WO2020111887A1 - 뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법 - Google Patents

뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법 Download PDF

Info

Publication number
WO2020111887A1
WO2020111887A1 PCT/KR2019/016777 KR2019016777W WO2020111887A1 WO 2020111887 A1 WO2020111887 A1 WO 2020111887A1 KR 2019016777 W KR2019016777 W KR 2019016777W WO 2020111887 A1 WO2020111887 A1 WO 2020111887A1
Authority
WO
WIPO (PCT)
Prior art keywords
brain
derived
aplp1
cadm2
disease
Prior art date
Application number
PCT/KR2019/016777
Other languages
English (en)
French (fr)
Inventor
문지숙
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Priority to US17/426,936 priority Critical patent/US20220099686A1/en
Publication of WO2020111887A1 publication Critical patent/WO2020111887A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2814—Dementia; Cognitive disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2814—Dementia; Cognitive disorders
    • G01N2800/2821—Alzheimer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2835—Movement disorders, e.g. Parkinson, Huntington, Tourette

Definitions

  • It relates to a brain-derived vesicle-specific marker and a method for diagnosing brain disease using the same.
  • exosomes are a type of extracellular vesicles secreted into cells and are distinguished from microvesicles in that they are derived from intracellular endosomes. Exosomes are known to contain proteins or miRNAs required for cell-to-cell communication, and have also been reported to play a role in maintaining homeostasis in cells by releasing harmful proteins, DNA and RNA accumulated in cells to the outside. In particular, exosomes have a small size of 100 nm or less and are known to pass freely through the blood brain barrier. For this reason, a large amount of brain-derived exosomes secreted from the brain are incorporated into human blood.
  • Brain-derived endoplasmic reticulum for example, exosome
  • exosome Brain-derived endoplasmic reticulum, for example, exosome
  • the indirect profile of the brain using brain-derived exosomes has the advantage that information on brain tissue can be obtained without biopsy of the brain.
  • brain-derived exosomes were isolated from the blood by targeting an exosome surface antibody called CD171, but CD171-based brain-derived exosome studies of other organs have been studied in The disadvantage is that the results can be affected by the state.
  • the present invention was completed by identifying new endoplasmic reticulum markers capable of replacing CD171, and separating the vesicles based on the new markers, and confirming that the separated vesicles can represent the disease state of the brain. Did.
  • One aspect is a method of separating brain-derived endoplasmic reticulum from a biological sample, the method comprising: obtaining a biological sample comprising vesicles from an individual; And CADM2 (Cell Adhesion Molecule 2), APLP1 (amyloid beta precursor like protein 1), EPHA7 (EPH receptor A7), CRLF1 (cytokine receptor like factor 1), and SLC6A3 (solute carrier family 6 member 3) in the biological sample.
  • CADM2 Cell Adhesion Molecule 2
  • APLP1 amloid beta precursor like protein 1
  • EPHA7 EPH receptor A7
  • CRLF1 cytokine receptor like factor 1
  • SLC6A3 synthetic carrier family 6 member 3
  • compositions for separating brain-derived vesicles comprising an agent that measures one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in biological samples containing vesicles.
  • Another aspect is a method for providing information for the diagnosis of degenerative brain disease, comprising: obtaining a biological sample comprising a vesicle from an individual; Separating brain-derived exosomes by analyzing one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in the biological sample; And comparing the expression levels of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 measured in the brain-derived endoplasmic reticulum to the expression level of a control group.
  • compositions for diagnosing degenerative brain disease comprising an agent that measures one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in a biological sample containing vesicles.
  • the marker according to one aspect can efficiently and highly specifically separate brain-derived vesicles without collecting tissue using markers specifically expressed in brain-derived vesicles, and express vesicles specifically expressed in each brain region. Can be separated.
  • the disease state of the brain can be diagnosed through the expression profile of the brain region-specific marker in the brain-derived vesicles using the marker according to one aspect.
  • FIG. 2 is a result of quantifying the intensity of RT-PCR bands confirming the mRNA expression levels of Aplp1, Cadm2 and L1CAM in brain, kidney, heart, spleen, and liver tissues (FIG. 2A: L1CAM, FIG. 2B: APLP1, FIG. 2c: CADM2).
  • FIG. 3 is a result of confirming the mRNA relative expression levels of Aplp1 and L1CAM in brain, heart, kidney, and liver tissues (FIG. 3A: L1CAM, FIG. 3B: APLP1).
  • FIG. 4 is a result confirming mRNA expression levels of Aplp1, Cadm2 and L1CAM in brain, heart, kidney, spleen, and liver tissues (FIG. 4A: L1CAM, FIG. 4B: APLP1, FIG. 4C: CADM2).
  • Figure 5 is a result of confirming the protein expression levels of Aplp1, Cadm2 and L1CAM (the full length, and truncated form), which are some of the genes derived as candidates in brain, heart, kidney, spleen, and liver tissues by Western blot to be.
  • FIG. 6 shows mRNA expression levels of Aplp1 and Cadm2 in human fetal-derived neural progenitor cells (hNPC), human heart cell lines (AC16), human liver cell lines (HepG2), human kidney cell lines (HEK293), and human spleen cell lines (TK6). It is a result confirmed by quantifying the intensity of the RT-PCR band (Fig. 6a: APLP1, Fig. 6b: CADM2).
  • FIG. 8 is a result of confirming the expression level of CD171 (L1CAM), Aplp1 and Cadm2 in exosomes collected from mouse blood, brain, heart, kidney, spleen, and liver using FACS (FIG. 8A: blood, FIG. 8B: brain, Figure 8c: Heart, Figure 8d: Kidney, Figure 8e: Spleen, Figure 8f: Liver).
  • FIG. 8A blood
  • FIG. 8B brain
  • Figure 8c Heart
  • Figure 8d Kidney
  • Figure 8e Spleen
  • Figure 8f Liver
  • FIG. 9 shows CD171 in exosomes isolated from cultures of human fetal-derived neural progenitor cells (hNPC), human heart cell lines (AC16), human kidney cell lines (HEK293), human spleen cell lines (TK6), and human liver cell lines (HepG2). L1CAM), Aplp1 and Cadm2 expression levels are confirmed using FACS (FIG. 9A: hNPC, FIG. 9B: AC16, FIG. 9C: HEK293, FIG. 9D: TK6, FIG. 9E: HepG2).
  • hNPC human fetal-derived neural progenitor cells
  • AC16 human heart cell lines
  • HEK293 human kidney cell lines
  • TK6 human spleen cell lines
  • HepG2 human liver cell lines
  • One aspect provides a method of isolating brain-derived vesicles from a biological sample.
  • the method comprises obtaining a biological sample comprising a vesicle from an individual; And CADM2 (Cell Adhesion Molecule 2), APLP1 (amyloid beta precursor like protein 1), EPHA7 (EPH receptor A7), CRLF1 (cytokine receptor like factor 1), and SLC6A3 (solute carrier family 6 member 3) in the biological sample. Analyzing one or more expression levels selected from the constructed group.
  • the method may further include determining a biological sample as a brain-derived vesicle when the expression level is higher than that of the control group.
  • vesicles may be one or more selected from the group consisting of exosomes, microparticles, microvesicles, nanosomes, extracellular vesicles, and ectosomes.
  • exosome is derived from the endosomes of cells (Endosome) is a microscopic body that is discharged to the outside of the cell, has a size of 50-100nm, various DNA, RNA, protein, metabolites derived from inside the cell (Metabolite) means a microelement containing molecules inside.
  • Brain-derived vesicle refers to a generic term for vesicles secreted from various cells of brain tissue.
  • the brain-derived vesicles are subdivided into vesicles secreted from various cells, such as neurons-derived vesicles, oligodendrocyte-derived vesicles, microglia-derived vesicles, and astrocyte-derived vesicles.
  • neurons-derived vesicles oligodendrocyte-derived vesicles, microglia-derived vesicles, and astrocyte-derived vesicles.
  • the brain-derived endoplasmic reticulum for example, exosome
  • exosome is characterized in that it is easily incorporated into the blood because its size is small, 50-100 nm.
  • Brain-derived exosomes can be separated by analyzing the expression level of a marker molecule specifically expressing brain-derived exosomes in blood-derived exosomes mixed into blood.
  • the brain-derived endoplasmic reticulum may have an increased level of CADM2, APLP1, EPHA7, CRLF1, SLC6A3, or a combination thereof compared to vesicles derived from other organs. That is, the CADM2, APLP1, EPHA7, CRLF1, SLC6A3, or a combination thereof may be brain specific, brain region specific markers.
  • the CADM2, APLP1, EPHA7, CRLF1, SLC6A3, or a combination thereof may be a protein present in the membrane of the endoplasmic reticulum.
  • the analysis can be performed through an agent comprising an antibody or an antigen-binding fragment thereof that specifically binds one or more fragments selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3.
  • Antibodies can be fragmented by using conventional techniques, and fragments can be screened for availability in the same manner as described above for whole antibodies.
  • F(ab)2 fragments can be generated by treating antibodies with pepsin. The resulting F(ab)2 fragment can be treated to reduce the disulfide bridge to produce a Fab fragment.
  • Antigen binding moieties can also be generated by recombinant DNA techniques, or enzymatic or chemical cleavage of intact antibodies.
  • Antigen binding moieties are in particular Fab, Fab', F(ab')2, Fv, dAb and complementarity determining region (CDR) fragments, single chain antibodies (scFv), single domain antibodies, bispecific antibodies, chimeric antibodies, humanized Antibodies, diabodies, and polypeptides containing at least a portion of an immunoglobulin sufficient to confer specific antigen binding to the polypeptide.
  • the antibody further comprises a label that can be attached to and detected (eg, the label can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor).
  • immunoassay devices and methods are often used. These devices and methods can use a labeled molecule in various sandwich, competitive or non-competitive assay formats to generate a signal related to the presence or amount of an analyte of interest. Additionally, specific methods and devices, such as biosensors and optical immunoassays, can measure the presence or amount of analytes without the need for labeled molecules. Other methods (eg, measurement of marker RNA levels) are well known to those skilled in the art, but are preferably measured by using an immunoassay. The presence or amount of markers is generally confirmed by using antibodies specific for each marker and detecting specific binding.
  • any suitable immunoassay such as enzyme-linked immunoassay (ELISA), radioimmunoassay (RIA), competitive binding assay, planar waveguide technology, and the like can be used.
  • the specific immunological binding of the antibody to the marker can be detected directly or indirectly.
  • Direct labels include fluorescent or luminescent tags attached to the antibody, metals, dyes, radionuclides, and the like.
  • Indirect labels include various enzymes well known in the art, such as alkaline phosphatase, horseradish peroxidase, and the like.
  • the expression level can be the protein level of CADM2, APLP1, EPHA7, CRLF1, SLC6A3, or a combination thereof.
  • the sample may be a cell culture supernatant, whole blood, serum, plasma, ascites fluid, cerebrospinal fluid, bone marrow inhalation, bronchial-alveolar lavage, urine, semen, vaginal fluid, mucus, saliva, sputum or lysate purified from biological tissue samples, or It may also be obtained from other sources known in the art, including other tissues including, for example, brain tissue.
  • the sample is blood, it can be combined with various components after collection to preserve or prepare the sample for subsequent techniques.
  • blood is treated with an anticoagulant, cell fixative, protease inhibitor, phosphatase inhibitor, protein, DNA or RNA preservative after collection.
  • blood is collected via venipuncture by using a vacuum collection tube containing an anticoagulant, such as EDTA or heparin.
  • Blood may also be collected by using a heparin-coated syringe and hypodermic needle.
  • Blood may be combined with components that will be useful for cell culture.
  • blood can be combined with a cell culture medium or supplemented cell culture medium (eg, cytokines).
  • cytokines eg, cytokines
  • compositions for separating brain-derived vesicles comprising an agent that measures one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in biological samples containing vesicles.
  • Biological samples, vesicles, brain-derived vesicles, and agents for measuring expression levels are as described above.
  • brain-derived vesicles have increased expression levels of CADM2, APLP1, EPHA7, CRLF1, or SLC6A3 compared to other organ-derived vesicles.
  • kits for separating brain-derived vesicles comprising an agent that measures one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in biological samples containing vesicles.
  • the kit can include means for quantifying one or more markers in an individual.
  • the kit may include means for collecting biological samples, means for quantifying one or more biomarkers in the biological sample, and instructions for use of the kit contents.
  • the kit may include means for concentrating or separating vesicles from biological samples.
  • the means for concentrating or isolating vesicles includes the reagents necessary to concentrate or separate vesicles from biological samples.
