY0279 colony in a 100 m ⁇ volume of lysis buffer (200 mM Li acetate, 1% SDS) and heating the suspension to 70°C for 5 minutes. DNA was precipitated from the lysate by the addition of 300 m ⁇ of 100% ethanol, followed by centrifugation at 15,000 x g for 3 minutes. The recovered material was washed with a 1 ml volume of 70% ethanol, followed by centrifugation. The precipitated DNA was dissolved in a 100 m ⁇ volume of DNA elution buffer (5 mM Tris/HCl, pH 8.5).
  • a 2 m ⁇ volume of the recovered DNA solution was used to transform ElectroMax DH10B competent cells as described in Example 3, and bacterial transformants were recovered by plating on LB plates containing ampicillin at a concentration of 100 pg/ml. Plasmid DNA was isolated from the bacterial transformants using a QIAprep Spin Miniprep Kit, and the sequence of the mutated promoter was determined by sequencing the plasmid DNA using the MxO0569 and MxO0570 primers. The recovered plasmid vector containing the mutant pAOXl promoter driving GFP expression was designated pMx0414. The sequence is set forth in SEQ ID NO:29 as shown in Figure 2, where 19 mutation sites are double underlined.
  • the recovered pMx0414 plasmid was transformed into the MxY0051 strain of P.
  • GFP fluorescence was measured in cultures expressing the reporter protein using a SpectraMax M2 microplate reader and SoftMax Pro 6.1 software (Molecular Devices, San Jose, Calif.) at an excitation wavelength of 485 nm, and an emission wavelength of 525 nm.
  • Fluorescence in shake flask cultures was measured at 48 hours after dilution into the relevant carbon source.
  • GFP fluorescence, in relative fluorescence units (RFU) was normalize to the OD of the culture. (See Figure 4).
  • a combinatorial promoter library containing the mutations present in a plasmid with all 19 mutations in pAOXl (promoter designated MxG0038; see, e.g., SEQ ID NO: 29), where each of the positions mutated in MxG0038 was either the wild type or mutant nucleotide.
  • a group of five mutations from the MxG0038 mutant that confer the improved expression phenotype was identified.
  • a mutant AOX1 promoter containing mutations T688C, A696T, T702C, A712G, and T714G was designated MxG0220.
  • a portion of the sequences of MxG0038 and MxG0020 are compared in Figure 5.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Botany (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2020/028858 2019-04-17 2020-04-17 Materials and methods for protein production Ceased WO2020215017A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
CA3137100A CA3137100A1 (en) 2019-04-17 2020-04-17 Materials and methods for protein production
AU2020257270A AU2020257270B2 (en) 2019-04-17 2020-04-17 Materials and methods for protein production
BR112021020727A BR112021020727A2 (pt) 2019-04-17 2020-04-17 Materiais e métodos para produção de proteína
CN202080041851.4A CN114555812A (zh) 2019-04-17 2020-04-17 用于蛋白质产生的材料和方法
PH1/2021/552635A PH12021552635A1 (en) 2019-04-17 2020-04-17 Materials and methods for protein production
EP20724682.8A EP3956454A1 (en) 2019-04-17 2020-04-17 Materials and methods for protein production
JP2021561699A JP7762567B2 (ja) 2019-04-17 2020-04-17 タンパク質作製の材料および方法
MX2021012671A MX2021012671A (es) 2019-04-17 2020-04-17 Métodos y materiales para la producción de proteínas.
SG11202111468SA SG11202111468SA (en) 2019-04-17 2020-04-17 Materials and methods for protein production
KR1020217037340A KR20210153106A (ko) 2019-04-17 2020-04-17 단백질 생산을 위한 물질 및 방법
IL287318A IL287318A (en) 2019-04-17 2021-10-17 Materials and methods for the production of proteins
JP2025038452A JP2025102798A (ja) 2019-04-17 2025-03-11 タンパク質作製の材料および方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962835338P 2019-04-17 2019-04-17
US62/835,338 2019-04-17

