WO2020060003A1 - 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법 - Google Patents

락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법 Download PDF

Info

Publication number
WO2020060003A1
WO2020060003A1 PCT/KR2019/006460 KR2019006460W WO2020060003A1 WO 2020060003 A1 WO2020060003 A1 WO 2020060003A1 KR 2019006460 W KR2019006460 W KR 2019006460W WO 2020060003 A1 WO2020060003 A1 WO 2020060003A1
Authority
WO
WIPO (PCT)
Prior art keywords
lactobacillus acidophilus
primer
seq
lactobacillus
strain
Prior art date
Application number
PCT/KR2019/006460
Other languages
English (en)
French (fr)
Inventor
남영도
정원형
임미영
이소영
박용수
강지수
김윤태
신희순
신지희
Original Assignee
한국식품연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180113928A external-priority patent/KR102444745B1/ko
Priority claimed from KR1020190040986A external-priority patent/KR102142473B1/ko
Priority claimed from KR1020190040985A external-priority patent/KR102142474B1/ko
Application filed by 한국식품연구원 filed Critical 한국식품연구원
Priority to US17/278,472 priority Critical patent/US20220154250A1/en
Priority to EP19862761.4A priority patent/EP3854888A4/en
Publication of WO2020060003A1 publication Critical patent/WO2020060003A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a composition for discriminating Lactobacillus acidophilus , more specifically, quickly and accurately.
  • Lactobacillus acidophilus a primer composition capable of specifically discriminating and identifying a species of acidophilus from the genus Lactobacillus , Lactobacillus acidophilus , a primer composition for discriminating individual strains, Lactobacillus acidophilus ( Lactobacillus acidophilus ) YT1
  • a primer composition for strain identification It also relates to a kit comprising the primer composition and a method of discrimination using the same.
  • Lactic acid bacteria or lactic acid bacteria are bacteria that break down carbohydrates into lactic acid by metabolism, and are used to ferment foods such as yogurt, lactic acid bacteria drinks, and kimchi.
  • Lactobacillus shows various effects depending on the strain, and can be divided into five genera: Streptococcus , Lactobacillus , Leuconostoc , Bifidobacteria , and Pediococcus . .
  • the microorganism of the genus Lactobacillus is a lactic acid bacterium that is homozygous or heterogeneous fermentation, and is a bacterium commonly found in the fermentation process of dairy products or vegetables. do.
  • microorganisms of the Lactobacillus acidophilus species are mainly strong in the small intestine of humans and have excellent acid resistance, and thus have the ability to withstand gastric or bile acids, lower cholesterol, improve diarrhea and constipation, and improve cotton It is actually used in various products because it has all the basic properties as probiotics and lactic acid bacteria.
  • probiotics through a wide range of studies, such as the possibility of utilization as probiotics, research on the production of useful products, growth inhibition of harmful microorganisms, mixed culture of other lactic acid bacteria and yeast bacteria, intestinal flora change, antibiotic adaptability, cholesterol magnetization, etc. Since the usefulness has been proven, more functional food additives, hygiene products, and cosmetics are expected to be developed and utilized.
  • a method for determining microorganism species developed to date is typically by analyzing 16S rRNA gene sequence information. This method has the disadvantage that some Lactobacillus acidophilus strains do not follow the criteria for determining the 16S rRNA gene sequence, and require a lot of time and labor.
  • Lactobacillus ash also kits for the filler's (Lactobacillus acidophilus) species discrimination based on the base sequence of the gene of the pillar's (Lactobacillus acidophilus), present on the NCBI It has a limitation in that detection is possible only for 95% of Lactobacillus acidophilus strain.
  • the specific gene possessed by the microorganism may undergo many variations during the evolution process, the above-described methods of targeting the specific gene have obvious limitations in detecting a number of microorganisms of the Lactobacillus acidophilus species.
  • the NGS analysis method was able to discriminate specific microbial species based on the results of the entire genome analysis of the microorganism, but it was difficult to identify the species by comparing the genome by analyzing the genomic information individually and drawing a systematic diagram between each strain. It has the big disadvantage that it takes a lot of time and labor. In addition, the method has a limitation in detecting multiple species at the same time.
  • the present inventors found that the CRISPR region is distinguished from microorganisms of other species in Lactobacillus acidophilus, which has a useful effect on the human body, and analyzes the CRISPR region to analyze Lactobacillus acidophilus ( Lactobacillus acidophilus) the species (species it can be clearly detected), specific universal primer (universal primer) composition and Lactobacillus ash is also to develop a specific primer composition capable of clearly detecting the pillar's (Lactobacillus acidophilus) the individual strains After efforts, the present invention has been completed.
  • the problem to be solved by the present invention includes a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 8 and one or more reverse primers selected from SEQ ID NOs: 9 to 16. It is to provide a primer composition for the identification of Lactobacillus acidophilus species.
  • Another problem to be solved by the present invention is to provide a primer composition for identifying individual strains of Lactobacillus acidophilus .
  • Lactobacillus acidophilus Lactobacillus acidophilus It is to provide a primer composition for YT1 strain discrimination.
  • Another problem to be solved by the present invention is to provide a kit including the primer composition.
  • Another problem to be solved by the present invention is to provide a method for discriminating Lactobacillus acidophilus species.
  • Another problem to be solved by the present invention is to provide a method for discriminating individual strains of Lactobacillus acidophilus .
  • Lactobacillus acidophilus Lactobacillus acidophilus It is to provide a method for determining the YT1 strain.
  • Another problem to be solved by the present invention is to provide a method for detecting the presence of a Lactobacillus acidophilus strain in a clinical, environmental or food sample.
  • Another problem to be solved by the present invention is to provide a method for detecting the presence of individual strains of Lactobacillus acidophilus in clinical, environmental, or food samples.
  • Lactobacillus acidophilus in clinical, environmental, or food samples. It provides a method for detecting the presence of the YT1 strain.
  • Another problem to be solved by the present invention is to detect one or more forward primers selected from SEQ ID NOs: 1 to 8 and any one or more selected from SEQ ID NOs: 9 to 16 for detecting Lactobacillus acidophilus strains. It provides the use of a primer set consisting of reverse primers.
  • the present invention includes a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 8 and one or more reverse primers selected from SEQ ID NOs: 9 to 16.
  • a primer composition for determining Lactobacillus acidophilus species is provided.
  • the forward primer further comprises at least one label selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes linked to the 5'-end. You can.
  • the present invention provides a primer composition for identifying individual strains of Lactobacillus acidophilus comprising a primer set consisting of a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16.
  • the composition may further include a primer set consisting of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15.
  • the present invention is a Lactobacillus acidophilus ( Lactobacillus acidophilus ) comprising a primer set consisting of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15
  • a primer composition for YT1 strain discrimination Provided is a primer composition for YT1 strain discrimination.
  • the present invention provides a kit comprising the primer composition.
  • the kit is Lactobacillus acidophilus according to the primer set included in the primer composition Species identification, Lactobacillus acidophilus Individual strain identification or Lactobacillus acidophilus YT1 strain can be used for identification purposes.
  • the kit may include a buffer solution, a DNA polymerase and dNTP.
  • the present invention a) using a DNA isolated from the sample to be determined as a template, a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 8 and any one or more reverse primers selected from SEQ ID NOs: 9 to 16. Obtaining a PCR product through a polymerase chain reaction (PCR); And
  • the present invention A) using a set of primers consisting of a DNA separated from the sample to be determined as a template, and a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16, polymerase chain reaction , PCR) to obtain a PCR product;
  • a set of primers consisting of a DNA separated from the sample to be determined as a template, and a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16, polymerase chain reaction , PCR
  • step A) may further include a primer set consisting of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15.
  • the present invention is a polymerase chain reaction using a primer set consisting of 1) DNA separated from the sample to be determined as a template, and a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15. , PCR) to obtain a PCR product;
  • Lactobacillus acidophilus Provides a method for discriminating YT1 strains.
  • the present invention also provides a method for detecting the presence of Lactobacillus acidophilus strain in a clinical, environmental or food sample comprising the following steps.
  • PCR polymerase chain reaction
  • the present invention provides a method for detecting individual strains of Lactobacillus acidophilus in clinical, environmental or food samples comprising the following steps.
  • PCR polymerase chain reaction
  • the step I) may further include a primer set consisting of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15.
  • the present invention provides a method for detecting Lactobacillus acidophilus YT1 strain in a clinical, environmental or food sample comprising the following steps.
  • PCR polymerase chain reaction
  • the present invention is composed of any one or more forward primers selected from SEQ ID NOs: 1 to 8 and one or more reverse primers selected from SEQ ID NOs: 9 to 16 for detecting Lactobacillus acidophilus strains. Provides the use of primer sets.
  • the composition according to the present invention is from the target sample to Lactobacillus acidophilus species
  • the microorganisms belonging can be easily, quickly, accurately identified, detected, and identified. Therefore, it can be usefully used for fermented milk, baby food, dairy products, livestock farm feed, cosmetics, health supplements, formal medicines, and raw materials using Lactobacillus acidophilus species strain.
  • composition according to the present invention can distinguish individual strains of Lactobacillus acidophilus ( Lactobacillus acidophilus ) from the target sample as well as the presence of individual strains, in particular, Lactobacillus acidophilus ( Lactobacillus acidophilus ) LA1 strain or lactose Bacillus acidophilus ( Lactobacillus acidophilus) YT1 strain can be specifically and accurately identified.
  • Example 1 is a CRISPR structure analysis results of strains (21 species) belonging to Lactobacillus acidophilus identified through Example 1.
  • Figure 3a is a Lactobacillus acidophilus ( Lactobacillus acidophilus) of the present invention
  • Primer-BLAST is the top screen of the results of sequence analysis using a sequence search program, by comparing the primer sets represented by SEQ ID NOs: 1 and 9 that can be specifically detected with the database provided from the NCBI site.
  • Figure 3b Lactobacillus acidophilus ( Lactobacillus acidophilus)
  • the primer set represented by SEQ ID NOs: 1 and 9 that can be specifically detected is compared with the database provided from the NCBI site, and Primer-BLAST is a collection of parts obtained by analyzing a sequence by a sequence search program.
  • FIG. 4 is a whole genome configuration diagram of Lactobacillus acidophilus LA1 analyzed through Example 3.
  • Figure 5a is a schematic diagram using the 16S rRNA gene of 10 strains, including Lactobacillus acidophilus LA1 identified through Example 4.
  • Figure 5b is a schematic diagram utilizing the comparison of ANI genome of 10 strains, including Lactobacillus acidophilus LA1 strain identified through Example 4.
  • Figure 6 is from among 10 strains, including Lactobacillus acidophilus LA1 identified through Example 4, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus La-14, Lactobacillus acidophilus FSI4 and Lactobacillus acidophilus LA1 It is the result of CRISPR structure analysis.
  • Figure 7 The PCR product size of each strain was illustrated through in silico when PCR was performed with a primer set capable of specifically detecting Lactobacillus acidophilus LA1 and the primer set.
  • FIG. 8 is a whole genome configuration diagram of Lactobacillus acidophilus YT1 analyzed through Example 6.
  • Figure 9a is a schematic diagram using the 16S rRNA gene of 22 types of Lactobacillus acidophilus strains, including Lactobacillus acidophilus YT1 identified through Example 7.
  • Figure 9b is a schematic diagram utilizing a comparison of ANI genome of 10 strains, including Lactobacillus acidophilus YT1 identified through Example 7.
  • pillar's (Lactobacillus acidophilus) YT1 the other 22 strains from among the reference strain Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) NCFM and Lactobacillus ash FIG pillar's (Lactobacillus Lactobacillus ash confirmed through Example 7 acidophilus) YT1 CRISPR structure analysis.
  • Figure 11 The PCR product size was illustrated through in silico analysis when PCR was performed with a primer set capable of specifically detecting Lactobacillus acidophilus YT1 and the primer set.
  • Figure 12 is in silico (in silico), Lactobacillus acidophilus of the present invention (Lactobacillus acidophilus) YT1 strain discrimination primer set (CRISPR_YT1_F, CRISPR_YT1_R) in the database of NCBI site using Primer-BLAST search results to be.
  • Lactobacillus acidophilus of the present invention Lactobacillus acidophilus
  • YT1 strain discrimination primer set CRISPR_YT1_F, CRISPR_YT1_R
  • FIG. 13 is a schematic diagram of a total of 414 16S rRNA sequences having 97% or more similarity to Lactobacillus acidophilus NCFM confirmed through Experimental Example 1). Sequences corresponding to species other than Lactobacillus acidophilus are indicated in FIG. 13 by red and upper right asterisks (*).
  • each strain Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophilus CB_LA1, Lactobacillus acidophilus CB_LA1, Lactobacillus )
  • each strain Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophilus CB_LA1, Lactobacillus acidophilus CB_LA1, Lactobacillus )
  • PCR Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophil
  • FIG. 15 is a PCR amplification product obtained by performing PCR on the Lactobacillus acidophilus YT1 strain as a representative, using the primer set represented by SEQ ID NOs: 1 and 9 of the present invention, and then agar This is the result of repeating the analysis process twice (Uni-a, Uni-b) by ros gel electrophoresis.
  • FIG 16 is by using a primer set for Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) determine LA1 strain of the present invention, each of the strains (Lactobacillus acidophilus LA1, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM ) .
  • Figure 18 shows the results of PCR analysis on each strain ( Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM ) using a primer set for L. acidophilus strain identification of the present invention , and analyzed by agarose gel electrophoresis to be.
  • 19 is a PCR amplification product obtained by performing PCR on each strain ( Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM ) using the primer set for L. acidophilus strain identification of the present invention, This is the result of analysis by agarose gel electrophoresis.
  • Figure 20 is by using a primer set for Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) determine YT1 strain of the present invention, each of the strains (Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus This is the result of PCR analysis on acidophilus LA1 and Lactobacillus acidophilus YT1 ) .
  • 21 is a PCR amplification product obtained by performing PCR on the YT1 strain using the primer set for identifying Lactobacillus acidophilus YT1 strain of the present invention, and then analyzing it by agarose gel electrophoresis As a result, this is a representative result among 10 replicates.
  • a primer is a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a complementary nucleic acid template and a base pair, and for copying a strand of a nucleic acid template.
  • the primer can initiate DNA synthesis in the presence of a reagent (i.e., DNA polymerase) for polymerization at an appropriate buffer and temperature.
  • Primer set in the present invention means a combination of primers for amplifying a specific sequence DNA, and one primer set usually includes two primers (forward primer, reverse primer or left primer, right primer), but exceeds this It may be.
  • oligonucleotides are deoxyribooligonucleotides or ribooligonucleotides that exist in single-stranded or double-stranded form, and include analogs of natural nucleotides, unless otherwise specified.
  • One aspect of the present invention comprises a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 8 and any one or more reverse primers selected from SEQ ID NOs: 9 to 16 Lactobacillus acidophilus It relates to a primer composition for species identification.
  • any one or more forward primers selected from SEQ ID NOs: 1 to 8 and any one or more reverse primers selected from SEQ ID NOs: 9 to 16 It relates to the use of a primer set consisting of.
  • the primer composition is a primer set comprising primers represented by SEQ ID NOs: 1 to 8 and SEQ ID NOs: 9 to 16 that can specifically detect strains belonging to Lactobacillus acidophilus species.
  • the primer set is preferably a primer set consisting of SEQ ID NO: 1 and 9, a primer set consisting of SEQ ID NO: 2 and 10, a primer set consisting of SEQ ID NO: 3 and 11, a primer set consisting of SEQ ID NO: 4 and 12, SEQ ID NO: 5 and It may be any one or more selected from a primer set consisting of 13, a primer set consisting of SEQ ID NOs: 6 and 14, a primer set consisting of SEQ ID NOs: 7 and 15, and a primer set consisting of SEQ ID NOs: 8 and 16.
  • the primer composition of the present invention is a strain of Lactobacillus acidophilus , even in samples mixed with Lactobacillus acidophilus species or similar strains having the same species and genus. It may include a primer set that can be specifically detected.
  • the primer composition of the present invention does not synthesize PCR products at all with respect to strains of other species except Lactobacillus acidophilus , as confirmed in the experimental examples described below, and the target Lactobacillus ash pillar's (Lactobacillus acidophilus) 'CRISPR' because region genes are synthesized PCR products and as a template only when the present, clearly from the sample Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) using the primer composition of the species present strain of the species Whether it can be specifically determined.
  • Lactobacillus acidophilus species can be specifically identified.
  • a primer composition comprising a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 9, 100 to 300 bp, preferably if a strain of Lactobacillus acidophilus species is present in the sample PCR products with a size of 267 bp are detected. Therefore, the presence or absence of Lactobacillus acidophilus species can be specifically determined through the detection of PCR products according to each primer composition and the size of PCR products. PCR products are synthesized using only the 'CRISPR' region gene of the Lactobacillus acidophilus species, which is the target of detection or diagnosis, as a template.
  • PCR 100 to 400 bp against a strain belonging to the Lactobacillus acidophilus species upon PCR detection
  • a product preferably a PCR product of 267 bp, will be detected.
  • the primer composition of the present invention can specifically discriminate a specific species (ashidophilus) from the genus Lactobacillus.
  • the primer length included in the primer composition of the present invention may be 20 to 30 bp, respectively.
  • forward primers represented by SEQ ID NOs: 1 to 8 are 24 to 26 bp
  • reverse primers represented by SEQ ID NOs: 9 to 16 May be 20 to 22 bp.
  • the target sequence may be amplified by performing an amplification reaction using a primer set including the primers.
  • Melting temperature (Tm) is 55 °C to 65 °C
  • the maximum Tm difference between primers is preferably within 3 to 5 °C
  • GC% may be 30% to 70%
  • the primer composition may be a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 6 and one or more reverse primers selected from SEQ ID NOs: 9 to 14, which are universal primer sets, All Lactobacillus acidophilus Species can be specifically identified, identified and detected.
  • the method for amplifying the target sequence includes polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. , Amplification via strand displacement amplification or Q5 replication enzymes or any other suitable method for amplifying nucleic acid molecules known in the art.
  • PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase.
  • PCR methods are well known in the art, and commercially available kits may be used.
  • the primer set including any one or more forward primers selected from SEQ ID NOs: 1 to 8 and one or more reverse primers selected from SEQ ID NOs: 9 to 16 among the primer sets have the same annealing temperature and Under one condition with time, Lactobacillus acidophilus ( Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620) did not synthesize PCR products at all, whereas Lactobacillus acidophilus species of the same dependency For, it was confirmed that the PCR product was synthesized.
  • primer sets comprising any one or more forward primers selected from SEQ ID NOS: 1-6 and any one or more reverse primers selected from SEQ ID NOS: 9-14 are all for Lactobacillus acidophilus species . It was confirmed that the same PCR product was synthesized.
  • the primer composition further comprises at least one label selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes, linked to the 5'-end or 3'-end of the forward or reverse primer. It may be.
  • the "label” or “detectable label” may mean any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, and the binding may be covalent or non-covalent.
  • the label is detectable and may be the nucleotide or nucleotide polymer that can be detected by the experimenter of the present invention.
  • Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants.