  • the kit may include means for quantifying the amount of biomarker, and means for quantifying the amount of biomarker may include reagents necessary to detect the amount of biomarker.
  • Another aspect provides a method for providing information for diagnosis and prognosis of degenerative brain disease.
  • the method comprises obtaining a biological sample comprising a vesicle from an individual; Separating brain-derived vesicles by analyzing one or more expression levels selected from the group consisting of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 in the biological sample; And comparing the expression levels of CADM2, APLP1, EPHA7, CRLF1, and SLC6A3 measured in the brain-derived vesicles with those of the control group.
  • Biological samples, vesicles, brain-derived vesicles, and expression levels are measured as described above.
  • the brain-derived vesicle markers CADM2, APLP1, EPHA7, CRLF1, and/or SLC6A3 are both brain-derived vesicle markers and may be brain region specific markers. That is, each of the proteins may have increased expression in a specific region of the brain. For example, APLP1 is expressed throughout the brain, CADM2, EPHA7, and CRLF1 are specifically expressed in the hippocampus, and SLC6A3 may be specifically expressed in the midbrain.
  • the marker is a specific brain region specific marker
  • the disease is diagnosed and the prognosis is predicted by separating the endoplasmic reticulum from a specific brain region and measuring the expression level of a disease marker, for example, a gene or protein, contained within the endoplasmic reticulum. Can be.
  • the disease markers are amyloid beta, phosphorylated Tau, A ⁇ 1-42, TDP-43, ⁇ -synuclein, SOD-1, FUS, FKBP51, IRS-1, phosphorylated IRS-1, CTSD, LAMP1, UBP, HSP70, It may be one or more selected from the group consisting of NSE, NFL, CD9, CD63, CD81 and CD171.
  • the gene expression level of the disease marker can be measured by measuring the mRNA or miRNA level.
  • immunoassay devices and methods are often used for the detection and analysis of the disease marker.
  • These devices and methods can use a labeled molecule in various sandwich, competitive or non-competitive assay formats to generate a signal related to the presence or amount of an analyte of interest.
  • specific methods and devices such as biosensors and optical immunoassays, can be used to measure the presence or amount of analytes without the need for labeled molecules.
  • RNA levels are well known to those skilled in the art, but for example disease markers are analyzed using immunoassays. The presence or amount of markers is generally confirmed by using antibodies specific for each marker and detecting specific binding. Any suitable immunoassay, such as enzyme-linked immunoassay (ELISA), radioimmunoassay (RIA), competitive binding assay, planar waveguide technology, and the like can be used. The specific immunological binding of the antibody to the marker can be detected directly or indirectly.
  • Direct labels include fluorescent or luminescent tags attached to the antibody, metals, dyes, radionuclides, and the like. Indirect labels include various enzymes well known in the art, such as alkaline phosphatase, horseradish peroxidase, and the like.
  • Antibodies can be immobilized on a variety of solid supports, such as magnetic or chromatographic matrix particles, surfaces of analytical sites (eg, microtiter wells), pieces of solid substrate materials (eg, plastics, nylon, paper), and the like.
  • Assay strips can be prepared by coating an antibody or multiple antibodies in an array on a solid support. The strip can then be immersed into the test sample and then quickly processed through a washing and detection step to generate a measurable signal, such as a colored spot.
  • Analysis of multiple disease markers can be performed separately or simultaneously with one test sample. Several markers can be combined in one test for efficient processing of multiple samples. In addition, one skilled in the art will appreciate the value of testing multiple samples from the same individual (eg, at successive time points). This test of a series of samples will allow us to identify changes in marker levels over time. The increase or decrease at the marker level, as well as the absence of changes at the marker level, confirm the approximate time from the onset of the event, the presence and amount of salvageable tissue, the feasibility of drug treatment, and various treatments This will provide useful information about the disease state, including, but not limited to, the effectiveness of the event, identification of the severity of the event, identification of the severity of the disease, and identification of the patient's outcome, including risk of future events.
  • the disease marker may play an important role in early detection and monitoring of brain cancer other than neurodegenerative disorder.
  • Such disease markers are materials found in body samples that can typically be measured.
  • the measured amount can be correlated with the underlying disorder or disease pathophysiology, the presence or absence of neurodegenerative disorders, and the likelihood of future neurodegenerative disorders.
  • the amount measured in a patient receiving treatment for his condition may also correlate with the response to treatment.
  • degenerative brain disease refers to Alzheimer's disease, Parkinson's disease, Huntington's disease, stroke, multiple system atrophy, vascular disease dementia, frontotemporal dementia (FTD), cortical basal degeneration (CBD), advanced nuclear paralysis (PSP), and Louis.
  • Body dementia knot-predominant senile dementia, Pick'sdisease (PiD), or argyrophilic grain disease, amyotrophic lateral sclerosis (ALS), other motor neurological disorders, Guam ) Parkinsonism-dementia complex, FTDP-17, Lytico-Bodig disease, multiple sclerosis, brain cancer and traumatic brain injury (TBI).
  • a doctor can diagnose or prognose one or more degenerative brain diseases in an individual.
  • the doctor exclude or eliminate one or more degenerative brain diseases as a diagnostic possibility.
  • the doctor can identify an individual at risk of developing degenerative brain disease.
  • the doctor can predict whether the individual will develop degenerative brain disease later.
  • doctors can prescribe treatment regimens or predict the benefits of treatment in individuals with degenerative brain disease.
  • the method plays an important role in the initial detection and monitoring of degenerative brain disease. Markers of this disorder are substances found in body samples that can typically be measured. The measured amount may be correlated with the underlying disorder or disease pathophysiology, the presence or absence of degenerative brain disease, and the likelihood of developing degenerative brain disease and brain cancer in the future. The amount measured in a patient receiving treatment for his condition will also correlate with the response to treatment.
  • the Human Protein atlas which is a public database providing mRNA expression and protein staining pattern for each human tissue. From the DB, 419 proteins were selected as candidates for a protein with annotation data specifically expressed in the human brain (Brain-enriched protein).
  • the DB provides the gene expression level for each region in the mouse brain through in situ hybridization. Using this, genes that are global in the entire brain and regions that are specifically expressed in the hippocampus, midbrain, etc., were selected.
  • the brain-specific protein selected from the public DB as in 1.1. above was actually confirmed in mice.
  • mRNA expression of a new group of markers was confirmed by PCR from RNA collected from mouse brain, liver, kidney, heart, and spleen, and the PCR resulted in brain-specific mRNA expression.
  • protein expression was confirmed by Western blot.
  • PCR was perfused with PBS in an 8-week-old mouse, and then each organ (brain, kidney, heart, lung, liver) was extracted and frozen with liquid nitrogen. Each tissue was crushed while maintaining -80°C.
  • RNA was extracted using Trizol, and cDNA was synthesized using 1 ⁇ g of the extracted RNA (using intron, 25082). PCR was performed on the following candidates using 2 ⁇ g of the synthesized cDNA.
  • Table 1 shows the genes used in PCR and primer information for each gene.
  • FIG. 1 is a result of confirming mRNA expression levels of Aplp1, Cadm2 and L1CAM, which are some of the genes derived as candidates in brain, kidney, heart, spleen, and liver tissues by RT-PCR.
  • 2 is a result of quantifying the intensity of RT-PCR bands confirming the mRNA expression levels of Aplp1, Cadm2 and L1CAM in brain, kidney, heart, spleen, and liver tissues (FIG. 2A: L1CAM, FIG. 2B: APLP1, FIG. 2c: CADM2).
  • FIG. 3 is a result of confirming the mRNA relative expression levels of Aplp1 and L1CAM in brain, heart, kidney, and liver tissues (FIG. 3A: L1CAM, FIG. 3B: APLP1).
  • 4 is a result confirming mRNA expression levels of Aplp1, Cadm2 and L1CAM in brain, heart, kidney, spleen, and liver tissues (FIG. 4A: L1CAM, FIG. 4B: APLP1, FIG. 4C: CADM2).
  • L1CAM which has been used as an existing brain marker, is confirmed to be expressed in the brain, but is not specifically expressed only in the brain, but also in the kidney, heart, lung and liver.
  • CADM2 and APLP1 were found to have high levels of expression only in the brain. Therefore, it can be seen that CADM2 and APLP1 are brain specific markers.
  • Western blot was performed to confirm the protein expression levels of CADM2 and APLP1 identified by brain markers.
  • Western blots were perfused with PBS in 8 week old mice, and then each organ (brain, kidney, heart, spleen, liver) was removed and frozen with liquid nitrogen. Each tissue was crushed while maintaining -80°C. Protein was extracted using RIPA buffer and protein was quantified through BCA assay. 15 ⁇ g protein was run on the gel (running, 60V 1hr, 120V 1.5hrs). After running, transfer was performed using a membrane with a 0.2 ⁇ m hole (20 V in a cold room, overnight (O/N)).
  • 5 is a result of confirming the protein expression levels of Aplp1, Cadm2, and some of the existing brain markers L1CAM (full length, truncated form) as candidate candidates in brain, heart, kidney, spleen, and liver tissues by Western blot. .
  • the band of the full-length L1CAM was not observed in other tissues, but only in the brain.
  • Metalloprotease (metalloprotease) and plasmin (plasmin) generated by the cleaved form (cleaved form) was confirmed that all bands appear in tissues other than the brain, it was confirmed that it is not a brain-specific marker.
  • Aplp1, Cadm2 proteins are not expressed in other tissues, but only in the brain, and thus, were confirmed to be brain specific markers.
  • APLP1 and CADM2 express brain-specific in humans.
  • Certain cells from various tissues AC16: human heart cell line; HepG2: human liver cell line; HEK293: human kidney cell line; TK6: human spleen cell lines
  • hNPCs human brain primary cell line
  • RNA was isolated from cell culture, synthesized with cDNA, and used real-time PCR (real-time gene polymerization chain reaction experiment technique).
  • Figure 6 is a result of confirming the mRNA expression levels of Aplp1, Cadm2 in human fetal derived neuronal progenitor cells, human heart cell lines (AC16), human liver cell lines (HepG2), human kidney cell lines (HEK293), and human spleen cell lines (TK6). As shown in Figure 6, it was confirmed that Aplp1 and Cadm2 are specifically highly expressed only in human neural progenitor cell culture.
  • CADM2 was added to the exosomes collected from mouse blood, Fluorescence markers were attached to APLP1 and CD171, respectively, and confirmed using a FACS (fluorescence activated cell sorter).
  • FIG. 8A is a result of confirming the expression level of CD171 (L1CAM), Aplp1, and Cadm2 in exosomes collected from mouse blood using FACS. As a result, as shown in FIG. 8A, it was confirmed that CD171+ exosomes and APLP1 and CADM2 positive exosomes exhibit similar expression levels in exosomes drawn from blood.
  • exosomes were separated from various organ sections of mice in addition to blood, followed by fluorescence labeling with APLP1, CADM2, CD171 and confirmed by FACS.
  • FIG. 8B-8F are the results of confirming the expression levels of CD171 (L1CAM), Aplp1, and Cadm2 in exosomes collected from mouse brain, heart, kidney, spleen, and liver using FACS.
  • CD171+ exosomes were found in exosomes isolated from the heart and spleen as well as the brain, but the novel markers CADM2 and APLP1 positive exosomes were separated from the brain. It was confirmed that it was present only in a specific amount in a small amount.
  • APLP1 and CADM2 are different from the existing brain marker CD171 in that they are present in a specific amount in brain-derived vesicles.
  • exosomes were separated from the culture obtained from various human cell lines, and CD171 and APLP1 and CADM2 were identified by FACS after fluorescent labeling.
  • FIG. 9 shows CD171 in exosomes isolated from cultures of human fetal-derived neural progenitor cells (hNPC), human heart cell lines (AC16), human kidney cell lines (HEK293), human spleen cell lines (TK6), and human liver cell lines (HepG2). L1CAM), Aplp1 and Cadm2 expression levels are confirmed by using FACS.
  • hNPC human fetal-derived neural progenitor cells
  • AC16 human heart cell lines
  • HEK293 human kidney cell lines
  • TK6 human spleen cell lines
  • HepG2 human liver cell lines
  • brain-derived exosomes can be specifically and efficiently separated from blood samples that are easy to collect, specifically specific for each brain region. It was confirmed that the exosomes expressed as can be isolated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법에 관한 것이다. 일 양상에 따른 마커는 뇌 유래 소포체에서 특이적으로 발현하는 마커를 이용하여 조직을 채취하지 않고도 뇌 유래 소포체를 고효율 및 고특이적으로 분리할 수 있고, 각 뇌 영역에서 특이적으로 발현하는 소포체를 분리할 수 있다. 또한 일 양상에 따른 마커를 이용해 분리된 뇌 유래 소포체서 뇌 영역 특이적 마커의 발현 프로파일을 통해 뇌의 질병 상태를 진단할 수 있다.