Publications (1)

Publication Number Publication Date
WO2020215017A1 true WO2020215017A1 (en) 2020-10-22

Family

ID=70614652

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/028858 Ceased WO2020215017A1 (en) 2019-04-17 2020-04-17 Materials and methods for protein production

Country Status (13)

Country Link
US (3) US11427932B2 (https=)
EP (1) EP3956454A1 (https=)
JP (2) JP7762567B2 (https=)
KR (1) KR20210153106A (https=)
CN (1) CN114555812A (https=)
AU (1) AU2020257270B2 (https=)
BR (1) BR112021020727A2 (https=)
CA (1) CA3137100A1 (https=)
IL (1) IL287318A (https=)
MX (1) MX2021012671A (https=)
PH (1) PH12021552635A1 (https=)
SG (1) SG11202111468SA (https=)
WO (1) WO2020215017A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10894812B1 (en) 2020-09-30 2021-01-19 Alpine Roads, Inc. Recombinant milk proteins
US10947552B1 (en) 2020-09-30 2021-03-16 Alpine Roads, Inc. Recombinant fusion proteins for producing milk proteins in plants
WO2022108839A1 (en) * 2020-11-17 2022-05-27 Ginkgo Bioworks, Inc. Synthetic methanol inducible promoters and uses thereof
US11840717B2 (en) 2020-09-30 2023-12-12 Nobell Foods, Inc. Host cells comprising a recombinant casein protein and a recombinant kinase protein

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT3294762T (pt) 2015-05-11 2022-03-21 Impossible Foods Inc Constructos de expressão e métodos de modificar geneticamente levedura metilotrófica
AU2020257270B2 (en) 2019-04-17 2026-01-15 Impossible Foods Inc. Materials and methods for protein production
EP3959311A1 (en) 2019-04-25 2022-03-02 Impossible Foods Inc. Strains and methods for production of heme-containing proteins
AU2022369299A1 (en) 2021-10-19 2024-03-14 Eat Scifi Inc. Plant base/animal cell hybrid meat substitute
KR20240118861A (ko) * 2021-12-16 2024-08-05 임파서블 푸즈 인크. 재조합 단백질의 발현을 증가시키는 유전 인자

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1997028273A1 (en) * 1996-02-01 1997-08-07 North American Vaccine, Inc. Expression of group b neisseria meningitidis outer membrane (mb3) protein from yeast and vaccines
EP1734121A2 (en) * 1994-12-16 2006-12-20 Dyax Corporation Genetically engineered human-derived Kunitz domains that inhibit human neutrophil elastase
WO2014110539A1 (en) 2013-01-11 2014-07-17 Maraxi, Inc. Methods and compositions for consumables
EP3128006A1 (en) * 2015-08-06 2017-02-08 Consejo Superior de Investigaciones Cientificas (CSIC) Tools for multiprotein complex expression in pichia pastoris
US9938327B2 (en) 2015-05-11 2018-04-10 Impossible Foods Inc. Expression constructs and methods of genetically engineering methylotrophic yeast