  • the detectable label can also be any useful linker molecule (e.g., biotin, avidin, streptavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni 2+ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes.
  • a detectable label may be considered to indicate a change in mass, as in the case of surface plasmon resonance detection. Those skilled in the art will readily recognize even useful detectable labels not mentioned above, and these may also be used in embodiments of the present invention.
  • Another aspect of the present invention relates to a primer composition for identifying individual strains of Lactobacillus acidophilus comprising a primer set consisting of a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16.
  • a primer set composed of a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16 determines individual strains of Lactobacillus acidophilus through the size of the PCR product. And can be distinguished, such as Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus The NCFM and Lactobacillus acidophilus LA1 strains can be specifically identified.
  • the primer composition further includes a primer set composed of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15 desirable.
  • the PCR product size obtained by performing PCR using the primer set is detected to be about 100-1000 bP, they are Lactobacillus acidophilus . Belonging to the strain of the species, in particular Lactobacillus acidophilus ( Lactobacillus acidophilus ) among the Lactobacillus acidophilus ( Lactobacillus acidophilus ) ATCC 4356, Lactobacillus acidophilus NCFM and Lactobacillus acidophilus LA1 strains, respectively, can be specifically identified.
  • Lactobacillus acidophilus ATCC 4356
  • Lactobacillus acidophilus ATCC 4356
  • the NCFM and Lactobacillus acidophilus LA1 strains can be specifically identified, and their PCR product size is detected to be about 100-1000 bP, so that Lactobacillus acidophilus strain It can be specifically determined whether or not the existence of. Lactobacillus acidophilus to be detected or diagnosed Since the PCR product is synthesized using the template as a template only when the 'CRISPR' region gene of the strain is present, only 100-1000 bp of the product is detected when detecting PCR with Lactobacillus acidophilus .
  • Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) LA1 Lactobacillus ash FIG pillar's (Lactobacillus acidophilus)
  • the PCR product size of the strains containing the strain is about 100 to 250 bp, the same in forming the strain and PCR products of the different species
  • the composition is used to specifically identify the presence of the Lactobacillus acidophilus LA1 strain Can be discerned.
  • the target for DNA amplification is "gene sequence of the CRISPR region" among the strain chromosomal sequences of the genus Lactobacillus acidophilus
  • the Lactobacillus acidophilus strain is conventionally known as Lactobacillus acidophilus.
  • the strain belonging to Lactobacillus acidophilus is not particularly limited, for example, L. acidophilus ATCC 4356, L. acidophilus NCFM, L. acidophilus La-14, L. acidophilus FSI4, and L. acidophilus LA1. It may be a strain.
  • Exemplary “gene sequences of CRISPR regions” which are targets for amplification according to the present invention are schematically disclosed in FIGS. 6 and 7 below, and exemplary nucleotides of the complete genome of Lactobacillus acidophilus LA1
  • the sequence is Genbank Accession No. NZ_CP017062
  • exemplary nucleotide sequences of the entire genome of the CRISPR region of L. acidophilus NCFM, L. acidophilus La-14, and L. acidophilus FSI4 are identified by Genbank Accession No. NC_006814.3, NC_021181.2, NZ_CP010432.1.
  • the primer set included in the composition of the present invention generally has a total primer length of 18 to 23 (optimum length 20), a melting temperature (Tm) of 57 ° C to 62 ° C, and a maximum Tm difference between primers is 5 degrees. Within, GC% is 35 to 65%.
  • primer sets comprising the forward primer represented by SEQ ID NO: 8 and the reverse primer represented by SEQ ID NO: 16 of the present invention are of the same dependency under one condition having the same annealing temperature and time.
  • Lactobacillus acidophilus strains while synthesizing PCR products of different sizes, represented by 165bp, 837bp, 898bp, 900bp, and 1000bp, respectively, belong to the same genus, but strains of different species ( Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620) was confirmed that no PCR product was synthesized at all.
  • Lactobacillus acidophilus strain of the present invention As well as lactobacillus ash through the PCR product size in the sample Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM and Lactobacillus acidophilus LA1 strains can be individually identified, and Lactobacillus acidophilus Lactobacillus It can be seen that the time and effort required to individually identify acidophilus strains can be reduced.
  • the primer set comprising the forward primer represented by SEQ ID NO: 8 and the reverse primer represented by SEQ ID NO: 16 of the present invention is Lactobacillus acidophilus (Lactobacillus acidophilus ) LA1 among Lactobacillus acidophilus PCR product size for the strain is 150 to 250 bp, and the size of the PCR product is clearly distinguished from other Lactobacillus acidophilus strains. (Lactobacillus acidophilus) The existence of the LA1 strain can be specifically determined.
  • the PCR product size of the Lactobacillus acidophilus LA1 strain is about 150 to 250 bp, preferably 150 to 200 bp, and has a significant difference in PCR product size from other strains of the same species, Lactobacillus acidophilus LA1 strain can be specifically detected, classified and discriminated by analyzing the PCR product size using the composition, so that Lactobacillus acidophilus LA1 strain is present in the sample It can be seen that the time and effort required to determine whether or not can be saved.
  • the forward primer or reverse primer may be further comprising one or more labels selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes connected to the 5'-end or 3'-end of the primer. have.
  • the "lable” or “detectable label” can mean any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, and the binding can be covalent or non-covalent.
  • the label is detectable and may be the nucleotide or nucleotide polymer that can be detected by the experimenter of the present invention.
  • Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants.
  • the detectable label can also be any useful linker molecule (e.g., biotin, avidin, streptavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni 2+ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes.
  • a detectable label may be considered to indicate a change in mass, as in the case of surface plasmon resonance detection.
  • Lactobacillus acidophilus comprising a primer set consisting of a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15 YT1 It relates to a primer composition for strain identification.
  • the Lactobacillus acidophilus YT1 strain has a genomic structural property in which the CRISPR region is divided into two. remind The strains of all known Lactobacillus acidophilus species except Lactobacillus acidophilus YT1 have one CRISPR region. Through these differences, the known Lactobacillus acidophilus ( Lactobacillus acidophilus ) Sequences at completely different positions with differences from the strains were identified, and a specific primer set capable of amplifying them was designed, and accordingly, clear differences were also confirmed in the amplified length.
  • the primer composition comprising the primer set is a Lactobacillus acidophilus ( Lactobacillus acidophilus ) YT1 strain similar to, or even in a sample mixed with similar strains having the same species and genus, Lactobacillus ash A strain of Lactobacillus acidophilus YT1 can be specifically detected.
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus ash FIG filler's Lactobacillus acidophilus
  • No PCR products are synthesized at all for the strain, and Lactobacillus acidophilus is a target. Since the PCR product is synthesized using the template as a template only when the 'CRISPR' region gene of the YT1 strain is present, the composition is used to specifically identify the presence or absence of the Lactobacillus acidophilus YT1 strain. can do.
  • the primer set (SEQ ID NOs: 7 and 15), Lactobacillus acidophilus ( Lactobacillus acidophilus ) YT1 strain can be specifically identified, PCR product size is 300 to 350 bp, preferably detected to be 320 bp Through the Lactobacillus acidophilus ( Lactobacillus acidophilus ) YT1 strain can be specifically identified as present. Lactobacillus acidophilus to be detected or diagnosed Since the PCR product is synthesized as a template only when the 'CRISPR' region gene of the YT1 strain is present, only Lactobacillus acidophilus YT1 strain is 300 to 350 bp, preferably 320 bp when detecting PCR. Will be detected.
  • the Lactobacillus acidophilus YT1 strain (Accession No. KCCM11808P), which is a target of the composition of the present invention, is a strain known from Patent Publication No. 10-2018-0052569, in a menopausal animal model in which ovaries have been removed. It is a strain showing the greatest difference among microorganisms with a reduced distribution, and is a strain confirmed to have a depression prevention or treatment effect in menopausal women when administered to the menopausal animal model.
  • nucleotide sequence of the CRISPR region which is a target for amplification according to the present invention is schematically disclosed in FIGS. 10 and 11 below, and exemplary nucleotides of the complete genome of Lactobacillus acidophilus YT1
  • the sequence is Genbank Accession No. CP025200.1.
  • the entire genomic nucleotide sequence of the CRISPR region of Lactobacillus acidophilus NCFM among the strains used as a comparative group for analyzing the specificity of the composition of the present invention was Genbank Accession No. It can be checked in NC_006814.3. Other strains for comparison can also confirm the entire genomic nucleotide sequence through Genbank Accession.
  • the optimum length of all primers in the primer set included in the composition of the present invention is 20 bp, the melting temperature (Tm) is 60 ° C, the maximum Tm difference between primers is within 5 ° C, and the GC% is 50%. .
  • primer sets comprising the forward primer represented by SEQ ID NO: 7 and the reverse primer represented by SEQ ID NO: 15 of the present invention have the same dependency under one condition having the same annealing temperature and time. Lactobacillus acidophilus PCR products were not synthesized at all for the strains, and it was confirmed that PCR products were synthesized at 320 bp only in the Lactobacillus acidophilus YT1 strain.
  • the primer composition further comprises at least one label selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes, linked to the 5'-end or 3'-end of the forward or reverse primer. It may be.
  • the "label” or “detectable label” may mean any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, and the binding may be covalent or non-covalent.
  • the label is detectable and may be the nucleotide or nucleotide polymer that can be detected by the experimenter of the present invention.
  • Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants.
  • the detectable label can also be any useful linker molecule (e.g., biotin, avidin, streptavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni 2+ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes.
  • a detectable label may be considered to indicate a change in mass, as in the case of surface plasmon resonance detection. Those skilled in the art will readily recognize even useful detectable labels not mentioned above, and these may also be used in embodiments of the present invention.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) containing the primer composition It relates to a species discrimination kit.
  • the kit is Lactobacillus acidophilus according to the primer set included in the primer composition Species identification, Lactobacillus acidophilus Individual strain identification or Lactobacillus acidophilus Lactobacillus acidophilus YT1 strain can be used for identification purposes.
  • the kit may further include a reagent for performing an amplification reaction, and may include, for example, a buffer solution, DNA polymerase, dNTP and distilled water, which are commonly used in the art, such as solutions, enzymes, etc. Can be used without limitation.
  • the kit may be manufactured in a number of separate packaging or compartments containing the reagent component.
  • the buffer solution is a compound that is added to an amplification reaction to modulate the amplification reaction, thereby modifying stability, activity, and / or lifespan of one or more elements of the amplification reaction.
  • the buffer solution of the present invention is compatible with PCR amplification and RNase H cleavage activity.
  • the buffer solution is HEPES (4- (2-hydroxyethyl) -1-piperazinethanesulfonic acid), MOPS (3- (N-morpholino) propanesulfonic acid) (3- (N-morpholino) -propane Sulfonic acid) and acetate or phosphate buffers, and the like.
  • the PCR buffer solution may generally include about 70 mM or less of KCl and about 1.5 mM or more of MgCl 2 , about 50-200 uM of each dATP, dCTP, dGTP, and dTTP.
  • the buffers of the present invention may contain additives to optimize efficient reverse transcriptase-PCR or PCR reactions.
  • additives affect inactivation of contaminated enzymes, stabilization of protein folding, and / or reduction of aggregation.
  • additives that may be included in the amplification reaction are betaine, formamide, KCl, CaCl 2 , MgOAc, MgCl 2 , NaCl, NH 4 OAc, NaI, Na (CO 3 ) 2 , LiCl, MnOAc, NMP, trehalose, demi Ethyl sulfoxide (DMSO), glycerol, ethylene glycol, dithiothreitol (DTT), pyrophosphatase (Inorganic pyrophosphatase (TAP), but not limited to), serum serum albumin (BSA) ), Propylene glycol, Glycineamide, CHES, Percoll, Aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100,
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • a primer set forward primer and reverse primer or Left primer and Right primer
  • Lactobacillus ash Philus Lactobacillus acidophilus
  • a method has been developed to accurately detect the presence or absence of a species or to accurately and quickly specify a strain of any strain, as well as to distinguish and distinguish the exact strain for a specific strain.
  • a primer set consisting of at least one forward primer selected from SEQ ID NOs: 1 to 8 and at least one reverse primer selected from SEQ ID NOs: 9 to 16 amplifies the CRISPR chromosome of Lactobacillus acidophilus , Particularly, a primer set consisting of any one or more forward primers selected from SEQ ID NOs: 1 to 6 and one or more reverse primers selected from SEQ ID NOs: 9 to 14 is selected from Lactobacillus acidophilus among chromosomes of the amplified CRISPR region. ) Lactobacillus acidophilus using primers that amplify one or more regions selected from the regions of spacer 1 to spacer 5 possessed by all strains of the species. Species can be identified universally.
  • Lactobacillus acidophilus The strain of the species was found to have a PCR product size of 100 to 400 bp, preferably 267 bp, which was amplified with a primer set Lactobacillus acidophilus Since the PCR product for the CRISPR section of the species strain (spacer 1 to 5) 223 bp and the primer set sequences (44 bp) of SEQ ID NOs: 1 and 9 are measured by combining, lactose if it belongs to the PCR product size 267 bp during PCR analysis Bacillus ashophilus ( Lactobacillus acidophilus ) It can be identified as a strain belonging to the species.
  • the primer composition does not generate PCR products in other strains and all Lactobacillus acidophilus PCR products are generated only for the strains belonging to the species (e.g., 200 to 300 bp in the case of the primer compositions of SEQ ID NOs: 1 and 9, and specifically, PCR products of 267 bp), so that they are clearly and clearly distinguished without verification through sequencing of PCR products can do.
  • the present inventors have the sequence length of Lactobacillus acidophilus LA1 strain among chromosomes in the CRISPR region, unlike other strains in the prior art, and thus have 165 bp (150 bp + 8 bp primer and 7 bp dicer). As a result, it was confirmed that the Lactobacillus acidophilus LA1 strain can be identified using this.
  • a primer set consisting of SEQ ID NO: 8 and SEQ ID NO: 16 for PCR analysis is selected from Lactobacillus acidophilus species through the size of the generated PCR product ( Lactobacillus acidophilus) .
  • Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, and Lactobacillus acidophilus LA1 strains were identified.
  • Lactobacillus acidophilus YT1 When a primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 15 is combined, Lactobacillus acidophilus YT1 can be distinguished.
  • the PCR product when using a primer set consisting of SEQ ID NO: 8 and SEQ ID NO: 16, when the PCR product has a size of about 150 to 200 bp, it can be identified and discriminated with Lactobacillus acidophilus LA1 strain.
  • the PCR product for the CRISPR section of the Lactobacillus acidophilus LA1 strain amplified with a primer set (150bp + 8bp primer and 7bp dicer) and primer sets of SEQ ID NOs: 8 and 16 Since the sequence (40 bp) was measured by combining, it can be identified as a Lactobacillus acidophilus LA1 strain if it belongs to the PCR product size 150 to 250 bp during PCR analysis.
  • the Lactobacillus acidophilus LA1 strain has a PCR product size of 800 to 1500 bp, preferably 800 to 1000 bp, so it is clear and distinct. Can be distinguished.
  • Lactobacillus acidophilus YT1 strain has 320 bp among chromosomes of the amplified CRISPR region, and as a result, Lactobacillus acidophilus was used.
  • a primer set of SEQ ID NO: 7 and SEQ ID NO: 15 capable of discriminating the YT1 strain was developed, and the PCR product 165 bp (for the CRISPR section of the Lactobacillus acidophilus YT1 strain amplified with the primer set ) 150bp + 8bp primer and 7bp dicer) and the primer set sequences of SEQ ID NOs: 7 and 15 (40 bp) were measured by combining, so if the PCR analysis belongs to the PCR product size 320 bp, Lactobacillus acidophilus ( Lactobacillus acidophilus) YT1 strain.
  • Other Lactobacillus acidophilus strains are clearly and clearly distinguishable by not producing PCR products, unlike the Lactobacillus acid
  • Another aspect of the present invention using the primer composition comprising the following steps Lactobacillus acidophilus ( Lactobacillus acidophilus ) It relates to a method for discriminating species.
  • PCR polymerase chain reaction
  • another aspect of the present invention relates to a method for detecting the presence of a Lactobacillus acidophilus strain in a clinical, environmental, or food sample, and may include the following steps.
  • PCR polymerase chain reaction
  • PCR enzyme chain reaction
  • the method of separating DNA from the sample may use a method known in the art, but the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the sample to be determined is Lactobacillus acidophilus It may include a variety of samples to detect the presence or absence of a strain belonging to a species, preferably a clinical, environmental or food sample.
  • PCR polymerase chain reaction
  • NASBA nucleic acid sequence-based amplification
  • LCR ligase chain reaction
  • RCA rolling circle amplification
  • PCR polymerase chain reaction
  • the PCR may be real-time PCR, qRT-PCR or RT-PCR, but is not limited thereto.
  • polymerase chain reaction polymerase chain reaction
  • PCR generally refers to a method for amplifying a desired target sequence in vitro (in vitro), which is a process commonly used in the art It is not particularly limited.
  • the PCR process consists of adding an oligonucleotide primer complementary to the opposite strand of the double-stranded target sequence to a reaction mixture containing the desired target sequence (s) in an excess of 2 times the molar concentration.
  • the reaction mixture is applied to a thermal cycling program in the presence of DNA polymerase to amplify the desired target sequence between the DNA primer sets.
  • PCR product obtained through the above process is also called a "PCR fragment” or “reverse transcriptase-PCR fragment” or “amplicon”, and is used for amplification of a specific target nucleic acid. It means a polynucleotide molecule (or collectively a large number of molecules) produced accordingly.
  • PCR fragments generally mean, but are not limited to, DNA PCR fragments.
  • the PCR fragment can be single stranded or double stranded, or a mixture thereof according to any concentration ratio.
  • the PCR fragment or reverse transcriptase-PCR fragment may be 100-500 nucleotides or more.
  • Lactobacillus acidophilus Species presence can be identified and discriminated.
  • the PCR product size is 100 to 400 bp, preferably 260 to 280 bp, most preferably identified as 267 bp).
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus acidophilus Accumulate information on PCR products that are specific to a species, and specifically Lactobacillus acidophilus Species can be accurately and quickly identified and analyzed with high reliability.
  • Lactobacillus acidophilus in the sample If a strain belonging to the species is present, when using the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 9, the PCR product of 267 bp is used, and when the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 10 are used, 208 When the PCR product of bp uses the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 11, the PCR product of 147 bp is used, and when the forward primer of SEQ ID NO: 4 and the reverse primer of SEQ ID NO: 12 are used, the PCR product of 207 bp When the PCR product uses the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 13, the PCR product of 148 bp, and when the forward primer of SEQ ID NO: 6 and the reverse primer of SEQ ID NO: 14 are used, the PCR product of 146 bp This is observed.
  • a PCR product of 300 to 350 bp, preferably 320 bp, is observed, through which Lactobacillus acidophilus species belong.
  • the existence of the strain can be determined, or in particular, the presence or absence of the Lactobacillus acidophilus YT1 strain can be detected or determined.
  • a PCR product of 150 to 200 bp is observed, in this case, also a filler's (Lactobacillus Lactobacillus ash in the sample Among the acidophilus) strains, it can be clearly determined that Lactobacillus acidophilus LA1 strain is present.