Description

뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법
뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법에 관한 것이다.
최근 사회는 보편 복지의 증가와 기대수명의 증가로 인해 사회의 고령화가 진행되고 있어 알츠하이머 병, 파킨슨 병, 뇌졸중, 뇌암 같은 노화성 뇌질환 인구도 증가하고 있는 추세이다. 하지만 치매로 통칭되는 이러한 퇴행성 뇌질환들은 질병 초기에는 서로 임상적 특징을 상당 부분 공유하기에 초기에 확실한 진단이 어려우며, 조기 진단의 어려움으로 인해 적절한 치료시기를 놓치는 경우가 많다. 특히, 뇌는 조직검사가 사실상 불가능한 장기이므로, 퇴행성 뇌질환의 검진 특이도를 끌어 올리기 위해선 조직검사의 결과를 대변할 수 있되 조직의 채취가 필요 없는 간접적 수단의 개발이 필요하다.
한편, 엑소좀(Exosome)은 세포로 분비되는 세포 외 소포체의 일종으로, 세포 내 엔도좀(Endosome)으로 유래되었다는 점에서 미세소포(Microvesicles)와 구별된다. 엑소좀은 세포 간 커뮤니케이션에 필요한 단백질이나 miRNA 등을 포함한다고 알려져 있으며, 또한 세포 내에 쌓인 해로운 단백질, DNA, RNA를 외부로 방출하여 세포 내 항상성을 유지하는데도 역할을 한다고 보고되었다. 특히 엑소좀은 100nm이하의 작은 사이즈를 가져 혈액 뇌장벽(Blood brain barrier)를 자유롭게 통과할 수 있다고 알려져 있는데, 이러한 이유로 인해 사람의 혈액 내에는 뇌에서부터 분비된 뇌 유래 엑소좀이 다량 혼입되어 있다.
뇌 유래 소포체, 예를 들면 엑소좀은 뇌질환 진단 분야에서 현재 각광받고 있는 요소로, 혈액 중에서 뇌 유래 엑소좀을 분리하고, 그 엑소좀 내부 분자들을 조사하여 뇌의 상태를 간접적으로 파악하는 연구가 진행되고 있다. 뇌 유래 엑소좀을 이용한 뇌의 간접적 프로파일은 뇌의 조직검사 없이도 뇌조직에 대한 정보를 얻을 수 있다는 장점이 있다. 이전까지는 CD171이라고 하는 엑소좀 표면 항체를 타겟으로 하여 혈액 중 뇌 유래 엑소좀을 분리하였으나, CD171은 뇌 이외의 다른 장기에서도 상당 수준으로 발현하기 때문에 이전 CD171 기반의 뇌 유래 엑소좀 연구는 다른 장기의 상태에 의해 결과가 영향을 받을 수 있다는 단점이 존재한다.
이러한 배경 하에 CD171을 대체할 수 있는 보다 장기 특이적인 신규 소포체 마커를 발굴하고, 이를 분리하는 방법과 새로운 마커를 기반으로 분리된 소포체가 뇌의 질병상태를 대변할 수 있음을 확인하여 본 발명을 완성하였다.
일 양상은 생물학적 시료로부터 뇌 유래 소포체를 분리하는 방법으로, 개체로부터 소포체를 포함하는 생물학적 시료를 수득하는 단계; 및 상기 생물학적 시료에서 CADM2(Cell Adhesion Molecule 2), APLP1(amyloid beta precursor like protein 1), EPHA7(EPH receptor A7), CRLF1(cytokine receptor like factor 1), 및 SLC6A3(solute carrier family 6 member 3)으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하는 단계를 포함하는, 뇌 유래 엑소좀을 분리하는 방법을 제공한다.
다른 양상은 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 뇌 유래 소포체 분리용 조성물을 제공한다.
다른 양상은 퇴행성 뇌질환의 진단을 위한 정보를 제공하는 방법으로, 개체로부터 소포체를 포함하는 생물학적 시료를 수득하는 단계; 상기 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하여 뇌 유래 엑소좀을 분리하는 단계; 및 상기 뇌 유래 소포체에서 측정된 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3의 발현 수준을 대조군의 발현 수준과 비교하는 단계를 포함하는 퇴행성 뇌질환의 진단을 위한 정보를 제공하는 방법을 제공한다.
다른 양상은 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 퇴행성 뇌질환 진단용 조성물을 제공한다.
일 양상에 따른 마커는 뇌 유래 소포에서 특이적으로 발현하는 마커를 이용하여 조직을 채취하지 않고도 뇌 유래 소포를 고효율 및 고특이적으로 분리할 수 있고, 각 뇌 영역에서 특이적으로 발현하는 소포를 분리할 수 있다. 또한 일 양상에 따른 마커를 이용해 분리된 뇌 유래 소포에서 뇌 영역 특이적 마커의 발현 프로파일을 통해 뇌의 질병 상태를 진단할 수 있다.
도 1은 뇌, 신장, 심장, 비장, 및 간 조직에서 후보로 도출된 유전자 중 일부인 Aplp1, Cadm2 및 기존 뇌 마커인 L1CAM의 mRNA 발현 수준을 RT-PCR에 의해 확인한 결과이다.
도 2는 뇌, 신장, 심장, 비장, 및 간 조직에서 Aplp1, Cadm2 및 L1CAM의 mRNA 발현 수준을 확인한 RT-PCR 밴드의 강도를 정량화하여 확인한 결과이다 (도 2a: L1CAM, 도 2b: APLP1, 도 2c: CADM2).
도 3은 뇌, 심장, 신장, 및 간 조직에서 Aplp1 및 L1CAM의 mRNA 상대적인 발현 수준을 확인한 결과이다 (도 3a: L1CAM, 도 3b: APLP1).
도 4는 뇌, 심장, 신장, 비장, 및 간 조직에서 Aplp1, Cadm2 및 L1CAM의 mRNA 발현 수준을 확인한 결과이다 (도 4a: L1CAM, 도 4b: APLP1, 도 4c: CADM2).
도 5는 뇌, 심장, 신장, 비장, 및 간 조직에서 후보로 도출된 유전자 중 일부인 Aplp1, Cadm2 및 기존 뇌 마커인 L1CAM(전장, 및 절단된 형태)의 단백질 발현 수준을 웨스턴 블롯에 의해 확인한 결과이다.
도 6은 인간 태아 유래 신경전구세포(hNPC), 인간 심장 세포주(AC16), 인간 간 세포주(HepG2), 인간 신장 세포주(HEK293), 인간 비장 세포주(TK6)에서 Aplp1, Cadm2의 mRNA 발현 수준을 확인한 RT-PCR 밴드의 강도를 정량화하여 확인한 결과이다 (도 6a: APLP1, 도 6b: CADM2).
도 7은 인간 태아 유래 신경전구세포 배양액으로부터 분리된 엑소좀(hNPC EV), 및 인간 혈액으로부터 분리된 엑소좀(hblood EV)에서 Aplp1 및 Cadm2의 존재 여부를 확인한 결과이다.
도 8은 마우스 혈액, 뇌, 심장, 신장, 비장, 간으로부터 채취한 엑소좀에서 CD171(L1CAM), Aplp1 및 Cadm2 발현 수준을 FACS를 이용하여 확인한 결과이다 (도 8a: 혈액, 도 8b: 뇌, 도 8c: 심장, 도 8d: 신장, 도 8e: 비장, 도 8f: 간).
도 9는 인간 태아 유래 신경전구세포(hNPC), 인간 심장 세포주(AC16), 인간 신장 세포주(HEK293), 인간 비장 세포주(TK6), 및 인간 간 세포주(HepG2) 배양액으로부터 분리된 엑소좀에서 CD171(L1CAM), Aplp1 및 Cadm2 발현 수준을 FACS를 이용하여 확인한 결과이다 (도 9a: hNPC, 도 9b: AC16, 도 9c: HEK293, 도 9d: TK6, 도 9e: HepG2).
일 양상은 생물학적 시료로부터 뇌 유래 소포체를 분리하는 방법을 제공한다.
상기 방법은 개체로부터 소포체를 포함하는 생물학적 시료를 수득하는 단계; 및 상기 생물학적 시료에서 CADM2(Cell Adhesion Molecule 2), APLP1(amyloid beta precursor like protein 1), EPHA7(EPH receptor A7), CRLF1(cytokine receptor like factor 1), 및 SLC6A3(solute carrier family 6 member 3)으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하는 단계를 포함한다.
상기 방법은 상기 발현 수준이 대조군의 발현 수준에 비해 높은 경우, 생물학적 시료를 뇌 유래 소포체로 판단하는 단계를 더 포함할 수 있다.
본 명세서에서 "소포체(vesicles)"는 엑소좀(exosome), 미세입자, 미세소포, 나노좀(nanosome), 세포외 소포 및 엑토좀(ectosome)으로 구성된 군으로부터 선택된 하나 이상일 수 있다.
상기"엑소좀(exosome)"은 세포의 엔도솜(Endosome)에서 유래하여 세포 외부로 배출되는 미세소체로, 50-100nm의 크기를 가지며, 세포 내부로부터 유래한 다양한 DNA, RNA, 단백질, 대사체(Metabolite)등의 분자를 내부에 포함한 미세소체를 의미한다.