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4158065A (en) 1977-12-16 1979-06-12 Sugiyo Co., Ltd. Crab meat substitute and method of preparing same
US5824511A (en) 1995-08-01 1998-10-20 University Technology Corporation Method for enhancing the production of hemoproteins
JP3462218B2 (ja) 1996-06-10 2003-11-05 ノボザイムス バイオテック,インコーポレイティド 糸状菌におけるヘムタンパク質生産を増加せしめるための方法
JP3794760B2 (ja) 1996-07-30 2006-07-12 三井化学株式会社 フィターゼ生産酵母
US7803765B2 (en) 1999-05-05 2010-09-28 Phylogica Limited Methods of constructing biodiverse gene fragment libraries and biological modulators isolated therefrom
US7498304B2 (en) * 2000-06-16 2009-03-03 Curis, Inc. Angiogenesis-modulating compositions and uses
WO2004099405A1 (en) 2003-04-11 2004-11-18 Ventria Bioscience Human blood proteins expressed in monocot seeds
CN1308452C (zh) * 2004-09-14 2007-04-04 上海永业农科生物工程有限公司 一种含有改组乙醇氧化酶启动子的毕赤酵母植酸酶表达系统
AT501955B1 (de) 2005-02-23 2007-08-15 Univ Graz Tech Mutierte aox1-promotoren
EP2479254A1 (en) 2005-08-24 2012-07-25 The Scripps Research Institute Translation enhancer-element dependent vector systems
JP2007228956A (ja) 2006-02-28 2007-09-13 Suntory Ltd 醸造用酵母由来の有用タンパク質同定方法
JP2008017733A (ja) 2006-07-11 2008-01-31 Tokyo Univ Of Agriculture 異種タンパク質の発現方法及び異種タンパク質の発現方法により得られたタンパク質
JP2008017774A (ja) 2006-07-13 2008-01-31 Nipro Corp ピキア酵母を用いた組換えヒトヘモグロビンの製造
CN101541187A (zh) 2006-11-01 2009-09-23 西格马食品可变资本有限公司 肉类替代食品及其制备方法
US8143023B2 (en) 2007-01-26 2012-03-27 Novozymes A/S Method for methanol independent induction from methanol inducible promoters in Pichia
EP2058398A1 (en) 2007-11-09 2009-05-13 Nipro Corporation Production of recombinant human hemoglobin using pichia yeast
CN102105589A (zh) 2008-07-11 2011-06-22 诺维信公司 巴斯德毕赤酵母(Pichia pastoris) DAS启动子变体
US20120156761A1 (en) 2009-07-02 2012-06-21 Verdezyne, Inc. Biological methods for preparing adipic acid
US20120184007A1 (en) 2009-07-09 2012-07-19 Stephen Picataggio Engineered microorganisms with enhanced fermentation activity
WO2011079388A1 (en) 2009-12-30 2011-07-07 Iogen Energy Corporation Modified yeast strains exhibiting enhanced fermentation of lignocellulosic hydrolysates
CN102190731B (zh) 2010-03-09 2016-01-27 中国科学院上海生命科学研究院 用人工转录因子诱导产生多能干细胞
US9085766B2 (en) 2010-05-21 2015-07-21 Cornell University Methods of producing recombinant heme-binding proteins and uses thereof
WO2012083424A1 (en) 2010-12-21 2012-06-28 The University Of Western Ontario Novel amino acid linker sequences for ligand immobilization
