WO2020204260A1 - 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물 - Google Patents

신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물 Download PDF

Info

Publication number
WO2020204260A1
WO2020204260A1 PCT/KR2019/006938 KR2019006938W WO2020204260A1 WO 2020204260 A1 WO2020204260 A1 WO 2020204260A1 KR 2019006938 W KR2019006938 W KR 2019006938W WO 2020204260 A1 WO2020204260 A1 WO 2020204260A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
skin
atg
bifidobacterium longum
inflammatory
Prior art date
Application number
PCT/KR2019/006938
Other languages
English (en)
French (fr)
Inventor
이용현
백보람
강지희
정도윤
박건석
임성훈
송원호
Original Assignee
(주) 에이투젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주) 에이투젠 filed Critical (주) 에이투젠
Priority to CN201980095232.0A priority Critical patent/CN113924357A/zh
Priority to US17/600,650 priority patent/US20220143112A1/en
Publication of WO2020204260A1 publication Critical patent/WO2020204260A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/18—Antioxidants, e.g. antiradicals
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745—Bifidobacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/10—Anti-acne agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/007—Preparations for dry skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2400/00—Lactic or propionic acid bacteria
    • A23V2400/51—Bifidobacterium
    • A23V2400/533—Longum
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to a novel Bifidobacterium longum ATG-F5 ( Bifidobacterium longum ATG-F5, accession number: KCTC13828BP) strain or a cosmetic composition comprising the same.
  • whitening functional cosmetics have the principle of melanin activity inhibition, which plays a role in determining human skin color.
  • Melanin is present in the base layer of the epidermis, and this melanin is a pigment that blocks ultraviolet rays received from the sun.
  • the physiological function of the skin decreases due to excessive synthesis or aging, it is deposited in the skin, resulting in spots, freckles and various pigments. do.
  • Melanin was synthesized by tyrosinase, tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2), cyclic adenosine monophosphate (cAMP) inducer Adrenocorticotropic hormone (ACTH), ⁇ -melanocyte stimulating hormone ( ⁇ ). -MSH).
  • TRP-1 tyrosinase related protein-1
  • TRP-2 tyrosinase related protein-2
  • cAMP cyclic adenosine monophosphate
  • ACTH Adrenocorticotropic hormone
  • ⁇ ⁇ -melanocyte stimulating hormone
  • -MSH ⁇ -melanocyte stimulating hormone
  • Tyrosinase promotes the hydroxylation reaction, thereby making Tyrosine 3,4-dihydroxyphenylalanine.
  • DOPA DOPA
  • DOPA-quinone DOPA-quinone
  • tyrosinase activity inhibition effect plays an important role in bringing about the whitening effect by inhibiting melanin production.
  • Collagen which is well known for skin elasticity, is involved in the principle of cosmetics with the function of improving and suppressing wrinkles, which is another technique.
  • Skin aging can be classified into two types, endogenous and exogenous. In the case of endogenous, it is aging that occurs with age, and in the case of exogenous, there is photoaging due to exposure to sunlight and ultraviolet rays. Accordingly, the skin is largely composed of three types: the epidermis, which serves to protect the skin with keratinocytes, the dermis and the other subcutaneous fat, which are involved in the elasticity and wrinkles of the skin. Among them, the dermis expresses the fibrous proteins Collagen and Elastin.
  • Collagen is a fibrous protein, and there are 14 types, and out of 14, Type 1 collagen acting on the skin mainly exists.
  • Matrix metalloproteinases are matrix proteins that degrade collagen, and more than 20 types are known, and MMP-1 is also called Collagenase 1, and as it decomposes collagen, the elasticity in the skin decreases, resulting in wrinkles. (Lee et al., 2013) Therefore, it is possible to improve wrinkles and maintain skin elasticity by controlling the proteins that act on the skin.
  • Skin barrier improvement is related to improving the skin condition by enhancing the expression of Occludin, Claudin, etc., which are proteins required when tight junction proteins are involved in cell-to-cell contact in skin tissue epithelial cells (B. Tebbe et al., 2002 ), in the case of dry skin, Hyaluronan synthase 2 (HAS2) induces the synthesis of Hyaluronic acid (HA), thereby reducing moisture loss in the skin.
  • Hyaluronic acid plays an important biological role in the skin to maintain moisture, maintain tissue structure and elasticity, and exchange nutrients.
  • the present invention proposes a Bifidobacterium longum ATG-F5 strain deposited as accession number KCTC13828BP as a method for enhancing skin whitening, wrinkle improvement, skin barrier strengthening, skin dry relief, anti-acne, and anti-inflammatory functions related to skin beauty.
  • Patent Document 1 Republic of Korea Patent Registration No. 10-1589464 (Name of the invention: a novel bifidus strain and a functional food composition for promoting growth including the same, Applicant: Cell Biotech Co., Ltd., registration date: January 22, 2016)
  • Patent Document 2 European Patent Registration No. 2308566B1 (Name of invention: Use of orally administered probiotic bifidobacteria for human beauty benefits, Applicant: The Procter & Gamble Company and others, registration date: April 13, 2011)
  • Patent Document 3 Korean Registered Patent No. 10-0889605 (Name of invention: cosmetic composition for wrinkle improvement, Applicant: LG Household & Health Care Co., Ltd., registration date: March 12, 2009)
  • Patent Document 4 Korean Registered Patent No. 10-1456040 (Name of invention: cosmetic composition for whitening, Applicant: LG Household & Health Care Co., Ltd., registration date: October 23, 2014)
  • Patent Document 5 Republic of Korea Patent Publication No. 10-2016-0092564 (Name of the invention: a cosmetic composition having antioxidant, wrinkle improvement and moisturizing effect containing a two-stage fermentation lysate of yeast and lactic acid bacteria, Applicant: Incos, Release date: August 5, 2016)
  • Patent Document 6 Korean Patent Registration No. 10-1788544 (Name of the invention: Cosmetic composition for strengthening skin barrier containing complex lactic acid bacteria culture, Applicant: Cosmax Co., Ltd. and one other, registration date: October 16, 2017)
  • Patent Document 7 Korean Registered Patent No. 10-1885195 (Name of invention: Cosmetic composition containing Mokseo fermented extract as an active ingredient, Applicant: Koreana Cosmetics Co., Ltd., registration date: July 30, 2018)
  • Non-Patent Document 1 B. Tebbe J. Mankertz C. SchwarzS. AmashehM. FrommC. AssafU. Schultz-Ehrenburg H. Sanchez Ruderisch J.-D. Schulzke C. Orfanos. (2002). Tight junction proteins: a novel class of integral membrane proteins. Archives of Dermatological Research , 294(1-2), 14-18.
  • Non-Patent Document 2 Chan, YY, Kim, KH, & Cheah, SH (2011). Inhibitory effects of Sargassum polycystum on tyrosinase activity and melanin formation in B16F10 murine melanoma cells. Journal of Ethnopharmacology , 137(3), 1183-1188.
  • Non-Patent Document 3 Chang, OK, Seol, KH, Jeong, SG, Oh, MH, Park, BY, Perrin, C., & Ham, JS (2013). Casein hydrolysis by Bifidobacterium longum KACC91563 and antioxidant activities of peptides derived therefrom. Journal of dairy science , 96(9), 5544-5555.
  • Non-Patent Document 4 Choi, SM, Jang, HS, & Kim, BO (2008). Effects of H2O2 and chlorhexidine on MMP-1, TIMP-1, 2, Type 1 collagen, fibronectin and UNCL expressions in human periodontal ligament fibroblasts. The Journal of the Korean Academy of Periodontology , 38(4), 645-656.
  • Non-Patent Document 5 EFSA. (2012). Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA Journal 10(6):2740
  • Non-Patent Document 6 Erel, O. (2004). A novel automated direct measurement method for total antioxidant capacity using a new generation, more stable ABTS radical cation. Clinical biochemistry , 37(4), 277-285.
  • Non-Patent Document 7 Hasegawa, T. (2010). Tyrosinase-expressing neuronal cell line as in vitro model of Parkinson's disease. International journal of molecular sciences , 11(3), 1082-1089.
  • Non-Patent Document 8 Gye Won Lee, Sung Min Park, Yung Choon Yoo, and Young Ho Cho. (2013). Effect of Ponciri Fructus Extracts Fermented with Ganoderma lucidum on the Collagen Synthesis and Expression of Matrix Metalloproteinase-1. Kor Society for Biotechnology and Bioengineering Journal 28(2), 106-114.
  • Non-Patent Document 9 Kim, YJ, & Yoon, Y. (2013). Regulation of Col1A1 and MMP1 Expression by Taurine, Major Component of Oyster, in Human Dermal Fibroblasts. Kor J Aesthet Cosmetol , 11(2), 393-397.
  • Non-Patent Document 10 Sang-Myeoung Nam, Il-Jun Kang and Mee-Hye Shin. (2015). Anti-diabetic and Anti-oxidative Activities of Extracts from Crataegus pinnatifida. J East Asian Soc Dietary Life 25(2): 270-277.
  • Non-Patent Document 11 Re, R., Pellegrini, N., Proteggente, A., Pannala, A., Yang, M., & Rice-Evans, C. (1999). Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free radical biology and medicine , 26(9-10), 1231-1237.
  • Non-Patent Document 12 Tae Won Jang and Jae Ho Park. (2017). Antioxidative Activities and Whitening Effects of Ethyl Acetate Fractions from The Immature Seeds of Abeliophyllum distichum. Journal of Life Science , 27(5), 536-544.
  • An object of the present invention is to provide a novel Bifidobacterium longum ATG-F5 strain or a cosmetic composition comprising the same.
  • the present invention relates to a novel Bifidobacterium longum ATG-F5 ( Bifidobacterium longum ATG-F5, accession number: KCTC13828BP) strain.
  • the strain strengthens the skin barrier by enhancing the expression of occludin/OCLN and claudin 4/CLDN4 genes, and by enhancing gene expression of hyaluronic acid synthase 2/HAS2, skin It is characterized by having a dry relieving function.
  • It has an anti-acne function that inhibits the growth of Cutibacterium acnes , an acne- causing bacteria, or an anti-inflammatory activity that increases interleukin 10 (IL-10), and has an antioxidant function.
  • IL-10 interleukin 10
  • the strain has a whitening function due to inhibition of tyrosinase activity or melanin production effect, or pro-collagen enhancement function due to inhibition of MMP-1 (Matrix metalloproteinase-1) activity. It features.
  • the Bifidobacterium longum ATG-F5 strain refers to the bacterial body of the strain; Lysate of the cells; Culture of the strain; A culture solution from which cells are removed from the culture of the strain; Cell extract of the strain; An extract of the culture of the strain; And, the extract of the culture medium from which the cells have been removed from the culture of the strain; may be replaced or included with one selected from the group consisting of.
  • the present invention provides a cosmetic composition comprising the above strains, which has the effect of strengthening skin barrier, relieving skin dryness, anti-inflammatory, anti-acne, antioxidant, or wrinkle improvement.
  • the formulation of the cosmetic composition is skin lotion, skin softener, skin toner, astringent, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foot cream, neck cream, foundation, essence, pack, It may be selected from the group consisting of soap, cleansing foam, cleansing lotion, cleansing cream, body lotion, hair shampoo, hair treatment, hair rinse, and body cleanser.
  • the present invention can provide a health functional food having an effect of strengthening skin barrier, relieving skin dryness, anti-inflammatory, anti-acne, antioxidant, or wrinkle improvement, including the strain.
  • the health functional food may be selected from the group consisting of meat, sausage, bread, candy, snacks, noodles, ice cream, dairy products, fermented milk, soup, ionized drinks, beverages, alcoholic beverages, gum, tea and vitamin complexes. I can.
  • the present invention also relates to a composition for preventing or treating a disease selected from the group consisting of dry skin, acne and inflammatory diseases, including the above strain.
  • the inflammatory diseases include inflammatory bowel disease, inflammatory collagen vascular disease, glomerulonephritis, inflammatory skin disease, sarcoidosis, retinitis, gastritis, hepatitis, enteritis, arthritis, tonsillitis, sore throat, bronchitis, pneumonia, pancreatitis, sepsis, cystitis, nephritis and neuritis. It may be selected from the group consisting of dry skin, acne, and inflammatory diseases, characterized in that it is selected from among diseases consisting of.
  • the Bifidobacterium longum ATG-F5 strain of the present invention is a liquid or solid medium (broth or agar) of BL medium (hereinafter referred to as BL) or MRS medium (hereinafter referred to as MRS-cys) to which 0.3-0.7 g/L of L-cystein is added. ), and Bifidobacterium longum ATG-F5 in BL or MRS-cys broth can be cultured to a concentration of 8.0 ⁇ 10 8 ⁇ 1.0 ⁇ 10 9 CFU/ml. Also, when adding L-cystein to the MRS medium, it is better to add 0.6 g/L.
  • This strain is preferably incubated for 16 to 24 hours at 30 to 37°C, and the optimum temperature for cultivation is 37°C, the minimum temperature is 15°C, the maximum temperature is 37°C, the optimum pH is 6.8, and the minimum pH that can be cultured is 5.0.
  • the maximum pH is 7.3.
  • the optimum incubation time is 18 hours and the minimum incubation time is 8 hours and the maximum incubation time is 72 hours.
  • the strains of the present invention include ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, clindamycin, erythromycin, erythromycin, and tetracycline. It is a safe strain that does not have resistance to antibiotics selected from at least one selected from the group consisting of chloramphenicol.
  • the present invention is a Bifidobacterium longum ATG-F5 strain, that is, the cells of the strain; Lysate of the cells; Culture of the strain; A culture solution from which cells are removed from the culture of the strain; Cell extract of the strain; An extract of the culture of the strain; or; An extract of a culture solution from which cells are removed from the culture of the strain; It provides various compositions including those selected from.
  • the cell lysate of the F5 strain can be obtained by centrifuging the culture medium of the strain to separate the cells from the culture supernatant, then suspending them in PBS, treating Lysozyme, and sonicating.
  • the cells may be washed with a buffer such as PBS and then centrifuged again, and centrifugation may be performed for 5 to 60 minutes at 3,000 to 5000 rpm, respectively.
  • Lysozyme in the cells suspended in PBS is preferably treated at a concentration of 300 to 700 ⁇ g/ml at 30 to 37°C, and ultrasonic treatment conditions are preferably 50 to 90W, 20 to 60 sec, and 20 to 40 cycles.
  • the separately separated culture supernatant can be used as a composition derived from various cultures by adjusting the pH to 7-8 and filtering (using a 0.2 ⁇ m pore filter).
  • Each composition derived from the strain may be used without separate processing, and may be purified or dried through various methods and added to a cosmetic composition, a pharmaceutical composition, or a health functional food.
  • Each composition derived from the strain may be dried by performing a lyophilization method, and may include various excipients included when drying a conventional strain or a composition derived from these strains.
  • the excipients for freeze-drying are gluconic acid, alginic acid, sodium alginate, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, carbomer, hyaluronic acid, tragacanth, karaya gum, water-soluble starch, pectin, Gelatin, polyvinyl alcohol, polyvinyl pyrrolidone, oligosaccharides, sugar alcohols, calcium gluconate, calcium lactate, polymethyl methacrylate, wheat protein, soybean protein, methylcellulose, aquacoat, guar gum, locust bean gum, It can be selected from xanthan gum, gellan gum, gum arabic, trehalose, and the like.
  • the present invention can provide a cosmetic composition containing various compositions derived from the strain, the cosmetic composition can be used as a composition for enhancing skin barrier, relieving skin dryness, anti-inflammatory, anti-acne, antioxidant or wrinkle improvement effect,
  • the weight of the cosmetic composition is based on 100% by weight of the total, 0.001 to 20% by weight of various compositions derived from the strain may be included.
  • the formulation of the cosmetic composition is preferably a skin lotion, skin softener, skin toner, astringent, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foot cream, neck cream, foundation, It may be selected from the group consisting of essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion, hair shampoo, hair treatment, hair rinse, and body cleanser.