  • polymerase chain reaction using a primer set consisting of a DNA separated from the sample to be determined as a template, a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16 obtaining a PCR product through chain reaction (PCR);
  • B) identifying the presence of the PCR product relates to a method for determining individual strains of Lactobacillus acidophilus ( Lactobacillus acidophilus ).
  • a primer set consisting of a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16 to perform a polymerase chain reaction (PCR); And II) confirming whether a PCR product is formed; and a method for detecting individual strains of Lactobacillus acidophilus in a clinical, environmental or food sample.
  • PCR polymerase chain reaction
  • A) DNA separated from the sample to be determined is used as a template, and a polymerase chain reaction (PCR) is performed using the composition to obtain a PCR product.
  • PCR polymerase chain reaction
  • the method of separating DNA from the sample may use a method known in the art, but the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the sample to be discriminated is intended to detect individual strains of Lactobacillus acidophilus or Lactobacillus acidophilus It may include a variety of samples to detect the presence or absence of the LA1 strain, preferably a clinical, environmental or food sample.
  • PCR polymerase chain reaction
  • NASBA nucleic acid sequence-based amplification
  • LCR ligase chain reaction
  • RCA rolling circle amplification
  • PCR polymerase chain reaction
  • the PCR may be real-time PCR, qRT-PCR or RT-PCR, but is not limited thereto.
  • polymerase chain reaction polymerase chain reaction
  • PCR generally refers to a method for amplifying a desired target sequence in vitro (in vitro), which is a process commonly used in the art It is not particularly limited.
  • the PCR process consists of adding an oligonucleotide primer complementary to the opposite strand of the double-stranded target sequence to a reaction mixture containing the desired target sequence (s) in an excess of 2 times the molar concentration.
  • the reaction mixture is applied to a thermal cycling program in the presence of DNA polymerase to amplify the desired target sequence between the DNA primer sets.
  • PCR product obtained through the above process is also called a "PCR fragment” or “reverse transcriptase-PCR fragment” or “amplicon”, and is used for amplification of a specific target nucleic acid. It means a polynucleotide molecule (or collectively a large number of molecules) produced accordingly.
  • PCR fragments generally mean, but are not limited to, DNA PCR fragments.
  • the PCR fragment can be single stranded or double stranded, or a mixture thereof according to any concentration ratio.
  • the PCR fragment or reverse transcriptase-PCR fragment may be 100-500 nucleotides or more.
  • Lactobacillus acidophilus strain is preferably Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus Lactobacillus acidophilus It can be a LA1 strain.
  • Lactobacillus acidophilus strain by analyzing the presence or absence of amplified PCR products, Lactobacillus acidophilus strain can be detected or determined. Furthermore, in the present invention, individual fragments of Lactobacillus acidophilus can be identified by analyzing gene fragments of amplified PCR products or by analyzing the size of the amplified products. Specifically, under one condition having the same annealing temperature and time, Lactobacillus acidophilus strains of the same dependency are synthesized with PCR products of different sizes, represented by 165bp, 837bp, 898bp, 900bp, and 1000bp, respectively. , Through this, it is possible to identify and discriminate individual strains of Lactobacillus acidophilus present in the sample.
  • Lactobacillus acidophilus LA1 stored information about the PCR product ever appear specifically to strain, and Lactobacillus acidophilus LA1 strain and strains of the same genus and species, based on the accumulated information, By comparing the gene information of, Lactobacillus acidophilus LA1 strain can be accurately and quickly discriminated and analyzed with high reliability.
  • the Lactobacillus acidophilus strain LA1 exists among Lactobacillus acidophilus strain in a sample it can be clearly discriminated.
  • Another aspect of the present invention is a polymerase chain reaction (polymerase) using a primer set consisting of a DNA isolated from a sample to be determined as a template, a forward primer represented by SEQ ID NO: 7 and a reverse primer represented by SEQ ID NO: 15 obtaining a PCR product through chain reaction (PCR); And 2) confirming the presence of the PCR product; Lactobacillus acidophilus comprising It relates to a method for determining the YT1 strain.
  • the present invention comprises: a) performing a polymerase chain reaction (PCR) using a primer set comprising a forward primer represented by SEQ ID NO: 8 and a reverse primer represented by SEQ ID NO: 16; And (b) confirming whether or not the PCR product is formed. It relates to a method for detecting Lactobacillus acidophilus YT1 strain in a clinical, environmental, or food sample.
  • PCR polymerase chain reaction
  • DNA separated from the sample to be discriminated is used as a template, and a polymerase chain reaction (PCR) is performed using the composition to obtain a PCR product.
  • PCR polymerase chain reaction
  • the method of separating DNA from the sample may use a method known in the art, but the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / chloroform (Phenol / Chloroform) extraction method, and more preferably, may be an alkaline extraction method.
  • the sample to be determined is Lactobacillus acidophilus It may include various samples to detect the presence or absence of the YT1 strain.
  • PCR polymerase chain reaction
  • NASBA nucleic acid sequence-based amplification
  • LCR ligase chain reaction
  • RCA rolling circle amplification
  • PCR polymerase chain reaction
  • the PCR may be real-time PCR, qRT-PCR or RT-PCR, but is not limited thereto.
  • polymerase chain reaction polymerase chain reaction
  • PCR generally refers to a method for amplifying a desired target sequence in vitro (in vitro), which is a process commonly used in the art It is not particularly limited.
  • the PCR process consists of adding an oligonucleotide primer complementary to the opposite strand of the double-stranded target sequence to a reaction mixture containing the desired target sequence (s) in an excess of 2 times the molar concentration.
  • the reaction mixture is applied to a thermal cycling program in the presence of DNA polymerase to amplify the desired target sequence between the DNA primer sets.
  • PCR product obtained through the above process is also called a "PCR fragment” or “reverse transcriptase-PCR fragment” or “amplicon”, and is used for amplification of a specific target nucleic acid. It means a polynucleotide molecule (or collectively a large number of molecules) produced accordingly.
  • PCR fragments generally mean, but are not limited to, DNA PCR fragments.
  • the PCR fragment can be single stranded or double stranded, or a mixture thereof according to any concentration ratio.
  • the PCR fragment or reverse transcriptase-PCR fragment may be 100-500 nucleotides or more.
  • the nucleotide sequence of the PCR product may be analyzed, or the size of the amplified product may be confirmed to be performed 300 to 350 bp, preferably 320 bp.
  • the presence or absence of amplified PCR products can be analyzed to detect or discriminate Lactobacillus acidophilus YT1 strain. Furthermore, in the present invention, the gene fragment of the amplified PCR product is analyzed to accurately identify the Lactobacillus acidophilus YT1 strain.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) accumulates information on PCR products that are specific to the YT1 strain, and based on the accumulated information, Lactobacillus acidophilus ( Lactobacillus acidophilus ) of the same species as the strain
  • Lactobacillus acidophilus YT1 strain can be accurately and quickly identified and analyzed with high reliability.
  • the PCR product is 300 to 350 bp, preferably 320 bp, Lactobacillus acidophilus in the sample Among the strains, it can be clearly identified that the Lactobacillus acidophilus YT1 strain is present.
  • Example 1 Lactobacillus acidophilus ( Lactobacillus acidophilus) CRISPR structural analysis and primer set design.
  • the genomes of 21 strains belonging to the Lactobacillus acidophilus species with known genomic information were compared and analyzed. Specifically, the 21 strains are as follows (in order to omit repeated descriptions, the Korean language will be omitted from the strain description below): L. acidophilus YT1, L. acidophilus NCFM (GCA 000011985.1), L. acidophilus ATCC 4796 (GCA 000159715.1), L. acidophilus La-14 (GCA 000389675.2), L. acidophilus DSM 20242 (GCA 000442825.1), L. acidophilus CIRM-BIA 442 (GCA 000442865.1), L. acidophilus DSM 9126 (GCA 000469745.1), L.
  • L. acidophilus YT1 L. acidophilus NCFM
  • L. acidophilus ATCC 4796 (GCA 000159715.1)
  • L. acidophilus La-14 (GCA 000389675.2)
  • L. acidophilus DSM 20242 (
  • the genome of these 21 strains was obtained from the NCBI Genome site (https://www.ncbi.nlm.nih.gov/genome/genomes/1099). From the genomic information of each strain, the CRISPR region where evolutionary history is known was analyzed through CRISPRCasFinder (version 1.0), and the CRISPR composition of each strain was compared to sequence positions shared by all Lactobacillus acidophilus. Was confirmed.
  • Example 1 is a CRISPR structure analysis results of strains (21 species) belonging to Lactobacillus acidophilus identified through Example 1.
  • strains belonging to 21 Lactobacillus acidophilus species commonly include the spacers 1 to 5 regions.
  • a marker primer set
  • the primer set design represented by SEQ ID NOs: 1 and 9 among the primer sets and the PCR amplification product size obtained through the primer set design are shown in FIG. 2. 2 in more detail All Lactobacillus acidophilus ( Lactobacillus acidophilus) When PCR was performed with the primer set represented by SEQ ID NOs: 1 and 9 that can be specifically detected and the primer set, the PCR product size of the corresponding strain analyzed through in silico analysis was illustrated.
  • the primer set includes a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 9, as shown in FIG. 2.
  • a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 9, as shown in FIG. 2.
  • SEQ ID NO: 1 a forward primer represented by SEQ ID NO: 1
  • a reverse primer represented by SEQ ID NO: 9 as shown in FIG. 2.
  • FIG. 2 by developing a primer containing spacers common to strains belonging to Lactobacillus acidophilus species in the first CRISPR region, Lactobacillus acidophilus ( Lactobacillus acidophilus)
  • a marker capable of specifically detecting the strain belonging to the species was produced.
  • 24 bp from the 10th position in the spacer region of Lactobacillus acidophilus 1 was prepared as a left primer
  • 20 bp from the 20th position in the spacer region of 5 was used as a right primer.
  • all lactobacillus were produced. It
  • the length of the PCR product was analyzed using in silico modeling, and the results are shown in the lower part of FIG. 3. Did. As a result of analysis, the length of PCR products of strains belonging to Lactobacillus acidophilus species was confirmed to be 267 bp.
  • the sample belongs to Lactobacillus acidophilus species
  • the presence or absence of the strain can be detected.
  • the primer set may have the same or different primer lengths, and specifically, the forward primer represented by SEQ ID NO: 1 may be 24 bp, and the reverse primer represented by SEQ ID NO: 9 may be 20 bp.
  • the primer was designed to have a melting temperature (Tm) of 57 ° C to 63 ° C, preferably 60 ° C, and the maximum Tm difference between primers was limited to within 3 to 5 ° C.
  • GC% was designed to be 50% to 37.5%.
  • the primer set composition designed through the present invention has no strain that can be amplified other than the strain belonging to Lactobacillus acidophilus among the sequences registered in NCBI Was confirmed.
  • Figure 3 is in silico (in silico), Lactobacillus acidophilus ( Lactobacillus acidophilus) of the present invention
  • Primer-BLAST is a result of sequence analysis using a sequence search program by comparing the primer sets represented by SEQ ID NOs: 1 and 9 that can be specifically detected with a database provided from the NCBI site.
  • FIG. 3A is a top screen of the program
  • FIG. 3B is a view showing a specific program analysis result part.
  • Lactobacillus (ash) were also cultured for the filler's (Lactobacillus acidophilus) for the translation of the genome LA1 strain, Lactobacillus ash Figure 37 °C the pillar's (Lactobacillus acidophilus) LA1 strain in MRS broth (Difco, 288110), 18 hours.
  • Lactobacillus acidophilus (Lactobacillus acidophilus) Securing the genome of the LA1 strain
  • each sequence read was assembled using HGAP 3.0, and the location of dnaA, a chromosomal replication initiation gene, was confirmed to determine the starting point of the entire genome during the process.
  • NCBI Prokaryotic Genome Annotation Pipeline was used to confirm the function of a gene present on the Lactobacillus acidophilus LA1 genome.
  • Lactobacillus acidophilus LA1 genome and 9 similar strains of the same genus were analyzed. Specifically, the nine strains are as follows. L. acidophilus assembly accession (GCF_000011985.1), L. acidophilus La-14 (GCF_000389675.2), L. acidophilus FSI4 (GCF_000934625.1), L. gallinarum HFD4 (GCF_001314245.2), L. helveticus CNRZ32 ( GCF_000422165.1), L. crispatus ST1 (GCF_000091765.1), L. kefiranofaciens ZW3 (GCF_000214785.1), L.
  • amylovorus GRL1118 (GCF_000194115.1), L. acetotolerans NBRC 13120 (GCF_001042405.1).
  • GCF_001042405.1 L. acetotolerans NBRC 13120
  • a molecular phylogenetic tree was prepared in the maximum likelihood method based on the Tamura-Nei model, and the genome was compared after the genome was compared using the Orthologous average nucleotide identity (OrthoANI) to analyze the similarity of the entire genome
  • OrthoANI Orthologous average nucleotide identity
  • the CRISPR region where phage infection information is known was analyzed through a CRISPR finder, and the CRISPR configuration of each strain was compared.
  • Figure 4 is a whole genome composition diagram of Lactobacillus acidophilus LA1 analyzed through Example 3, looking at this, Lactobacillus acidophilus LA1 genomic analysis result, the entire genome of LA1 is 1.99 -Mbp circular chromosome (34.7% G + C content), 1,953 genes, 76 RNA genes and 33 psedo genes.
  • Figure 5a is a schematic diagram using the 16S rRNA gene of 10 strains including Lactobacillus acidophilus LA1 confirmed through Example 4
  • Figure 5b is a Lactobacillus acidophilus confirmed through Example 4 (Lactobacillus acidophilus) This is a systematic diagram using ANI genome comparison of 10 strains including LA1.
  • Lactobacillus acidophilus LA1 As shown in FIG. 5, a flexible relationship between 10 strains including Lactobacillus acidophilus LA1 was confirmed through a molecular system using 16S rRNA gene and OrthoANI. Specifically, the four strains belonging to Lactobacillus acidophilus ( L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4, and L. acidophilus LA1) are very rarely able to confirm the difference between each strain. It was similar.
  • Figure 6 is a CRISPR structure of L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 and L. acidophilus LA1 among 10 strains including Lactobacillus acidophilus LA1 identified through Example 4 It is an analysis result. Specifically, FIG. 6 is a result of separately analyzing only the CRISPR region among all genomic information of L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4, and L. acidophilus LA1 analyzed from Example 4.
  • Figure 7 shows the PCR product size of each strain through in silico analysis when PCR was performed with a primer set capable of specifically detecting L. acidophilus LA1 and the primer set.
  • the L. acidophilus strain has a CRISPR region, unlike other strains, so that it can be specifically identified.
  • the L. acidophilus LA1 strain unlike other strains, is characterized by the fact that the base sequence of the CRISPR 6 ⁇ 17 region is lost, and thus it was confirmed that the L. acidophilus LA1 strain can be clearly distinguished through these characteristics.
  • a marker capable of specifically detecting the L. acidophilus strain preferably the L. acidophilu s LA1 strain, was prepared.
  • L. acidophilus NCFM, Lacidophilus La-14, and L. acidophilus FSI4 were used to prepare a left primer in spacer 6, and a right primer in spacer 20, through which L. acidophilus LA1 strain of the present invention was produced. It can be seen that it can be clearly distinguished.
  • PCR is performed on each strain to obtain a PCR product, and the length of the PCR product is analyzed using in silico modeling, and the results are shown in FIG. 7. It was written at the bottom.
  • L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 and other L. acidophilus strains confirmed that the PCR product length was about 898 bp (883 bp + 8 bp primer and 7 bp dicer), and L. acidophilus
  • the length of the PCR product of LA1 was confirmed to be 165 bp (150 bp + 8 bp primer and 7 bp dicer).
  • L. acidophilus LA1 can be clearly distinguished among the L. acidophilus strains.
  • the primer set for discrimination of L. acidophilus strain of the present invention was compared with a database provided from the NCBI site, and the sequence was analyzed by a sequence search program called BLASTN.
  • the primer was designed to have 18 to 23 (optimum length 20).
  • the primer was designed to have a melting temperature (Tm) of 57 ° C to 62 ° C, preferably 59 ° C, and the maximum Tm difference between primers was limited to within 5 degrees.
  • the primer was designed to have a GC% of 35 to 65%, preferably 50%.
  • primer set compositions of SEQ ID NOs: 8 and 16 thus produced have specificity against the L. acidophilus strain, particularly L. acidophilus LA1, was analyzed through in silico analysis and sequence match on the existing NCBI DB. (Tables 2 to 9), it was confirmed that the primer set composition designed through the present invention selectively amplifies only Lactobacillus acidophilus species. Furthermore, among the strains of the detected Lactobacillus acidophilus species, it was confirmed that the PCR product was smaller than 720 bp in the case of LA1, through which it was confirmed that the LA1 strain can be clearly and accurately identified.
  • Lactobacillus acidophilus Lactobacillus acidophilus YT1 strain culture
  • Lactobacillus ash is also used to scan the filler (Lactobacillus acidophilus) for YT1 genomic transcription of strain
  • Patent Laid-Open Publication No. 10-2018-0052569 also a Lactobacillus ash filler's (Lactobacillus acidophilus) YT1 strain known in the No. (Accession No. KCCM11808P) Incubated with MRS medium (Difco, 288110) at 37 ° C. for 18 hours.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) Securing the genome of the YT1 strain
  • each sequence read was assembled using HGAP 3.0, and the location of dnaA, a chromosomal replication initiation gene, was confirmed to determine the starting point of the entire genome during the process.
  • NCBI Prokaryotic Genome Annotation Pipeline was used to confirm the function of a gene present on the Lactobacillus acidophilus YT1 genome.
  • the genomes of Lactobacillus acidophilus YT1 genome and 21 strains belonging to the same species were compared and analyzed.
  • the 21 strains are as follows. L. acidophilus NCFM (GCA 000011985.1), L. acidophilus ATCC 4796 (GCA 000159715.1), L. acidophilus La-14 (GCA 000389675.2), L. acidophilus DSM 20242 (GCA 000442825.1), L. acidophilus CIRM-BIA 442 (GCA 000442865.1 ), L. acidophilus CIP 76.13 (GCA 000469705.1), L. acidophilus DSM 9126 (GCA 000469745.1), L.
  • the Lactobacillus ash also utilize the 16S rRNA gene information of the filler's 22 strains (Lactobacillus acidophilus) Lactobacillus ash
  • FIG pillar's (L actobacillus acidophilus) including YT1 was prepared a molecular flow diagram with maximum likelihood methods based on the Tamura-Nei model .
  • 16S rRNA of Lactobacillus helveticus CAUH18 was used as the out group of the molecular diagram.
  • the range of 18 to 784 was calculated based on the NCFM 16S rRNA sequence considering some genomes that did not have a full length 16S rRNA.
  • the CRISPR region where phage infection information is known was analyzed through a CRISPR finder, and the CRISPR configuration of each strain was compared.
  • FIG. 8 is Lactobacillus acidophilus analyzed through Example 6. Overall genome composition diagram of YT1, looking at it, Lactobacillus acidophilus As a result of YT1 genome analysis, it was confirmed that the entire genome of YT1 was 2.09-Mbp circular chromosome (34.7% G + C content), has 1,913 functional genes, 83 RNA genes, and 93 pseudo genes.