EP2669375B1 (en) 2011-01-27 2018-10-17 Kaneka Corporation Yeast of the genus pichia modified to express high levels of a mpp1 homolog and process for producing protein
US9212359B2 (en) 2011-06-23 2015-12-15 Sanford Jay Silverman Systems for induction of gene expression and protein depletion in yeast
CN105724726A (zh) 2011-07-12 2016-07-06 非凡食品有限公司 用于消费品的方法和组合物
US10039306B2 (en) 2012-03-16 2018-08-07 Impossible Foods Inc. Methods and compositions for consumables
US20140220217A1 (en) 2011-07-12 2014-08-07 Maraxi, Inc. Method and compositions for consumables
EP2565262A1 (en) * 2011-08-31 2013-03-06 VTU Holding GmbH Protein expression
JP6295512B2 (ja) 2012-03-15 2018-03-20 株式会社豊田中央研究所 酵母における外来遺伝子の発現産物の生産方法、酵母における発現調節剤及びその利用
WO2013158749A2 (en) 2012-04-17 2013-10-24 Gevo, Inc. Engineered microorganisms with improved growth properties
CN102757976B (zh) 2012-07-12 2014-10-08 华东理工大学 消除甲醇诱导型启动子单一甲醇碳源依赖性的方法
CN104812405A (zh) 2012-09-19 2015-07-29 国立大学法人大阪大学 含有肺炎球菌表面蛋白a的肺炎球菌疫苗
AU2014305233B2 (en) 2013-08-05 2017-06-29 New Zealand Institute For Bioeconomy Science Limited A method and control system for optimising the quality of meat
JP6759103B2 (ja) 2014-03-31 2020-09-23 インポッシブル フーズ インコーポレイテッド ひき肉レプリカ
WO2016089516A2 (en) 2014-10-31 2016-06-09 Board Of Regents, The University Of Texas System Short exogenous promoter for high level expression in fungi
EP3688166A4 (en) 2017-09-28 2021-06-23 Precision Fermentation, Inc. METHODS, DEVICES AND COMPUTER PROGRAM PRODUCTS FOR MONITORING LEEF PERFORMANCE IN FERMENTATION SYSTEMS
RU2658758C1 (ru) 2017-10-02 2018-06-22 ООО "Лаборатория Ангиофарм" Рекомбинантная плазмида для экспрессии в дрожжах Pichia pastoris гена химерного белка ангиогенина человека и штамм дрожжей Pichia pastoris - продуцент рекомбинантного химерного белка ангиогенина человека
US20200325484A1 (en) 2019-04-12 2020-10-15 Delin Liang Enhancing gene expression by linking self-amplifying transcription factor with viral 2A-like peptide
AU2020257270B2 (en) 2019-04-17 2026-01-15 Impossible Foods Inc. Materials and methods for protein production
EP3959311A1 (en) 2019-04-25 2022-03-02 Impossible Foods Inc. Strains and methods for production of heme-containing proteins
US20210062206A1 (en) 2019-07-08 2021-03-04 The Regents Of The University Of California Synthetic transcription factors
KR20240118861A (ko) 2021-12-16 2024-08-05 임파서블 푸즈 인크. 재조합 단백질의 발현을 증가시키는 유전 인자