본 명세서에서 "뇌 유래 소포체(Brain-derived vesicle)"은 뇌 조직의 다양한 세포로부터 분비된 소포체의 총칭을 의미한다. 상기 뇌 유래 소포체는 뉴런(Neuron) 유래 소포체, 희소돌기아교세포(Oligodendrocyte) 유래 소포체, 미세아교세포(Microglia) 유래 소포체, 성상아교세포 (Astrocyte) 유래 소포체 등, 다양한 세포로부터 분비된 소포체로 세분화될 수 있다.
상기 뇌 유래 소포체, 예를 들어 엑소좀은 크기가 50-100nm로 작기 때문에 쉽게 혈액 중으로 혼입되는 것을 특징으로 한다. 혈액 중으로 혼입된 혈중 뇌 유래 엑소좀 내에서 뇌 유래 엑소좀 특이적으로 발현하는 마커 분자의 발현 수준을 분석함으로써 뇌 유래 엑소좀을 분리할 수 있다.
상기 뇌 유래 소포체는 다른 기관으로부터 유래한 소포체에 비해 CADM2, APLP1, EPHA7, CRLF1, SLC6A3, 또는 이들의 조합의 수준이 증가된 것일 수 있다. 즉, 상기 CADM2, APLP1, EPHA7, CRLF1, SLC6A3, 또는 이들의 조합은 뇌 특이적, 뇌 영역 특이적 마커일 수 있다.
상기 CADM2, APLP1, EPHA7, CRLF1, SLC6A3, 또는 이들의 조합은 소포체의 막에 존재하는 단백질일 수 있다.
상기 분석은 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상 또는 이의 단편에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 포함하는 제제를 통해 수행할 수 있다.
항체는 통상적인 기법을 이용함으로써 단편화될 수 있고, 단편은 전체 항체에 대해 전술된 바와 동일한 방식으로 유용성에 대해 스크리닝될 수 있다. 예를 들면, F(ab)2 단편은 항체를 펩신으로 처리함으로써 생성될 수 있다. 생성된 F(ab)2 단편은 다이설파이드 가교를 환원시켜 Fab 단편을 생성하도록 처리될 수 있다. 항원 결합 부분도 재조합 DNA 기법, 또는 온전한 항체의 효소적 또는 화학적 절단에 의해 생성될 수 있다. 항원 결합 부분은 특히 Fab, Fab', F(ab')2, Fv, dAb 및 상보성 결정 영역(CDR) 단편, 단일 쇄 항체(scFv), 단일 도메인 항체, 이중특이적 항체, 키메라 항체, 인간화된 항체, 디아바디, 및 특이적 항원 결합을 폴리펩타이드에 부여하기에 충분한 면역글로불린의 적어도 일부를 함유하는 폴리펩타이드를 포함한다. 특정 실시양태에서, 항체는 그에 부착되어 검출될 수 있는 표지(예를 들면, 표지는 방사성동위원소, 형광 화합물, 효소 또는 효소 보조인자일 수 있음)를 추가로 포함한다.
당분야에서 통상의 기술을 가진 자는 상기 측정 및 분석을 위해 이용될 수 있는 여러 방법들 및 장치들을 알고 있다. 환자 시험 시료 중의 폴리펩타이드 또는 단백질에 대하여, 면역분석 장치들 및 방법들이 종종 이용된다. 이 장치들 및 방법들은 다양한 샌드위치, 경쟁적 또는 비-경쟁적 분석 포맷들에서 표지된 분자를 이용하여 관심있는 분석물의 존재 또는 양과 관련되어 있는 신호를 생성할 수 있다. 추가로, 특정 방법들 및 장치들, 예컨대, 바이오센서 및 광학 면역분석이 표지된 분자에 대한 필요성 없이 분석물의 존재 또는 양을 측정할 수 있다. 다른 방법들(예를 들면, 마커 RNA 수준의 측정)이 당분야에서 숙련된 자에게 잘 공지되어 있지만, 바람직하게는 면역분석을 이용함으로써 측정된다. 마커의 존재 또는 양은 일반적으로 각각의 마커에 대해 특이적인 항체를 사용하고 특이적 결합을 검출함으로써 확인된다. 임의의 적합한 면역분석, 예를 들면, 효소-연결된 면역분석(ELISA), 방사면역분석(RIA), 경쟁 결합 분석, 평면 도파관(planar waveguide) 기술 등이 이용될 수 있다. 항체와 마커의 특이적 면역학적 결합은 직접적으로 또는 간접적으로 검출될 수 있다. 직접적인 표지는 항체에 부착된 형광 또는 발광 태그, 금속, 염료, 방사성핵종 등을 포함한다. 간접적인 표지는 당분야에서 잘 공지된 다양한 효소들, 예컨대, 알칼리성 포스파타제, 호스라디쉬 퍼록시다제 등을 포함한다.
상기 생물학적 시료에 존재하는 소포체가 제제에 결합하여 소포체-제제 복합체를 형성하는 조건 하에서 상기 생물학적 시료를 상기 제제와 접촉시키는 단계; 및 상기 소포체-제제 복합체로부터 상기 소포체를 분리하여 상기 소포체를 포함하는 시료를 수득하는 단계에 의해서 생물학적 시료로부터 뇌 유래 소포체를 분리하거나 농축할 수 있다.
상기 발현 수준은 CADM2, APLP1, EPHA7, CRLF1, SLC6A3, 또는 이들의 조합의 단백질 수준일 수 있다.
상기 시료는 세포 배양 상청액, 전혈, 혈청, 혈장, 복수액, 뇌척수액, 골수 흡입물, 기관지-폐포 세척물, 소변, 정액, 질액, 점액, 타액, 객담 또는 생물학적 조직 시료로부터 정제된 용해물, 또는 예를 들면, 뇌 조직을 포함하는 다른 조직을 포함하는, 당분야에서 공지된 다른 공급원으로부터 수득될 수도 있다.
상기 시료가 혈액인 경우, 후속 기법들을 위해 샘플을 보존하거나 준비하기 위해 채취 후에 다양한 성분들과 조합될 수 있다. 예를 들면, 혈액은 채취 후에 항응고제, 세포 고정제, 프로테아제 억제제, 포스파타제 억제제, 단백질, DNA 또는 RNA 보존제로 처리된다. 예를 들어, 혈액은 항응고제, 예컨대, EDTA 또는 헤파린을 함유하는 진공 채취 튜브를 이용함으로써 정맥천자를 통해 채취된다. 혈액은 헤파린-코팅된 주사기 및 피하 바늘을 이용함으로써 채취될 수도 있다. 혈액은 세포 배양에 유용할 성분과 조합될 수도 있다. 예를 들면, 혈액은 세포 배양 배지 또는 보충된 세포 배양 배지(예를 들면, 사이토카인)와 조합될 수 있다. 또한, 상기 시료가 혈액인 경우, 혈액 뇌장벽을 자유롭게 통과할 수 있는 소포체를 사용하여 뇌 조직을 채취하지 않고도 뇌 유래 소포체를 분리할 수 있는 장점이 있다.
다른 양상은 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 뇌 유래 소포체 분리용 조성물을 제공한다.
생물학적 시료, 소포체, 뇌 유래 소포체, 발현 수준을 측정하는 제제는 상술한 바와 같다.
일 구현예에서, 뇌 유래 소포체는 다른 기관 유래 소포체에 비하여 CADM2, APLP1, EPHA7, CRLF1, 또는 SLC6A3의 발현 수준이 증가되어 있으므로, 이들 발현 수준을 측정하면 뇌 유래 소포체를 분리할 수 있다.
다른 양상은 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 뇌 유래 소포체 분리용 키트를 제공한다.
상이한 성분들을 가진 다양한 키트들이 본 발명에 의해 고려된다. 일반적으로 말하면, 상기 키트는 개체에서 하나 이상의 마커를 정량하는 수단을 포함할 수 있다. 상기 키트는 생물학적 시료를 수집하는 수단, 생물학적 시료에서 하나 이상의 바이오마커를 정량하는 수단, 및 키트 내용물의 사용을 위한 설명서를 포함할 수 있다. 상기 키트는 생물학적 시료에서 소포체를 농축하거나 분리하는 수단을 포함할 수 있다. 추가 양상에서, 소포체를 농축하거나 분리하는 수단은 생물학적 시료로부터 소포체를 농축하거나 분리하기 위해 필요한 시약을 포함한다. 상기 키트는 바이오마커의 양을 정량하는 수단을 포함할 수 있고, 바이오마커의 양을 정량하는 수단은 바이오마커의 양을 검출하기 위해 필요한 시약을 포함할 수 있다.
다른 양상은 퇴행성 뇌질환의 진단, 예후 예측을 위한 정보를 제공하는 방법을 제공한다.
상기 방법은 개체로부터 소포체를 포함하는 생물학적 시료를 수득하는 단계; 상기 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하여 뇌 유래 소포체를 분리하는 단계; 및 상기 뇌 유래 소포체에서 측정된 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3의 발현 수준을 대조군의 발현 수준과 비교하는 단계를 포함한다.
생물학적 시료, 소포체, 뇌 유래 소포체, 발현 수준을 측정은 상술한 바와 같다.
상기 뇌 유래 소포체의 마커인 CADM2, APLP1, EPHA7, CRLF1, 및/또는 SLC6A3은 뇌 유래 소포체의 마커임과 동시에 뇌 영역 특이적 마커일 수 있다. 즉, 상기 단백질은 각각 뇌의 특정 부위에서 발현이 증가된 것일 수 있다. 예를 들어, APLP1은 뇌 전체에서 발현되는 것이고, CADM2, EPHA7, 및 CRLF1은 해마에서 특이적으로 발현되는 것이고, SLC6A3은 중뇌에서 특이적으로 발현되는 것일 수 있다.
상기 마커가 특정 뇌 영역 특이적 마커이므로, 특정 뇌 영역 유래의 소포체를 분리하고, 상기 소포체 내부에 포함된 질병 마커, 예를 들면 유전자, 단백질 등의 발현 수준을 측정함으로써 질병을 진단하고 예후를 예측할 수 있다.