  • Figure 9a is a Lactobacillus acidophilus ( Lactobacillus acidophilus ) confirmed through Example 7
  • FIG. 9B is Lactobacillus acidophilus identified through Example 7. This is a system diagram using ANI genome comparison of 22 strains including YT1.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) through a molecular system using 16S rRNA gene and ANI
  • a flexible relationship between 22 strains including YT1 was confirmed. Specifically, all of the 21 species except YT1 belonging to Lactobacillus acidophilus were very similar to each other, so that the difference between the strains was almost impossible to confirm. Since YT1 has a similarity of 99.5% or less based on ANI compared to other species, it was confirmed that there is a slight difference in the entire genome from the known L. acidophilus species.
  • Example 10 is a CRISPR structure analysis result of L. acidophilus NCFM and L. acidophilus YT1 among 22 strains including Lactobacillus acidophilus YT1 identified through Example 7.
  • FIG. 10 is a result of separately analyzing only the CRISPR region among the entire genome information of L. acidophilus NCFM and L. acidophilus YT1 analyzed from Example 7.
  • the L. acidophilus YT1 strain consists of two CRISPR regions, and only a part of the CRISPR overlaps with other strains, and a new sequence not reported by the existing strains exists in the CRISPR. Through these characteristics, it was confirmed that the L. acidophilus YT1 strain can be clearly distinguished.
  • FIG. 11 shows the PCR product size of the corresponding strain through in silico analysis when PCR was performed with a primer set capable of specifically detecting L. acidophilus YT1 and the primer set.
  • a marker capable of specifically detecting the L. acidophilu s YT1 strain was prepared. Specifically, a 20 bp left primer from the 6th nucleotide to the 25th nucleotide in the spacer region of L. acidophilus YT1 5 was produced, and a 20 bp right primer from the 1st nucleotide to the 20th nucleotide in the spacer region d was produced. It can be seen that the L. acidophilus YT1 strain of the present invention can be clearly distinguished.
  • the length of the PCR product was analyzed using in silico modeling, and the results are shown in the lower part of FIG. 11. Did.
  • the length of the PCR product of L. acidophilus YT1 was 320 bp (32 bp 4 spacers (spacer a, a, b, c), 28 bp dicer 5 (DP5), and spacer 5 left primer 27 bp, 20 bp including the right primer of spacer d).
  • the primer was designed to have 18 to 23 (optimum length 20).
  • the primer was designed to have a melting temperature (Tm) of 57 ° C to 62 ° C, preferably 60 ° C, and the maximum Tm difference between primers was limited to within 5 degrees.
  • the primer was designed to have a GC% of 35 to 65%, preferably 50%.
  • primer set compositions of SEQ ID NOs: 7 and 15 thus produced have specificity for L. acidophilus YT1 was analyzed by in silico analysis and sequence match on the existing NCBI DB. It was confirmed that the primer set composition designed through the present invention had no amplifiable strain among sequences registered in NCBI.
  • Figure 12 is in silico (in silico), the L. acidophilus YT1 strain set of the present invention is compared with the database provided from the NCBI site, the results of sequence analysis with the Primer-BLAST sequence search program. Specifically, access to the Primer-BLAST web service and specify CP025200.1 as the PCR Template, 557,700 ⁇ 557,800 of the forward primer, and 558,00 ⁇ 558,100 of the reverse primer. CRISPR_YT1_R is assigned to the forward primer sequence of the Primer parameters, and the reverse primer After entering CRISPR_YT1_F in the sequence, the database was designated as "nr". The rest of the settings were executed with the default settings.
  • a primer set for L. acidophilus YT1 strain discrimination was obtained by specifically amplifying only the L. acidophilus YT1 (Accession No. CP025200.1) genome from the sequence present in NCBI. Specifically, it was indicated as follows in the "Specificity of primers" section of FIG. "Primer pairs are specific to input template as no other targets were found in selected database: Nucleotide collection (nt)".
  • the reverse primer CRISPR_YT1_R which is the reverse primer of CRISPR_YT1_F
  • the reverse primer CRISPR_YT1_R is a forward primer on the genome because the primer template uses the reverse sequence of the genome during the preparation of the primer.
  • Primer-BLAST the primer located at the front of the genome is unconditionally recognized as a forward, so a reverse primer is indicated in “Forward primer” and a forward primer is indicated in "Reverse primer”.
  • Lactobacillus acidophilus has been reported to have a high degree of similarity within species, and among sequences reported to NCBI, the similarity between 16S rRNAs of 60 strains belonging to Lactobacillus acidophilus 97.5 to 100%. Lactobacillus acidophilus ( Lactobacillus acidophilus ) NCFM and Lactobacillus acidophilus ( Lactobacillus acidophilus ) EMBS082 was confirmed to show the largest difference with 97.5% similarity.
  • the 16S rRNA discrimination method is judged to be the same species when the similarity is 97% or more. Accordingly, based on 16S rRNA gene information of NCFM (Accession No. CP000033.3), a representative of the Lactobacillus acidophilus genome, similar genes were searched and compared among 16S genes reported to NCBI. A BLASTN search was performed on the NCBI NT database, and 414 sequences except for the Uucultured strain were found among sequences with more than 97% similarity.
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • Lactobacillus acidophilus NCFM Lactobacillus acidophilus NCFM
  • 97% or more similarity As a strain having Lactobacillus helveticus ( Lactobacillus helveticus ) strain 252, Lactobacillus crispatus ( Lactobacillus crispatus ) strain 33 species, Lactobacillus amyloborus ( Lactobacillus amylovorus ) 18 strains, Lactobacillus sp .
  • FIG. 13 was a phylogenetic analysis of 16 s rRNA sequences of a total of 414 species having a similarity of 97% or higher with Lactobacillus acidophilus NCFM identified through 1), and some of them are extracted. Sequences corresponding to species other than Lactobacillus acidophilus are indicated in FIG. 13 by red and upper right asterisks (*).
  • FIG. 13 phylogenetic cluster analysis result, in the in-phase grid a wooden Lactobacillus ash FIG pillar's (Lactobacillus acidophilus) of "A" is 60 strain is classified as a strain belonging to the species Lactobacillus bacteria (Lactobacillus sp .) (Accession No. EU600905.1, KF952776.1, MH782151.1) and Lactobacillus kitasatonis (Accession No. AB186333.1, AB186339.1) strains are present. .
  • the primer composition for determining the Lactobacillus acidophilus species of the present invention prepared in FIG. 2 (a primer set of SEQ ID NOs: 1 and 9) specifically specific to the Lactobacillus acidophilus species We wanted to check whether it was discriminated against.
  • Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1 and Lactobacillus acidophilus YT1 strains were incubated with MRS medium (Difco, 288110) at 37 ° C. for 18 hours, respectively. Then, the cells were recovered from the culture medium of each strain, and genomic DNA was extracted with a QIAamp DNA Mini kit (Qiagen, Germany).
  • PCR Thermal cycling
  • PCR reaction was carried out using Dyad (Bio-rad), and the reaction conditions were maintained at 95 ° C for 300 seconds, then treated at 95 ° C for 30 seconds to denature DNA, and annealed at 60 ° C for 30 seconds, 72 It was amplified (DNA polymerization) for 90 seconds at °C, and repeated 28 times (95 °C, 30 seconds (denaturation)-> 60 °C, 30 seconds (recombination)-> 72 °C, 90 seconds (DNA polymerization) ), And the final synthesis was performed at 72 ° C for 300 seconds.
  • the amplified product (PCR product) amplified by the above process was electrophoresed on an agarose gel of 1.2%, stained with Safeview (iNtRON Biotechnology, Korea), and detected by irradiating a DNA polymorphic band with UV, Gel-Doc system (Bio -rad) and printed and shown in FIG. 14.
  • each strain Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus) ATCC 4356 , Lactobacillus ash dopil Russ (Lactobacillus acidophilus) NCFM, Lactobacillus ash FIG filler's (Lactobacillus acidophilus) CB_LA1, Lactobacillus acidophilus (Lactobacillus acidophilus) YT1 ) is a result of PCR analysis, Figure 15 is a representative of Lactobacillus acido filler using the primer set represented by SEQ ID NO: 1, 9 of the present invention This is the result of repeating the process of analyzing the PCR amplified product obtained by performing PCR on the strain Lactobacillus acidophilus YT1 (Ani-a, Uni-b) twice after analyzing it with agarose gel electrophores
  • M is a DNA size standard marker (Sizer TM 100bp DNA Marker (cat.No, 24073), 1 is Lactobacillus helveticus ATCC 13866, 2 is Lactobacillus amylovorus ATCC 33620, 3 is Lactobacillus acidophilus ATCC 4356, 4 is Lactobacillus acidophilus NCFM strain, 5 is Lactobacillus acidophilus LA1 (also called CB_LA1), and 6 is Lactobacillus acidophilus YT1.
  • Sizer TM 100bp DNA Marker catalog.1.1
  • 1 is Lactobacillus helveticus ATCC 13866
  • 2 is Lactobacillus amylovorus ATCC 33620
  • 3 is Lactobacillus acidophilus ATCC 4356
  • 4 is Lactobacillus acidophilus NCFM strain
  • 5 is Lactobacillus acidophilus LA1 (also called CB_LA1)
  • 6 is Lactobacillus acidophilus YT1.
  • composition for discrimination of Lactobacillus acidophilus species comprising the primers represented by SEQ ID NO: 1 and SEQ ID NO: 9 of the present invention confirmed that amplified DNA fragments of about 267 bp in size Did.
  • PCR products are amplified even though they are detected at 200 to 300 bp (preferably 260 to 280 bp). Since the PCR product 267 bp for the CRISPR section of the Lactobacillus acidophilus strain was derived as a basis, it will be referred to as a result belonging to the scope of the present invention.
  • the PCR product is exactly 267 bp, but considering the various conditions described above, if the PCR product derived by actual application corresponds to 200 to 300 bp, preferably 260 to 280 bp, Lactobacillus ash It can be determined as being a Lactobacillus acidophilus (affected by a region measurable with a marker).
  • the primers represented by SEQ ID NO: 1 and SEQ ID NO: 9 according to the present invention are rapidly and accurately producing Lactobacillus acidophilus for amplicons only, Lactobacillus acidophilus Lactobacillus acidophilus ) can be used as a composition for species identification.
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • YT1 strain Lactobacillus acidophilus
  • the size of the amplification product identified only in Lactobacillus acidophilus was measured to be 267 bp including a primer, and the amplification sequence is as follows.
  • PCR for Lactobacillus acidophilus substantially amplified It was confirmed that the nucleotide sequence readout length of the product was 267 bp, and it was 100% consistent with the predicted nucleotide sequence in the genome. That is, the electrophoresis seemed to be close to about 270 bp with the naked eye, but the length of the amplified sequence was 267 bp, which perfectly matched the predicted length and the base sequence was also identical.
  • composition for discriminating Lactobacillus acidophilus species comprising the primers represented by SEQ ID NO: 1 and SEQ ID NO: 9 of the present invention according to the present invention was used for all Lactobacillus acidophilus . It can be seen that the belonging strain is clearly distinguishable from other strains of the species.
  • the primers represented by SEQ ID NO: 1 and SEQ ID NO: 9 according to the present invention quickly and accurately produce Lactobacillus acidophilus only in Lactobacillus acidophilus , and Lactobacillus acidophilus Lactobacillus acidophilus ) It was confirmed once again that it can be used as a composition for species identification.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) in a systematic analysis in Experimental Example 1 has a high degree of similarity to NCFM and was identified as Lactobacillus acidophilus ( Lactobacillus acidophilus ).
  • Lactobacillus kitasatonis) strains DSM 16761 (Genbank accession: GCA_001434435.1) and JCM 1039 (Genbank accession: GCA_000615285.1) were prepared.
  • Lactobacillus kitasatonis DSM 16761 (Genbank accession: GCA_001434435.1) and JCM 1039 (Genbank accession: GCA_000615285.1) genomes disclosed in NCBI were designed as primer sets designed in the present invention.
  • SEQ ID NO: 1 and 9, SEQ ID NO: 2 and 10, SEQ ID NO: 3 and 11, SEQ ID NO: 4 and 12, SEQ ID NO: 5 and 13, SEQ ID NO: 6 and 14 were designed as primer sets designed in the present invention.
  • the method of discriminating 16S rRNA gene information is Lactobacillus acidophilus, which was identified as Lactobacillus acidophilus, and Lactobacillus acidophilus, which has a very similar 16S rRNA gene to Lactobacillus kitasatonis ( It can be seen that even the Lactobacillus kitasatonis) can clearly distinguish and discriminate that the primer composition of the present invention does not belong to Lactobacillus acidophilus .
  • the primer composition according to the present invention Compared to the conventional 16S rRNA gene discrimination method, the primer composition according to the present invention accurately identifies strains belonging to the species Lactobacillus acidophilus and strains that do not belong It is understood that it is possible to accurately discriminate, distinguish, and detect, and if the primer composition of the present invention is used, whether or not Lactobacillus acidophilus is present on the product or sample, the unsorted strain is Lactobacillus ash It can be seen that it is possible to accurately identify whether the strain belongs to Lactobacillus acidophilus .
  • compositions for discriminating individual strains of Lactobacillus acidophilus of the present invention produced in FIGS. 6 and 7 were specifically intended to determine whether L. acidophilus strains, particularly L. acidophilus LA1 strains.
  • Example 4 the primer set for discrimination of individual strains of L. acidophilus of the present invention was compared with the database provided from the NCBI site, and the results of sequence analysis using a sequence search program called BLASTN were as follows. Tables 2 to 9 specifically show.
  • Lactobacillus acidophilus LA1 Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 and Lactobacillus acidophilus NCFM strains were incubated with MRS medium (Difco, 288110) at 37 ° C. for 18 hours. Then, the cells were recovered from the culture medium of each strain, and genomic DNA was extracted with a QIAamp DNA Mini kit (Qiagen, Germany).
  • PCR Thermal cycling
  • the PCR reaction was carried out using Dyad (Bio-rad), and the reaction conditions were maintained at 95 ° C for 300 seconds, and then treated at 95 ° C for 30 seconds to denature DNA, and annealed at 55 ° C for 30 seconds, 72 It was amplified (DNA polymerization) for 90 seconds at °C, and repeated 30 times (95 °C, 30 seconds (denaturation)-> 55 °C, 30 seconds (recombination)-> 72 °C, 90 seconds (DNA polymerization) -> 95 °C, 30 seconds (denaturation)), 72 °C, last synthesis was carried out for 300 seconds.
  • the amplified product (PCR product) amplified by the above process was electrophoresed on an agarose gel of 1.2%, stained with Safeview (iNtRON Biotechnology, Korea), and detected by irradiating a DNA polymorphic band with UV, Gel-Doc system (Bio -rad) and printed and shown in FIG. 16.
  • Figure 16 is PCR for each strain ( Lactobacillus acidophilus LA1, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM ) using the primer set for L. acidophilus individual strain identification of the present invention It is the result of analysis conducted.
  • M is a DNA size standard marker (Sizer TM 100bp DNA Marker (cat.No, 24073), 1 is Lactobacillus helveticus ATCC 13866, 2 is Lactobacillus amylovorus ATCC 33620, 3 is Lactobacillus acidophilus ATCC 4356, 4 is Lactobacillus acidophilus NCFM strain, 5 is Lactobacillus acidophilus LA1 (also called CB_LA1).
  • composition for identifying Lactobacillus acidophilus strains comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention is specific only to the Lactobacillus acidophilus strain As a result, it was confirmed that PCR products (100-1000 bp) were formed.
  • composition for identifying a Lactobacillus acidophilus strain comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention is about 200 bp in size from Lactobacillus acidophilus LA1. It was confirmed that the DNA fragment was amplified.
  • Lactobacillus acidophilus LA1 strain specifically has 6 to 17 spacer regions that are different from other strains (same strains, homogeneous strains) with different base sequences in the CRISPR section.
  • Lactobacillus acidophilus containing primers represented by SEQ ID NOs: 8 and 16 (Lactobacillus acidophilus )
  • the size of the PCR products amplified DNA fragments, amplicons recovered through the composition for determining LA1 strain 165 It was considered as bp (150 bp + 8 bp primer and 7 bp dicer). However, the PCR product was found to be approximately 200 bp in size.
  • This difference is due to the combination of the lengths of SEQ ID NO: 8 and SEQ ID NO: 16 used as primers in the identification of PCR products.
  • the PCR product is preferably exactly 165 bp (150 bp + 8 bp primer and 7 bp dicer), but considering the various conditions described above, the PCR product derived by actual application is preferably 150 to 250 bp, preferably Can be determined to be a Lactobacillus acidophilus LA1 strain if it corresponds to 150 to 200 bp (affected by a region measurable with a marker).
  • the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 according to the present invention selectively amplify the sequence of the CRISPR target site only among the L1 strain among Lactobacillus acidophilus species, and thus Lactobacillus among various strains Lactobacillus acidophilus LA1 strain can be detected and identified.
  • the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 according to the present invention are rapid to generate amplicons of different sizes for each strain even between Lactobacillus acidophilus species, Lactobacillus acidophilus ( Lactobacillus acidophilus) can be used as a composition capable of clearly discriminating only the LA1 strain.
  • Lactobacillus acidophilus ( Lactobacillus acidophilus ) comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention Lactobacillus acidophilus Lactobacillus acidophilus ) LA1, Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus
  • Lactobacillus acidophilus By processing each DNA separated from NCFM, and performing a polymerase chain reaction, to obtain a PCR product, and to analyze its size.
  • Lactobacillus acidophilus LA1 Lactobacillus acidophilus ATCC 4356
  • Lactobacillus acidophilus NCFM The strains were each incubated with MRS medium (Difco, 288110) at 37 ° C. for 18 hours. Then, the cells were recovered from the culture medium of each strain, and genomic DNA was extracted with a QIAamp DNA Mini kit (Qiagen, Germany).
  • PCR Thermal cycling
  • PCR reaction was carried out using Dyad (Bio-rad), and the reaction conditions were maintained for 5 minutes at an initial temperature of 95 ° C., followed by treatment at 95 ° C. for 30 seconds to denature DNA, annealing at 55 ° C. for 30 seconds, and 72 It was amplified (DNA polymerization) for 90 seconds at °C, and repeated 30 times (95 °C, 30 seconds (denaturation)-> 55 °C, 30 seconds (recombination)-> 72 °C, 90 seconds (DNA polymerization) -> 95 °C, 30 seconds (denaturation)), 72 °C, the final synthesis was carried out for 5 minutes.
  • the amplified product (PCR product) amplified by the above process was electrophoresed on an agarose gel of 1.2%, stained with Safeview (iNtRON Biotechnology, Korea), and detected by irradiating a DNA polymorphic band with UV, Gel-Doc system (Bio -rad) and printed and shown in FIGS. 17 to 19.