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
EP1734121A2 (en) * 1994-12-16 2006-12-20 Dyax Corporation Genetically engineered human-derived Kunitz domains that inhibit human neutrophil elastase
WO1997028273A1 (en) * 1996-02-01 1997-08-07 North American Vaccine, Inc. Expression of group b neisseria meningitidis outer membrane (mb3) protein from yeast and vaccines
WO2014110539A1 (en) 2013-01-11 2014-07-17 Maraxi, Inc. Methods and compositions for consumables
WO2014110532A2 (en) 2013-01-11 2014-07-17 Maraxi, Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9938327B2 (en) 2015-05-11 2018-04-10 Impossible Foods Inc. Expression constructs and methods of genetically engineering methylotrophic yeast
EP3128006A1 (en) * 2015-08-06 2017-02-08 Consejo Superior de Investigaciones Cientificas (CSIC) Tools for multiprotein complex expression in pichia pastoris

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Methods In Molecular Biology", vol. 389, 2007, HUMANA PRESS, INC., article "Pichia Protocols"
"PCR Primer: A Laboratory Manual", 1995, COLD SPRING HARBOR LABORATORY PRESS
CHENNA ET AL., NUCLEIC ACIDS RES., vol. 31, no. 13, 2003, pages 3497 - 500
DAYHOFF ET AL., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, vol. 5, no. 3, 1978, pages 345 - 352
HOFFMAN ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 310, no. 4, 2003, pages 1247 - 53
KRAINER ET AL., MICROB. CELL FACT., vol. 13, no. 14, 2015, pages 4
KRANTHI ET AL., YEAST, vol. 27, 2010, pages 705 - 11
LIACHKODUNHAM, FEMS YEAST RES., vol. 14, 2014, pages 364 - 7
MCCULLUM ET AL., METHODS IN MOLECULAR BIOLOGY, vol. 634, 2010, pages 103 - 9
NAKAGAWA ET AL., YEAST, vol. 15, 1999, pages 1223 - 30
OHIHIDEYUKI ET AL., MOLECULAR AND GENERAL GENETICS MGG 243.5, 1994, pages 489 - 499
RAYMOND ET AL., YEAST, vol. 14, 1998, pages 11 - 23
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11840717B2 (en) 2020-09-30 2023-12-12 Nobell Foods, Inc. Host cells comprising a recombinant casein protein and a recombinant kinase protein
US12139737B2 (en) 2020-09-30 2024-11-12 Nobell Foods, Inc. Host cells comprising a recombinant casein protein and a recombinant kinase protein
US10988521B1 (en) 2020-09-30 2021-04-27 Alpine Roads, Inc. Recombinant milk proteins
US11034743B1 (en) 2020-09-30 2021-06-15 Alpine Roads, Inc. Recombinant milk proteins
US11072797B1 (en) 2020-09-30 2021-07-27 Alpine Roads, Inc. Recombinant fusion proteins for producing milk proteins in plants
US11142555B1 (en) 2020-09-30 2021-10-12 Nobell Foods, Inc. Recombinant milk proteins
US11685928B2 (en) 2020-09-30 2023-06-27 Nobell Foods, Inc. Recombinant fusion proteins for producing milk proteins in plants
US12241109B2 (en) 2020-09-30 2025-03-04 Nobell Foods, Inc. Host cells comprising a recombinant casein protein and a recombinant kinase protein
US10947552B1 (en) 2020-09-30 2021-03-16 Alpine Roads, Inc. Recombinant fusion proteins for producing milk proteins in plants
US10894812B1 (en) 2020-09-30 2021-01-19 Alpine Roads, Inc. Recombinant milk proteins
US11952606B2 (en) 2020-09-30 2024-04-09 Nobell Foods, Inc. Food compositions comprising recombinant milk proteins
US12077798B2 (en) 2020-09-30 2024-09-03 Nobell Foods, Inc. Food compositions comprising recombinant milk proteins
US11401526B2 (en) 2020-09-30 2022-08-02 Nobell Foods, Inc. Recombinant fusion proteins for producing milk proteins in plants
WO2022108839A1 (en) * 2020-11-17 2022-05-27 Ginkgo Bioworks, Inc. Synthetic methanol inducible promoters and uses thereof

Also Published As

Publication number Publication date
MX2021012671A (es) 2022-01-24
KR20210153106A (ko) 2021-12-16
AU2020257270A1 (en) 2021-11-18
AU2020257270B2 (en) 2026-01-15
BR112021020727A2 (pt) 2021-12-14
US20200332267A1 (en) 2020-10-22
JP7762567B2 (ja) 2025-10-30
CN114555812A (zh) 2022-05-27
CA3137100A1 (en) 2020-10-22
US20250066951A1 (en) 2025-02-27
SG11202111468SA (en) 2021-11-29
JP2022529021A (ja) 2022-06-16
US12116699B2 (en) 2024-10-15
EP3956454A1 (en) 2022-02-23
JP2025102798A (ja) 2025-07-08
IL287318A (en) 2021-12-01
US11427932B2 (en) 2022-08-30
US20220389616A1 (en) 2022-12-08
PH12021552635A1 (en) 2022-07-11

Similar Documents

Publication Publication Date Title
US12116699B2 (en) Materials and methods for protein production
JP7596344B2 (ja) メチロトローフ酵母の遺伝子操作の発現構築物および方法
US12509695B2 (en) Materials and methods for protein production
EP4448719A1 (en) A genetic factor to increase expression of recombinant proteins
HK40078346B (en) Expression constructs and methods of genetically engineering methylotrophic yeast
HK1252605B (en) Expression constructs and methods of genetically engineering methylotrophic yeast

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20724682

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021561699

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3137100

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021020727

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20217037340

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020257270

Country of ref document: AU

Date of ref document: 20200417

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020724682

Country of ref document: EP

Effective date: 20211117

ENP Entry into the national phase

Ref document number: 112021020727

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211015

WWD Wipo information: divisional of initial pct application

Ref document number: 819910

Country of ref document: NZ

WWR Wipo information: refused in national office

Ref document number: 1020217037340

Country of ref document: KR