상기 질병 마커는 아밀로이드 베타, 인산화된 Tau, Aβ1-42, TDP-43, α-시누클레인, SOD-1, FUS, FKBP51, IRS-1, 인산화된 IRS-1, CTSD, LAMP1, UBP, HSP70, NSE, NFL, CD9, CD63, CD81 및 CD171로 구성된 군으로부터 선택된 1종 이상일 수 있다.
상기 질병 마커의 유전자 발현 수준은 mRNA 또는 miRNA 수준을 측정함으로써 측정될 수 있다. 당분야에서 통상의 기술을 가진 자는 상기 질병 마커의 검출 및 분석을 위해 이용될 수 있는 여러 방법들 및 장치들을 알고 있다. 환자 시험 샘플 중의 폴리펩타이드 또는 단백질에 대하여, 면역분석 장치들 및 방법들이 종종 이용된다. 이 장치들 및 방법들은 다양한 샌드위치, 경쟁적 또는 비-경쟁적 분석 포맷들에서 표지된 분자를 이용하여 관심있는 분석물의 존재 또는 양과 관련되어 있는 신호를 생성할 수 있다. 추가로, 특정 방법들 및 장치들, 예컨대, 바이오센서 및 광학 면역분석이 표지된 분자에 대한 필요성 없이 분석물의 존재 또는 양을 측정하는 데에 이용될 수 있다.
다른 방법들(예를 들면, 마커 RNA 수준의 측정)이 당분야에서 숙련된 자에게 잘 공지되어 있지만, 예를 들어 질병 마커는 면역분석을 이용함으로써 분석된다. 마커의 존재 또는 양은 일반적으로 각각의 마커에 대해 특이적인 항체를 사용하고 특이적 결합을 검출함으로써 확인된다. 임의의 적합한 면역분석, 예를 들면, 효소-연결된 면역분석(ELISA), 방사면역분석(RIA), 경쟁 결합 분석, 평면 도파관(planar waveguide) 기술 등이 이용될 수 있다. 항체와 마커의 특이적 면역학적 결합은 직접적으로 또는 간접적으로 검출될 수 있다. 직접적인 표지는 항체에 부착된 형광 또는 발광 태그, 금속, 염료, 방사성핵종 등을 포함한다. 간접적인 표지는 당분야에서 잘 공지된 다양한 효소들, 예컨대, 알칼리성 포스파타제, 호스라디쉬 퍼록시다제 등을 포함한다.
질병 마커에 대해 특이적인 고정된 항체의 사용도 본 발명에 의해 고려된다. 항체는 다양한 고체 지지체들, 예컨대, 자성 또는 크로마토그래피 매트릭스 입자, 분석 장소(예컨대, 마이크로타이터 웰)의 표면, 고체 기판 물질(예컨대, 플라스틱, 나일론, 종이)의 조각 등 상에 고정될 수 있다. 분석 스트립은 항체 또는 복수의 항체들을 고체지지체 상에 어레이로 코팅함으로써 제조될 수 있다. 그 다음, 이 스트립은 검사 샘플 내로 침지된 후 세척 및 검출 단계를 통해 신속히 프로세싱되어 측정가능한 신호, 예컨대, 착색된 스폿(spot)을 생성할 수 있다.
복수의 질병 마커들의 분석은 한 시험 샘플과 별도로 또는 동시에 수행될 수 있다. 여러 마커들이 다수의 샘플들의 효율적인 프로세싱을 위해 한 시험으로 조합될 수 있다. 또한, 당분야에서 숙련된 자는 동일한 개체로부터 (예를 들면, 연속적인 시점들에서) 다수의 샘플들을 시험할 가치를 인식할 것이다. 일련의 샘플들의 이러한 시험은 시간의 경과에 따라 마커 수준에서의 변화를 확인할 수 있게 할 것이다. 마커 수준에서의 증가 또는 감소뿐만 아니라 마커 수준에서의 변화의 부재도 사건(event) 시작으로부터의 대략적인 시간의 확인, 구조할 수 있는 (salvageable) 조직의 존재 및 양, 약물 치료의 타당성, 다양한 치료들의 효과, 사건의 중증도의 확인, 질환 중증도의 확인, 및 장래 사건의 위험을 포함하는 환자의 결과의 확인을 포함하나 이들로 한정되지 않는, 질환 상태에 대한 유용한 정보를 제공할 것이다.
상기 질병 마커는 신경퇴행성 장애외 뇌암의 초기 검출 및 모니터링에서 중요한 역할을 수행할 수 있다. 이러한 질병 마커는 전형적으로 측정될 수 있는 신체 샘플에서 발견된 물질이다. 측정된 양은 기저 장애 또는 질환 병리생리학, 신경퇴행성 장애의 존재 또는 부재, 향후 신경퇴행성 장애의 가능성과 상관관계를 가질 수 있다. 그의 상태에 대해 치료를 받고 있는 환자에서 측정된 양은 치료에 대한 반응과도 상관관계를 가질 수 있다.
본 명세서에서 "퇴행성 뇌질환"은 알츠하이머 병, 파킨슨 병, 헌팅턴 병, 뇌졸중, 다계통위축증, 혈관 질환 치매, 전두측두엽 치매(FTD), 피질기저 퇴행(CBD), 진행핵상마비(PSP), 루이소체 치매, 매듭-우세 노인성 치매(tangle-predominant senile dementia), 픽병(Pick'sdisease)(PiD), 혹은 과립(argyrophilic grain) 질환, 근위축성 측삭 경화증(ALS), 다른 운동 신경 질환, 괌(Guam) 파킨슨증-치매 복합, FTDP-17, 라이티코-보디그병(Lytico-Bodig disease), 다발성 경화증, 뇌암 및 외상성 뇌손상(TBI)으로 구성된 군으로부터 선택될 수 있다.
일 구현예에서, 혈액 시료로부터 분리된 뇌 유래 소포체에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정한 결과, 퇴행성 뇌질환 동물 모델에서 퇴행성 뇌질환을 특이적으로 진단할 수 있음을 확인하였다.
또 다른 구현예에서, 의사로 하여금 개체에서 하나 이상의 퇴행성 뇌질환을 진단하거나 예후하게 할 수 있다. 또는, 의사로 하여금 진단 가능성으로서 하나 이상의 퇴행성 뇌질환을 배제하거나 제거하게 할 수 있다. 또는, 의사로 하여금 퇴행성 뇌질환을 발생시킬 위험에 있는 개체를 확인하게 할 수 있다. 또는, 의사로 하여금 개체가 퇴행성 뇌질환을 나중에 발생시킬지를 예측하게 할 수 있다. 또한, 의사로 하여금 퇴행성 뇌질환을 가진 개체에서 치료 요법을 처방하거나 치료로부터의 이익을 예측하게 할 수 있다.
상기 방법은 퇴행성 뇌질환의 초기 검출 및 모니터링에서 중요한 역할을 수행한다. 이러한 장애의 마커는 전형적으로 측정될 수 있는 신체 시료에서 발견된 물질이다. 측정된 양은 기저 장애 또는 질환 병리생리학, 퇴행성 뇌질환의 존재 또는 부재, 향후 퇴행성 뇌질환 및 뇌암 발병 가능성과 상관관계를 가질 수 있다. 그의 상태에 대해 치료를 받고 있는 환자에서 측정된 양은 치료에 대한 반응과도 상관관계를 가질 것이다.
이하 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 뇌 유래 엑소좀 특이적 마커의 도출 및 검증
1.1. 공공 데이터베이스(Database: DB) 기반 뇌 특이적 신규 표지자군의 선정
인간의 각 장기별 단백질 발현 양상을 확인하기 위해, 인간 조직별 mRNA 발현 및 단백질 염색 양상을 제공하는 공공 데이터 베이스인 The Human Protein atlas라는 DB를 사용하였다. 상기 DB로부터 인간 뇌에서 특이적으로 발현한다는 주석정보(Annotation data)가 붙은 단백질(Brain-enriched protein)로 419개 단백질을 후보로 선정하였다.
다음, 419개 후보 단백질의 GENEONTOLOGY 및 Uniprot라는 DB를 이용해 엑소좀의 막(membrane)에 존재하는 단백질 214개를 골라내었다.
다음, 214개의 후보 단백질들이 뇌의 어느 부분에서 발현되는지 확인하기 위해, Allen brain atlas db를 이용하였다. 상기 DB는 In situ hybridization을 통해 마우스 뇌에서 영역별 유전자 발현 정도를 제공한다. 이를 이용해 뇌 전체 영역에서 발현(global)되는 유전자와, 해마, 중뇌 등에 특이적으로 발현(region-specific)되는 유전자를 골라내었다.
1.2 신규 표지자군의 뇌 발현 특이도 검증
상기 1.1.과 같이 공공 DB부터 선정한 뇌 특이적으로 발현하는 단백질을 마우스에서 실제로 확인하였다. 중합효소 연쇄반응 (Polymerase chain reaction) 방법을 이용해, 마우스의 뇌, 간, 신장, 심장, 비장에서 채취한 RNA에서 신규 표지자군의 mRNA 발현을 PCR로 확인하고, PCR 결과 뇌 특이적으로 mRNA 발현이 확인된 후보에 대해서는 단백질 발현을 웨스턴 블롯으로 확인하였다.
구체적으로, PCR은 8주령 마우스에서 PBS로 관류 후, 각 기관(뇌, 신장, 심장, 폐, 간)을 적출하고 액체 질소로 냉동하였다. -80℃를 유지하며 각 조직을 파쇄하였다. Trizol을 이용해 RNA를 추출하고, 추출된 RNA 1μg을 이용해 cDNA를 합성하였다(intron, 25082 사용). 합성된 cDNA 2μg을 이용해서 다음 후보에 대해 PCR을 수행하였다. PCR에 사용된 유전자 및 각 유전자에 대한 프라이머 정보는 표 1과 같다.
유전자 서열 서열번호 조건
Aplp1 정방향: GCCACTGTCATTGCTGCTTC 1 56℃, hot start kit, 28~30 cycle, 3step
역방향: GGGTTAGACGCCCACATAGTC 2
Cadm2 정방향: CGATCCGATTGTCCCTTAAAGC 3 56 ℃, normal kit, 28~30cycle, 3step
역방향: AGGGCAGTTTCCACTAACTCA 4
L1CAM 정방향: AAAGGTGCAAGGGTGACATTC 5 58 ℃, normal kit, 33cycle, 3step