  • FIG. 17 is a result of PCR analysis on a DNA size standard marker
  • FIG. 18 is a Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356 , Lactobacillus using the primer set for L. acidophilus strain identification of the present invention acidophilus and results of the PCR analyzes by agarose gel electrophoresis for NCFM), 19 is by using a primer set for the L.
  • acidophilus strains of the invention is determined, each of the strains (Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM ) , and the result is analyzed by agarose gel electrophoresis after purifying the PCR amplification product obtained by performing PCR.
  • the lanes without separate marks on both sides are DNA size standard markers, 1, 4, 7, and 10 are Lactobacillus acidophilus ATCC 4356, and 2, 5, 8, and 11 are Lactobacillus acidophilus is an NCFM strain, and 3, 6, 9, and 12 are Lactobacillus acidophilus LA1 (also called CB_LA1).
  • Lactobacillus ash FIG pillar's (L actobacillus acidophilus) predicting the length of NCFM strain Lactobacillus ash is also based on the CRISPR region of the pillar's (Lactobacillus acidophilus) NCFM strain, and the initial prediction length standing die adjacent to the non-primer based primer Since the (dicer) sequence is based, the actual predicted length is 898 when 8 bp sequence between the left primer and the adjacent dicer and 7 bp sequence between the right primer and the adjacent dicer are included during prediction. It was confirmed to be bp.
  • the composition for identifying Lactobacillus acidophilus LA1 strain comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention was added to the Lactobacillus acidophilus NCFM strain. When applied, it was confirmed that it was amplified to the expected size.
  • Lactobacillus acidophilus ATCC 4356 strain was measured to be 837 bp except for the primer, and the amplification sequence is as follows.
  • the predicted length of the Lactobacillus acidophilus ATCC 4356 strain was based on the CRISPR region of the Lactobacillus acidophilus NCFM strain, and the initial predicted length was a dicer adjacent to the primer rather than the primer. Since the (dicer) sequence is based, the actual predicted length is 898 when the 8-bp sequence between the left primer and the adjacent dicer and the 7-bp sequence between the right primer and the adjacent dicer are included in prediction. It was bp.
  • the CRISPR region of Lactobacillus acidophilus ATCC 4356 deleted the ninth spacer (33 bp) and dicer (28 bp) of the Lactobacillus acidophilus NCFM.
  • the CRISPR region of Lactobacillus acidophilus ATCC 4356 could be expected to be 837 bp, 61 bp shorter than Lactobacillus acidophilus NCFM.
  • sequence length of the substantially amplified Lactobacillus acidophilus ATCC 4356 was 837 bp, and it was confirmed that a sequence 61 bp shorter than the Lactobacillus acidophilus NCFM was detected.
  • composition for identifying Lactobacillus acidophilus LA1 strain comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention according to the present invention is Lactobacillus acidophilus NCFM And Lactobacillus acidophilus ATCC 4356, as well as confirming that it can be accurately distinguished, Lactobacillus acidophilus ( Lactobacillus acidophilus) was confirmed again that it can clearly distinguish from LA1.
  • Lactobacillus acidophilus LA1 strain was measured to be 165 bp except for the primer, and the amplification sequence is as follows.
  • Lactobacillus acidophilus LA1 which was substantially amplified, was 165 bp, and was confirmed to be 100% consistent with the predicted length. That is, the electrophoresis seemed to be close to about 200 bp with the naked eye, but the length of the amplified sequence was 165 bp, indicating that it was perfectly matched with the predicted length.
  • composition for identifying Lactobacillus acidophilus LA1 strain comprising the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 of the present invention according to the present invention is Lactobacillus acidophilus LA1 It can be seen that it is clearly distinguishable among strains of the same genus.
  • the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 according to the present invention selectively amplify the sequence of the CRISPR target site only by strains of Lactobacillus acidophilus species, and thus, Lactobacillus ash among various strains A strain of Lactobacillus acidophilus can be detected and identified.
  • the primers represented by SEQ ID NO: 8 and SEQ ID NO: 16 according to the present invention are rapid to generate amplicons of different sizes for each strain even between Lactobacillus acidophilus species, It was confirmed once again that Lactobacillus acidophilus can be accurately used as a composition for discriminating LA1 strains.
  • Example 6 Lactobacillus acidophilus of Example 7 ( Lactobacillus acidophilus) PCR analysis of the composition for strain identification.
  • composition for discrimination of Lactobacillus acidophilus strain of the present invention prepared in FIG. 11 was specifically intended to confirm whether the L. acidophilus strain, in particular, L. acidophilus YT1 strain was identified.
  • Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1 and Lactobacillus acidophilus YT1 strains were incubated with MRS medium (Difco, 288110 for 37 hours at 37 hours, 37 hours at Difco, 288110). Then, the cells were recovered from the culture medium of each strain, and genomic DNA was extracted with a QIAamp DNA Mini kit (Qiagen, Germany).
  • PCR Thermal cycling
  • PCR reaction was carried out using Dyad (Bio-rad), and the reaction conditions were maintained at initial temperature of 95 ° C for 300 seconds, followed by treatment at 95 ° C for 30 seconds to denature DNA, and annealing at 60 ° C for 30 seconds, followed by 72. It was amplified (DNA polymerization) for 90 seconds at °C, and repeated 28 times (95 °C, 30 seconds (denaturation)-> 60 °C, 30 seconds (recombination)-> 72 °C, 90 seconds (DNA polymerization) ), And final synthesis was performed at 72 ° C for 300 seconds.
  • the amplified product (PCR product) amplified by the above process was electrophoresed on an agarose gel of 1.2%, stained with Safeview (iNtRON Biotechnology, Korea), and detected by irradiating a DNA polymorphic band with UV, Gel-Doc system (Bio -rad) and printed and shown in FIG. 20.
  • Figure 20 is using the L. acidophilus YT1 strain discrimination primer set of the present invention, each strain ( Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, Lactobacillus ) The results are analyzed by PCR.
  • M is a DNA size standard marker (Sizer TM 100bp DNA Marker (cat.No, 24073), 1 is Lactobacillus helveticus ATCC 13866, 2 is Lactobacillus amylovorus ATCC 33620, 3 is Lactobacillus acidophilus ATCC 4356, 4 is Lactobacillus acidophilus NCFM strain, 5 is Lactobacillus acidophilus LA1 (also called CB_LA1), and 6 is Lactobacillus acidophilus YT1.
  • Sizer TM 100bp DNA Marker catalog.1.1
  • 1 is Lactobacillus helveticus ATCC 13866
  • 2 is Lactobacillus amylovorus ATCC 33620
  • 3 is Lactobacillus acidophilus ATCC 4356
  • 4 is Lactobacillus acidophilus NCFM strain
  • 5 is Lactobacillus acidophilus LA1 (also called CB_LA1)
  • 6 is Lactobacillus acidophilus YT1.
  • composition for identifying Lactobacillus acidophilus strain comprising the primers represented by SEQ ID NO: 7 and SEQ ID NO: 15 of the present invention is about 320 in Lactobacillus acidophilus YT1 It was confirmed that the DNA fragment of bp size was amplified.
  • Lactobacillus acidophilus YT1 strain has two CRISPRs, and unlike other strains (same strains, homogeneous strains) having different base sequences in the CRISPR section, the CRISPR region of another strain It was confirmed that only part was preserved. Specifically, spacers 1 to 5 of NCFM were present in the first CRISPR of YT1, and spacers 22 to 26 of NCFM were present in the second CRISPR of YT1.
  • the 320 bp target is amplified and contains a primer represented by SEQ ID NOs: 7, 15 through the composition for identifying Lactobacillus acidophilus YT1 strain It can be seen that the size of the recovered PCR product was also measured at 320 bp.
  • the PCR product is exactly 320 bp, but considering the various conditions described above, if the PCR product derived by actual application corresponds to 250 to 400 bp, preferably 300 to 350 bp, Lactobacillus ash It can be identified as being a strain of Lactobacillus acidophilus YT1 (affected by marker measurable regions).
  • the primers represented by SEQ ID NO: 7 and SEQ ID NO: 15 according to the present invention are rapidly and accurately produced by Lactobacillus acidophilus YT1, and thus, quickly and accurately, Lactobacillus acidophilus ( Lactobacillus acidophilus) YT1 strain can be used as a composition for identification.
  • 21 is a PCR amplification product obtained by performing PCR on the YT1 strain using the primer set for L. acidophilus YT1 strain discrimination of the present invention, and analyzed by agarose gel electrophoresis, which is repeated 10 times This is a representative result.
  • M is a Sizer TM 100bp DNA Marker (Cat. No. 24073)
  • N is Blank
  • YT1-a and b are Lactobacillus acidophilus YT1, which means two experiments. .
  • Lactobacillus acidophilus Lactobacillus acidophilus
  • YT1 Lactobacillus acidophilus
  • composition for identifying Lactobacillus acidophilus YT1 strain comprising the primers represented by SEQ ID NO: 7 and SEQ ID NO: 15 of the present invention according to the present invention is Lactobacillus acidophilus YT1 It can be seen that it is clearly distinguishable among strains of the same genus.
  • the primers represented by SEQ ID NO: 7 and SEQ ID NO: 15 according to the present invention are rapidly and accurately producing Lactobacillus acidophilus YT1, only rapidly and accurately, Lactobacillus acidophilus Lactobacillus acidophilus) It was confirmed once again that it can be used as a composition for identifying YT1 strains.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물에 관한 것으로, 대상 시료로부터 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 미생물을 간편하고 신속, 정확하게 판별, 검출, 동정할 수 있다. 따라서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 균주를 이용한 발효유, 유아식, 유제품, 축산 농가 사료, 화장품, 건강 보조식품, 정장약품 및 원료 개발 등에 유용하게 사용될 수 있다.

Description

락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법
본 발명은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물에 관한 것으로, 보다 상세하게는 빠르고 정확하게 다양한 락토바실러스 속 중에서 애시도필러스 종을 특이적으로 판별 및 동정할 수 있는 프라이머(universal primer) 조성물, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 조성물에 관한 것이다. 또한 상기 프라이머 조성물을 포함하는 키트 그리고 이를 이용한 판별방법에 관한 것이다.
젖산균(Lactic acid bacteria) 또는 유산균은 물질대사에 의해 탄수화물을 젖산으로 분해시키는 세균으로, 요거트, 유산균 음료 및 김치 등의 식품을 발효시키는데 사용된다.
유산균은 균주에 따라 다양한 효과를 나타내며, 스트렙토코커스(Streptococcus), 락토바실러스(Lactobacillus), 루코노스탁(Leuconostoc), 비피도박테리아(Bifidobacteria) 및 페디오코커스(Pediococcus)의 5개 속으로 구분할 수 있다. 이 중, 락토바실러스 속 미생물은 동형 또는 이형발효를 하는 유산간균으로, 유제품이나 채소의 발효과정에서 흔히 볼 수 있는 균이며, 쌍구균인 루코노스탁 속 미생물은 이형 발효를 하며 채소류의 발효에 주로 관여한다.
이러한 락토바실러스 속 미생물 중에서 애시도필러스(Lactobacillus acidophilus) 종의 미생물은 주로 사람의 소장에 정착능이 강하고 내산성이 뛰어나 위산이나 담즙산에 견디는 능력이 있으며, 콜레스테롤 저하작용, 설사와 변비의 개선 및 면정증강 등 프로바이오틱(probiotics) 젖산균으로서의 기본적 특성을 고루 갖추고 있기 때문에 실제로 여러 가지 제품들에 활용되고 있다. 게다가 프로바이오틱(probiotics)로의 활용 가능성, 유용산물의 생산관련 연구, 유해 미생물의 생육억제, 다른 젖산균과 효모균과의 혼합배양, 장내균총변화, 항생제 적응성, 콜레스테롤 자화성여부 등 폭넓은 연구를 통해 유용성이 입증되고 있으므로, 더 많은 기능성식품 첨가제나 위생 용품, 화장품 등의 개발 및 활용이 기대되고 있다.
따라서, 락토바실러스 속 중에서 애시도필러스 종의 미생물을 특이적으로 판별할 수 있는 검출, 판별, 동정 방법에 대한 중요성이 점차 높아지고 있는 추세에 있다.
현재까지 개발된 미생물 종(species)을 판정하는 방법은 대표적으로 16S rRNA 유전자 염기서열 정보를 분석하는 것이 있다. 상기 방법은 일부 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주에서 16S rRNA 유전자 염기서열의 판정기준을 따르지 않는 예외가 존재할 뿐만 아니라, 많은 시간과 노동력이 필요하다는 단점이 있다.
최근에는 영국 GENESIG 사에서 락토바실러스 애시도필러스(Lactobacillus acidophilus)의 Recombinase A(recA)유전자의 염기서열에 기반한 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 키트를 개발하였으나, NCBI상에 존재하는 95%의 락토바실러스 애시도필러스 균주(Lactobacillus acidophilus strain)에 대해서만 검출이 가능하다는 한계점을 갖는다. 게다가 미생물이 가지는 특정 유전자는 진화과정 중에 많은 변이가 생길 수 있으므로, 특정 유전자를 타겟하는 상기와 같은 방법들은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 다수 미생물을 검출하는데 한계가 분명하다.
또한 NGS 분석방법은 미생물이 가지는 전체 게놈 분석 결과를 바탕으로 특정 미생물 종(species)을 판별할 수 있었으나, 일일이 게놈 정보를 분석하여 유전체를 비교하고 각 균주간의 계통도를 그려 종을 확인해야하는 번거로움과 많은 시간과 노동력이 필요하다는 큰 단점을 갖는다. 또한 상기 방법은 다수의 균종을 동시에 검출하는데 한계가 있다.
이에 본 발명자들은 인체에 유용한 효과를 갖는 락토바실러스 애시도필러스(Lactobacillus acidophilus)에서 CRISPR 영역이 다른 종의 미생물들과 구분되는 특징을 찾음으로써, 상기 CRISPR 영역을 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 명확하게 검출할 수 있는 종(species) 특이적인 범용 프라이머(universal primer) 조성물과 락토바실러스 애시도필러스(Lactobacillus acidophilus)개별 균주를 명확하게 검출할 수 있는 특이적 프라이머 조성물을 개발하고자 노력한 바, 본 발명을 완성하게 되었다.
본 발명이 해결하고자 하는 과제는 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 조성물을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 상기 프라이머 조성물을 포함하는 키트를 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 판별하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 존재를 검출하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주의 존재를 검출하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 존재를 검출하기 위한 방법을 제공하는 것이다.
본 발명이 해결하고자 하는 다른 과제는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출하기 위한, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트의 용도를 제공하는 것이다.
본 발명은 상기 과제를 달성하기 위하여, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물을 제공한다.
본 발명의 일 실시예에 의하면, 상기 정방향 프라이머는 5'-말단에 연결된, 형광단, 발색단, 화학발광단, 자기입자 및 방사능동위원소로 이루어진 군에서 선택된 1종 이상의 표지를 추가로 포함하는 것일 수 있다.
또한, 본 발명은 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물을 제공한다.
본 발명의 다른 실시예에 의하면 상기 조성물은 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함할 수 있다.
또한, 본 발명은 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 조성물을 제공한다.
또한, 본 발명은 상기 프라이머 조성물을 포함하는 키트를 제공한다.
본 발명의 다른 실시예에 의하면, 상기 키트는 프라이머 조성물에 포함되는 프라이머 세트에 따라 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별 또는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별 용도로 사용될 수 있다.
본 발명의 다른 실시예에 의하면, 상기 키트는 완충용액, DNA 중합효소 및 dNTP를 포함하는 것일 수 있다.
또한 본 발명은 a) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
b) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 판별하기 위한 방법을 제공한다.
또한 본 발명은 A) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
B) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별하기 위한 방법을 제공한다.
본 발명의 다른 실시예에 의하면, 상기 A) 단계는 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함하는 것일 수 있다.
또한 본 발명은 1) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
2) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별하기 위한 방법을 제공한다.
또한 본 발명은 하기 단계를 포함하는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 존재를 검출하기 위한 방법을 제공한다.
i) 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 ii) PCR 산물의 형성여부 확인하는 단계;
또한 본 발명은 하기 단계를 포함하는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 검출하기 위한 방법을 제공한다.
Ⅰ) 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 Ⅱ) PCR 산물의 형성여부 확인하는 단계;
상기 Ⅰ) 단계는 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함하는 것일 수 있다.
또한 본 발명은 하기 단계를 포함하는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 검출하기 위한 방법을 제공한다.
ㄱ) 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 ㄴ) PCR 산물의 형성여부 확인하는 단계;
또한, 본 발명은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출하기 위한, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트의 용도를 제공한다.
본 발명에 따른 조성물은 대상 시료로부터 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 미생물을 간편하고 신속, 정확하게 판별, 검출, 동정할 수 있다. 따라서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 균주를 이용한 발효유, 유아식, 유제품, 축산 농가 사료, 화장품, 건강 보조식품, 정장약품 및 원료 개발 등에 유용하게 사용될 수 있다.
또한 본 발명에 따른 조성물은 대상 시료로부터 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 존재뿐만 아니라 이들의 개별 균주를 판별할 수 있고, 특히 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 또는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 특이적이고 정확하게 확인가능하다.
도 1은 실시예 1을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주(21종)들의 CRISPR 구조 분석 결과이다.
도 2는 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 특이적으로 검출할 수 있는 서열번호 1, 9로 표시되는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때, 인 실리코 분석(in silico)을 통해 분석한 해당 균주의 PCR 산물 크기를 도시화한 것이다.
도 3a는 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 특이적으로 검출할 수 있는 서열번호 1, 9로 표시되는 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, Primer-BLAST란 서열검색 프로그램으로 시퀀스를 분석한 결과의 윗 화면이다.
도 3b는 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 특이적으로 검출할 수 있는 서열번호 1, 9로 표시되는 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, Primer-BLAST란 서열검색 프로그램으로 시퀀스를 분석한 결과 부분을 취합하여 나타낸 것이다.
도 4는 실시예 3을 통해 분석한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1의 전체 게놈 구성도이다.
도 5a는 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 비롯한 10종 균주의 16S rRNA 유전자를 활용한 계통도이다.
도 5b는 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 비롯한 10종 균주의 ANI genome 비교를 활용한 계통도이다.
도 6은 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 비롯한 10종 균주들 중에서, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM, 락토바실러스 애시도필러스(Lactobacillus acidophilus) La-14, 락토바실러스 애시도필러스(Lactobacillus acidophilus) FSI4 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1의 CRISPR 구조 분석 결과이다.
도 7은 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 특이적으로 검출할 수 있는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때 인 실리코 분석(in silico)을 통해 각 균주의 PCR 산물 크기를 도시화한 것이다.
도 8은 실시예 6을 통해 분석한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1의 전체 게놈 구성도이다.
도 9a는 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 비롯한 22종 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 16S rRNA 유전자를 활용한 계통도이다.
도 9b는 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1비롯한 10종 균주의 ANI genome 비교를 활용한 계통도이다.
도 10은 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 비롯한 22종 균주들 중에서 레퍼런스 균주인 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 과 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1의 CRISPR 구조 분석 결과이다.
도 11은 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 특이적으로 검출할 수 있는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때 인 실리코 분석(in silico)을 통해 PCR 산물 크기를 도시화한 것이다.