  • the cosmetic composition of the present invention may further include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, sphingo lipids, and seaweed extract.
  • the water-soluble vitamin may be any one that can be blended in cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, etc. And their salts (thiamine hydrochloride, sodium ascorbate, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a culture of microorganisms, an enzyme method or a chemical synthesis method.
  • the oil-soluble vitamin may be any one that can be blended in the cosmetic composition, but preferably vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), etc. And their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, nicotinic acid dl-alpha tocopherol vitamin E, DL-pantotenyl alcohol, D-pantotenyl alcohol, pantotenyl) Ethyl ether, etc.) are also included in the oil-soluble vitamin used in the present invention.
  • Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microorganism culture, an enzyme or a chemical synthesis method.
  • the polymeric peptide may be any one as long as it can be blended into the cosmetic composition, and preferably, collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin, and the like are exemplified.
  • the polymeric peptide can be purified and obtained by a conventional method such as a purification method from a culture medium of a microorganism, an enzyme method, or a chemical synthesis method, or it can be used after being purified from natural products such as dermis of pigs and cattle, silk fibers of silkworms.
  • the polymer polysaccharide may be any one as long as it can be blended in the cosmetic composition, but preferably, hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfuric acid or a salt thereof (sodium salt, etc.) may be mentioned.
  • chondroitin sulfate or a salt thereof can be used after being purified from mammals or fish.
  • the sphingo lipid may be any one as long as it can be blended into the cosmetic composition, and ceramide, phytosphingosine, sphingoglycolipid, and the like are preferably mentioned.
  • Sphingo lipids are usually purified from mammals, fish, shellfish, yeast, plants, etc. by a conventional method, or can be obtained by chemical synthesis.
  • the seaweed extract may be anything as long as it can be blended into the cosmetic composition, but preferably brown algae extract, red algae extract, green algae extract, etc. are exemplified, and carrageenan, arginic acid, sodium arginate purified from these seaweed extracts And potassium arginate are also included in the seaweed extract used in the present invention.
  • Seaweed extract can be obtained by purifying from seaweed by a conventional method.
  • the cosmetic composition of the present invention may also contain other ingredients to be blended in a conventional cosmetic composition.
  • ingredients that may be added include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, Blood circulation accelerators, cold sensation agents, restrictors, and purified water.
  • oil and fat components examples include ester oils and fats, hydrocarbon oils, silicone oils, fluorine oils, animal oils and vegetable oils.
  • ester oils include glyceryl tri2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid.
  • hydrocarbon-based fats and oils examples include hydrocarbon-based fats such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybuden, microcrystalline wax, and petrolatum.
  • Silicone-based fats and oils include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylsteaoxysiloxane copolymer, alkyl And modified silicone oil and amino-modified silicone oil.
  • fluorine-based fats and oils examples include perfluoropolyether and the like.
  • Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, new flower oil, soybean oil, corn oil, rapeseed oil, almond oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil, cottonseed oil, coconut oil, cucuine nut oil, wheat germ oil, rice germ oil, shea butter, walnut colostrum, marker deimia nut oil, meadow home oil, egg yolk oil, beef tallow, horse oil, mink oil, orange rape oil, jojoba oil, candelier Animal or vegetable fats such as wax, carnava wax, liquid lanolin, and hydrogenated castor oil.
  • the moisturizing agent examples include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.
  • water-soluble polymer examples include carboxyvinyl polymer, polyaspartic acid salt, tragacanth, xanthan gum, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, water-soluble chitin, chitosan, dextrin, and the like. I can.
  • oil-soluble polymer examples include polyvinylpyrrolidone/eicosene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and polymer silicone.
  • emollient agent examples include long-chain acyl glutamate cholesteryl ester, hydroxystearate cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.
  • surfactant examples include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.
  • Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbit fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE ⁇ POP (polyoxyethylene ⁇ polyoxypropylene) copolymer, POE ⁇ POP alkyl ether, polyether-modified silicone, lauric acid Alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.
  • anionic surfactants fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkylamide sulfate, alkyl phosphate, POE alkyl phosphate, alkyl amide Phosphate, alkyloylalkyltaurine salt, N-acylamino acid salt, POE alkylether carboxylate, alkyl sulfosuccinate, sodium alkylsulfoacetate, acylated hydrolyzed collagen peptide salt, perfluoroalkyl phosphate, and the like. have.
  • Cationic surfactants include alkyl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, stearyl trimethyl ammonium bromide, cetostearyl trimethyl ammonium chloride, distearyl dimethyl ammonium chloride, stearyldimethylbenzyl ammonium chloride, behenyl trimethyl ammonium bromide, and chloride.
  • Benzalkonium diethylaminoethyl amide stearate, dimethylaminopropyl amide stearate, lanolin derivative quaternary ammonium salt, and the like.
  • amphoteric surfactants include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amideamine type, etc. Amphoteric surfactants, and the like.
  • organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide.
  • Inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluorine resin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene-styrene copolymer, Organic pigments, such as silk powder, cellulose, CI pigment yellow, and CI pigment orange, and complex pigments of these inorganic pigments and organic pigments, etc. are mentioned.
  • organic powder examples include metal soaps such as calcium stearate; Alkyl phosphate metal salts, such as sodium zinc cetylate, a zinc laurylate, and calcium laurylate; Acylamino acid polyvalent metal salts such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroyl glycine calcium; Amide sulfonic acid polyvalent metal salts such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N, such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoyl lizine, N-alpha-paritoylolnitine, N-alpha-lauroylarginine, N-alpha-hardened tallow fatty acid acylarginine, etc.
  • metal soaps such as calcium stearate
  • N-acyl polypeptides such as N-lauroylglycylglycine
  • Alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid
  • Polyethylene polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene/styrene copolymer, ethylene tetrafluoride, and the like.
  • UV absorbers include paraaminobenzoic acid, ethyl paraaminobenzoate, amyl paraaminobenzoate, octyl paraaminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicate, butyl phenyl salicylate, homomentyl salicylate, benzyl cinnamate , Paramethoxycinnamic acid-2-ethoxyethyl, paramethoxycinnamic acid octyl, diparamethoxycinnamic acid mono-2-ethylhexane glyceryl, paramethoxycinnamic acid isopropyl, diisopropyl ⁇ diisopropyl cinnamic acid ester mixture, right Cannic acid, ethyl urocanate, hydroxymethoxybenzophenone, hydroxymethoxybenz
  • antioxidant examples include butylhydroxyanisole, propyl gallic acid, and elisorbic acid.
  • pH adjuster examples include citric acid, sodium citrate, malic acid, sodium malate, pmalic acid, sodium pmarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like.
  • alcohol examples include higher alcohols such as cetyl alcohol.
  • blending ingredients that may be added are not limited thereto, and any of the above ingredients can be blended within a range that does not impair the object and effect of the present invention, but is preferably 0.01 to 5% by weight, more preferably, based on the total weight. May be blended in 0.01-3% by weight.
  • the cosmetic composition of the present invention may take the shape of a solution, an emulsion, a viscous mixture, or the like.
  • Ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetic compositions in addition to the strain-derived composition as an active ingredient, for example, stabilizers, solubilizers, vitamins, pigments, and flavors. Phosphorus adjuvants and carriers.
  • the cosmetic composition formulation of the present invention is a paste, cream, or gel
  • animal fibers, plant fibers, wax, paraffin, starch, tracant, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide, etc. are used as carrier components.
  • the cosmetic composition formulation of the present invention is a powder or spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component.
  • additional chlorofluorohydrocarbons such as dimethyl ether.
  • a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol , 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.
  • the cosmetic composition formulation of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like may be used.
  • the cosmetic composition formulation of the present invention is a surfactant containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linoline derivatives, or ethoxylated glycerol fatty acid esters may be used.
  • the present invention provides a pharmaceutical composition containing various compositions derived from the Bifitobacterium longum ATG-F5 strain.
  • the composition derived from the Bifitobacterium longum ATG-F5 strain may be added in an amount of 0.001 to 30% by weight to the pharmaceutical composition of the present invention.
  • the pharmaceutical composition may be a composition for preventing or treating a disease selected from the group consisting of dry skin, acne, and inflammatory diseases, and the inflammatory disease is inflammatory bowel disease, inflammatory collagen vascular disease, glomerulonephritis, inflammatory skin disease, sarcoidosis, It may be selected from diseases consisting of retinitis, gastritis, hepatitis, enteritis, arthritis, tonsillitis, pharyngitis, bronchitis, pneumonia, pancreatitis, sepsis, cystitis, nephritis and neuritis.
  • a disease selected from the group consisting of dry skin, acne, and inflammatory diseases
  • the inflammatory disease is inflammatory bowel disease, inflammatory collagen vascular disease, glomerulonephritis, inflammatory skin disease, sarcoidosis, It may be selected from diseases consisting of retinitis, gastritis, hepatitis, enteritis, arthritis, tonsillitis, pharyngit
  • compositions may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, etc., according to a conventional method.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oils.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, sucrose or lactose, in the strain of the present invention, It is prepared by mixing gelatin or the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories, and vaginal suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
  • injectable ester such as ethyl oleate
  • a base for suppositories witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like may be used.
  • the dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, and weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of one of ordinary skill in the art, and dosages generally range from 0.01 mg/kg/day to approximately 2000 mg/kg/day. A more preferred dosage is from 1 mg/kg/day to 500 mg/kg/day. Administration may be administered once a day, or may be divided several times. The above dosage does not in any way limit the scope of the present invention.
  • the pharmaceutical composition of the present invention can be administered to mammals such as mice, livestock, and humans by various routes. Since the strain of the present invention has little toxicity and side effects, it is a drug that can be safely used even when taken for a long time for prophylactic purposes.
  • the present invention provides a health functional food having an effect of strengthening skin barrier, relieving skin dryness, anti-inflammatory, anti-acne, antioxidant or wrinkle-improving effect, containing a composition derived from Bifitobacterium longum ATG-F5.
  • the composition derived from the BPitobacterium longum ATG-F5 may be added to the health functional food of the present invention in an amount of 0.001 to 50% by weight.
  • the health functional food of the present invention includes forms such as tablets, capsules, pills or liquids, and foods to which the composition derived from the strain of the present invention can be added include, for example, meat, sausage, bread, candy, snacks. , Noodles, ice cream, dairy products, fermented milk, soups, ionized beverages, beverages, alcoholic beverages, gum, tea and vitamin complexes.
  • the present invention relates to a novel Bifidobacterium longum ATG-F5 ( Bifidobacterium longum ATG-F5) strain, wherein the F5 strain is safe from antibiotic resistance, antibacterial activity against cutibacterium acnes , a skin pathogen, antioxidant effect against radical, Functional beneficial bacteria that improve skin health through skin barrier improvement, anti-inflammatory effect, skin whitening function, wrinkle improvement function, and skin dryness relief function, and can be used as a cosmetic composition or health functional food containing the same Do.
  • Bifidobacterium longum ATG-F5 Bifidobacterium longum ATG-F5
  • the F5 strain is safe from antibiotic resistance, antibacterial activity against cutibacterium acnes , a skin pathogen, antioxidant effect against radical, Functional beneficial bacteria that improve skin health through skin barrier improvement, anti-inflammatory effect, skin whitening function, wrinkle improvement function, and skin dryness relief function, and can be used as a cosmetic composition or health functional food containing the same Do.
  • FIG. 1 shows the 16S rRNA nucleotide sequence of the Bifitobacterium longum ATG-F5 strain of the present invention.
  • Figure 2 shows the results of confirming the antibacterial activity of the two types of acne causative bacteria Cutibacterium acnes of the Bifitobacterium longum ATG-F5 strain of the present invention.
  • Figure 4 shows the results of confirming the effect of increasing melanin production related to the whitening function of the Bifitobacterium longum ATG-F5 strain of the present invention (Figure 4A) and the inhibitory effect on tyrosiana activity ( Figure 4B).
  • Figure 6 shows the results of confirming the effect of increasing the gene expression of occludin (OCLN) and claudin 4 (CLDN4) related to the function of strengthening the skin barrier of the Bifitobacterium longum ATG-F5 strain of the present invention.
  • HAS2 Hyaluronan synthase 2
  • Figure 8 is a result showing the inflammation inhibitory effect (Interleukin 10/IL-10 increase) of the Bifitobacterium longum ATG-F5 strain of the present invention.
  • Bifidobacterium longum (hereinafter, F5) was isolated by donating neonatal feces (born in 2018, Daejeon, Korea). To this end, the resulting product obtained by diluting newborn feces in 0.9% (w/v) saline by 10-fold serial dilution method was plated on Bifidobacterium selective (BS, MBcell seoul, Korea) solid medium and incubated at 37°C for 48 hours. By observing the colonies of bacteria generated in the cultured BS medium under a microscope, the bacillus type and the ones without catalase reaction were selected. It was named ATG-F5 strain (hereinafter also referred to as F5).
  • the F5 strain in the experiment After culturing the F5 strain in the experiment, it was first cultured in BL or MRS-cys agar solid medium, followed by inoculation of purely isolated colony in broth liquid medium. The microorganism was cultured at 37° C. overnight (between about 16 and 20 hours).
  • the 16S rRNA sequence analysis of the F5 strain was requested by Solgent Co., Ltd. (Solgent, Dajeon).
  • Primers for sequencing analysis are 27F (5′-AGA GTT TGA TCC TGGCTC AG-3′), 518F (5′-CCA GCA GCC GCG GTA ATA C-3′), 907R (5′-CCGTCA ATT CMT TTR AGT TT-3′), 1492R (5′-GGT TAC CTT GTT ACG ACT T-3′) was used to read the nucleotide sequence for a total of 4 times, and the contig nucleotide sequence derived through the nucleotide sequence alignment of each reading was recorded in the National Center. For Biotechnology Information (NCBI) BLAST online tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to analyze.