역방향: TCCCCACGTTCCTGTAGGT 6
도 1은 뇌, 신장, 심장, 비장, 및 간 조직에서 후보로 도출된 유전자 중 일부인 Aplp1, Cadm2 및 기존 뇌 마커인 L1CAM의 mRNA 발현 수준을 RT-PCR에 의해 확인한 결과이다. 도 2는 뇌, 신장, 심장, 비장, 및 간 조직에서 Aplp1, Cadm2 및 L1CAM의 mRNA 발현 수준을 확인한 RT-PCR 밴드의 강도를 정량화하여 확인한 결과이다 (도 2a: L1CAM, 도 2b: APLP1, 도 2c: CADM2).
도 3은 뇌, 심장, 신장, 및 간 조직에서 Aplp1 및 L1CAM의 mRNA 상대적인 발현 수준을 확인한 결과이다 (도 3a: L1CAM, 도 3b: APLP1). 도 4는 뇌, 심장, 신장, 비장, 및 간 조직에서 Aplp1, Cadm2 및 L1CAM의 mRNA 발현 수준을 확인한 결과이다 (도 4a: L1CAM, 도 4b: APLP1, 도 4c: CADM2).
도 1내지 4에 나타낸 바와 같이, 기존 뇌 마커로 사용되어 온 L1CAM은 뇌에서 발현이 확인 되지만, 뇌에서만 특이적으로 발현하는 것이 아니고 신장, 심장, 폐 및 간에서도 모두 발현하는 것을 확인하였다. 그에 비하여 CADM2와 APLP1은 뇌에서만 높은 수준의 발현이 확인되었다. 따라서, CADM2와 APLP1은 뇌 특이적 마커임을 알 수 있다.
뇌 마커로 확인된 CADM2와 APLP1의 단백질 발현수준을 확인하기 위해 웨스턴 블롯을 수행하였다. 웨스턴 블롯은 8주령 마우스에서 PBS로 관류 후, 각 기관(뇌, 신장, 심장, 비장, 간)을 적출하고 액체 질소로 냉동하였다. -80℃를 유지하며 각 조직을 파쇄하였다. RIPA 버퍼를 이용하여 단백질을 추출하고, BCA assay를 통해 단백질을 정량하였다. 15μg 단백질을 젤에서 러닝(running, 60V 1hr, 120V 1.5hrs)하였다. 러닝 후 0.2μm 구멍을 가진 멤브레인을 이용하여 트랜스퍼(Cold room에서 20V, overnight(O/N))하였다. 10% skim milk으로 상온에서 2시간 동안 차단하고, 5% skim milk에 희석된 1차 항체(항-L1CAM 항체: ab20148, Abcam; 항-APLP1 항체: ab192481, Abcam; 및 항-CADM2 항체: bs-8246R, Bioss Inc.)와 인큐베이션 하였다(APLP1: 1:2000, 4℃, O/N; CADM2: 1:1000, 4℃, O/N; L1CAM: 1:1000, 4℃, O/N; GAPDH: 1:10000, 4℃, O/N). TBST를 이용하여 15분 동안 4회 세척하였다. 5% skim milk에 희석된 2차 항체와 인큐베이션 하였다 (APLP1 & CADM2: Rabbit HRP 1:1000, RT, 2hrs; L1CAM & GAPDH: Mouse HRP 1:1000, RT, 2hrs). 인큐베이션 완료 후 디벨로핑해 실험을 완료하였다.
도 5는 뇌, 심장, 신장, 비장, 및 간 조직에서 후보로 도출된 유전자 중 일부인 Aplp1, Cadm2 및 기존 뇌 마커인 L1CAM(전장, 절단된 형태)의 단백질 발현 수준을 웨스턴 블롯에 의해 확인한 결과이다.
도 5에 나타낸 바와 같이, 전장 길이의 L1CAM은 다른 조직에서는 밴드가 확인되지 않고, 뇌에서만 밴드가 확인 되었다. 메탈로프로테아제(metalloprotease)와 플라스민(plasmin)에 의해 발생된 절단된 형태(cleaved form)는 뇌 외에 다른 조직들에서도 모두 밴드가 나타나는 것을 확인되어, 뇌 특이적 마커는 아님을 확인하였다. 반면에, Aplp1, Cadm2 단백질은 다른 조직에서는 발현하지 않고 오직 뇌에서만 발현하므로, 뇌 특이적 마커임을 확인하였다.
1.3. 뇌 유래 엑소좀에서 신규 마커의 확인
마우스에 이어, 인간에서도 APLP1 및 CADM2가 뇌 특이적으로 발현하는지 확인하였다. 다양한 조직에서의 특정 세포 (AC16: human heart cell line; HepG2: human liver cell line; HEK293: human kidney cell line; TK6: human spleen cell line)들을 인간 태아 유래 신경전구세포(hNPCs: human brain primary cell line)과 비교 분석하기 위하여, 세포 배양액에서 RNA를 분리하여 cDNA로 합성 후 real-time PCR (실시간 유전자 중합연쇄반응 실험 기법)을 사용하였다.
도 6은 인간 태아 유래 신경전구세포, 인간 심장 세포주(AC16), 인간 간 세포주(HepG2), 인간 신장 세포주(HEK293), 인간 비장 세포주(TK6)에서 Aplp1, Cadm2의 mRNA 발현 수준을 확인한 결과이다. 도 6에 나타낸 바와 같이, Aplp1 및 Cadm2는 인간 신경전구세포 배양액에서만 특이적으로 높게 발현되는 것을 확인되었다.
또한, 상기 hNPC 배양액으로부터 분리된 엑소좀 및 인간 혈액에서 추출된 엑소좀 내에 Aplp1 및 Cadm2 단백질이 존재하는지 확인하기 위해 웨스턴 블롯을 수행하였다.
도 7은 인간 태아 유래 신경전구세포 배양액으로부터 분리된 엑소좀(hNPC EV), 및 인간 혈액으로부터 분리된 엑소좀(hblood EV)에서 APLP1 및 CADM2의 존재 여부를 확인한 결과이다. 도 7에 나타낸 바와 같이, Aplp1 및 Cadm2는 인간 태아 유래 신경전구세포 및 인간 혈액으로부터 분리, 추출된 엑소좀 내에 높은 수준으로 발현되는 것을 확인하였다.
실시예 2. CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3 양성 엑소좀과 CD171 양성 엑소좀(CD171+ 엑소좀)과의 호환성 및 차별성 검증
2.1. CD171+ 엑소좀의 호환성 확인
실시예 1을 통해 확인한 뇌 유래 소포체의 신규한 마커인 CADM2 및 APLP1 양성인 엑소좀과 기존 뇌 마커인 CD171(L1CAM) 양성 엑소좀과의 호환성을 확인하기 위해, 마우스 혈액으로부터 채취한 엑소좀에 CADM2, APLP1, 및 CD171각각에 형광 표지자를 달아 FACS(fluorescence activated cell sorter)를 이용하여 확인하였다.
도 8 a는 마우스 혈액으로부터 채취한 엑소좀에서 CD171(L1CAM), Aplp1 및 Cadm2 발현 수준을 FACS를 이용하여 확인한 결과이다. 그 결과, 도 8a에 나타낸 바와 같이, CD171+ 엑소좀과 APLP1 및 CADM2 양성 엑소좀은 혈액에서 뽑은 엑소좀에서는 유사한 발현량을 보이는 것을 확인하였다.
상기 결과를 통해, APLP1 및 CADM2 양성 엑소좀과 CD171 양성 엑소좀은 호환성을 가짐을 확인할 수 있다.
2.2. CD171+ 엑소좀의 차별성 확인
신규한 마커인 CADM2 및 APLP1과 기존 마커인 CD171의 차별성을 확인하기 위해, 혈액 외에도 마우스의 다양한 장기 절편으로부터 엑소좀을 분리하여 APLP1, CADM2, CD171로 형광표지 후 FACS로 확인하였다.
도 8b-8f는 마우스 뇌, 심장, 신장, 비장, 간으로부터 채취한 엑소좀에서 CD171(L1CAM), Aplp1 및 Cadm2 발현 수준을 FACS를 이용하여 확인한 결과이다. 그 결과, 도 8b-8f에 나타낸 바와 같이, 뇌뿐만 아니라, 심장과 비장에서 분리된 엑소좀에서는 CD171+ 엑소좀이 많은 것을 확인하였으나, 신규한 마커인 CADM2 및 APLP1 양성 엑소좀은 뇌로부터 분리한 엑소좀에만 특이적으로 많은 양으로 존재하는 것임을 확인하였다.
상기 결과를 통해, APLP1 및 CADM2는 뇌 유래 소포체에 특이적으로 많은 양으로 존재하는 점에서 기존 뇌 마커인 CD171와 차별성을 가짐을 확인할 수 있다.
마우스에 이어, 인간에서도 APLP1 및 CADM2가 기존 뇌 마커인 CD171과 차별성을 갖는지 확인하기 위해, 다양한 인간 세포주로부터 얻은 배양액에서 엑소좀을 분리하여, CD171과 APLP1 및 CADM2을 형광표지 후 FACS로 확인하였다.
도 9는 인간 태아 유래 신경전구세포(hNPC), 인간 심장 세포주(AC16), 인간 신장 세포주(HEK293), 인간 비장 세포주(TK6), 및 인간 간 세포주(HepG2) 배양액으로부터 분리된 엑소좀에서 CD171(L1CAM), Aplp1 및 Cadm2 발현 수준을 FACS를 이용하여 확인한 결과이다. 그 결과, 도 9에 나타낸 바와 같이, CD171+ 엑소좀은 비장 세포주에서도 풍부하게 발견된 반면, Aplp1 및 Cadm2는 인간 신경전구세포주에서만 특이적으로 높은 농도로 발견되었다.
상기 결과로부터, 본 발명에 따른 APLP1, CADM2, EPHA7, CRLF1, 및 SLC6A3을 이용하여, 채취가 용이한 혈액 시료에서 뇌 유래 엑소좀을 특이적으로 고효율로 분리할 수 있고, 특히 뇌 영역별로 특이적으로 발현하는 엑소좀을 분리할 수 있음을 확인하였다.