도 12는 인 실리코(in silico)에서, 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 세트(CRISPR_YT1_F, CRISPR_YT1_R)를 NCBI 사이트의 데이터베이스에 Primer-BLAST를 활용하여 검색한 결과이다.
도 13은 실험예 1)을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM과 97% 이상의 유사도를 갖는 총 414 종의 16S rRNA 서열의 계통도이다. 락토바실러스 애시도필러스(Lactobacillus acidophilus) 이외의 종에 해당하는 서열은 도 13에서 붉은색 및 우측상단 별표(*)로 표기하였다.
도 14는 본 발명의 서열번호 1, 9로 표시되는 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus CB_LA1, Lactobacillus acidophilus YT1)에 대해 PCR을 수행하여 분석한 결과이다.
도 15는 본 발명의 서열번호 1, 9로 표시되는 프라이머 세트를 이용하여, 대표로 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후 이를 아가로스 겔 전기영동으로 분석하는 과정을 두 번 반복(Uni-a, Uni-b)한 결과이다.
도 16은 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 분석한 결과이다.
도 17은 DNA 크기 표준 마커에 대해 PCR을 수행하여 분석한 결과이다.
도 18은 본 발명의 L. acidophilus 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 아가로스 겔 전기영동으로 분석한 결과이다.
도 19는 본 발명의 L. acidophilus 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후, 이를 아가로스 겔 전기영동으로 분석한 결과이다.
도 20은 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, Lactobacillus acidophilus YT1)에 대해 PCR을 수행하여 분석한 결과이다.
도 21은 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 세트를 이용하여 YT1 균주에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후 이를 아가로스 겔 전기영동으로 분석한 것으로, 이는 10회의 반복실험 중에서 대표적인 결과이다.
이하에서, 본 발명의 여러 측면 및 다양한 구현예에 대해 더욱 구체적으로 살펴보도록 한다.
본 발명에서 프라이머(primer)란, 짧은 자유 3 말단 수산화기(free 3' hydroxyl group)을 가지는 핵산서열로 상보적인 핵산의 주형과 염기쌍(base pair)를 형성할 수 있고, 핵산 주형의 가닥 복사를 위한 시작 지점으로 기능하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(즉, DNA 폴리머라아제)의 존재 하에서 DNA 합성을 개시할 수 있다.
본 발명에서 프라이머 세트(primer set)란 특정 서열 DNA를 증폭하기 위한 프라이머의 조합을 의미하고 하나의 프라이머 세트에는 통상 2가지 프라이머(정방향 프라이머, 역방향 프라이머 혹은 Left primer, Right primer)가 포함되나 이를 초과하는 경우도 있다.
본 발명에서 올리고뉴클레오티드(oligonucleotide)란 단일가닥 또는 이중가닥 형태로 존재하는 디옥시리보올리고뉴클레오티드 또는 리보올리고뉴클레오티드이며, 다르게 특별하게 언급되어 있지않는 한 자연의 뉴클레오티드의 유사체를 포함한다.
본 발명의 일 측면은 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물에 관한 것이다.
또한 본 발명의 다른 측면은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출하기 위한, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트의 용도에 관한 것이다.
상기 프라이머 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주를 특이적으로 탐지할 수 있는 서열번호 1 내지 8 및 서열번호 9 내지 16으로 표시되는 프라이머를 포함하는 프라이머 세트이다.
상기 프라이머 세트는 바람직하게 서열번호 1 및 9로 구성된 프라이머 세트, 서열번호 2 및 10로 구성된 프라이머 세트, 서열번호 3 및 11로 구성된 프라이머 세트, 서열번호 4 및 12으로 구성된 프라이머 세트, 서열번호 5 및 13로 구성된 프라이머 세트, 서열번호 6 및 14로 구성된 프라이머 세트, 서열번호 7 및 15로 구성된 프라이머 세트, 서열번호 8 및 16으로 구성된 프라이머 세트 중에서 선택되는 어느 하나 이상일 수 있다.
본 발명의 프라이머 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종과 유사하거나 동일한 종 및 속을 갖는 유사 균주들과 혼합되어 있는 시료에서도, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주를 특이적으로 검출할 수 있는 프라이머 세트를 포함하는 것일 수 있다.
본 발명의 프라미어 조성물은 후술하는 실험예에서 확인된 바와 같이, 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 제외한 다른 종의 균주에 대해서는 전혀 PCR 산물을 합성하지 않으며, 대상이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 'CRISPR' 영역 유전자가 존재할 때만 이를 주형으로 하여 PCR 산물을 합성하므로, 상기 프라이머 조성물을 사용하여 시료로부터 명확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주 존재여부를 특이적으로 판별할 수 있다.
상기 프라이머 조성물을 적용할 경우, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 특이적으로 확인할 수 있다. 예컨대, 서열번호 1로 표시되는 정방향 프라이머 및 서열번호 9로 표시되는 역방향 프라이머를 포함하는 프라이머 조성물을 사용할 경우, 시료 내에 락토바실러스 애시도필러스 종의 균주가 존재한다면 100 내지 300 bp, 바람직하게는 267 bp의 크기를 갖는 PCR 산물이 검출된다. 따라서 각 프라이머 조성물에 따른 PCR 산물의 검출 여부 및 PCR 산물의 크기를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 존재여부를 특이적으로 판별할 수 있다. 검출 또는 진단 대상이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 'CRISPR' 영역 유전자가 존재할 때만 이를 주형으로 하여 PCR 산물을 합성하게 된다.
서열번호 1로 표시되는 정방향 프라이머 및 서열번호 9로 표시되는 역방향 프라이머를 포함하는 프라이머 조성물의 경우, PCR 검출시 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주에 대해 100 내지 400 bp의 PCR 산물, 바람직하게는 267 bp의 PCR 산물이 검출되게 된다.
즉, 본 발명의 프라이머 조성물은 락토바실러스 속 중에서 특정 종(애시도필러스)를 특이적으로 판별할 수 있다.
상기 본 발명의 프라이머 조성물에 포함되어 있는 프라이머 길이는 각각 20 내지 30 bp일 수 있고, 구체적으로 서열번호 1 내지 8로 표시되는 정방향 프라이머는 24 내지 26 bp, 서열번호 9 내지 16으로 표시되는 역방향 프라이머는 20 내지 22 bp일 수 있다. 상기 프라이머들을 포함하는 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. Melting temperature(Tm)는 55℃ 내지 65℃이며, 프라이머 간의 최대 Tm 차이는 3 내지 5℃ 이내인 것이 바람직하며, GC%가 30% 내지 70%일 수 있다
상기 프라이머 조성물은 바람직하게 서열번호 1 내지 6 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 14 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트일 수 있고, 이는 범용(universal) 프라이머 세트로, 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 특이적으로 판별, 동정, 검출할 수 있다.
상기 표적 서열을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Q5 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR 이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용 가능한 키트를 이용할 수도 있다.
본 발명의 구체적인 실시예에 의하면, 상기 프라이머 세트 중에서 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머를 포함하는 프라이머 세트는 동일한 어닐링 온도 및 시간을 갖는 하나의 조건에서, 다른 종속의 균주들(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620)에 대해서는 전혀 PCR 산물을 합성하지 않는데 반해, 동일한 종속의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종들에 대해서는 PCR 산물이 합성됨을 확인하였다. 특히, 서열번호 1 내지 6 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 14 중에서 선택되는 어느 하나 이상의 역방향 프라이머를 포함하는 프라이머 세트들은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종들에 대해서 모두 동일한 PCR 산물이 합성됨을 확인하였다.
이를 통해 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주가 존재하는지 여부를 판별하는데 필요한 시간 및 노력을 절감할 수 있음을 알 수 있다.
상기 프라이머 조성물은 정방향 프라이머 혹은 역방향 프라이머의 5'-말단 또는 3'-말단에 연결된, 형광단, 발색단, 화학발광단, 자기입자 및 방사능동위원소로 이루어진 군에서 선택된 1종 이상의 표지를 추가로 포함하는 것일 수 있다.
상기 "표지(label)" 또는 "검출가능한 표지(detectable label)"는 뉴클레오티드, 뉴클레오티드 중합체, 또는 핵산 결합 인자에 결합된 어떠한 화학적 모이어티를 의미할 수 있으며, 상기 결합은 공유결합 또는 비공유 결합일 수 있다. 바람직하게는, 상기 표지는 검출 가능하며, 본 발명의 실험자에게 검출될 수 있는 상기 뉴클레오티드 또는 뉴클레오티드 중합체일 수 있다. 검출가능한 표지는 발광 분자, 화학 발광 분자, 형광 색소, 형광 퀀칭제(quenching agent), 색깔 분자, 방사성 동위원소 또는 신틸런트(scintillant)를 포함한다. 검출가능한 표지는 또한, 임의의 유용한 링커 분자(예를 들어, 비오틴, 아비딘, 스트랩트아비딘, HRP, protein A, protein G, 항체 또는 그의 단편, Grb2, 폴리히스티딘, Ni2+, FLAG 태그, myc 태그), 중금속, 효소(예를 들어. 알칼라인 포스파타제, 퍼옥시다제 및 루시퍼라제), 전자 공여체(donor)/수용체(acceptor), 아크리디늄 에스테르, 염료(dye) 및 열량 측정 기질(calorimetric substrate)를 포함한다. 또한, 표면 플라스몬 공명(surface plasmon resonance) 검출의 경우와 같이, 질량의 변화(a change in mass)를 나타내는데 검출가능한 표지가 고려될 수 있다. 당업자는 상기 언급되지 않은 유용한 검출가능한 표지에 대해서도 용이하게 인식할 수 있을 것이며, 이들 또한 본 발명의 실시예에 사용될 수 있다.
본 발명의 다른 측면은 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물에 관한 것이다.
구체적으로, 상기 프라이머 조성물 중에서 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트는, PCR 산물의 크기를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별 및 구별할 수 있으며, 예컨대 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 각각 특이적으로 확인할 수 있다.
나아가 상기 프라이머 조성물이 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주까지 명확히 판별 및 구별하기 위해서는 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함하는 것이 바람직하다.
구체적으로 상기 프라이머 세트를 사용하여 PCR 수행하여 얻은 PCR 산물 크기가 약 100~1000 bP로 검출되면, 이들은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주에 속하며, 특히 락토바실러스 애시도필러스(Lactobacillus acidophilus) 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주로 각각 특이적으로 판별할 수 있다.
상기 조성물을 적용할 경우, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 각각 특이적으로 확인할 수 있고, 이들의 PCR 산물 크기는 약 100~1000 bP로 검출되는 것을 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 존재여부를 특이적으로 판별할 수 있다. 검출 또는 진단 대상이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 'CRISPR' 영역 유전자가 존재할 때만 이를 주형으로 하여 PCR 산물을 합성하게 되므로, PCR 검출시 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주만이 100~1000 bp의 산물이 검출되게 된다.
이 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 PCR 산물 크기는 약 100 내지 250 bp이며, 동일속 다른 종의 균주와 PCR 산물 형성 여부에 차이를 가질뿐만 아니라, 다른 종래 동일 종속의 균주와 최대 750 bp의 차이를 가지므로, 상기 조성물을 사용하여 시료로부터 명확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 존재여부를 특이적으로 판별할 수 있다.
다시 말해, DNA 증폭을 위한 표적은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 속종의 균주 염색체 서열 중에서 "CRISPR 영역의 유전자 서열"이고, 상기 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주에는 종래 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주라면 특별히 제한되지 않으나, 예를 들어 L. acidophilus ATCC 4356, L. acidophilus NCFM, L. acidophilus La-14, L. acidophilus FSI4 및 L. acidophilus LA1 등의 다양한 균주일 수 있다.
본 발명에 따른 증폭을 위한 표적이 되는 예시적인 "CRISPR 영역의 유전자 서열"은 하기 도 6, 7에 개략적으로 개시되어 있으며, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1의 완전한 게놈의 예시적인 뉴클레오티드 서열은 Genbank Accession No. NZ_CP017062 에서 확인할 수 있고, L. acidophilus NCFM, L. acidophilus La-14, L. acidophilus FSI4의 CRISPR 영역의 전체 게놈의 예시적인 뉴클레오티드 서열은 각각 Genbank Accession No. NC_006814.3, NC_021181.2, NZ_CP010432.1에서 확인할 수 있다.
상기 본 발명의 조성물에 포함되어 있는 프라이머 세트는 일반적으로 전체 프라이머의 길이가 18 내지 23(최적길이 20)이고, Melting temperature(Tm)가 57 ℃ 내지 62 ℃이며, 프라이머 간의 최대 Tm 차이는 5도 이내이며, GC%가 35 내지 65%인 것이다.
본 발명의 구체적인 실시예에 의하면, 본 발명의 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머를 포함하는 프라이머 세트들은 동일한 어닐링 온도 및 시간을 갖는 하나의 조건에서, 동일한 종속의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주들 각각 165bp, 837bp, 898bp, 900bp, 1000bp로 나타나는 서로 다른 크기의 PCR 산물을 합성하는데 반해, 동일한 속에 속하지만, 다른 종의 균주(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620)에 대해서는 전혀 PCR 산물이 합성되지 않았음을 확인하였다. 이를 통해 동일한 속의 균주가 시료 상에 존재하더라도, 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주만을 특이적이고 명확하게 검출 및 판별할 수 있을뿐만 아니라, 시료 내에 PCR산물 크기를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 개별적으로 판별할 수 있으며, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 개별적으로 판별하는데 필요한 시간 및 노력을 절감할 수 있음을 알 수 있다.
특히, 본 발명의 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머를 포함하는 프라이머 세트는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주에 대해서 PCR 산물의 크기가 150 내지 250 bp로, 다른 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주들과는 PCR 산물의 크기가 명확히 구분되므로 상기 조성물을 사용하여 시료로부터 명확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 존재여부를 특이적으로 판별할 수 있다.
락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 PCR 산물 크기는 약 150 내지 250 bp, 바람직하게는 150 내지 200 bp이며, 동종 동속의 다른 균주들과 PCR 산물 크기에 현저한 차이를 가지므로, 상기 조성물을 사용하여 PCR 산물 크기를 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 특이적으로 검출, 구분 및 판별할 수 있으므로, 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 존재 여부를 판별하는데 필요한 시간 및 노력을 절감할 수 있음을 알 수 있다.
상기 정방향 프라이머 혹은 역방향 프라이머의 5'-말단 또는 3'-말단에 연결된, 형광단, 발색단, 화학발광단, 자기입자 및 방사능동위원소로 이루어진 군에서 선택된 1종 이상의 표지를 추가로 포함하는 것일 수 있다.
상기 "표지(lable)" 또는 "검출가능한 표지(detectable label)"는 뉴클레오티드, 뉴클레오티드 중합체, 또는 핵산 결합 인자에 결합된 어떠한 화학적 모이어티를 의미할 수 있으며, 상기 결합은 공유결합 또는 비공유 결합일 수 있다. 바람직하게는, 상기 표지는 검출 가능하며, 본 발명의 실험자에게 검출될 수 있는 상기 뉴클레오티드 또는 뉴클레오티드 중합체일 수 있다. 검출가능한 표지는 발광 분자, 화학 발광 분자, 형광 색소, 형광 퀀칭제(quenching agent), 색깔 분자, 방사성 동위원소 또는 신틸런트(scintillant)를 포함한다. 검출가능한 표지는 또한, 임의의 유용한 링커 분자(예를 들어, 비오틴, 아비딘, 스트랩트아비딘, HRP, protein A, protein G, 항체 또는 그의 단편, Grb2, 폴리히스티딘, Ni2+, FLAG 태그, myc 태그), 중금속, 효소(예를 들어. 알칼라인 포스파타제, 퍼옥시다제 및 루시퍼라제), 전자 공여체(donor)/수용체(acceptor), 아크리디늄 에스테르, 염료(dye) 및 열량 측정 기질(calorimetric substrate)를 포함한다. 또한, 표면 플라스몬 공명(surface plasmon resonance) 검출의 경우와 같이, 질량의 변화(a change in mass)를 나타내는데 검출가능한 표지가 고려될 수 있다. 당업자는 상기 언급되지 않은 유용한 검출가능한 표지에 대해서도 용이하게 인식할 수 있을 것이며, 이들 또한 본 발명의 실시에 사용될 수 있다.
본 발명의 다른 측면은 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 조성물에 관한 것이다.
구체적으로 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트는, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 특이적으로 판별할 수 있다.
락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주는 CRISPR 영역이 두 개로 나누어 존재하는 유전체 구조적 특성을 갖는다. 상기 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 제외한 알려진 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주는 한 개의 CRISPR 영역을 갖는다. 이런 차이를 통해 기존에 알려진 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주들과 차이를 갖는 전혀 다른 위치의 서열을 확인하고, 이를 증폭할 수 있는 특이적 프라이머 세트를 설계하였으며, 이에 따라 증폭되는 길이에도 분명한 차이를 확인하였다.
상기 프라이머 세트(서열번호 7 및 15)를 포함하는 프라이머 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주와 유사하거나 동일한 종 및 속을 갖는 유사 균주들과 혼합되어 있는 시료에서도, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 특이적으로 검출할 수 있다.
후술하는 실험예에서 확인된 바와 같이, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 제외한 다른 락토바실러스(Lactobacillus) 균주뿐만 아니라 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주에 대해서도 전혀 PCR 산물을 합성하지 않으며, 대상이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 'CRISPR' 영역 유전자가 존재할 때만 이를 주형으로 하여 PCR 산물을 합성하므로, 상기 조성물을 사용하여 시료로부터 명확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 존재여부를 특이적으로 판별할 수 있다.
상기 프라이머 세트(서열번호 7 및 15)는, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 특이적으로 확인할 수 있고, PCR 산물 크기는 300 내지 350 bp, 바람직하게는 320 bp로 검출되는 것을 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 존재여부를 특이적으로 판별할 수 있다. 검출 또는 진단 대상이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 'CRISPR' 영역 유전자가 존재할 때만 이를 주형으로 하여 PCR 산물을 합성하게 되므로, PCR 검출시 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주만이 300 내지 350 bp 바람직하게는 320 bp의 산물이 검출되게 된다.
본 발명의 조성물의 표적이 되는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주(수탁번호 KCCM11808P)는 특허공개특허 제10-2018-0052569호에 공지된 균주로, 난소가 제거된 갱년기 동물모델에서 분포가 감소된 미생물 중에서 가장 큰 차이를 보인 균주이며, 상기 갱년기 동물모델에 투여시 갱년기 여성의 우울증 예방 또는 치료효과를 가지는 것으로 확인된 균주이다.
본 발명에 따른 증폭을 위한 표적이 되는 예시적인 "CRISPR 영역의 유전자 서열"은 하기 도 10, 11에 개략적으로 개시되어 있으며, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1의 완전한 게놈의 예시적인 뉴클레오티드 서열은 Genbank Accession No. CP025200.1에서 확인할 수 있다. 이에 반해 본 발명의 조성물의 특이성을 분석하기 위한 비교군으로 사용된 균주 중 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM의 CRISPR 영역의 전체 게놈 뉴클레오티드 서열은 각각 Genbank Accession No. NC_006814.3 에서 확인할 수 있다. 이외 나머지 비교를 위한 균주들 역시 Genbank Accession를 통해 전체 게놈 뉴클레오티드 서열을 확인할 수 있다.