  • NCBI Biotechnology Information
  • API50 CHL test (BioMerieux, France) was slightly modified to determine the sugar fermentation pattern. Briefly, L-cystein was added to a 10 mL API 50CHL medium (BioMerieux, France) at a concentration of 0.5 ⁇ g/ml, and the pH was adjusted to about 6.7, and the purely cultured F5 strain was suspended to have an OD 600 absorbance of about 0.5. , The suspension culture was inoculated into each cuple of the API 50CH test strip and cultured at 37°C. The sugar fermentation results were confirmed at 48 and 72 hours after inoculation.
  • the F5 strains in the evaluation of sugar fermentation using API Kit were L-Arabinose, Ribose, Galactose, Glucose, Fructose, Mannose, Mannitol, Sorbitol, Methyl- ⁇ D-Mannopyranoside, N-Acetylglucosamine, Amygdalin, Arbutin, Esculin, It has been shown to degrade Salicin, Cellobiose, Maltose, Lactose, Melibiose, Trehalose, Melezitose, Raffinose, and Turanose, and it has been found to weakly degrade D-Arabinose, Methyl- ⁇ D-glucopyranoside, Gentibiose, L-fucose, and Gluconate.
  • the antibacterial activity of F5 is inhibited through a disc test against a total of two infectious or opportunistic bacteria of acne causative bacteria ( Cutibacterium acnes , KCTC5012, KCTC3314). The clear zone was confirmed. Two bacteria cultured overnight in BL broth (MBcell seoul, Korea) plate medium were suspended in 1X phosphate buffered saline (PBS) at an OD 600 of about 0.8.
  • PBS 1X phosphate buffered saline
  • Each suspension was absorbed with a sterilized cotton swab, smeared and dried on an agar medium for antibacterial activity test in which BL and MRS were mixed 1:1, and an 8 mm paper disc (Advantec, Japan) was attached to the dried test agar medium.
  • F5 bacteria cultured for 18-20 hours in BL broth were inoculated on paper discs of 35 ⁇ l each, dried for about 3 minutes, and cultured at 37°C to observe the progress.
  • the size of the suppression ring generated after cultivation was measured by measuring the diameter and subtracting the diameter of the paper disc of 8 mm to calculate the final value.
  • cutibacterium acnes (KCTC 5012, 3314) strains were tested, and the antibacterial activity of F5 was confirmed, and antimicrobial activities of 9 to 10 mm and 5 to 6 mm were shown for KCTC5012 and KCTC3314, respectively.
  • clear zones of up to 10 mm and 6 mm were shown (Table 2, FIG. 2).
  • the antibiotic test was performed using an E-test strip (BioMerieux, France) or a MIC test strip (liofilchem, Italy) of nine antibiotics, including ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, clindamycin, erythromycin, tetracycline, and chloramphenicol.
  • the minimum inhibitory concentration (MIC) value was checked.
  • the F5 strain was suspended at an absorbance of about OD 600 of 0.8 and smeared on a BL solid medium using a sterilized cotton swab was used. After drying the solid medium coated with the F5 strain for about 3 minutes, the E-test strip or MIC test strip was put up and incubated at 37°C for 24 to 48 hours.
  • CFCS cell free culture supernatant
  • the culture medium of F5 was centrifuged at 4,000 rpm for 25 minutes to separate the cells of F5 and the culture supernatant.
  • the culture supernatant was adjusted to pH 7-8 and filtered using a 0.2 ⁇ m pore syringe filter (Satorious, Germany), and the filtered culture was stored at -20°C.
  • the cells were suspended in 1X PBS, washed with vortex, and then centrifuged at 4,000 rpm for 5 minutes at 4° C. to remove the culture medium of the remaining bacteria, and then suspended again with 1X PBS.
  • Lysozyme (Sigma-aldrich, Germany) was dispensed to the suspended cells at a concentration of 500 ⁇ g/ml, passed through an incubator at 37°C for 2 hours, and then subjected to ultrasonic cytolysis using a Sonicator (70W, 30sec, 30cycle). The crushed material was prepared. Meanwhile, heat treatment was performed at 60° C. for 45 minutes to kill bacteria that may be alive in the cell lysate. At this time, the reaction at 60° C. was performed in a water bath to minimize protein denaturation.
  • the cell lysate was stored at -20°C and thawed when performing the experiment, and the cell lysate was used in all subsequent experiments.
  • the moisture content of the suspension was measured and the solid content was calculated and diluted.
  • ABTS [2, 2'-Azino-Bis (3-Ethylbenzthiazoline-6-sulfonic acid], Sigma-aldrich, Germany) to measure the antioxidant functionality of the F5 strain.
  • ABTS is an antioxidant substance. This is an experiment using the principle of decolorizing from cyan to colorless as cationic radicals are scavenged by reaction with (Nam et al., 2015).
  • the antioxidant ability of the cell lysate of the F5 strain was measured using the ABTS solution.
  • a mixture of 14 mM ABTS stock solution and 4.9 mM Potassium persulfate 1:1 was prepared to prepare a mixed solution, and the dark reaction was carried out overnight to make it cyan.
  • 10% (v/v) of the cell lysate sample of the F5 strain was added to the working solution diluted so that the absorbance at the OD 734 wavelength was about 0.7, reacted in the dark for 10 minutes, and then the absorbance at the 734 nm wavelength was measured. And, each measured value was calculated by the following formula.
  • ABTS radical scavenging activity (%) ⁇ 1-(OD sample /OD control ) ⁇ ⁇ 100
  • the radical scavenging activity pattern starts to increase significantly from the concentration of the cell lysate of the strain 500 ⁇ g/ml, and the antioxidant functionality is enhanced to a greater extent from 1 mg/ml.
  • B16F10 Melanoma cells, a cell line of the Mouse model, were used.
  • B16F10 is a representative cell line that can confirm the whitening function.
  • the mechanism of this cell line increases the melanin production reaction, which is the last reaction point, starting from the cell signaling pathway and L-Tyrosine starting the Tyrosinase activation pathway.
  • This evaluation method for this is Gibco® dulbecco with 10% (v/v) fetal bovine serum (Sigma-aldrich, Germany) and 1% (v/v) penicillin/streptomycin cocktail (Sigma-aldrich, Germany) added to B16F10.
  • Cells were cultured using a modified eagle medium (DMEM, Gibco, USA) medium using a 75cm 2 Flask (Thermo fisher, USA). Thereafter, when the cells grew about 80% in a 75cm 2 flask, the cells were harvested and subcultured. The cells were seeded in a 6 well plate at 2 X 10 6 cells/ml, and then cultured for 24 hours using an incubator in 5% CO 2 conditions.
  • DMEM modified eagle medium
  • 75cm 2 Flask Thermo fisher, USA
  • ⁇ -MSH ⁇ -Melanocyte stimulating hormone
  • melanin production decreased according to the treatment concentration of the cell lysate of the F5 strain.
  • melanin was further stimulated with ⁇ -MSH during treatment of each strain, the production of melanin was further suppressed, indicating a remarkable whitening effect.
  • the supernatant collected separately was used to measure the Tyrosinase inhibitor.
  • 40 ⁇ l of the supernatant and 160 ⁇ l of Dihydroxyphenylalanine (L-DOPA, Sigma, USA) dissolved in 2 ⁇ g/ml in 0.1M PBS were mixed and reacted for 1 hour using an incubator at 37°C, and then ELISA reader (BioTek, USA) ) was used to measure the absorbance at 475 nm to show the relative tyrosinase inhibitor inhibitory ability.
  • the Human Dermal Fibroblast (HDF) cell line which is a human model cell line, was used to evaluate the wrinkle improvement functionality.
  • Gibco® dulbecco modified eagle medium (DMEM, Gibco, added with 10%(v/v) fetal bovine serum (Sigma-aldrich, Germany), 1%(v/v) penicillin/streptomycin cocktail (Sigma-aldrich, Germany) USA) medium was used to culture the cells using a 75cm 2 Flask (Thermo fisher, USA). Thereafter, when the cells grew about 80% in a 75cm 2 flask, the cells were harvested and subcultured.
  • the cells for the experiment were seeded in a 24well plate at 2 X 10 5 cells/ml, and then cultured for 24 hours using an incubator in 5% CO 2 conditions. After that, the culture medium was removed and plate washed with Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, USA), and then the control (control, untreated group), TNF- ⁇ (Human Tumor necrosis factor alpha, Sigma-aldrich, USA). ) A 10 ng/ml treatment group was prepared. * TNF- ⁇ increases MMP-1 to produce skin wrinkles.
  • the cell lysate of the F5 strain was dispensed at each concentration along with 10 ng/ml of TNF- ⁇ .
  • the cell lysate of TNF- ⁇ and F5 strain was treated for 24 hours, and cultured using an incubator at 37° C. in 5% CO 2 conditions.
  • MMP-1 Matrix metalloproteinase-1
  • Type 1 collagen was performed.
  • MMP-1 was relative quantitation using Human Pro-MMP-1 Quantikine ELISA Kit (R&D systems, USA), and Type 1 collagen using Human Procollagen Type I C-peptide (PIP) EIA Kit (Takara, JAPAN).
  • PIP Human Procollagen Type I C-peptide
  • pro-collagen was increased when the cell lysate of the F5 strain was treated with TNF- ⁇ at a concentration of 500 ⁇ g/ml as shown in FIG. 5A, which is the level of the control (untreated group). It can be seen that it is recovered, and significantly increased compared to the TNF- ⁇ alone treatment group.
  • the expression of MMP-1 was recovered to the level of the control group (control, untreated group) compared to the TNF- ⁇ alone treatment group. This proves that even though the increase of MMP-1 was induced through the TNF- ⁇ challenge, the cell lysate of the F5 strain is the cause that affects the recovery (reduction) of the pro-collagen to the amount corresponding to the control. This indicates that the lysate has an effect of greatly enhancing the ability to produce Type 1 collagen.
  • HaCaT cell line a human keratinocyte, was used to evaluate skin function.
  • the culture method was cultured in the same manner as described above, and when the cells grew about 80% in a 75cm 2 flask, the cells were harvested and subcultured. Cells were seeded in a 10cm circular plate at 5 X 10 6 cells/ml, and then cultured for 24 hours using an incubator in 5% CO 2 conditions. Thereafter, the culture medium was removed, plate wash was performed using Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, USA), and then 50, 100, 500 ⁇ g/ml of the cell lysate of the F5 strain were dispensed for each concentration. No treatment was applied to the control group. The F5 lysate was treated for 24 hours, and incubated using an incubator at 37°C under 5% CO 2 conditions.
  • DPBS Dulbecco's Phosphate Buffered Saline
  • RNA of cells was isolated using TRIzol® Reagent (Ambion, USA). After RNA was quantified to synthesize cDNA, it was synthesized into cDNA using SuperScriptTM IV First-Strand Synthesis System (Invitrogen, USA).
  • oligo primers of occludin OCLN
  • CCLDN4 claudin 4
  • HAS2 Hyaluronan synthase 2
  • Applied Biosystems 7500 fast real-time PCR system to identify skin-related functional genes.
  • qRT-PCR quantitative real-time PCR
  • the cell lysate of the strain of the present invention is involved in contact between skin cells as the expression of OCLN and CLDN4 increases, and thus has a function of remarkably strengthening the skin barrier.
  • the cell lysate of the strain is Hyaluronan synthase 2 (HAS2 ) By stimulating the expression of Hyaluronic acid (HA) in the skin, thereby reducing skin dryness.
  • IL-10 In order to evaluate the function of anti-inflammatory, the expression level of IL-10 was confirmed.
  • the culture method was the HDF cell culture method described above, and when the cells were grown about 80% in a 75cm 2 flask, the cells were harvested and subcultured. Cells were seeded in a 24well plate at 1 X 10 6 cells/ml, and then cultured for 24 hours using an incubator in 5% CO 2 conditions. First, the control was prepared as an untreated group, and LPS (Lipopolysaccharide, Sigma-aldrich, USA) was treated as a positive control group.
  • LPS Lipopolysaccharide, Sigma-aldrich, USA
  • a group treated with the cell lysate of the F5 strain alone and a group treated with 100 ⁇ g/ml of F5 together with 1 ⁇ g/ml of LPS were also prepared. After 24 hours, the supernatant in each well was recovered and relative quantification was performed using Interleukin 10 (IL-10, R&D, USA).
  • IL-10 Interleukin 10
  • a skin toner (100 g) containing the lyophilized product of the cell lysate of the Bifidobacterium longum ATG-F5 strain was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 3.0 Butylene glycol 2.0 Propylene glycol 2.0 Polyoxyethylene (60) hardened castor oil 1.0 ethanol 10.0 Triethanolamine 0.1 antiseptic a very small amount Pigment a very small amount Spices a very small amount Purified water Balance
  • the lyophilized product of the cell lysate of the Bifidobacterium longum ATG-F5 strain was extracted with a 70 (v/v)% ethanol aqueous solution to obtain a concentrated solution from which the solvent was removed, and a moisture lotion (100 g) containing this concentrated solution as shown in Table 6 was used. It was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 1.0 Sitosterol 1.7 Polyglyceryl 2-oleate 1.5 Ceteares 1.2 cholesterol 1.5 Dicetyl phosphate 0.4 Concentrated glycerin 5.0 Sunflower Oil 10.0 Carboxyvinyl polymer 0.2 Xanthan gum 0.3 antiseptic a very small amount Spices a very small amount Purified water Balance
  • a nutrient cream 100 g containing a lyophilized product of the cell lysate of Bifidobacterium longum ATG-F5 strain was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 5.0 Sitosterol 4.0 Polyglyceryl 2-oleate 3.0 Ceramide 0.7 Ceteares-4 2.0 cholesterol 3.0 Dicetyl phosphate 0.4 Concentrated glycerin 5.0 Sunflower Oil 22.0 Carboxyvinyl polymer 0.5 Triethanolamine 0.5 antiseptic a very small amount Spices a very small amount Purified water Balance
  • an essence (100 g) containing a lyophilized product of the cell lysate of Bifidobacterium longum ATG-F5 strain was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 1.0 Sitosterol 1.7 Polyglyceryl 2-oleate 1.5 Ceteares-4 2.0 cholesterol 3.0 Dicetyl phosphate 0.4 Concentrated glycerin 5.0 Sunflower Oil 22.0 Carboxyvinyl polymer 0.5 Triethanolamine 0.5 antiseptic a very small amount Spices a very small amount Purified water Balance
  • a foundation (100 g) containing a lyophilized product of the cell lysate of Bifidobacterium longum ATG-F5 strain was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 1.0 Beeswax 2.0 Cyclomethicone 2.0 Floating paraffin 5.0 Squalane 5.0 Stearic acid 2.0 Lipophilic glycerin monostearate 3.0 Caprylic/Capric Triglyceride 4.0 glycerin 4.0 Propylene glycol 3.0 Butylene glycol 3.0 Triethanolamine 1.0 Aluminum Magnesium Silicate 0.5 Pigment 12.0 antiseptic a very small amount Spices a very small amount Purified water Balance
  • hair shampoo (100 g) containing a lyophilized product of the cell lysate of Bifidobacterium longum ATG-F5 strain was prepared according to a conventional method.
  • Raw material Content (g) Freeze-dried product of cell lysate of Bifidobacterium longum ATG-F5 strain 3.0 Arachidyl glucoside 4.5 ethanol 2.0 Butylene glycol 2.0 Citric acid 0.1 Phenoxyethanol 0.02 Purified water Balance
  • 200 g of the lyophilisate of the cell lysate of the Bifidobacterium longum ATG-F5 strain of the present invention was mixed with 175.9 g of lactose, 180 g of potato starch, and 32 g of colloidal silicic acid. After adding a 10% (w/v) gelatin solution to this mixture, it was pulverized and passed through a 14 mesh sieve. This was dried, and 160 g of potato starch, 50 g of talc, and 5 g of magnesium stearate were added thereto, and the resulting mixture was made into an anti-inflammatory tablet.
  • the freeze-dried powder of the cell lysate of the Bifidobacterium longum strain of the present invention was added in an amount of 1% by weight to the cooking seasoning to prepare a cooking seasoning for health promotion.
  • Freeze-dried powder of the cell lysate of the Bifidobacterium longum strain of the present invention was added to milk in an amount of 0.1% by weight, and various dairy products such as butter and ice cream were prepared using the milk.
  • Vegetable juice for health promotion was prepared by adding 0.5 g of lyophilized powder of the cell lysate of the Bifidobacterium longum strain of the present invention to 1,000 ml of tomato juice or carrot juice.
  • Fruit juice for health promotion was prepared by adding 0.1 g of lyophilized powder of the cell lysate of the Bifidobacterium longum strain of the present invention to 1,000 ml of apple juice or grape juice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dermatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Molecular Biology (AREA)
  • Birds (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Cosmetics (AREA)