Claims (12)

  1. 생물학적 시료로부터 뇌 유래 소포체를 분리하는 방법으로,
    개체로부터 소포체를 포함하는 생물학적 시료를 수득하는 단계; 및
    상기 생물학적 시료에서 CADM2(Cell Adhesion Molecule 2), APLP1(amyloid beta precursor like protein 1), EPHA7(EPH receptor A7), CRLF1(cytokine receptor like factor 1), 및 SLC6A3(solute carrier family 6 member 3)으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하는 단계를 포함하는, 뇌 유래 소포체를 분리하는 방법.
  2. 청구항 1에 있어서, 상기 생물학적 시료는 세포 배양 상청액, 전혈, 혈청, 혈장, 복수액, 뇌척수액, 골수 흡입물, 기관지-폐포 세척물, 소변, 정액, 질액, 점액, 타액, 객담 또는 생물학적 조직 시료로부터 정제된 용해물인 것인 방법.
  3. 청구항 1에 있어서, 상기 뇌 유래 소포체는 뉴런 유래, 희소돌기아교세포 유래, 미세아교세포 유래, 성상아교세포 유래, 또는 이들의 조합으로부터 유래된 것인 방법.
  4. 청구항 1에 있어서, 상기 소포체는 엑소좀, 미세입자, 미세소포, 나노좀, 세포외 소포 및 엑토좀으로 구성된 군으로부터 선택되는 것인 방법.
  5. 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 뇌 유래 엑소좀 분리용 조성물.
  6. 청구항 5에 있어서, 상기 생물학적 시료는 세포 배양 상청액, 전혈, 혈청, 혈장, 복수액, 뇌척수액, 골수 흡입물, 기관지-폐포 세척물, 소변, 정액, 질액, 점액, 타액, 객담 또는 생물학적 조직 시료로부터 정제된 용해물인 것인 조성물.
  7. 청구항 5에 있어서, 상기 뇌 유래 뇌 유래 소포체는 뉴런 유래, 희소돌기아교세포 유래, 미세아교세포 유래, 성상아교세포 유래, 또는 이들의 조합으로부터 유래된 것인 조성물.
  8. 청구항 5에 있어서, 상기 소포체는 엑소좀, 미세입자, 미세소포, 나노좀, 세포외 소포 및 엑토좀으로 구성된 군으로부터 선택되는 것인 조성물.
  9. 청구항 5에 있어서, 상기 제제는 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상 또는 이의 단편에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편인 것인 조성물.
  10. 퇴행성 뇌질환의 진단을 위한 정보를 제공하는 방법으로,
    개체로부터 소포를 포함하는 생물학적 시료를 수득하는 단계;
    상기 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 분석하여 뇌 유래 소포체를 분리하는 단계; 및
    상기 뇌 유래 소포체에서 측정된 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3의 발현 수준을 대조군의 발현 수준과 비교하는 단계를 포함하는 퇴행성 뇌질환의 진단을 위한 정보를 제공하는 조성물.
  11. 청구항 10에 있어서, 상기 퇴행성 뇌질환은 알츠하이머 병, 파킨슨 병, 헌팅턴 병, 뇌졸중, 다계통위축증, 혈관 질환 치매, 전두측두엽 치매(FTD), 피질기저 퇴행(CBD), 진행핵상마비(PSP), 루이소체 치매, 매듭-우세 노인성 치매(tangle-predominant senile dementia), 픽병(Pick'sdisease)(PiD), 호은 과립(argyrophilic grain) 질환, 근위축성 측삭 경화증(ALS), 다른 운동 신경 질환, 괌(Guam) 파킨슨증-치매 복합, FTDP-17, 라이티코-보디그병(Lytico-Bodig disease), 다발성 경화증, 및 외상성 뇌손상(TBI)으로 구성된 군으로부터 선택되는 것인 방법.
  12. 소포체를 포함하는 생물학적 시료에서 CADM2, APLP1, EPHA7, CRLF1, 및 SLC6A3으로 구성된 군으로부터 선택된 하나 이상의 발현 수준을 측정하는 제제를 포함하는 퇴행성 뇌질환 진단용 조성물.
PCT/KR2019/016777 2018-11-30 2019-11-29 뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법 WO2020111887A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/426,936 US20220099686A1 (en) 2018-11-30 2019-11-29 Brain-derived vesicle-specific marker and brain disease diagnostic method using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0152714 2018-11-30
KR20180152714 2018-11-30