상기 본 발명의 조성물에 포함되어 있는 프라이머 세트의 전체 프라이머의 최적 길이는 20 bp이고, Melting temperature(Tm)는 60 ℃이며, 프라이머 간의 최대 Tm 차이는 5 ℃ 이내이며, GC%가 50%인 것이다.
본 발명의 구체적인 실시예에 의하면, 본 발명의 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머를 포함하는 프라이머 세트들은 동일한 어닐링 온도 및 시간을 갖는 하나의 조건에서, 동일한 종속의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주들에 대해서는 전혀 PCR 산물이 합성되지 않고, 오로지 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주에서만 320 bp에서 PCR 산물이 합성되었음을 확인하였다. 이를 통해 동일한 속의 균주가 시료 상에 존재하더라도, 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주만을 특이적이고 명확하게 검출 및 판별할 수 있음을 확인하였으므로, 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 존재 여부를 판별하는데 필요한 시간 및 노력을 현저히 절감할 수 있음을 알 수 있다.
상기 프라이머 조성물은 정방향 프라이머 혹은 역방향 프라이머의 5'-말단 또는 3'-말단에 연결된, 형광단, 발색단, 화학발광단, 자기입자 및 방사능동위원소로 이루어진 군에서 선택된 1종 이상의 표지를 추가로 포함하는 것일 수 있다.
상기 "표지(label)" 또는 "검출가능한 표지(detectable label)"는 뉴클레오티드, 뉴클레오티드 중합체, 또는 핵산 결합 인자에 결합된 어떠한 화학적 모이어티를 의미할 수 있으며, 상기 결합은 공유결합 또는 비공유 결합일 수 있다. 바람직하게는, 상기 표지는 검출 가능하며, 본 발명의 실험자에게 검출될 수 있는 상기 뉴클레오티드 또는 뉴클레오티드 중합체일 수 있다. 검출가능한 표지는 발광 분자, 화학 발광 분자, 형광 색소, 형광 퀀칭제(quenching agent), 색깔 분자, 방사성 동위원소 또는 신틸런트(scintillant)를 포함한다. 검출가능한 표지는 또한, 임의의 유용한 링커 분자(예를 들어, 비오틴, 아비딘, 스트랩트아비딘, HRP, protein A, protein G, 항체 또는 그의 단편, Grb2, 폴리히스티딘, Ni2+, FLAG 태그, myc 태그), 중금속, 효소(예를 들어. 알칼라인 포스파타제, 퍼옥시다제 및 루시퍼라제), 전자 공여체(donor)/수용체(acceptor), 아크리디늄 에스테르, 염료(dye) 및 열량 측정 기질(calorimetric substrate)를 포함한다. 또한, 표면 플라스몬 공명(surface plasmon resonance) 검출의 경우와 같이, 질량의 변화(a change in mass)를 나타내는데 검출가능한 표지가 고려될 수 있다. 당업자는 상기 언급되지 않은 유용한 검출가능한 표지에 대해서도 용이하게 인식할 수 있을 것이며, 이들 또한 본 발명의 실시예에 사용될 수 있다.
본 발명의 다른 측면은 상기 프라이머 조성물을 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 키트에 관한 것이다.
상기 키트는 프라이머 조성물에 포함되는 프라이머 세트에 따라 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별 또는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별 용도로 사용될 수 있다.
상기 키트는 증폭 반응을 수행하기 위한 시약을 더 포함할 수 있고, 예를 들어 완충용액, DNA 중합효소, dNTP 및 증류수 등을 포함할 수 있으며, 이는 당업계에서 통상적으로 사용되는 용액, 효소 등이 제한없이 사용될 수 있다. 또한 상기 키트는 상기 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
상기 완충용액(buffer)은 증폭 반응에 첨가되어 상기 증폭 반응을 조절함으로서 상기 증폭 반응의 하나 이상의 요소를 안정성, 활성, 및/또는 수명을 변형시키는 화합물이다. 본 발명의 상기 완충액은 PCR 증폭 및 RNase H 절단 활성과 양립할 수 있다. 완충용액은 구체적으로, HEPES(4-(2-히드록시에틸)-1-피페라진에탄술폰산), MOPS(3-(N-morpholino)propanesulfonic acid)(3-(N-모르폴리노)-프로판술폰산) 및 아세테이트 또는 포스페이트를 포함하는 완충액 등을 포함하나 이에 한정하지는 않는다. 또한, PCR 완충용액은 일반적으로 약 70 mM 이하의 KCl 및 약 1.5 mM 또는 그 이상의 MgCl2, 약 50-200 uM의 각각의 dATP, dCTP, dGTP 및 dTTP를 포함할 수 있다. 본 발명의 완충액은 효율적인 역전사 효소-PCR 또는 PCR 반응을 최적화시키기 위해 첨가물을 포함할 수 있다.
상기 첨가물은 오염된 효소의 불활성화, 단백질 접힘의 안정화, 및/또는 응집의 감소에 영향을 미친다. 증폭 반응에 포함될 수 있는 첨가물의 예는 베타인, 포름아미드, KCl, CaCl2, MgOAc, MgCl2, NaCl, NH4OAc, NaI, Na(CO3)2, LiCl, MnOAc, NMP, 트레할로스, 데미에틸술폭시드(DMSO), 글리세롤, 에틸렌 글리콜, 디티오트레이톨(DTT), 피로포스파타제(Thermoplasma acidophilum 무기 피로포스파타제(inorganic pyrophosphatase, TAP)를 포함하나, 이에 한정하지 않는다.), 우혈청 알부민(BSA), 프로필렌 글리콜, 글리신아미드, CHES, 퍼콜(Percoll), 아우린트리카르복실산, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100, CHAPS, CHAPSO, Mackernium, LDAO(N-도데실-N,N-디메틸아민-N-옥시드), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E. Coli SSB, RecA, 닉킹 엔도뉴클레아제(nicking endonucleases), 7-디아자G, dUTP, 음이온 디터전트(anionic detergent), 양이온 디터전트(cationic detergent), 비-이온 디터전트(nonionic detergent), zwittergent, 스테롤, 삼투조절물질(osmolyte), 양이온, 및 증폭의 효율을 변화시킬 수 있는 기타 화합물, 단백질, 또는 보조인자를 포함하나, 이에 한정하지 않는다. 일 구체예에서, 2 이상의 첨가물이 증폭 반응에 포함된다. 상기 첨가물이 RNase H의 활성을 방해하지 않는다면, 첨가물은 프라이머 어닐링의 선택성을 향상시키기 위해 선택적으로 첨가될 수 있다.
본 발명자들은 시료 내에 존재하는 미생물들 중에서, 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종들의 CRISPR 영역 유전자를 표적으로 하는 프라이머 세트(정방향 프라이머와 역방향 프라이머 혹은 Left primer와 Right primer)를 개발하였고, 상기 증폭된 CRISPR 영역의 염기서열들의 존재 유무와 길이를 비교 분석함으로써, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 존재 유무를 정확하게 검출하거나, 임의의 균주의 균종을 정확하고 신속하게 특정할 수 있을 뿐만 아니라, 특정 균주에 대해서는 정확한 균명까지 판별, 구별할 수 있는 방법을 개발하였다. 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머와 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성되는 프라이머 세트는 락토바실러스 애시도필러스(Lactobacillus acidophilus)의 CRISPR 염색체를 증폭하며, 특히 서열번호 1 내지 6 중에서 선택되는 어느 하나 이상의 정방향 프라이머와 서열번호 9 내지 14 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트는 상기 증폭된 CRISPR 영역의 염색체 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주가 모두 가지고 있는 spacer 1 내지 spacer 5의 영역 중에서 선택되는 하나 이상의 영역을 증폭하는 프라이머를 이용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 범용적으로 판별할 수 있다. 실제 PCR 분석에 서열번호 1 및 서열번호 9의 프라이머 조성물을 이용할 경우, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주는 100 내지 400 bp, 바람직하게는 267 bp의 PCR 산물 크기를 갖고 있는 것으로 확인되었고, 이는 프라이머 세트로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 균주의 CRISPR 구간에 대한 PCR 산물(spacer 1~5) 223 bp와 서열번호 1 및 9의 프라이머 세트 서열(44 bp)가 합해져서 측정된 것이므로, PCR 분석시 PCR 산물 크기 267 bp에 속한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주라 판별할 수 있다.
상기 프라이머 조성물은 다른 균주에서는 PCR 산물을 생성하지 않고 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주에 대해서만 PCR 산물(예컨대, 서열번호 1 및 9의 프라이머 조성물의 경우 200 내지 300 bp, 구체적으로 267bp의 PCR 산물)이 생성되므로, PCR 산물의 시퀀싱을 통한 검증 없이 명확하고 확연하게 구별할 수 있다.
또한, 본 발명자들은 CRISPR 영역의 염색체 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 서열 길이가 종래 다른 균주들과는 달리 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)를 가지고 있으므로, 결과적으로 이를 이용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 판별할 수 있음을 확인하였다. 이를 기반으로 설계된 프라이머 세트 중에서 PCR 분석에 서열번호 8 및 서열번호 16으로 구성된 프라이머 세트는, 생성된 PCR 산물의 크기를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 중에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 각각 판별할 수 있었다. 여기에 서열번호 7 및 서열번호 15로 구성된 프라이머 세트를 조합할 경우에는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1까지 구별할 수 있다.
구체적으로 서열번호 8 및 서열번호 16으로 구성된 프라이머 세트를 사용하였을 때, PCR 산물이 약 150~200 bp의 크기를 갖는 경우, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주로 확인 및 판별할 수 있으며, 이는 프라이머 세트로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 CRISPR 구간에 대한 PCR 산물 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)과 서열번호 8 및 16의 프라이머 세트 서열(40 bp)가 합해져서 측정된 것이므로, PCR 분석시 PCR 산물 크기 150 내지 250 bp에 속한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주라 판별할 수 있다. 다른 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주와 달리 PCR 산물 크기가 800 내지 1500 bp, 바람직하게는 800 내지 1000 bp에 해당되므로, 명확하고 확연하게 구별가능하다.
또한, 본 발명자들은 상기 증폭된 CRISPR 영역의 염색체 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주만이 320 bp를 가지고 있음을 파악하여, 결과적으로 이를 이용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 판별할 수 있는 서열번호 7 및 서열번호 15의 프라이머 세트를 개발하였으며, 상기 프라이머 세트로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 CRISPR 구간에 대한 PCR 산물 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)과 서열번호 7 및 15의 프라이머 세트 서열(40 bp)가 합해져서 측정된 것이므로, PCR 분석시 PCR 산물 크기 320 bp에 속한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주라 판별할 수 있다. 다른 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주와 달리 PCR 산물을 생성하지 않음으로 명확하고 확연하게 구별가능하다.
본 발명의 또 다른 측면은 하기 단계를 포함하는 상기 프라이머 조성물을 이용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 판별하기 위한 방법에 관한 것이다.
a) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및 b) 상기 PCR 산물의 존재를 확인하는 단계를 포함한다.
또한, 본 발명의 또 다른 측면은 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 존재를 검출하기 위한 방법에 관한 것으로, 하기 단계를 포함할 수 있다.
i) 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 ii) PCR 산물의 형성여부 확인하는 단계;를 포함한다.
우선 a) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 이용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하여, PCR 산물을 얻는다.
상기 시료로부터 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으나, 상기 DNA 추출법은 바람직하게는 알카라인 추출법(Alkaline extraction method), 열수추출법, 컬럼(Column) 추출법 또는 페놀/클로로포름(Phenol/Chloroform) 추출법일 수 있으며, 더욱 바람직하게는 알카라인 추출법(Alkaline extraction method)일 수 있다.
상기 판별 대상 시료는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주의 존재유무를 검출하고자 하는 다양한 시료를 포함할 수 있으며, 바람직하게는 임상적, 환경적 또는 식품 시료일 수 있다.
상술한 바와 같이 프라이머가 설계되고, 판별 대상 시료로부터 DNA가 준비되면, 이의 증폭은 중합효소 연쇄 반응(PCR), 핵산 서열 기반 증폭(NASBA), 리가제 연쇄 반응(LCR), 및 롤링 서클 증폭(RCA)을 포함한 다양한 방법에 의해 수행될 수 있으나, 상기 중합효소 연쇄 반응(PCR)이 특이적인 표적 DNA 서열을 증폭하는데 가장 일반적이고, 바람직하다.
또한 상기 PCR은 실시간(real-time) PCR, qRT-PCR 또는 RT-PCR일 수 있으나, 이에 한정되지 않는다.
본 발명에서 "중합 효소 연쇄 반응(polymerase chain reaction)" 또는 "PCR"란, 일반적으로 원하는 표적 서열을 인 비트로(in vitro)에서 증폭하는 방법을 말하는 것으로, 이는 당업계에서 통상적으로 사용되는 과정이라면 특별히 이에 한정되지 않는다. 예를 들어 상기 PCR 과정은 2배 몰농도 이상 과량의, 상기 이중 가닥 표적 서열의 반대 가닥에 상보적인 올리고뉴클레오티드 프라이머를 원하는 표적 서열(들)을 포함하는 반응 혼합물에 넣는 단계로 이루어져 있다. 상기 반응 혼합물은 DNA 중합효소의 존재 하에 온도 싸이클링(thermal cycling) 프로그램에 적용하여, 상기 DNA 프라이머 세트 사이의 원하는 표적 서열을 증폭하도록 한다.
또한, 상기 과정을 통해 얻은 PCR 산물은 "PCR 절편(PCR fragment)" 또는 "역전사 효소-PCR 절편(reverse transcriptase-PCR fragment)" 또는 "앰플리콘(amplicon)"이라고도 하며, 특정한 표적 핵산의 증폭에 따라 생성되는 폴리뉴클레오티드 분자(또는 집합적으로 분자의 다수)를 의미한다. PCR 절편은 일반적으로, DNA PCR 절편을 의미하나, 이에 한정하는 것은 아니다. PCR 절편은 단일 가닥 또는 이중 가닥, 또는 임의의 농도비에 따른 그의 혼합물일 수 있다. PCR 절편 또는 역전사 효소-PCR 절편은 100-500개의 뉴클레오티드 또는 그 이상일 수 있다.
상기 증폭된 PCR 산물을 분석하여, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 존재를 확인 및 판별할 수 있다. 상기 분석을 위한 방법으로는 PCR 산물의 염기서열을 분석하거나 증폭산물의 크기를 확인 분석하여(예컨대 서열번호 1 및 9의 프라이머 조성물의 경우 PCR 산물의 크기가 100 내지 400 bp, 바람직하게는 260 내지 280 bp, 가장 바람직하게는 267bp로 확인됨) 분류함으로써 수행되는 것일 수 있다.
본 발명에서는 증폭된 PCR 산물의 생성 유무를 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주가 있는지를 확인하거나, 검출할 수 있고, 미지의 균주가 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균종에 속하는지를 판별할 수 있다.
즉, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 특이적으로 나타나는 PCR 산물에 대한 정보를 축적하고, 특이적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 높은 신뢰도로 정확하고 빠르게 판별 및 분석할 수 있다.
이때 상기 PCR 산물은 100 내지 400 bp에서 관찰된다면, 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주가 존재한다고 분명하게 판별할 수 있다.
구체적으로 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주가 존재한다면, 서열번호 1의 정방향 프라이머와 서열번호 9의 역방향 프라이머를 사용할 경우에는 267 bp의 PCR 산물이, 서열번호 2의 정방향 프라이머와 서열번호 10의 역방향 프라이머를 사용할 경우에는 208 bp의 PCR 산물이, 서열번호 3의 정방향 프라이머와 서열번호 11의 역방향 프라이머를 사용할 경우에는 147 bp의 PCR 산물이, 서열번호 4의 정방향 프라이머와 서열번호 12의 역방향 프라이머를 사용할 경우에는 207 bp의 PCR 산물이, 서열번호 5의 정방향 프라이머와 서열번호 13의 역방향 프라이머를 사용할 경우에는 148 bp의 PCR 산물이, 서열번호 6의 정방향 프라이머와 서열번호 14의 역방향 프라이머를 사용할 경우에는 146 bp의 PCR 산물이 관찰된다. 또한, 서열번호 7의 정방향 프라이머와 서열번호 15의 역방향 프라이머를 사용할 경우에는 300 내지 350 bp 바람직하게는 320 bp의 PCR 산물이 관찰되는데, 이를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주의 존재를 판별하거나, 특히 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주가 존재함을 검출하거나, 판별할 수 있다.
또한, 서열번호 8의 정방향 프라이머와 서열번호 16의 역방향 프라이머를 사용할 경우에는 150 내지 250 bp, 바람직하게 150 내지 200 bp의 PCR 산물이 관찰되며, 이 경우, 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주가 존재함을 분명하게 판별할 수 있다.
본 발명의 다른 측면은 A) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
B) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별하기 위한 방법에 관한 것이다.
또한, 본 발명의 다른 측면은 Ⅰ) 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 Ⅱ) PCR 산물의 형성여부 확인하는 단계;를 포함하는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 검출하기 위한 방법에 관한 것이다.
우선 A) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 상기 조성물을 이용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하여, PCR 산물을 얻는다.
상기 시료로부터 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으나, 상기 DNA 추출법은 바람직하게는 알카라인 추출법(Alkaline extraction method), 열수추출법, 컬럼(Column) 추출법 또는 페놀/클로로포름(Phenol/Chloroform) 추출법일 수 있으며, 더욱 바람직하게는 알카라인 추출법(Alkaline extraction method)일 수 있다.
상기 판별 대상 시료는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 검출하고자 하거나 혹은 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 존재 유무를 검출하고자 하는 다양한 시료를 포함할 수 있으며, 바람직하게는 임상적, 환경적 또는 식품 시료일 수 있다.
상술한 바와 같이 프라이머가 설계되고, 판별 대상 시료로부터 DNA가 준비되면, 이의 증폭은 중합효소 연쇄 반응(PCR), 핵산 서열 기반 증폭(NASBA), 리가제 연쇄 반응(LCR), 및 롤링 서클 증폭(RCA)을 포함한 다양한 방법에 의해 수행될 수 있으나, 상기 중합효소 연쇄 반응(PCR)이 특이적인 표적 DNA 서열을 증폭하는데 가장 일반적이고, 바람직하다.
또한 상기 PCR은 실시간(real-time) PCR, qRT-PCR 또는 RT-PCR일 수 있으나, 이에 한정되지 않는다.
본 발명에서 "중합 효소 연쇄 반응(polymerase chain reaction)" 또는 "PCR"란, 일반적으로 원하는 표적 서열을 인 비트로(in vitro)에서 증폭하는 방법을 말하는 것으로, 이는 당업계에서 통상적으로 사용되는 과정이라면 특별히 이에 한정되지 않는다. 예를 들어 상기 PCR 과정은 2배 몰농도 이상 과량의, 상기 이중 가닥 표적 서열의 반대 가닥에 상보적인 올리고뉴클레오티드 프라이머를 원하는 표적 서열(들)을 포함하는 반응 혼합물에 넣는 단계로 이루어져 있다. 상기 반응 혼합물은 DNA 중합효소의 존재 하에 온도 싸이클링(thermal cycling) 프로그램에 적용하여, 상기 DNA 프라이머 세트 사이의 원하는 표적 서열을 증폭하도록 한다.