Abstract

본 발명은 신규한 비피토박테리움 롱검 ATG-F5 균주에 관한 것으로서, 상기 F5 균주는 항생제 내성으로부터 안전하고, 피부병원균인 Cutibacterium acnes에 대한 항균력, radical에 대한 항산화 효과, 피부 장벽 개선, 항염증 효과를 통해 피부의 건강을 개선하고, 피부 미백 기능성, 주름 개선 기능성, 피부건조완화 기능성을 통해 피부 미용을 증진하는 기능성 유익균, 이를 포함하는 화장료 조성물이나 건강기능식품으로 이용가능하다.

Description

신규한 비피도박테리움 롱검 ATG-F5 균주 또는 이를 포함하는 화장료 조성물
본 발명은 신규한 비피도박테리움 롱검 ATG-F5(Bifidobacterium longum ATG-F5, 기탁번호 : KCTC13828BP) 균주 또는 이를 포함하는 화장료 조성물에 관한 것이다.
피부미용 분야는 점차 적용범위가 넓어짐에 따라 다양한 기법들을 이용하고 있다. 여러 기법 중 사람들은 피부를 화사하게 만들어주는 미백기능성 소재의 화장품이나 젊은 피부 및 탄력 있는 피부를 만들어주는 주름개선 및 억제의 기능성을 가진 화장품들을 선호하고 있다. 최근 피부의 장벽의 기능과 피부건조증을 방지하는 기능성 화장품들이 추가적으로 나타남에 따라 사람들의 인식의 변화로 인해 미백기능성 및 주름개선 화장품들이 더 다양한 기능성으로 개발이 되어가고 있는 추세이다.
이러한 기법 중 미백기능성 화장품은 사람의 피부색을 결정짓는 역할을 하는 Melanin activity inhibition 원리를 가지고 있다. Melanin은 표피의 기저층에 존재하고 있으며, 이 멜라닌은 태양으로부터 받게 되는 자외선을 차단하는 색소로 과도한 합성이나, 노화 등에 의하여 피부의 생리기능이 떨어지게 되면 피부내 침착하게 되어 기미, 주근깨 및 다양한 색소를 나타내게 된다.
Melanin의 합성은 Tyrosinase, Tyrosinase related protein-1 (TRP-1)과 Tyrosinase related protein-2 (TRP-2), cyclic adenosine monophosphate (cAMP) 유도 물질인 Adrenocorticotropic hormone (ACTH), α-melanocyte stimulating hormone (α-MSH)등에 의해 조절된다. (Chan et al., 2011). 이 중 멜라닌 생성 촉진은 Tyrosinase, Tyrosinase-related protein 1 (TRP-1) 그리고 Tyrosinase-related protein 2 (TRP-2)에 의해 조절을 하게 되는데, Tyrosinase는 수산화 반응을 촉진함으로써 Tyrosine을 3,4-dihydroxyphenylalanine (DOPA)로 전환하며, DOPA는 DOPA-quinone으로 전환된다. (Jang and Park, 2017) 이렇게 증가된 DOPA-quinone은 Melanin 생성으로 이어진다. 따라 Tyrosinase activity inhibition 효과는 Melanin 생성을 억제함으로써 미백효과를 가져오는 중요한 역할을 한다.
또 하나의 기법 중 하나인 주름개선 및 억제의 기능성을 가진 화장품의 원리는 피부탄력에 잘 알려져 있는 Collagen이 관여하고 있다. 피부노화에는 내인성과 외인성의 두가지로 분류할 수 있으며, 내인성의 경우 나이가 들어 감에 따라 나타나는 노화이며, 외인성의 경우 햇빛 자외선의 노출에 의한 광 노화(Photoaging)가 있다. 이에 피부는 크게 3가지로 구성되어 있으며 각질세포로 피부를 보호하는 역할인 표피와, 피부의 탄력 및 주름에 관여하는 진피와 그 외 피하지방이 있다. 이 중 진피는 섬유상 단백질인 Collagen과 Elastin 발현을 시키며, Collagen은 섬유상 단백질로 14개의 Type이 존재하며, 14개 중 피부에 작용하는 Type 1 collagen이 주로 존재하게 된다. (Kim and Yoon., 2013). Matrix metalloproteinases (MMPs)는 collagen을 분해하는 기질 단백질로 20여종 이상의 종류가 알려져 있고, MMP-1은 Collagenase 1이라고도 하며, Collagen을 분해하게 되면서 피부 내 탄력이 감소하여 주름을 생성하게 된다. (Lee et al., 2013) 따라서 피부에 이러한 작용을 하는 단백질들을 조절함으로서 주름개선 및 피부탄력을 유지 보수할 수 있다.
최근 피부와 관련된 위의 기능성 외에는 피부장벽 강화와 피부건조증 완화가 되는 기능성이 있다. 피부장벽 개선은 피부조직인 상피세포에서 Tight junction 단백질이 세포간 접촉에 관여할 때 필요한 단백질인 Occludin, Claudin 등의 발현을 증강시키면서 피부 상태를 개선하는 것과 관련이 있으며 (B. Tebbe et al., 2002), 피부건조증의 경우에는 Hyaluronan synthase 2 (HAS2)가 Hyaluronic acid (HA)의 합성을 유도하여 피부 속 수분손실을 줄여주는 역할을 하게 된다. Hyaluronic acid는 수분을 유지하고 조직의 구조와 탄력성을 유지와 영양소 교환 피부에서 중요한 생물학적 역할을 수행한다.
이에 본 발명은 피부미용과 관련된 미백, 주름개선, 피부장벽 강화, 피부건조 완화, 항여드름, 항염증 기능성을 강화하기 위한 방안으로 기탁번호 KCTC13828BP로 기탁된 Bifidobacterium longum ATG-F5 균주를 제시한다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 등록특허 제10-1589464호 (발명의 명칭 : 신규한 비피더스 균주 및 이를 포함하는 성장촉진용 기능성 식품 조성물, 출원인 : 주식회사 쎌바이오텍, 등록일 : 2016년01월22일)
(특허문헌 2) 유럽등록특허 제2308566B1호 (발명의 명칭 : Use of orally administered probiotic bifidobacteria for human beauty benefits, 출원인 : The Procter & Gamble Company 외 1인, 등록일 : 2011년04월13일)
(특허문헌 3) 대한민국 등록특허 제10-0889605호 (발명의 명칭 : 주름개선용 화장료 조성물, 출원인 : 주식회사 엘지생활건강, 등록일 : 2009년03월12일)
(특허문헌 4) 대한민국 등록특허 제10-1456040호 (발명의 명칭 : 미백용 화장료 조성물, 출원인 : 주식회사 엘지생활건강, 등록일 : 2014년10월23일)
(특허문헌 5) 대한민국 공개특허 제10-2016-0092564호 (발명의 명칭 : 효모,유산균 2단 발효 용해물을 함유하는 항산화, 주름개선, 보습 효과를 갖는 화장료 조성물, 출원인 : 인코스(주), 공개일 : 2016년08월05일)
(특허문헌 6) 대한민국 등록특허 제10-1788544호 (발명의 명칭 : 복합 유산균 배양물을 함유하는 피부장벽 강화용 화장료 조성물, 출원인 : 코스맥스 주식회사 외 1인, 등록일 : 2017년10월16일)
(특허문헌 7) 대한민국 등록특허 제10-1885195호 (발명의 명칭 : 목서 발효추출물을 유효성분으로 함유하는 화장료 조성물, 출원인 : (주)코리아나화장품, 등록일 : 2018년07월30일)
[비특허문헌]
(비특허문헌 1) B. TebbeJ. MankertzC. SchwarzS. AmashehM. FrommC. AssafU. Schultz-EhrenburgH. Sanchez RuderischJ.-D. SchulzkeC. Orfanos. (2002). Tight junction proteins: a novel class of integral membrane proteins. Archives of Dermatological Research, 294(1-2), 14-18.
(비특허문헌 2) Chan, Y. Y., Kim, K. H., & Cheah, S. H. (2011). Inhibitory effects of Sargassum polycystum on tyrosinase activity and melanin formation in B16F10 murine melanoma cells. Journal of Ethnopharmacology, 137(3), 1183-1188.
(비특허문헌 3) Chang, O. K., Seol, K. H., Jeong, S. G., Oh, M. H., Park, B. Y., Perrin, C., & Ham, J. S. (2013). Casein hydrolysis by Bifidobacterium longum KACC91563 and antioxidant activities of peptides derived therefrom. Journal of dairy science, 96(9), 5544-5555.
(비특허문헌 4) Choi, S. M., Jang, H. S., & Kim, B. O. (2008). Effects of H2O2 and chlorhexidine on MMP-1, TIMP-1, 2, Type 1 collagen, fibronectin and UNCL expressions in human periodontal ligament fibroblasts. The Journal of the Korean Academy of Periodontology, 38(4), 645-656.
(비특허문헌 5) EFSA. (2012). Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA Journal 10(6):2740
(비특허문헌 6) Erel, O. (2004). A novel automated direct measurement method for total antioxidant capacity using a new generation, more stable ABTS radical cation. Clinical biochemistry, 37(4), 277-285.
(비특허문헌 7) Hasegawa, T. (2010). Tyrosinase-expressing neuronal cell line as in vitro model of Parkinson’s disease. International journal of molecular sciences, 11(3), 1082-1089.
(비특허문헌 8) Gye Won Lee, Sung Min Park, Yung Choon Yoo, and Young Ho Cho. (2013). Effect of Ponciri Fructus Extracts Fermented with Ganoderma lucidum on the Collagen Synthesis and Expression of Matrix Metalloproteinase-1. Kor Society for Biotechnology and Bioengineering Journal 28(2), 106-114.
(비특허문헌 9) Kim, Y. J., & Yoon, Y. (2013). Regulation of Col1A1 and MMP1 Expression by Taurine, Major Component of Oyster, in Human Dermal Fibroblasts. Kor J Aesthet Cosmetol, 11(2), 393-397.
(비특허문헌 10) Sang-Myeoung Nam, Il-Jun Kang and Mee-Hye Shin. (2015). Anti-diabetic and Anti-oxidative Activities of Extracts from Crataegus pinnatifida. J East Asian Soc Dietary Life 25(2): 270～277.
(비특허문헌 11) Re, R., Pellegrini, N., Proteggente, A., Pannala, A., Yang, M., & Rice-Evans, C. (1999). Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free radical biology and medicine, 26(9-10), 1231-1237.
(비특허문헌 12) Tae Won Jang and Jae Ho Park. (2017). Antioxidative Activities and Whitening Effects of Ethyl Acetate Fractions from The Immature Seeds of Abeliophyllum distichum. Journal of Life Science, 27(5), 536-544.
본 발명의 목적은 신규한 비피도박테리움 롱검 ATG-F5 균주또는 이를 포함하는 화장료 조성물을 제공하는 데에 있다.
본 발명은 신규한 비피도박테리움 롱검 ATG-F5(Bifidobacterium longum ATG-F5, 기탁번호 : KCTC13828BP) 균주에 관한 것이다.
상기 균주는 오클루딘(occludin/OCLN), 클라우딘 4(claudin 4/CLDN4) 유전자 발현을 증강시켜 피부장벽을 강화하며, 히알루론산 합성 효소 2(Hyaluronan synthase 2/HAS2)의 유전자 발현을 증강함으로써, 피부건조 완화 기능이 있는 것을 특징으로 한다.
여드름 원인균인 쿠티박테리움 아크네스(Cutibacterium acnes)의 성장을 억제하는 항여드름 기능 또는 인터루킨-10(Interleukin 10, IL-10)을 증가시키는 항염증 활성이 있으며, 항산화 기능이 있다.
또한, 상기 균주는 티로시나아제의 활성 억제 또는 멜라닌 생성 효능으로 인한 미백 기능 또는 MMP-1(Matrix metalloproteinase-1) 활성 억제로 인한 프로-콜라겐(pro-collagen) 증진 기능이 있는 주름개선 효능이 있는 것을 특징으로 한다.
본 발명에서 비피도박테리움 롱검 ATG-F5 균주라 함은 상기 균주의 균체; 상기 균체의 파쇄물; 상기 균주의 배양물; 상기 균주의 배양물에서 균체를 제거한 배양액; 상기 균주의 균체 추출물; 상기 균주의 배양물의 추출물; 및, 상기 균주의 배양물에서 균체를 제거한 배양액의 추출물;로 이루어진 군 중에서 선택되는 것으로 대체되거나 포함될 수 있다.
따라서, 본 발명은 상기 균주를 포함하는 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능이 있는 화장료 조성물을 제공한다.
상기 화장료 조성물의 제형은 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 풋크림, 넥크림, 파운데이션, 에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 헤어샴푸, 헤어트리트먼트, 헤어린스 및 바디클렌저로 이루어진 군 중에서 선택될 수 있다.
또 다른 양태에서 본 발명은 상기 균주를 포함하는 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능이 있는 건강기능식품을 제공할 수 있다.
상기 건강기능식품은 상기 건강기능식품은 육류, 소세지, 빵, 캔디류, 스넥류, 면류, 아이스크림, 유제품, 발효유, 스프, 이온음료, 음료수, 알코올 음료, 껌, 차 및 비타민 복합제로 이루어진 군에서 선택될 수 있다.
본 발명은 또한 상기 균주를 포함하는 피부건조증, 여드름 및 염증 질환으로 이루어진 군에서 선택되는 질환의 예방 또는 치료용 조성물에 관한 것이다.
상기 염증 질환은 염증성 장질환, 염증성 콜라겐 혈관 질환, 사구체신염, 염증성 피부 질환, 유육종증, 망막염, 위염, 간염, 장염, 관절염, 편도선염, 인후염, 기관지염, 폐렴, 췌장염, 패혈증, 방광염, 신장염 및 신경염으로 이루어진 질환 중에서 선택되는 것을 특징으로 하는 피부건조증, 여드름 및 염증 질환으로 이루어진 군에서 선택될 수 있다.
이하 본 발명을 좀 더 자세하게 설명한다.
본 발명의 비피도박테리움 롱검 ATG-F5 균주는 BL medium (이하 BL) 또는 0.3~0.7 g/L의 L-cystein을 추가한 MRS medium (이하 MRS-cys)의 액체 또는 고체 배지(broth 또는 agar)에서 배양 가능하며, BL 또는 MRS-cys broth에서 비피도박테리움 롱검 ATG-F5가 8.0 × 108 ~ 1.0 × 109 CFU/㎖의 농도까지 배양가능하다. 또한 MRS medium에 L-cystein을 추가할 시, 0.6 g/L를 첨가하는 것이 더 좋다.
이 균주는 30~37℃에서 16~24시간 배양하는 것이 바람직하며, 배양가능한 최적 온도는 37℃, 최소 온도는 15℃, 최대온도는 37℃이고, 최적 pH는 6.8, 배양가능한 최소 pH는 5.0 최대 pH는 7.3 이다. 최적 배양시간은 18시간이며 최소 배양시간은 8시간 최대 배양시간 72시간이다.
본 발명의 균주는 암피실린(ampicillin), 반코마이신(vancomycin), 젠타마이신(gentamicin), 카나마이신(kanamycin), 스트렙토마이신(streptomycin), 클린다마이신(clindamycin), 에리트로마이신(erythromycin), 테트라사이클린(tetracycline) 및 클로라암페니콜(chloramphenicol)으로 이루어진 군에서 1종 이상 선택되는 항생제에 대한 내성이 없는 안전한 균주이다.
본 발명은 비피도박테리움 롱검 ATG-F5 균주, 즉, 상기 균주의 균체; 상기 균체의 파쇄물; 상기 균주의 배양물; 상기 균주의 배양물에서 균체를 제거한 배양액; 상기 균주의 균체 추출물; 상기 균주의 배양물의 추출물; 또는; 상기 균주의 배양물에서 균체를 제거한 배양액의 추출물; 중에서 선택되는 것을 포함하는 각종 조성물을 제공한다.