Publications (1)

Publication Number Publication Date
WO2020111887A1 true WO2020111887A1 (ko) 2020-06-04

Family

ID=70854041

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/016777 WO2020111887A1 (ko) 2018-11-30 2019-11-29 뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법

Country Status (3)

Country Link
US (1) US20220099686A1 (ko)
KR (1) KR102337232B1 (ko)
WO (1) WO2020111887A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4083070A4 (en) * 2019-12-27 2023-03-08 Osaka University METHOD OF COLLECTING NERVOUS SYSTEM CELL-DERIVED EXTRACELLULAR VESICLES

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH06128294A (ja) * 1992-04-20 1994-05-10 General Hospital Corp アミロイド前駆体様タンパク質及びその使用
KR20160068964A (ko) * 2013-10-24 2016-06-15 나노소믹스 인코포레이티드 알쯔하이머병 및 다른 신경퇴행성 장애에 대한 바이오마커 및 진단 방법
KR101741581B1 (ko) * 2015-11-16 2017-05-30 이화여자대학교 산학협력단 유전자의 발현 수준을 통한 식품의 항산화, 항염증, 또는 지질대사 수준 예측 방법
KR20180096981A (ko) * 2017-02-22 2018-08-30 한국과학기술연구원 신경퇴행성 장애의 진단을 위한 정보 제공 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005001092A2 (en) 2003-05-20 2005-01-06 Wyeth Compositions and methods for diagnosing and treating cancers
JP2010536367A (ja) * 2007-08-24 2010-12-02 オンコセラピー・サイエンス株式会社 癌関連遺伝子、ｃｄｃａ５、ｅｐｈａ７、ｓｔｋ３１及びｗｄｈｄ１
HU230680B1 (hu) 2012-10-19 2017-08-28 Egis Gyogyszergyar Nyilvanosan Muekoedoe Reszvenytarsasag Diagnosztikai eljárás
WO2016172598A1 (en) * 2015-04-22 2016-10-27 The Broad Institute Inc. Exosomes and uses thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH06128294A (ja) * 1992-04-20 1994-05-10 General Hospital Corp アミロイド前駆体様タンパク質及びその使用
KR20160068964A (ko) * 2013-10-24 2016-06-15 나노소믹스 인코포레이티드 알쯔하이머병 및 다른 신경퇴행성 장애에 대한 바이오마커 및 진단 방법
KR101741581B1 (ko) * 2015-11-16 2017-05-30 이화여자대학교 산학협력단 유전자의 발현 수준을 통한 식품의 항산화, 항염증, 또는 지질대사 수준 예측 방법
KR20180096981A (ko) * 2017-02-22 2018-08-30 한국과학기술연구원 신경퇴행성 장애의 진단을 위한 정보 제공 방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TANG, X. ET AL: "Amyloid-β precursor-like protein APLP1 is a novel p53 transcriptional target gene that augments neuroblastoma cell death upon genotoxic stress", ONCOGENE, vol. 26, no. 52, 28 May 2007 (2007-05-28), pages 7302 - 7312, XP055712199 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4083070A4 (en) * 2019-12-27 2023-03-08 Osaka University METHOD OF COLLECTING NERVOUS SYSTEM CELL-DERIVED EXTRACELLULAR VESICLES

Also Published As

Publication number Publication date
US20220099686A1 (en) 2022-03-31
KR20200066249A (ko) 2020-06-09
KR102337232B1 (ko) 2021-12-09

Similar Documents

Publication Publication Date Title
WO2013133675A1 (ko) 유방암 진단용 다중 바이오마커 세트, 이의 검출 방법 및 이에 대한 항체를 포함하는 유방암 진단키트
US20160215345A1 (en) Method and system to detect and diagnose alzheimer's disease
EP3633372A1 (en) Biomarker for alzheimer's disease
WO2014200178A1 (ko) 저산소증 검출 또는 이와 관련된 질환의 진단 방법
US20160047801A1 (en) Method and system to detect, diagnose, and monitor the progression of alzheimer's disease
KR102143189B1 (ko) 파킨슨병의 진단 방법 및 이를 위한 진단 키트
WO2021210905A1 (ko) 암의 예후 예측용 조성물
WO2020111887A1 (ko) 뇌 유래 소포체 특이적 마커 및 이를 이용한 뇌 질병 진단 방법
WO2020256526A1 (ko) 신장이식 후 항체 매개성 거부반응의 진단 또는 신장이식 후 환자의 예후 예측을 위한 소변 엑소좀 바이오마커
WO2015019979A1 (ja) 統合失調症に関するバイオマーカー
KR101995189B1 (ko) 비침습적 체외진단을 위한 간암 진단용 바이오마커 조성물 및 이를 포함하는 키트
KR102143190B1 (ko) 파킨슨병 치매의 진단 방법 및 이를 위한 진단 키트
US20130023428A1 (en) Biomarkers for neurological conditions
KR102041115B1 (ko) 콧물 시료를 이용하여 경도 및 중도 알츠하이머 질환을 구분하여 진단하기 위한 조성물 및 키트
WO2020085803A1 (ko) 인지기능 정상군 또는 경도 인지장애에서 아밀로이드 베타의 뇌 침착 검출용 혈액 바이오 마커
WO2013054984A1 (en) Composition for diagnosis of lung cancer and diagnosis kit of lung cancer
KR20090009579A (ko) 알츠하이머병 진단용 마커 및 이를 이용한 진단키트
KR101880554B1 (ko) 콧물 시료를 이용한 알츠하이머 질환의 진행 단계 스크리닝 방법
WO2020091222A1 (ko) 알츠하이머성 치매 진단용 바이오마커 단백질 및 이의 용도
WO2020256530A1 (ko) 신장이식 후 t세포 매개성 거부반응의 진단 또는 신장이식 후 환자의 예후 예측을 위한 소변 엑소좀 바이오마커
WO2021137553A1 (ko) 임신중독증 진단용 바이오마커 조성물 및 이의 용도
WO2011129483A1 (ko) 폐암 진단용 Ｘａｇｅ－１ｄ 마커 및 이를 이용한 진단 키트
WO2020256529A1 (ko) 신장이식 후 bk 바이러스 감염성 신병증의 진단 또는 신장이식 후 환자의 예후 예측을 위한 소변 엑소좀 바이오마커
WO2023101445A1 (ko) 반려견의 림프종 진단용 바이오마커
WO2024014834A1 (ko) 초기 알츠하이머병 진단용 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19890620

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19890620

Country of ref document: EP

Kind code of ref document: A1