이 중에서, F5 균주의 균체 파쇄물은 상기 균주의 배양액을 원심분리하여 균체를 배양 상등액으로부터 분리한 후, PBS에 현탁한 후 Lysozyme을 처리하고 초음파 처리하여 얻을 수 있다. 이 때, 원심분리하여 균체를 분리할 때 PBS 등의 완충액으로 균체를 세척한 후 다시 원심분리 할 수 있고, 원심분리는 각각 3,000~5000 rpm에서 5~60분간 수행할 수 있다. PBS에 현탁된 균체에 라이소자임은 30~37℃에서 300~700 ㎍/㎖의 농도로 처리되는 것이 바람직하며, 초음파 처리 조건은 50~90W, 20~60sec, 20~40cycle인 것이 좋다. 이 때, 균체 파쇄물에 살아있을 수 있는 균의 사멸을 위해 열처리 하는 것이 좋은데, 50~70℃에서 30~60분간 열처리할 수 있고, 직접 가열보다 단백질 변성을 최소화하기 위해 중탕으로 가열하는 것이 좋다. 또한 이 때 별도로 분리된 배양상등액은 pH 7~8로 조정하여 여과하여( 0.2 μm pore filter 이용) 각종 배양물 유래 조성물로서 이용가능하다.
상기 균주 유래의 각 조성물은 별도의 가공없이도 이용가능하며, 각종 방법을 통해 정제 또는 건조되어 화장료 조성물, 약학 조성물 또는 건강기능식품에 첨가될 수 있다.
상기 균주 유래의 각 조성물은 동결건조법을 수행하여 건조할 수도 있으며, 통상의 균주 또는 이들 유래의 조성물을 건조할 때 포함되는 각종 부형제를 포함할 수 있다. 상기 동결건조용 부형제는 글루콘산, 알긴산, 알긴산나트륨, 하이드록시프로필셀룰로오스, 하이드록시프로필메틸셀룰로오스, 카르복시메틸셀룰로오스나트륨, 메틸셀룰로오스, 카보머, 하이알루론산, 트라가칸트, 카라야검, 수용성 전분, 펙틴, 젤라틴, 폴리비닐알콜, 폴리비닐 피롤리돈, 올리고당류, 당알콜류, 글루콘산 칼슘, 젖산칼슘, 폴리메틸메타크릴레이트, 소맥 단백, 대두 단백, 메틸셀룰로오스, 아쿠아코트, 구아검, 로커스트 빈 검, 잔탄 검, 겔란 검, 아라비아 검, 트레할로오스 등에서 선택될 수 있다.
본 발명은 상기 균주 유래의 각종 조성물이 포함된 화장료 조성물을 제공할 수 있는데, 상기 화장료 조성물은 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능용 조성물로 이용가능하며, 화장료 조성물의 중량을 전체 100 중량% 기준으로 할 때, 상기 균주 유래의 다양한 조성물이 0.001~20 중량%가 포함될 수 있다. 또한 상기 화장료 조성물의 제형은 바람직하게는 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 풋크림, 넥크림, 파운데이션, 에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 헤어샴푸, 헤어트리트먼트, 헤어린스 및 바디클렌저로 이루어진 그룹에서 선택될 수 있다.
본 발명의 화장료 조성물에는 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 스핑고 지질 및 해초 엑기스로 이루어진 군에서 선택된 성분이 추가로 포함될 수 있다.
수용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 B1, 비타민 B2, 비타민 B6, 피리독신, 염산피리독신, 비타민 B12, 판토텐산, 니코틴산, 니코틴산아미드, 엽산, 비타민 C, 비타민 H 등을 들 수 있으며, 그들의 염(티아민염산염, 아스코르빈산나트륨염 등)이나 유도체(아스코르빈산-2-인산나트륨염, 아스코르빈산-2-인산마그네슘염 등)도 본 발명에서 사용할 수 있는 수용성 비타민에 포함된다. 수용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 수득할 수 있다.
유용성 비타민으로서는 화장료 조성물에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 A, 카로틴, 비타민 D2, 비타민 D3, 비타민 E(d1-알파 토코페롤, d-알파 토코페롤, d-알파 토코페롤) 등을 들 수 있으며, 그들의 유도체(팔미틴산아스코르빈, 스테아르산아스코르빈, 디팔미틴산아스코르빈, 아세트산dl-알파 토코페롤, 니코틴산dl-알파 토코페롤비타민 E, DL-판토테닐알코올, D-판토테닐알코올, 판토테닐에틸에테르 등) 등도 본 발명에서 사용되는 유용성 비타민에 포함된다. 유용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소 또는 화학 합성법 등의 통상의 방법에 의해 취득할 수 있다.
고분자 펩티드로서는 화장료 조성물에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 콜라겐, 가수 분해 콜라겐, 젤라틴, 엘라스틴, 가수 분해 엘라스틴, 케라틴 등을 들 수 있다. 고분자 펩티드는 미생물의 배양액으로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 정제 취득할 수 있으며, 또는 통상 돼지나 소 등의 진피, 누에의 견섬유 등의 천연물로부터 정제하여 사용할 수 있다.
고분자 다당으로서는 화장료 조성물에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 히드록시에틸셀룰로오스, 크산탄검, 히알루론산나트륨, 콘드로이틴 황산 또는 그 염(나트륨염 등) 등을 들 수 있다. 예를 들어, 콘드로이틴 황산 또는 그 염 등은 통상 포유동물이나 어류로부터 정제하여 사용할 수 있다.
스핑고 지질로서는 화장료 조성물에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 세라미드, 피토스핑고신, 스핑고당지질 등을 들 수 있다. 스핑고 지질은 통상 포유류, 어류, 패류, 효모 또는 식물 등으로부터 통상의 방법에 의해 정제하거나 화학 합성법에 의해 취득할 수 있다.
해초 엑기스로는 화장료 조성물에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 갈조 엑기스, 홍조 엑기스, 녹조 엑기스 등을 들 수 있으며, 또, 이들의 해초 엑기스로부터 정제된 칼라기난, 아르긴산, 아르긴산나트륨, 아르긴산칼륨 등도 본 발명에서 사용되는 해초 엑기스에 포함된다. 해초 엑기스는 해초로부터 통상의 방법에 의해 정제하여 취득할 수 있다.
본 발명의 화장료 조성물에는 또한 통상의 화장료 조성물에 배합되는 다른 성분을 배합할 수도 있다.
이외에 첨가해도 되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.
유지 성분으로서는 에스테르계 유지, 탄화수소계 유지, 실리콘계 유지, 불소계 유지, 동물 유지, 식물 유지 등을 들 수 있다.
에스테르계 유지로서는 트리2-에틸헥산산글리세릴, 2-에틸헥산산세틸, 미리스틴산이소프로필, 미리스틴산부틸, 팔미틴산이소프로필, 스테아르산에틸, 팔미틴산옥틸, 이소스테아르산이소세틸, 스테아르산부틸, 리놀레산에틸, 리놀레산이소프로필, 올레인산에틸, 미리스틴산이소세틸, 미리스틴산이소스테아릴, 팔미틴산이소스테아릴, 미리스틴산옥틸도데실, 이소스테아르산이소세틸, 세바신산디에틸, 아디핀산디이소프로필, 네오펜탄산이소알킬, 트리(카프릴, 카프린산)글리세릴, 트리2-에틸헥산산트리메틸롤프로판, 트리이소스테아르산트리메틸롤프로판, 테트라2-에틸헥산산펜타엘리슬리톨, 카프릴산세틸, 라우린산데실, 라우린산헥실, 미리스틴산데실, 미리스틴산미리스틸, 미리스틴산세틸, 스테아르산스테아릴, 올레인산데실, 리시노올레인산세틸, 라우린산이소스테아릴, 미리스틴산이소트리데실, 팔미틴산이소세틸, 스테아르산옥틸, 스테아르산이소세틸, 올레인산이소데실, 올레인산옥틸도데실, 리놀레산옥틸도데실, 이소스테아르산이소프로필, 2-에틸헥산산세토스테아릴, 2-에틸헥산산스테아릴, 이소스테아르산헥실, 디옥탄산에틸렌글리콜, 디올레인산에틸렌글리콜, 디카프린산프로필렌글리콜, 디(카프릴,카프린산)프로필렌글리콜, 디카프릴산프로필렌글리콜, 디카프린산네오펜틸글리콜, 디옥탄산네오펜틸글리콜, 트리카프릴산글리세릴, 트리운데실산글리세릴, 트리이소팔미틴산글리세릴, 트리이소스테아르산글리세릴, 네오펜탄산옥틸도데실, 옥탄산이소스테아릴, 이소노난산옥틸, 네오데칸산헥실데실, 네오데칸산옥틸도데실, 이소스테아르산이소세틸, 이소스테아르산이소스테아릴, 이소스테아르산옥틸데실, 폴리글리세린올레인산에스테르, 폴리글리세린이소스테아르산에스테르, 시트르산트리이소세틸, 시트르산트리이소알킬, 시트르산트리이소옥틸, 락트산라우릴, 락트산미리스틸, 락트산세틸, 락트산옥틸데실, 시트르산트리에틸, 시트르산아세틸트리에틸, 시트르산아세틸트리부틸, 시트르산트리옥틸, 말산디이소스테아릴, 히드록시스테아르산 2-에틸헥실, 숙신산디2-에틸헥실, 아디핀산디이소부틸, 세바신산디이소프로필, 세바신산디옥틸, 스테아르산콜레스테릴, 이소스테아르산콜레스테릴, 히드록시스테아르산콜레스테릴, 올레인산콜레스테릴, 올레인산디히드로콜레스테릴, 이소스테아르산피트스테릴, 올레인산피트스테릴, 12-스테알로일히드록시스테아르산이소세틸, 12-스테알로일히드록시스테아르산스테아릴, 12-스테알로일히드록시스테아르산이소스테아릴 등의 에스테르계 등을 들 수 있다.
탄화 수소계 유지로서는 스쿠알렌, 유동 파라핀, 알파-올레핀올리고머, 이소파라핀, 세레신, 파라핀, 유동 이소파라핀, 폴리부덴, 마이크로크리스탈린왁스, 와셀린 등의 탄화 수소계 유지 등을 들 수 있다.
실리콘계 유지로서는 폴리메틸실리콘, 메틸페닐실리콘, 메틸시클로폴리실록산, 옥타메틸폴리실록산, 데카메틸폴리실록산, 도데카메틸시클로실록산, 디메틸실록산ㆍ메틸세틸옥시실록산 공중합체, 디메틸실록산ㆍ메틸스테알록시실록산 공중합체, 알킬 변성 실리콘유, 아미노 변성 실리콘유 등을 들 수 있다.
불소계 유지로서는 퍼플루오로폴리에테르 등을 들 수 있다.
동물 또는 식물 유지로서는 아보카도유, 아르몬드유, 올리브유, 참깨유, 쌀겨유, 새플라워유, 대두유, 옥수수유, 유채유, 행인유, 팜핵유, 팜유, 피마자유, 해바라기유, 포도종자유, 면실유, 야자유, 쿠쿠이너트유, 소맥배아유, 쌀 배아유, 시아버터, 월견초유, 마커데이미아너트유, 메도홈유, 난황유, 우지(牛脂), 마유, 밍크유, 오렌지라피유, 호호바유, 캔데리러왁스, 카르나바왁스, 액상 라놀린, 경화피마자유 등의 동물 또는 식물 유지를 들 수 있다.
보습제로서는 수용성 저분자 보습제, 지용성 분자 보습제, 수용성 고분자, 지용성 고분자 등을 들 수 있다.
수용성 저분자 보습제로서는 세린, 글루타민, 솔비톨, 만니톨, 피롤리돈-카르복실산나트륨, 글리세린, 프로필렌글리콜, 1,3-부틸렌글리콜, 에틸렌글리콜, 폴리에틸렌글리콜B(중합도 n = 2 이상), 폴리프로필렌글리콜(중합도 n = 2 이상), 폴리글리세린B(중합도 n = 2 이상), 락트산, 락트산염 등을 들 수 있다.
지용성 저분자 보습제로서는 콜레스테롤, 콜레스테롤에스테르 등을 들 수 있다.
수용성 고분자로서는 카르복시비닐폴리머, 폴리아스파라긴산염, 트라가칸트, 크산탄검, 메틸셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 히드록시프로필셀룰로오스, 카르복시메틸셀룰로오스, 수용성 키틴, 키토산, 덱스트린 등을 들 수 있다.
지용성 고분자로서는 폴리비닐피롤리돈ㆍ에이코센 공중합체, 폴리비닐피롤리돈ㆍ헥사데센 공중합체, 니트로셀룰로오스, 덱스트린지방산에스테르, 고분자 실리콘 등을 들 수 있다.
에몰리엔트제로서는 장쇄아실글루타민산콜레스테릴에스테르, 히드록시스테아르산콜레스테릴, 12-히드록시스테아르산, 스테아르산, 로진산, 라놀린지방산콜레스테릴에스테르 등을 들 수 있다.
계면 활성제로서는 비이온성 계면 활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제 등을 들 수 있다.
비이온성 계면 활성제로서는 자기 유화형 모노스테아르산글리세린, 프로필렌글리콜지방산에스테르, 글리세린지방산에스테르, 폴리글리세린지방산에스테르, 솔비탄지방산에스테르, POE(폴리옥시에틸렌)솔비탄지방산에스테르, POE 솔비트지방산에스테르, POE 글리세린지방산에스테르, POE 알킬에테르, POE 지방산에스테르, POE 경화피마자유, POE 피마자유, POEㆍPOP(폴리옥시에틸렌ㆍ폴리옥시프로필렌) 공중합체, POEㆍPOP 알킬에테르, 폴리에테르변성실리콘, 라우린산알카놀아미드, 알킬아민옥시드, 수소첨가대두인지질 등을 들 수 있다.
음이온성 계면 활성제로서는 지방산비누, 알파-아실술폰산염, 알킬술폰산염, 알킬알릴술폰산염, 알킬나프탈렌술폰산염, 알킬황산염, POE 알킬에테르황산염, 알킬아미드황산염, 알킬인산염, POE 알킬인삼염, 알킬아미드인산염, 알킬로일알킬타우린염, N-아실아미노산염, POE 알킬에테르카르복실산염, 알킬술포숙신산염, 알킬술포아세트산나트륨, 아실화 가수분해 콜라겐펩티드염, 퍼플루오로알킬인산에스테르 등을 들 수 있다.
양이온성 계면 활성제로서는 염화알킬트리메틸암모늄, 염화스테아릴트리메틸암모늄, 브롬화스테아릴트리메틸암모늄, 염화세토스테아릴트리메틸암모늄, 염화디스테아릴디메틸암모늄, 염화스테아릴디메틸벤질암모늄, 브롬화베헤닐트리메틸암모늄, 염화벤잘코늄, 스테아르산디에틸아미노에틸아미드, 스테아르산디메틸아미노프로필아미드, 라놀린 유도체 제 4급 암모늄염 등을 들 수 있다.
양성 계면 활성제로서는 카르복시베타인형, 아미드베타인형, 술포베타인형, 히드록시술포베타인형, 아미드술포베타인형, 포스포베타인형, 아미노카르복실산염형, 이미다졸린 유도체형, 아미드아민형 등의 양성 계면 활성제 등을 들 수 있다.
유기 및 무기 안료로서는 규산, 무수규산, 규산마그네슘, 탤크, 세리사이트, 마이카, 카올린, 벵갈라, 클레이, 벤토나이트, 티탄피막운모, 옥시염화비스무트, 산화지르코늄, 산화마그네슘, 산화아연, 산화티탄, 산화알루미늄, 황산칼슘, 황산바륨, 황산마그네슘, 탄산칼슘, 탄산마그네슘, 산화철, 군청, 산화크롬, 수산화크롬, 칼라민 및 이들의 복합체등의 무기 안료 ; 폴리아미드, 폴리에스테르, 폴리프로필렌, 폴리스티렌, 폴리우레탄, 비닐수지, 요소수지, 페놀수지, 불소수지, 규소수지, 아크릴수지, 멜라민수지, 에폭시수지, 폴리카보네이트수지, 디비닐벤젠ㆍ스티렌 공중합체, 실크파우더, 셀룰로오스, CI 피그먼트옐로우, CI 피그먼트오렌지 등의 유기 안료 및 이들의 무기 안료와 유기 안료의 복합 안료 등을 들 수 있다.
유기 분체로서는 스테아르산칼슘 등의 금속비누 ; 세틸린산아연나트륨, 라우릴린산아연, 라우릴린산칼슘 등의 알킬인산금속염 ; N-라우로일-베타-알라닌칼슘, N-라우로일-베타-알라닌아연, N-라우로일글리신칼슘 등의 아실아미노산 다가금속염 ; N-라우로일-타우린칼슘, N-팔미토일-타우린칼슘 등의 아미드술폰산 다가금속염 ; N-엡실론-라우로일-L-리진, N-엡실론-팔미토일리진, N-알파-파리토일올니틴, N-알파-라우로일아르기닌, N-알파-경화우지지방산아실아르기닌 등의 N-아실염기성아미노산 ; N-라우로일글리실글리신 등의 N-아실폴리펩티드 ; 알파-아미노카프릴산, 알파-아미노라우린산 등의 알파-아미노지방산 ; 폴리에틸렌, 폴리프로필렌, 나일론, 폴리메틸메타크릴레이트, 폴리스티렌, 디비닐벤젠ㆍ스티렌 공중합체, 사불화에틸렌 등을 들 수 있다.
자외선 흡수제로서는 파라아미노벤조산, 파라아미노벤조산에틸, 파라아미노벤조산아밀, 파라아미노벤조산옥틸, 살리실산에틸렌글리콜, 살리신산페닐, 살리신산옥틸, 살리신산벤질, 살리신산부틸페닐, 살리신산호모멘틸, 계피산벤질, 파라메톡시계피산-2-에톡시에틸, 파라메톡시계피산옥틸, 디파라메톡시계피산모노-2-에틸헥산글리세릴, 파라메톡시계피산이소프로필, 디이소프로필ㆍ디이소프로필계피산에스테르 혼합물, 우로카닌산, 우로카닌산에틸, 히드록시메톡시벤조페논, 히드록시메톡시벤조페논술폰산 및 그 염, 디히드록시메톡시벤조페논, 디히드록시메톡시벤조페논디술폰산나트륨, 디히드록시벤조페논, 테트라히드록시벤조페논, 4-tert-부틸-4'-메톡시디벤조일메탄, 2,4,6-트리아닐리노-p-(카르보-2'-에틸헥실-1'-옥시)-1,3,5-트리아진, 2-(2-히드록시-5-메틸페닐)벤조트리아졸 등을 들 수 있다.
살균제로서는 히노키티올, 트리클로산, 트리클로로히드록시디페닐에테르, 크로르헥시딘글루콘산염, 페녹시에탄올, 레조르신, 이소프로필메틸페놀, 아줄렌, 살리칠산, 진크필리티온, 염화벤잘코늄, 감광소 301 호, 모노니트로과이어콜나트륨, 운데시렌산 등을 들 수 있다.
산화 방지제로서는 부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산 등을 들 수 있다.
pH 조정제로서는 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등을 들 수 있다.
알코올로서는 세틸알코올 등의 고급 알코올을 들 수 있다.
또한 이외에 첨가해도 되는 배합 성분은 이에 한정되는 것은 아니며, 또 상기 어느 성분도 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 배합 가능하지만, 총중량에 대하여 바람직하게는 0.01~5 중량%, 보다 바람직하게는 0.01 - 3 중량%로 배합될 수 있다.
본 발명의 화장료 조성물은 용액, 유화물, 점성형 혼합물 등의 형상을 취할 수 있다.
본 발명의 화장료 조성물에 포함되는 성분은 유효성분으로서 상기 균주 유래 조성물 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들면, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함한다.
본 발명의 화장료 조성물 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 화장료 조성물 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 화장료 조성물 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 화장료 조성물 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 화장료 조성물 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
또한, 본 발명은 비피토박테리움 롱검 ATG-F5 균주 유래의 각종 조성물이 함유하는 약학 조성물을 제공한다. 상기 비피토박테리움 롱검 ATG-F5 균주 유래의 조성물은 본 발명의 약학 조성물에 0.001~30 중량%로 하여 첨가될 수 있다.
상기 약학 조성물은 피부건조증, 여드름 및 염증 질환으로 이루어진 군에서 선택되는 질환의 예방 또는 치료용 조성물일 수 있으며, 상기 염증 질환은 염증성 장질환, 염증성 콜라겐 혈관 질환, 사구체신염, 염증성 피부 질환, 유육종증, 망막염, 위염, 간염, 장염, 관절염, 편도선염, 인후염, 기관지염, 폐렴, 췌장염, 패혈증, 방광염, 신장염 및 신경염으로 이루어진 질환 중에서 선택되는 것일 수 있다.
상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 등의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 균주에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제, 질좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 본 발명의 균주는 독성 및 부작용이 거의 없으므로 예방 목적으로 장기간 복용시에도 안심하고 사용할 수 있는 약제이다.
또한, 본 발명은 비피토박테리움 롱검 ATG-F5 유래의 조성물을 함유하는 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능이 있는 건강기능식품을 제공한다. 상기 비피토박테리움 롱검 ATG-F5 유래의 조성물은 본 발명의 건강기능식품에 0.001~50 중량%로 하여 첨가될 수 있다. 본 발명의 건강기능식품은 정제, 캡슐제, 환제 또는 액제 등의 형태를 포함하며, 본 발명의 균주 유래 조성물을 첨가할 수 있는 식품으로는, 예를 들어, 육류, 소세지, 빵, 캔디류, 스넥류, 면류, 아이스크림, 유제품, 발효유, 스프, 이온음료, 음료수, 알코올 음료, 껌, 차 및 비타민 복합제 등이 있다.
본 발명은 신규한 비피토박테리움 롱검 ATG-F5(Bifidobacterium longum ATG-F5) 균주에 관한 것으로서, 상기 F5 균주는 항생제 내성으로부터 안전하고, 피부병원균인 Cutibacterium acnes에 대한 항균력, radical에 대한 항산화 효과, 피부 장벽 개선, 항염증 효과를 통해 피부의 건강을 개선하고, 피부 미백 기능성, 주름 개선 기능성, 피부건조완화 기능성을 통해 피부 미용을 증진하는 기능성 유익균, 이를 포함하는 화장료 조성물이나 건강기능식품으로 이용가능하다.
도 1은 본 발명의 비피토박테리움 롱검 ATG-F5 균주의 16S rRNA 염기서열을 나타낸다.
도 2는 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 갖는 여드름 원인균 Cutibacterium acnes 2종에 대한 항균성을 확인한 결과를 나타낸다.
도 3은 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 항산화 기능을 ABTS 소거활성으로 확인한 결과를 나타낸다.
도 4는 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 갖는 미백 기능과 관련된 멜라닌 생성 증가 효능(도 4A) 및 티로시아나에 활성 억제 효능(도 4B)을 확인한 결과를 나타낸다.
도 5는 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 갖는 주름개선 기능과 관련된 pro-collagen 합성능 및 MMP-1의 억제 효능을 확인한 결과를 나타낸다.
도 6은 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 피부장벽강화 기능과 관련된 occludin (OCLN)과 claudin 4 (CLDN4)의 유전자 발현을 증가시키는 효능을 확인한 결과를 나타낸다.
도 7은 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 피부건조 완화 기능과 관련된 Hyaluronan synthase 2 (HAS2)의 유전자 발현을 증가시키는 효능을 확인한 결과를 나타낸다.
도 8은 본 발명의 비피토박테리움 롱검 ATG-F5 균주가 갖는 염증 억제 효과(Interleukin 10/IL-10 증가)를 나타내는 결과이다.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다.
<실시예 1. 기능성 평가를 위한 미생물의 배양>
Bifidobacterium longum (이하 F5)은 신생아 분변 (2018년 출생, 대전, 대한민국)을 공여받아 분리하였다. 이를 위해 0.9%(w/v) 식염수에 신생아 분변을 10배 연쇄희석법으로 희석한 결과물을 Bifidobacterium selective (BS, MBcell seoul, Korea) 고체배지에 도말하여 37℃에 48시간 동안 배양하였다. 배양된 BS 배지에서 발생한 세균들의 콜로니를 현미경으로 관찰하여 간균 형태, 카탈라제 (catalase) 반응이 없는 것을 골라내어 ATG-F5 균주라 명명하였다(이하 F5라고도 함). 이후 실험에서 F5 균주를 배양하여 실험하기 위해 BL 또는 MRS-cys agar 고체배지에 먼저 배양한 후, 순수 분리되는 colony를 broth 액체배지에 접종하여 배양하였다. 미생물의 배양은 37℃에 하룻밤 가량 (약 16~20시간 사이) 배양하였다.
<실시예 2. F5 균주의 특성 확인>
실시예 2-1. F5 균주의 16S rRNA sequencing
F5 균주의 16S rRNA 염기서열 분석은 ㈜솔젠트 (Solgent, Dajeon)에 의뢰하였다. 염기서열 분석을 위한 primer는 27F (5′ - AGA GTT TGA TCC TGGCTC AG - 3′), 518F (5′ - CCA GCA GCC GCG GTA ATA C - 3′), 907R (5′ - CCGTCA ATT CMT TTR AGT TT - 3′), 1492R (5′ - GGT TAC CTT GTT ACG ACT T - 3′)을 이용하여 총 4번의 염기서열 reading을 하였고, 각 reading의 염기서열 alignment를 통해 도출된 contig 염기서열을 National Center for Biotechnology Information (NCBI)의 BLAST online tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi)를 이용하여 분석하였다.
16S rRNA sequencing을 통해 얻은 서열번호 1의 염기서열(도 1)을 NCBI의 BLAST database에 대조해본 결과, Bifidobacterium longum strain IRT와 16S rRNA 서열이 99.9% 일치하여 분자생물학적 분류학상 위치는 Bifidobacterium longum에 속하는 것으로 나타났다.
이에 한국생물자원센터에 2019년 3월 18일에 수탁번호 : KCTC13828BP로 본 발명의 균주를 기탁하였다.
실시예 2-3. F5 균주의 당발효 패턴
또한 당발효 패턴을 파악하기 위해 API50 CHL test (BioMerieux, France)를 약간의 변형을 하여 실시하였다. 간략하게 10 mL API 50CHL medium (BioMerieux, France)에 L-cystein을 0.5 ㎍/㎖의 농도로 첨가하고 pH 6.7가량으로 조정하였고, 순수배양된 F5 균주를 약 0.5의 OD600 흡광도가 되도록 현탁한 후, 현탁배양액을 API 50CH test strip의 각 cuple에 접종하여 37℃에서 배양하였다. 접종 후 48, 72시간째 시점에서 당 발효 결과를 확인하였다.
API Kit을 이용한 당발효능 평가에서 F5 균주는 표 1과 같이, L-Arabinose, Ribose, Galactose, Glucose, Fructose, Mannose, Mannitol, Sorbitol, Methyl-αD-Mannopyranoside, N-Acetylglucosamine, Amygdalin, Arbutin, Esculin, Salicin, Cellobiose, Maltose, Lactose, Melibiose, Trehalose, Melezitose, Raffinose, Turanose를 분해하는 것으로 나타났으며, D-Arabinose, Methyl-αD-glucopyranoside, Gentibiose, L-fucose, Gluconate를 약하게 분해하는 것으로 확인된다.
Carbohydrates Bifidobacterium longum ATG-F5
Glycerol -
Erythritol -
D-Arabinose w
L-Arabinose +
Ribose +
D-Xylose -
L-Xylose -
Adonitol -
Methyl-βD-Xylopyranoside -
Galactose +
Glucose +
Fructose +
Mannose +
Sorbose -
Rhamnose -
Dulcitol -
Inositol -
Mannitol +
Sorbitol +
Methyl-αD-Mannopyranoside +
Methyl-αD-Glucopyranoside w
N-Acetylglucosamine +
Amygdalin +
Arbutin +
Esculin +
Salicin +
Cellobiose +
Maltose +
Lactose +
Melibiose +
Sucrose +
Trehalose +
Inulin -
Melezitose +
Raffinose +
Starch -
Glycogen -
Xylitol -
Gentiobiose w
Turanose +
Lyxose -
Tagatose -
D-Fucose -
L-Fucose w
D-Arabitol -
L-Arabitol -
Gluconate w
2-keto-glugonate -
5-keto-gluconate -
* Bifidobacterium longum ATG-F5의 당발효 패턴 (양성: +, 약한양성: w, 음성: -)
<실시예 3. F5 균주의 항균 활성 평가>
피부자극의 여러 기능성 평가 항목 중 F5에 대한 항균작용 기능성을 확인하기 위해 여드름 원인균 (Cutibacterium acnes, KCTC5012, KCTC3314)의 총 2종의 감염성 또는 기회감염성 세균에 대하여 F5의 항균활성을 disc test를 통해 억제환 (clear zone)을 확인하였다. 하룻밤 BL broth (MBcell seoul, Korea) 평판배지에서 배양한 2종의 세균을 1X phosphate buffered saline (PBS)에 약 0.8의 OD600으로 각각 현탁 하였다. 각 현탁액은 멸균된 면봉으로 흡수하여 BL과 MRS를 1:1로 혼합한 항균활성 시험용 agar medium에 전체 도말하고 건조하였고, 건조된 시험용 agar medium에 8 ㎜ paper disc (Advantec, Japan)를 부착하였다. BL broth에서 18-20시간가량 배양한 F5 균액을 각각 35 ㎕씩 paper disc에 접종한 후 약 3분간 건조하였고, 37°C에서 배양하며 경과를 관찰하였다. 배양 후 생성된 억제환의 크기는 지름을 측정하여 paper disc의 지름인 8 ㎜를 제하여 최종 값을 산출하였다.
항균활성 기능성에서 Cutibacterium acnes (KCTC 5012, 3314) 균주를 대상으로 한 결과 F5의 항균활성을 확인하였으며, KCTC5012와 KCTC3314에 대해 각각 9~10 ㎜, 5~6 ㎜의 항균활성을 보였으며, 각각의 Cutibacterium acnes 균주에 대해 최대 10 ㎜, 6 ㎜의 clear zone을 보였다 (표 2, 도 2).
실험 회차 Cutibacterium acnes KCTC 5012 에 대한 억제환 Cutibacterium acnes KCTC 3314에 대한 억제환
1차 실험 9 ㎜ 6 ㎜
2차 실험 9 ㎜ 5 ㎜
3차 실험 10 ㎜ 6 ㎜
평균 9.3 ㎜ 5.7 ㎜
<실시예 4. F5 균주의 항생제 내성 안전성>
항생제 테스트는 ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, clindamycin, erythromycin, tetracycline, chloramphenicol의 9종의 항생제 E-test strip (BioMerieux, France) 또는 MIC test strip (liofilchem, Italy)를 이용하여 최저저해농도 (minimum inhibitory concentration, MIC)값을 확인하였다.
이를 위해, F5 균주를 약 OD600 흡광도 0.8로 각각 현탁하여 멸균된 면봉을 이용하여 BL 고체배지에 도말하는 방법을 이용하였다. 이렇게 F5 균주가 도말된 고체배지를 약 3분간 건조 후 E-test strip 또는 MIC test strip을 올려 37°C에서 24~48시간 동안 배양하였다.
항생제의 종류와 안전하다고 판단될 수 있는 최저저해농도의 기준은 European food safety authority (EFSA)에서 발간한 가이드라인을 참조하였다 (EFSA Panel on Additives and Products or Substances used in Animal Feed, 2012).
이와 같이 9종의 항생제들에 대한 감수성 결과를 측정한 결과는 표 3의 결과와 같이 EFSA에서 제시한 가이드라인의 기준치에 부합하는 것으로 나타났다. *표 3의 각 수치의 단위는 μg/㎖이다.
Strains AMP VAN GEN KAN STR CD ERY TET CM
Bifidobacterium longum ATG-F5 0.75 0.75 8 NR 8 0.016 0.023 0.5 0.38
EFSA 기준 2 2 64 NR 128 1 1 8 4
AMP, ampicillin; VAN, vancomycin; GEN, gentamicin; KAN, kanamycin; STR, streptomycin; CD, clindamycin; ERY, erythromycin; TET, tetracycline; CM, chloramphenicol; NR, not required.
<실시예 5. F5 균주의 균체 파쇄물 제조>
각 기능성을 평가하기 위하여 10배 농축된 무세포 배양상등액 (CFCS, cell free culture supernatant)를 제작하였다.
이를 위해 F5의 배양액을 4,000 rpm에서 25분간 원심분리 하여 F5의 균체와 배양상등액을 분리하였다. 배양상등액은 pH7~8로 조정하여 0.2 μm pore syringe filter (Satorious, Germany)를 이용하여 여과하였고, 여과된 배양액은 -20℃에 보관하였다. 세포는 1X PBS에 현탁하여 vortex로 washing을 한 뒤, 4℃ 4,000 rpm에서 5min 조건하에 Centrifuge시켜 남아있는 균의 배양액을 제거해주었으며, 1X PBS로 한번 더 현탁하였다. 현탁된 균체에 Lysozyme (Sigma-aldrich, Germany)을 500 ㎍/㎖의 농도로 분주하여 37℃ Incubator에서 2시간을 거친 후 Sonicator(70W, 30sec, 30cycle)를 이용하여 초음파 세포분해반응을 수행하여 균체 파쇄물을 준비하였다. 한편 균체 파쇄물에 살아있을 수 있는 균의 사멸을 위해 60℃에서 45분간 열 처리하였다. 이 때의 60℃ 반응은 단백질 변성을 최소화하기 위해 Water bath에 수행하였다.
이후 상기 균체 파쇄물은 -20℃에 보관하여 실험 수행시 해동하여 사용하였고, 이후의 모든 실험에는 상기 균체 파쇄물을 사용하였다. 또한, 사용시 고형분 함량 대비 농도별로 분주하기 위해 현탁액의 수분함량을 측정하여 고형분 함량을 계산하여 희석하여 사용하였다.
<실시예 6. F5 균주의 항산화 기능성 확인>
F5 균주의 항산화 기능성을 측정하기 위하여 ABTS([2, 2’-Azino-Bis (3-Ethylbenzthiazoline-6-sulfonic acid], Sigma-aldrich, Germany)를 이용한 radical scavenge 실험을 계획하였다. ABTS는 항산화물질과 반응하여 양이온 라디칼이 소거되면서 청록색에서 무색으로 탈색되는 원리를 이용한 실험이다(Nam et al., 2015).
본 실험에서는, ABTS solution을 사용하여 F5 균주의 균체 파쇄물의 항산화 능력을 측정하였다. ABTS 실험을 준비하기 위해 14mM의 ABTS stock 용액과 4.9mM의 Potassium persulfate를 1:1로 혼합하여 혼합 용액을 제조하고, 암반응을 하면서 Overnight을 진행하여 청록색이 되도록 하였다. 이 후, 해당 용액을 OD734 파장에서 흡광도가 약 0.7이 되도록 희석한 Working solution에 F5 균주의 균체 파쇄물 시료를 10%(v/v) 첨가하여 10분간 암실에서 반응 후 734 nm 파장의 흡광도를 측정하고, 각 측정 수치는 다음의 수식으로 계산하였다.
ABTS radical scavenging activity (%) = {1-(ODsample/ODcontrol)} × 100
이와 같은 방법을 이용하여, ABTS radical 제거율로 측정한 Bifidobacterium longum ATG-F5 파쇄물의 항산화능은 도 3에 나타내었다.
도 3을 참고하면, 균주의 균체 파쇄물의 농도 500 μg/㎖부터 radical scavenging activity 패턴이 크게 증가하기 시작하고 1 ㎎/㎖부터 더 큰 폭으로 항산화 기능성이 증강됨을 확인할 수 있다.
<실시예 7. F5 균주의 Tyrosinase inhibitor를 통한 Melanin 억제 및 이로 인한 미백기능성 평가>
각 미백 기능성을 확인하기 위하여 Mouse model의 세포주인 B16F10 Melanoma cell을 사용하였다. B16F10은 미백기능성을 확인할 수 있는 대표적 세포주로 본 세포주의 Mechanism은 Cell signaling pathway에서 L-Tyrosine은 Tyrosinase activation pathway를 시작으로 마지막 반응점인 melanin 생성반응을 증가시키게 된다.
이를 위한 본 평가방법은 B16F10을 10%(v/v) fetal bovine serum (Sigma-aldrich, Germany), 1%(v/v) penicillin/streptomycin cocktail (Sigma-aldrich, Germany)가 첨가된 Gibco® dulbecco modified eagle medium (DMEM, Gibco, USA) 배지를 이용하여 75cm2 Flask(Thermo fisher, USA)를 이용하여 세포를 배양하였다. 그 후 세포가 75cm2 Flask에서 80% 정도 자랐을 때 세포를 수확하여 Subculture를 실시하였다. 세포는 2 X 106 cells/㎖로 6well plate에 Seeding을 시켜주었으며, 이어 24시간 동안 5% CO2 조건에서 Incubator를 이용하여 배양하였다.
이 후 배양배지를 제거하고 Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, USA)을 이용하여 plate wash를 한 후 대조군(control, 무처리군)과 α-Melanocyte stimulating hormone(α-MSH, Sigma-aldrich, USA) 처리군을 준비하였다. α-MSH는 멜라닌의 생성을 증가시켜 피부변색의 원인이 된다. 실험군에는 α-MSH 200 nmol/㎖와 함께 균주 처리물을 각 농도별로 50, 100, 500 μg/㎖ 씩 분주하였다. 이 때, α-MSH 및 균주의 균체 파쇄물의 처리시간은 24시간이며, 5% CO2 조건에서 37℃ incubator를 이용하여 배양하였다.
그 후 24시간 뒤 각 well에 있는 상등액을 제거하고, DPBS를 이용하여 wash를 진행하였다. 1%(v/v) triton X-100(Daejung, korea)이 첨가된 0.1M PBS를 Wash된 well에 500 ㎕를 분주하여 Cell을 Microtube에 얻어 Centrifuge 시킨 후 상층액을 별도로 모아두고 Pellet만을 수집하였다. 그 다음으로는 수집된 Cell Pellet을 이용하여, 멜라닌 생성을 확인하였다. 순수 Pellet에 1N NaOH를 첨가하여 80℃ Water bath에 1시간 가량 Cell Pellet을 녹여 얼음에 넣어 식혀, 405nm 흡광도를 측정하여 상대적 비교를 통하여 분석하였다.
그 결과, Mouse B16F10 melanoma cell을 사용하여 α-MSH로 Tyrosinase activity를 자극하여 melanin 생성을 유도하였을 때, 도 5A의 결과와 같이 F5 균주의 균체 파쇄물의 처리 농도별로 melanin 생성이 감소하였다. 특히 각 균주 처리시에 α-MSH로 melanin 생성을 더 자극하였음에도 melanin의 생성이 더 억제되어 현저한 미백효과가 있는 것으로 나타났다.
Cell Pellet을 수집한 뒤 별도로 모아둔 상층액은 Tyrosinase inhibitor 측정에 사용하였다. 상기 상층액 40 ㎕와 0.1M PBS속 2 ㎍/㎖로 녹인 Dihydroxyphenylalanine(L-DOPA, Sigma, USA) 160 ㎕를 섞어 37℃ Incubator를 이용하여 1시간 동안 반응하였고, 그 후 ELISA reader (BioTek, USA)을 이용하여 475 nm에서 흡광도를 측정하여 상대적 Tyrosinase inhibitor 저해능을 나타냈다.
이에 도 4B의 결과와 같이, 상층액을 처리한 후 Tyrosinase activity inhibition이 되는 것으로 확인되는데, 이로 인해 Tyrosinase activity가 저해되기 때문에 Melanin 생성이 억제되는 것을 입증할 수 있다.
<실시예 8. F5 균주의 MMP-1 억제를 통한 pro-collagen의 증가 및 이에 따른 주름 개선 기능성 평가>
주름 개선 기능성 평가를 실시하기 위하여 Human model의 세포주인 Human Dermal Fibroblast (HDF) 세포주를 이용하였다. 10%(v/v) fetal bovine serum (Sigma-aldrich, Germany), 1%(v/v) penicillin/streptomycin cocktail (Sigma-aldrich, Germany)가 첨가된 Gibco® dulbecco modified eagle medium (DMEM, Gibco, USA) 배지를 이용하여 75cm2 Flask(Thermo fisher, USA)를 이용하여 세포를 배양하였다. 그 후 세포가 75cm2 Flask에서 80% 정도 자랐을 때 세포를 수확하여 Subculture를 실시하였다.
실험을 위한 세포는 2 X 105 cells/㎖로 24well plate에 seeding을 시켜주었으며, 이어 24시간 동안 5% CO2 조건에서 incubator를 이용하여 배양하였다. 이 후 배양배지를 제거하고 Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, USA)를 이용하여 plate wash를 한 후 대조군(control, 무처리군), TNF-α(Human Tumor necrosis factor alpha, Sigma-aldrich, USA) 10 ng/㎖ 처리군을 준비하였다. * TNF-α는 MMP-1을 증가시켜 피부주름을 생성한다.
실험군에는 TNF-α 10 ng/㎖와 함께 F5 균주의 균체 파쇄물을 각 농도별로 50, 100, 500 μg/㎖씩 분주하였다. 이 때 TNF-α와 F5 균주의 균체 파쇄물은 24시간 동안 처리하였으며, 5% CO2 조건에서 37℃ incubator를 이용하여 배양하였다.
그 후 24시간 뒤 각 well에 있는 상등액을 회수하여 Matrix metalloproteinase-1(MMP-1)과 Type 1 collagen에 대한 enzyme linked immunosorbent assay (ELISA)를 실시하였다. MMP-1은 Human Pro-MMP-1 Quantikine ELISA Kit (R&D systems, USA), Type 1 collagen은 Human Procollagen Type I C-peptide (PIP) EIA Kit(Takara, JAPAN)를 이용하여 상대 정량하였다.
그 결과, 도 5A와 같이 TNF-α와 함께 F5 균주의 균체 파쇄물을 500 μg/㎖의 농도로 처리했을 때, pro-collagen이 증가되는 것이 확인되는데, 이 증가 수준이 대조군(무처리군) 수준으로 회복되고, TNF-α 단독 처리군에 비해 현저하게 증가한 것을 알 수 있다.
특히, 도 5B와 같이 TNF-α와 함께 F5 균주의 균체 파쇄물을 처리한 군에서는 TNF-α 단독 처리군에 비하여 MMP-1의 발현이 대조군(control, 무처리군) 수준으로 회복되었다. 이는 TNF-α challenge를 통하여 MMP-1의 증가를 유도하였음에도 F5 균주의 균체 파쇄물이 pro-collagen을 대조군에 상응하는 양으로 회복(감소)시키는데 영향을 주는 원인임을 입증하며, 이로 인해 F5 균주의 균체 파쇄물이 제1형 콜라겐(Type 1 collagen) 생성능을 매우 크게 증진시키는 효과가 있음을 나타낸다.
<실시예 9. F5 균주로 인한 피부장벽 강화 또는 피부건조완화 기능 확인>
피부기능성 평가를 위해 Human keratinocyte인 HaCaT 세포주를 이용하였다. 배양방법은 위에 기술한 것과 같은 방법으로 배양하였으며, 세포가 75cm2 Flask에서 80% 정도 자랐을 때 세포를 수확하여 Subculture를 실시하였다. 세포는 5 X 106 cells/㎖로 10cm 원형 plate에 seeding을 시켜주었으며, 이어 24시간 동안 5% CO2 조건에서 incubator를 이용하여 배양하였다. 이 후 배양배지를 제거하고 Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, USA)을 이용하여 plate wash를 한 후 F5 균주의 균체 파쇄물은 각 농도별로 50, 100, 500 μg/㎖씩 분주하였다. 대조군(control)에는 아무것도 처리하지 않았다. F5 파쇄물은 24시간 동안 처리하였으며, 5% CO2 조건에서 37℃ incubator를 이용하여 배양하였다.
다음으로, plate wash를 한 후 TRIzol® Reagent (Ambion, USA)를 이용하여 세포의 total RNA를 분리하였다. cDNA로 합성하기 위해 RNA를 정량한 후 SuperScript™ IV First-Strand Synthesis System (Invitrogen, USA)을 이용하여 cDNA로 합성하였다.
이 후 피부관련 기능성 유전자를 확인하기 위해 피부장벽과 관련 있는 occludin (OCLN), claudin 4 (CLDN4), 피부건조와 관련 있는 Hyaluronan synthase 2 (HAS2)의 oligo primer 및 Applied Biosystems 7500 fast real-time PCR system을 이용하여 quantitative real-time PCR (qRT-PCR)을 실시하였다. 이때에 β-actin을 housekeeping gene으로 사용하였다. 해당 실험에 사용한 primer 목록은 표 4와 같다.
유전자 발현 측정을 위해 사용한 primer들의 염기서열
Gene Sense (5`→3`) Anti-sense (5`→3`) Size (bp)
β-actin TCTACGAGGGGTATGCCCTCC GGATGCCACAGGACTCCATGC 330
OCLN GACTTCAGGCAGCCTCGTTAC GCCAGTTGTGTAGTCTGTCTCA 132
CLDN4 TGGGGCTACAGGTAATGGG GGTCTGCGAGGTGACAATGTT 145
HAS2 CTCTTTTGGACTGTATGGTGCC AGGGTAGGTTAGCCTTTTCACA 205
그 결과, 도 6 및 도 7과 같이 HaCaT 세포에 F5 균주의 균체 파쇄물을 50, 100, 500 μg/㎖의 농도로 파쇄물을 처리했을 때, Control(무처리군)에 비하여 500 μg/㎖ 농도에서 OCLN (occludin). CLDN4 (claudin 4) 및 Hyaluronan synthase 2 (HAS2) 발현의 발현을 증가시키는 것으로 확인된다.
따라서, 본 발명의 균주의 균체 파쇄물이 OCLN과 CLDN4의 발현이 증가되면서 피부세포간 접촉에 관여하여 그에 따른 피부장벽을 현저히 강화시키는 기능이 있고, 마찬가지로, 상기 균주의 균체 파쇄물이 Hyaluronan synthase 2 (HAS2)의 발현을 자극하여 Hyaluronic acid (HA)의 피부 내 생성이 증가함으로써 피부 건조를 완화시킴을 확인할 수 있다.
<실시예 10. F5 균주의 항염증 기능성 평가>
항염증에 대한 기능성 평가를 위해 IL-10의 발현량을 확인하였다. 쥐 대식세포인인 RAW264.7세포주를 사용하였다. 배양방법은 위에서 서술한 HDF 세포 배양 방법을 사용하였으며, 75cm2 Flask에서 80% 정도 자랐을 때 세포를 수확하여 Subculture를 실시하였다. 세포는 1 X 106 cells/㎖로 24well plate에 seeding을 시켜주었으며, 이어 24시간 동안 5% CO2 조건에서 incubator를 이용하여 배양하였다. 먼저 control은 무처리군으로 준비하였고, 양성대조군에는 LPS(Lipopolysaccharide, Sigma-aldrich, USA)를 처리하였다. 또한 F5 균주의 균체 파쇄물을 단독 처리한 군과, LPS 1㎍/㎖와 함께 F5 100 ㎍/㎖을 처리한 군도 준비하였다. 그 후 24시간 뒤 각 well에 있는 상등액을 회수하여 Interleukin 10 (IL-10, R&D, USA)을 이용하여 상대 정량하였다.
이 결과는 도 8에 나타내었는데, 이와 같이 RAW264.7 세포에 LPS로 유도된 염증 반응에 대하여, LPS 처리군보다 LPS와 F5 균주의 균체 파쇄물을 동시에 처리할 때에 항염증 cytokine인 IL-10 생성이 현저하게 증가되는 것이 확인된다.
<화장료 제형예 1. 스킨토너의 제조-1>
하기 표 5의 조성과 같이, 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 함유한 스킨토너(100g)를 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 3.0
부틸렌글리콜 2.0
프로필렌글리콜 2.0
폴리옥시에칠렌(60)경화 피마자유 1.0
에탄올 10.0
트리에탄올아민 0.1
방부제 미량
색소 미량
향료 미량
정제수 잔량
<화장료 제형예 2. 모이스쳐 로션의 제조>
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 70(v/v)% 에탄올 수용액으로 추출한 후 용매를 제거한 농축액을 얻고, 이 농축액을 표 6과 같이 함유한 모이스쳐 로션(100g)을 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 1.0
시토스테롤 1.7
폴리글리세릴 2-올레이트 1.5
세테아레스 1.2
콜레스테롤 1.5
디세틸포스페이트 0.4
농글리세린 5.0
선플라워오일 10.0
카르복시비닐폴리머 0.2
산탄검 0.3
방부제 미량
향료 미량
정제수 잔량
<화장료 제형예 3. 영양크림의 제조>
하기 표 7의 조성과 같이, 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 함유한 영양크림(100g)을 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 5.0
시토스테롤 4.0
폴리글리세릴 2-올레이트 3.0
세라마이드 0.7
세테아레스-4 2.0
콜레스테롤 3.0
디세틸포스페이트 0.4
농글리세린 5.0
선플라워오일 22.0
카르복시비닐폴리머 0.5
트리에탄올아민 0.5
방부제 미량
향료 미량
정제수 잔량
<화장료 제형예 4. 에센스의 제조>
하기 표 8의 조성과 같이, 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 함유한 에센스(100g)를 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 1.0
시토스테롤 1.7
폴리글리세릴 2-올레이트 1.5
세테아레스-4 2.0
콜레스테롤 3.0
디세틸포스페이트 0.4
농글리세린 5.0
선플라워오일 22.0
카르복시비닐폴리머 0.5
트리에탄올아민 0.5
방부제 미량
향료 미량
정제수 잔량
<화장료 제형예 5. 파운데이션의 제조>
하기 표 9의 조성과 같이, 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 함유한 파운데이션(100g)을 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 1.0
밀납 2.0
사이클로메치콘 2.0
유동파라핀 5.0
스쿠알란 5.0
스테아린산 2.0
친유성 모노스테아린산 글리세린 3.0
카프릴릭/카프릭트리글리세라이드 4.0
글리세린 4.0
프로필렌글리콜 3.0
부틸렌글리콜 3.0
트리에탄올아민 1.0
알루미늄마그네슘실리케이트 0.5
안료 12.0
방부제 미량
향료 미량
정제수 잔량
<화장료 제형예 6. 헤어샴푸의 제조>
하기 표 10의 조성과 같이, 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물을 함유한 헤어샴푸(100g)를 통상의 방법에 따라 제조하였다.
원료 함량 (g)
비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 3.0
아라키딜 글루코사이드 4.5
에탄올 2.0
부틸렌글리콜 2.0
시트르산 0.1
페녹시에탄올 0.02
정제수 잔량
<제제예 1. 약학적 제제>
제제예 1-1. 정제의 제조
본 발명의 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 200g을 락토오스 175.9g, 감자전분 180g 및 콜로이드성 규산 32g과 혼합하였다. 이 혼합물에 10%(w/v) 젤라틴 용액을 첨가시킨 후, 분쇄해서 14 메쉬체를 통과시켰다. 이것을 건조시키고 여기에 감자전분 160g, 활석 50g 및 스테아린산 마그네슘 5g을 첨가해서 얻은 혼합물을 항염증용 정제로 만들었다.
제제예 1-2. 연고제의 제조
본 발명의 비피도박테리움 롱검 ATG-F5 균주의 균체 파쇄물의 동결건조물 1g을 바셀린 99g과 혼합하여 항염증용 연고제로 제조하였다.
<제제예 2. 식품 제조>
제제예 2-1. 조리용 양념의 제조
본 발명의 Bifidobacterium longum 균주의 균체 파쇄물의 동결건조 분말을 조리용 양념에 1 중량%로 첨가하여 건강 증진용 조리용 양념을 제조하였다.
제제예 2-2. 유제품(dairy products)의 제조
본 발명의 Bifidobacterium longum 균주의 균체 파쇄물의 동결건조 분말을 우유에 0.1 중량%로 첨가하고, 상기 우유를 이용하여 버터 및 아이스크림과 같은 다양한 유제품을 제조하였다.
제제예 2-5. 야채주스 제조
본 발명의 Bifidobacterium longum 균주의 균체 파쇄물의 동결건조 분말 0.5g을 토마토주스 또는 당근주스 1,000㎖에 가하여 건강 증진용 야채주스를 제조하였다.
제제예 2-6. 과일주스 제조
본 발명의 Bifidobacterium longum 균주의 균체 파쇄물의 동결건조 분말 0.1g을 사과주스 또는 포도주스 1,000㎖에 가하여 건강 증진용 과일주스를 제조하였다.
[수탁기관]
기탁기관명 : 한국생물자원센터
수탁번호 : KCTC13828BP
수탁일자 : 2019년 3월 18일
[규칙 제91조에 의한 정정 28.06.2019]　
Figure WO-DOC-PAGE-

Claims (13)

  1. 피부장벽 강화 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5(Bifidobacterium longum ATG-F5, 기탁번호 : KCTC13828BP) 균주.
  2. 제1항에 있어서,
    상기 균주는 피부건조 완화 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  3. 제1항에 있어서,
    상기 균주는 항여드름 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  4. 제1항에 있어서,
    상기 균주는 항산화 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  5. 제1항에 있어서,
    상기 균주는 미백 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  6. 제1항에 있어서,
    상기 균주는 주름개선 효능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  7. 제1항에 있어서,
    상기 균주는 항염증 기능이 있는 것을 특징으로 하는 비피도박테리움 롱검 ATG-F5 균주.
  8. 제1항의 균주를 함유하는 것을 특징으로 하는 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능이 있는 화장료 조성물.
  9. 제8항에 있어서,
    상기 화장료 조성물의 제형은 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 풋크림, 넥크림, 파운데이션, 에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 헤어샴푸, 헤어트리트먼트, 헤어린스 및 바디클렌저로 이루어진 군 중에서 선택되는 것을 특징으로 하는 화장료 조성물.
  10. 제1항의 균주를 함유하는 것을 특징으로 하는 피부장벽 강화, 피부건조 완화, 항염증, 항여드름, 항산화 또는 주름개선 효능이 있는 건강기능식품.
  11. 제10항에 있어서,
    상기 건강기능식품은 육류, 소세지, 빵, 캔디류, 스넥류, 면류, 아이스크림, 유제품, 발효유, 스프, 이온음료, 음료수, 알코올 음료, 껌, 차 및 비타민 복합제로 이루어진 군에서 선택되는 것을 특징으로 하는 건강기능식품.
  12. 제1항의 균주를 함유하는 것을 특징으로 하는 피부건조증, 여드름 및 염증 질환으로 이루어진 군에서 선택되는 질환의 예방 또는 치료용 조성물.
  13. 제12항에 있어서,
    상기 염증 질환은 염증성 장질환, 염증성 콜라겐 혈관 질환, 사구체신염, 염증성 피부 질환, 유육종증, 망막염, 위염, 간염, 장염, 관절염, 편도선염, 인후염, 기관지염, 폐렴, 췌장염, 패혈증, 방광염, 신장염 및 신경염으로 이루어진 질환 중에서 선택되는 것을 특징으로 하는 피부건조증, 여드름 및 염증 질환으로 이루어진 군에서 선택되는 질환의 예방 또는 치료용 조성물.
PCT/KR2019/006938 2019-04-02 2019-06-10 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물 WO2020204260A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201980095232.0A CN113924357A (zh) 2019-04-02 2019-06-10 新长双歧杆菌菌株或包含所述菌株的化妆品组合物
US17/600,650 US20220143112A1 (en) 2019-04-02 2019-06-10 Novel bifidobacterium longum strain or cosmetic composition comprising same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190038337A KR101975031B1 (ko) 2019-04-02 2019-04-02 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물
KR10-2019-0038337 2019-04-02

Publications (1)

Publication Number Publication Date
WO2020204260A1 true WO2020204260A1 (ko) 2020-10-08

Family

ID=66656214

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006938 WO2020204260A1 (ko) 2019-04-02 2019-06-10 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물

Country Status (4)

Country Link
US (1) US20220143112A1 (ko)
KR (1) KR101975031B1 (ko)
CN (1) CN113924357A (ko)
WO (1) WO2020204260A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113832061A (zh) * 2021-09-26 2021-12-24 广东一元兰欣生物科技有限公司 一株长双歧杆菌nx-8及其在制备抗衰老药物中的应用

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101975031B1 (ko) * 2019-04-02 2019-05-07 (주)에이투젠 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물
KR102157970B1 (ko) 2019-11-14 2020-09-21 에스케이바이오랜드 주식회사 발아 새싹 추출물의 유산균 발효물을 함유하는 피부장벽 강화용 화장료 조성물
KR102269842B1 (ko) 2020-02-27 2021-06-28 주식회사 아이코맥스 비피더 발효물 및 천연식물 추출물을 포함하는 화장료 조성물
KR102303334B1 (ko) * 2020-06-25 2021-09-23 (주)에이투젠 화장료 조성물용 균주의 코팅 방법, 이의 방법에 의해 코팅된 균주 및 이의 용도
KR20220023048A (ko) 2020-08-20 2022-03-02 (주) 안온바이오 향장 기능성을 증대시키는 신규한 균주
KR102659125B1 (ko) * 2021-08-09 2024-04-23 (주)정코스메틱 도고온천수를 이용하여 배양된 프로바이오틱스를 포함하는 화장료 조성물
CN114748514A (zh) * 2022-05-13 2022-07-15 浙江大学医学院附属邵逸夫医院 三种双歧杆菌在预防或治疗急性胰腺炎方面的应用
CN115181696B (zh) * 2022-06-27 2023-08-29 广东粤港澳大湾区国家纳米科技创新研究院 一种长双歧杆菌cb39Y4及其应用
CN115181699B (zh) * 2022-06-28 2023-08-29 广东粤港澳大湾区国家纳米科技创新研究院 一株长双歧杆菌cb20y1及其应用
CN115678807B (zh) * 2022-11-10 2024-04-12 廖梅香 一种长双歧杆菌及其应用
CN115836646B (zh) * 2022-11-28 2023-09-26 贵州省林业学校(贵州省林业干部学校) 一种山桐子的组织培养方法
CN116590169B (zh) * 2022-12-15 2024-01-30 东莞华工创为生物科技有限公司 一种长双歧杆菌及其应用
CN117551589B (zh) * 2024-01-10 2024-05-07 广州集妍化妆品科技有限公司 长双歧杆菌婴儿亚种的溶胞产物的应用

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010111671A (ja) * 2008-10-28 2010-05-20 L'oreal Sa 脂性皮膚を処理するために微生物の溶解物を用いる方法
WO2014096086A2 (fr) * 2012-12-21 2014-06-26 L'oreal Utilisation de microorganismes probiotiques comme agent favorisant la synthèse de mélanine
KR20150065170A (ko) * 2012-08-07 2015-06-12 탑제닉스, 인크. 관심있는 화합물을 발현하는 형질전환된 박테리아를 포함하는 국소 조성물
KR101589464B1 (ko) * 2015-05-21 2016-02-01 주식회사 쎌바이오텍 신규한 비피더스 균주 및 이를 포함하는 성장촉진용 기능성 식품 조성물
KR101788544B1 (ko) * 2015-11-24 2017-10-23 코스맥스 주식회사 복합 유산균 배양물을 함유하는 피부장벽 강화용 화장료 조성물
KR101975031B1 (ko) * 2019-04-02 2019-05-07 (주)에이투젠 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2912916B1 (fr) * 2007-02-26 2009-05-22 Oreal Composition cosmetique ou dermatologique comprenant un milieu de culture cellulaire
KR101456040B1 (ko) 2007-04-20 2014-11-03 주식회사 엘지생활건강 미백용 화장료 조성물
KR100889605B1 (ko) 2007-07-02 2009-03-20 주식회사 엘지생활건강 주름개선용 화장료 조성물
FR2920305B1 (fr) * 2007-09-04 2010-07-30 Oreal Utilisation d'un lysat de bifidobacterium species pour le traitement de peaux sensibles.
KR20160092569A (ko) * 2015-01-27 2016-08-05 인코스(주) 효모, 유산균 2단 발효 추출물을 함유하는 항산화, 주름개선, 보습 효과를 갖는 화장료 조성물
KR20160092564A (ko) 2015-01-27 2016-08-05 인코스(주) 효모,유산균 2단 발효 용해물을 함유하는 항산화, 주름개선, 보습 효과를 갖는 화장료 조성물
KR101885195B1 (ko) 2016-10-07 2018-08-03 주식회사 코리아나화장품 목서 발효추출물을 유효성분으로 함유하는 화장료 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010111671A (ja) * 2008-10-28 2010-05-20 L'oreal Sa 脂性皮膚を処理するために微生物の溶解物を用いる方法
KR20150065170A (ko) * 2012-08-07 2015-06-12 탑제닉스, 인크. 관심있는 화합물을 발현하는 형질전환된 박테리아를 포함하는 국소 조성물
WO2014096086A2 (fr) * 2012-12-21 2014-06-26 L'oreal Utilisation de microorganismes probiotiques comme agent favorisant la synthèse de mélanine
KR101589464B1 (ko) * 2015-05-21 2016-02-01 주식회사 쎌바이오텍 신규한 비피더스 균주 및 이를 포함하는 성장촉진용 기능성 식품 조성물
KR101788544B1 (ko) * 2015-11-24 2017-10-23 코스맥스 주식회사 복합 유산균 배양물을 함유하는 피부장벽 강화용 화장료 조성물
KR101975031B1 (ko) * 2019-04-02 2019-05-07 (주)에이투젠 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113832061A (zh) * 2021-09-26 2021-12-24 广东一元兰欣生物科技有限公司 一株长双歧杆菌nx-8及其在制备抗衰老药物中的应用

Also Published As

Publication number Publication date
US20220143112A1 (en) 2022-05-12
CN113924357A (zh) 2022-01-11
KR101975031B1 (ko) 2019-05-07

Similar Documents

Publication Publication Date Title
WO2020204260A1 (ko) 신규한 비피도박테리움 롱검 atg-f5 균주 또는 이를 포함하는 화장료 조성물
WO2011010770A1 (ko) 신규한 락토바실러스 플란타룸 및 이를 포함하는 조성물
KR100773856B1 (ko) 나한과 추출물 또는 이로부터 분리된 트라이터펜계화합물을 함유하는 주름개선용 조성물
KR102011240B1 (ko) 신규한 락토바실러스 파라카제이 skb1192 균주 또는 이를 함유하는 광보호 효능이 있는 조성물 및 그 제품
WO2019098751A1 (ko) 락토바실러스 플란타룸 배양물을 포함하는 피부 주름 개선용 화장료 조성물
WO2018164369A1 (ko) 효소 처리된 무궁화 추출물을 유효성분으로 함유하는 피부 주름 개선용 조성물
KR20140056487A (ko) 감꼭지(枾滯) 추출물 또는 이로부터 분리된 트리폴린을 유효성분으로 함유하는 미백 및 피부 주름의 예방 및 치료용 피부외용 조성물
WO2022255795A1 (ko) 락토바실러스 세균 유래 세포외소포 및 이의 용도
KR101685121B1 (ko) 발효 밤송이 추출 정제물을 유효성분으로 함유하는 항산화, 또는 항염용 조성물
KR101627242B1 (ko) 발효 밤송이 추출 정제물을 유효성분으로 함유하는 피부 주름 방지 및 항균 조성물
WO2022255744A1 (ko) 락토바실러스 플란타룸 유래 소포 및 이의 용도
KR20120036011A (ko) 대청엽 추출물을 함유하는 미백 및 주름개선용 조성물
WO2021125484A1 (ko) 아릴 탄화수소 수용체의 활성을 억제하는 폡타이드 및 이를 이용하는 화장료 조성물
WO2020166868A1 (ko) 로치아 속 세균 유래 나노소포 및 이의 용도
WO2017014597A1 (ko) 오미자 종자 추출물을 포함하는 피부 미백 개선용 화장품 조성물
KR101541843B1 (ko) 발효 밤송이 추출물을 유효성분으로 함유하는 피부 주름 방지 및 항균 조성물
KR101541842B1 (ko) 발효 밤송이 추출물을 유효성분으로 함유하는 피부 미백 및 항산화, 또는 항염용 조성물
WO2018155933A1 (ko) 아쿠아포린-3의 발현을 증가시키는 6,7-디메톡시-2,2-디메틸-2h-크로멘 및 이의 용도
WO2022164183A1 (ko) 락토바실러스 커베투스 유래 세포밖 소포체를 유효성분으로 포함하는 양모 촉진용 조성물
WO2020218868A1 (ko) 스트렙토코커스 파이오제네스 세균 유래 단백질 및 이의 용도
WO2014185610A1 (ko) 밀기울 추출물을 유효성분으로 포함하는 탈모 방지 또는 육모 촉진 조성물
WO2022255784A1 (ko) 락토바실러스 람노수스 유래 소포 및 이의 용도
WO2017188692A1 (ko) 7,10-에폭시옥타데카-7,9-다이에노산을 유효성분으로 포함하는 항균 조성물
KR101657557B1 (ko) 피부 미백 및 항노화 효과를 갖는 루테올린-6-ｃ-푸코피라노사이드를 함유하는 화장품 조성물
WO2022146096A1 (ko) 락토바실러스 속 균주, 비피도박테리움 속 균주, 또는 루미노코쿠스 속 균주 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19923308

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19923308

Country of ref document: EP

Kind code of ref document: A1