또한, 상기 과정을 통해 얻은 PCR 산물은 "PCR 절편(PCR fragment)" 또는 "역전사 효소-PCR 절편(reverse transcriptase-PCR fragment)" 또는 "앰플리콘(amplicon)"이라고도 하며, 특정한 표적 핵산의 증폭에 따라 생성되는 폴리뉴클레오티드 분자(또는 집합적으로 분자의 다수)를 의미한다. PCR 절편은 일반적으로, DNA PCR 절편을 의미하나, 이에 한정하는 것은 아니다. PCR 절편은 단일 가닥 또는 이중 가닥, 또는 임의의 농도비에 따른 그의 혼합물일 수 있다. PCR 절편 또는 역전사 효소-PCR 절편은 100-500개의 뉴클레오티드 또는 그 이상일 수 있다.
상기 증폭된 PCR 산물을 분석하여, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 확인 및 검출할 수 있다. 상기 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주는 바람직하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주일 수 있다.
상기 방법을 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1까지 확인 및 검출하기 위해서는 상기 프라이머 세트에 서열번호 7 및 서열번호 15로 구성된 프라이머 세트를 더 포함하는 것이 바람직하다.
본 발명에서는 증폭된 PCR 산물의 생성 유무를 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출하거나, 판별할 수 있다. 나아가 본 발명에서는 증폭된 PCR 산물의 유전자 단편을 분석하거나, 증폭산물의 크기를 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별할 수 있다. 구체적으로 동일한 어닐링 온도 및 시간을 갖는 하나의 조건에서, 동일한 종속의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주들 각각 165bp, 837bp, 898bp, 900bp, 1000bp로 나타나는 서로 다른 크기의 PCR 산물을 합성하므로, 이를 통해 시료 내에 존재하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 확인 및 판별할 수 있다.
즉, PCR산물 크기가 약 898bp인 경우에는 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM에 해당하고, 165 bp인 경우에는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1인 것으로 판별할 수 있다.
본 발명에 따른 방법은, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주에 특이적으로 나타나는 PCR 산물에 대한 정보를 축적하고, 축적된 정보에 근거하여 Lactobacillus acidophilus LA1 균주와 동일한 속종의 균주들과의 유전자 정보를 비교함으로써, 특이적으로Lactobacillus acidophilus LA1 균주를 높은 신뢰도로 정확하고 빠르게 판별 및 분석할 수 있다.
이때 상기 상기 PCR 산물 중에서 150 내지 250 bp, 바람직하게 150 내지 200 bp인 것이 있을 경우, 시료 내에 Lactobacillus acidophilus 균주 중에서도 Lactobacillus acidophilus LA1 균주가 존재함을 분명하게 판별할 수 있다.
본 발명의 다른 측면은 1) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및 2) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별하기 위한 방법에 관한 것이다.
또한 본 발명은 ㄱ) 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계; 및 ㄴ) PCR 산물의 형성여부 확인하는 단계;를 포함하는 임상적, 환경적 또는 식품 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 검출하기 위한 방법에 관한 것이다.
우선 1) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 상기 조성물을 이용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 수행하여, PCR 산물을 얻는다.
상기 시료로부터 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으나, 상기 DNA 추출법은 바람직하게는 알카라인 추출법(Alkaline extraction method), 열수추출법, 컬럼(Column) 추출법 또는 페놀/클로로포름(Phenol/Chloroform) 추출법일 수 있으며, 더욱 바람직하게는 알카라인 추출법(Alkaline extraction method)일 수 있다.
상기 판별 대상 시료는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 존재유무를 검출하고자 하는 다양한 시료를 포함할 수 있다.
상술한 바와 같이 프라이머가 설계되고, 판별 대상 시료로부터 DNA가 준비되면, 이의 증폭은 중합효소 연쇄 반응(PCR), 핵산 서열 기반 증폭(NASBA), 리가제 연쇄 반응(LCR), 및 롤링 서클 증폭(RCA)을 포함한 다양한 방법에 의해 수행될 수 있으나, 상기 중합효소 연쇄 반응(PCR)이 특이적인 표적 DNA 서열을 증폭하는데 가장 일반적이고, 바람직하다.
또한 상기 PCR은 실시간(real-time) PCR, qRT-PCR 또는 RT-PCR일 수 있으나, 이에 한정되지 않는다.
본 발명에서 "중합 효소 연쇄 반응(polymerase chain reaction)" 또는 "PCR"란, 일반적으로 원하는 표적 서열을 인 비트로(in vitro)에서 증폭하는 방법을 말하는 것으로, 이는 당업계에서 통상적으로 사용되는 과정이라면 특별히 이에 한정되지 않는다. 예를 들어 상기 PCR 과정은 2배 몰농도 이상 과량의, 상기 이중 가닥 표적 서열의 반대 가닥에 상보적인 올리고뉴클레오티드 프라이머를 원하는 표적 서열(들)을 포함하는 반응 혼합물에 넣는 단계로 이루어져 있다. 상기 반응 혼합물은 DNA 중합효소의 존재 하에 온도 싸이클링(thermal cycling) 프로그램에 적용하여, 상기 DNA 프라이머 세트 사이의 원하는 표적 서열을 증폭하도록 한다.
또한, 상기 과정을 통해 얻은 PCR 산물은 "PCR 절편(PCR fragment)" 또는 "역전사 효소-PCR 절편(reverse transcriptase-PCR fragment)" 또는 "앰플리콘(amplicon)"이라고도 하며, 특정한 표적 핵산의 증폭에 따라 생성되는 폴리뉴클레오티드 분자(또는 집합적으로 분자의 다수)를 의미한다. PCR 절편은 일반적으로, DNA PCR 절편을 의미하나, 이에 한정하는 것은 아니다. PCR 절편은 단일 가닥 또는 이중 가닥, 또는 임의의 농도비에 따른 그의 혼합물일 수 있다. PCR 절편 또는 역전사 효소-PCR 절편은 100-500개의 뉴클레오티드 또는 그 이상일 수 있다.
상기 증폭된 PCR 산물을 분석하여, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 존재를 확인 및 판별할 수 있다. 상기 분석을 위한 방법으로는 PCR 산물의 염기서열을 분석하거나, 증폭산물의 크기를 확인하여 300 내지 350 bp 바람직하게는 320 bp 수행되는 것일 수 있다.
본 발명에서는 증폭된 PCR 산물의 생성 유무를 분석하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 검출하거나, 판별할 수 있다. 나아가 본 발명에서는 증폭된 PCR 산물의 유전자 단편을 분석하여 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 판별한다.
즉, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주에 특이적으로 나타나는 PCR 산물에 대한 정보를 축적하고, 축적된 정보에 근거하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주와 동일한 속종의 균주들과의 유전자 정보를 비교함으로써, 특이적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 높은 신뢰도로 정확하고 빠르게 판별 및 분석할 수 있다.
이때 상기 상기 PCR 산물 중에서 300 내지 350 bp 바람직하게는 320 bp인 것이 있을 경우, 시료 내에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주가 존재함을 분명하게 판별할 수 있다.
이하에서 실시예 등을 통해 본 발명을 더욱 상세히 설명하고자 하며, 다만 이하에 실시예 등에 의해 본 발명의 범위와 내용이 축소되거나 제한되어 해석될 수 없다. 또한, 이하의 실시예를 포함한 본 발명의 개시 내용에 기초한다면, 구체적으로 실험 결과가 제시되지 않은 본 발명을 통상의 기술자가 용이하게 실시할 수 있음은 명백한 것이며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속하는 것도 당연하다.
또한 이하에서 제시되는 실험 결과는 상기 실시예 및 비교예의 대표적인 실험 결과만을 기재한 것이며, 아래에서 명시적으로 제시하지 않은 본 발명의 여러 구현예의 각각의 효과는 해당 부분에서 구체적으로 기재하도록 한다.
실시예 1. 락토바실러스 애시도필러스( Lactobacillus acidophilus) 의 CRISPR 구조 분석 및 프라이머 세트 설계.
유전체 정보가 알려진 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 21개 균주들의 게놈을 비교 분석하였다. 구체적으로 상기 21종의 균주는 다음과 같다(반복되는 기재를 생략하기 위해, 하기에서는 균주 표기 중 국문을 생략하기로 한다): L. acidophilus YT1, L. acidophilus NCFM(GCA 000011985.1), L. acidophilus ATCC 4796(GCA 000159715.1), L. acidophilus La-14 (GCA 000389675.2), L. acidophilus DSM 20242(GCA 000442825.1), L. acidophilus CIRM-BIA 442(GCA 000442865.1), L. acidophilus DSM 9126(GCA 000469745.1), L. acidophilus CIRM-BIA 445(GCA 000469765.1), L. acidophilus CFH(GCA 000497795.1), L. acidophilus JCM 1132(GCA 000615165.1), L. acidophilus ATCC 4356(GCA 000786395.1), L. acidophilus FSI4(GCA 000934625.1), L. acidophilus DSM 20079(GCA 001433895.1), L. acidophilus NBRC 13951(GCA 001591845.1), L. acidophilus WG-LB-IV(GCA 001639165.1), L. acidophilus KLDS 1.0901(GCA 001868765.1), L. acidophilus L-55(GCA 001950045.1), L. acidophilus ATCC 53544(GCA 002224305.1), L. acidophilus LA1(GCA 002286215.1), L. acidophilus P2(GCA 002406675.1), L. acidophilus LMG P-21904(GCA 002914945.1).
이러한 21종 균주의 게놈을 NCBI Genome 사이트 (https://www.ncbi.nlm.nih.gov/genome/genomes/1099) 에서 확보하였다. 각 균주의 게놈 정보에서, 진화적 히스토리를 알 수 있는 CRISPR 지역을 CRISPRCasFinder(version 1.0) 통해 분석하였고, 각 균주의 CRISPR 구성을 비교하여 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus)가 공유하는 서열위치를 확인하였다.
도 1은 실시예 1을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주(21종)들의 CRISPR 구조 분석 결과이다.
이를 살펴보면, CRISPR 지역에서, 21종의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주들이 spacer 1번 부터 5번까지의 영역을 공통으로 포함하고 있음을 확인하였다.
따라서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주들이 공통적으로 갖는 CRISPR spacer 1번 내지 spacer 5번을 이용하여, 상기 균주들 중에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주들을 특이적으로 검출할 수 있는 마커(프라이머 세트)를 설계하고자 하였고, 그 결과 서열번호 1 및 9의 프라이머 세트와 서열번호 2 및 10의 프라이머 세트, 서열번호 3 및 11의 프라이머 세트, 서열번호 4 및 12의 프라이머 세트, 서열번호 5 및 13의 프라이머 세트, 서열번호 5 및 14의 프라이머 세트를 최종 디자인하였다.
상기 프라이머 세트 중에서 서열번호 1, 9로 표시되는 프라이머 세트 설계와 이를 통해 얻을 수 있는 PCR 증폭산물 크기를 도 2에 나타내었다. 보다 상세하게는 도 2는 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 특이적으로 검출할 수 있는 서열번호 1, 9로 표시되는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때, 인 실리코 분석(in silico)을 통해 분석한 해당 균주의 PCR 산물 크기를 도시화한 것이다.
상기 프라이머 세트는 도 2에서와 같이 서열번호 1로 표시되는 정방향 프라이머 및 서열번호 9로 표시되는 역방향 프라이머를 포함한다. 도 2에 나타난 바와 같이, 상기 첫 번째 CRISPR 영역에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주들이 공통적으로 갖는 spacer 들을 포함하는 프라이머를 개발함으로써, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주를 특이적으로 검출할 수 있는 마커를 제작하였다. 구체적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 1번 spacer 지역의 10번째 위치부터 24 bp를 left primer로, 5번 spacer 지역의 20번째 위치부터 20bp 를 right primer로 제작하여, 이를 통해 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주에 대해 범용적으로 적용이 가능하며, 다른 속 종의 균주들과 확실히 구별할 수 있음을 알 수 있다.
또한 본 발명을 통해 설계된 프라이머 세트를 이용하여, PCR을 수행하여 PCR 산물을 얻을 경우, PCR 산물의 길이를 인실리코 모델링(in silico modeling)을 이용하여 분석하였고, 그 결과를 도 3의 하단에 표기하였다. 분석 결과 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주들의 PCR 산물의 길이는 267 bp로 확인되었다.
즉, 본 발명에 따른 프라이머 세트를 이용할 경우, 시료에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주의 존재 유무를 검출할 수 있다.
본 발명에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주 판별용 프라이머 세트를 제조하기 위하여, 가장 중요하게 여긴 것은 전체 프라이머의 길이로, 20 내지 30 bp를 가지도록 디자인하였다. 바람직하게 상기 프라이머 세트는 각각의 프라이머 길이가 서로 동일하거나 상이할 수 있고, 구체적으로 서열번호 1로 표시되는 정방향 프라이머는 24 bp, 서열번호 9로 표시되는 역방향 프라이머는 20 bp일 수 있다. 또한 상기 프라이머는 Melting temperature(Tm)이 57℃ 내지 63℃, 바람직하게는 60℃로 디자인하였고, 프라이머 간의 최대 Tm 차이는 3~5℃ 이내로 한정하였다. 또한, GC%가 50% 내지 37.5%로 설계하였다.
이렇게 제작된 서열번호 1 및 9의 프라이머 세트 조성물이 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주에 대하여 특이성을 가지는지 여부를 인 실리코 분석(in silico) 및 현존 NCBI DB상의 sequence match를 통해 분석하였고, 그 결과를 살펴보면(도 3), 본 발명을 통해 설계된 프라이머 세트 조성물은 NCBI에 등록된 서열 중 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주 이외에는 증폭할 수 있는 균주가 없음을 확인하였다.
도 3은 인 실리코(in silico)에서, 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus)를 특이적으로 검출할 수 있는 서열번호 1, 9로 표시되는 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, Primer-BLAST란 서열검색 프로그램으로 시퀀스를 분석한 결과이다. 이때, 도 3a는 프로그램의 윗 화면이고, 도 3b는 구체적인 프로그램 분석 결과 부분을 취합하여 나타낸 것이다. Primer-BLAST 웹서비스에 접속하여 PCR Template로 CP000033.3(L. acidophilus NCFM 유전체의 Accession No.), forward primer의 범위 1,541,067 ~ 1,541,099(spacer 1 의 유전체 상 위치), reverse primer 의 범위 1,541,311 ~ 1,541,343(spacer 5 의 유전체 상 위치) 로 지정한 후 Primer Parameters의 forward primer 서열에 CRISPR_LA_uni_F(서열번호 1)을, reverse primer 서열에 CRISPR_LA_uni_R(서열번호 9)을 입력한 후 데이터베이스를 "nr" (또는 Nucleotide collection)로, 대상 Organism은 없음으로 지정했다. 나머지 설정은 기본설정을 유지한 상태로 프로그램을 실행했다.
그 결과 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주 판별용 범용 프라이머 세트는 NCBI에 현존하는 서열에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1, 락토바실러스 애시도필러스(Lactobacillus acidophilus) DSM 20079, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ACTC 53544, 락토바실러스 애시도필러스(Lactobacillus acidophilus) FSI14, 락토바실러스 애시도필러스(Lactobacillus acidophilus) La-14, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM을 증폭한다는 분석결과를 얻었다. 구체적으로는 도 3의 "Specificity of primers" 항목에서 다음과 같이 표시되었다. "Primer may not be specific to the input PCR template as targets were found in selected database: Nucleotide collection(nt)". 이는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주 중 특정한 균주(strain)을 증폭하지는 않으나 검색된 항목이 모두 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주에 속하므로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 범용적인 프라이머로 사용될 수 있음을 시사한다.
실시예 2. 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 배양
락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 게놈 해독을 위해, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다.
실시예 3. 락토바실러스 애시도필러스 (Lactobacillus acidophilus) LA1 균주의 게놈 확보
락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 게놈 해독을 위해, 실시예 2의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하고, PacBio RS II 시퀀싱 플랫폼(sequencing platform)을 이용하여 전체 게놈 염기서열을 확보하였다.
유전체 결과는 HGAP 3.0을 이용하여, 각 염기서열(sequence read) 조립(assembly)을 수행하였으며, 수행과정에서 전체 유전체의 시작점을 확정하기 위해 chromosomal replication 개시 유전자인 dnaA의 위치를 확인하였다.
실시예 4. 락토바실러스 애시도필러스( Lactobacillus acidophilus) LA1 균주의 게놈 비교
락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 게놈상에 존재하는 유전자의 기능을 확인하기 위하여 NCBI Prokaryotic Genome Annotation Pipeline(PGAAP)를 활용하였다.
이후, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 게놈과 동일 속의 유사균주 9종들의 게놈을 비교 분석하였다. 구체적으로 상기 9종의 균주는 다음과 같다. L. acidophilus NCFM(assembly accession: GCF_000011985.1), L. acidophilus La-14(GCF_000389675.2), L. acidophilus FSI4(GCF_000934625.1), L. gallinarum HFD4(GCF_001314245.2), L. helveticus CNRZ32(GCF_000422165.1), L. crispatus ST1(GCF_000091765.1), L. kefiranofaciens ZW3(GCF_000214785.1), L. amylovorus GRL1118(GCF_000194115.1), L. acetotolerans NBRC 13120(GCF_001042405.1). 이러한 9종 균주의 게놈을 확보하여 전체 게놈 정보를 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주와 동일한 방법으로 분석하였다.
9종 균주의 16S rRNA 유전자 정보를 활용하여 Tamura-Nei model에 근거한 maximum likelihood 방법으로 분자 계통도를 작성하였고, 전체 게놈의 유사도 분석을 위해 Orthologous average nucleotide identity(OrthoANI)를 이용하여 게놈 비교 후 전체 게놈정보에 기반한 분자 계통도를 함께 작성하여 실제로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 연관 미생물들이 얼마나 관련이 있는지를 확인하였다.
추가적으로, 각 균주에서, 파지(phage) 감염 정보를 알 수 있는 CRISPR 지역을 CRISPR finder 통해 분석하였고, 각 균주의 CRISPR 구성을 비교하였다.
도 4는 실시예 3을 통해 분석한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1의 전체 게놈 구성도로, 이를 살펴보면, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 게놈 분석결과 LA1의 전체 게놈은 1.99-Mbp의 circular chromosome(34.7% G+C content)이며, 1,953개의 유전자를 가지고 있고, 76개의 RNA gene와 33개의 psedo gene을 가지고 있는 것으로 확인 되었다.
도 5a는 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 비롯한 10종 균주의 16S rRNA 유전자를 활용한 계통도이고, 도 5b는 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 비롯한 10종 균주의 ANI genome 비교를 활용한 계통도이다.
도 5에 나타난 바와 같이 16S rRNA 유전자 및 OrthoANI를 이용한 분자계통도를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 포함하여 총 10종의 균주들의 유연관계를 확인할 수 있었다. 구체적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 4종 strain(L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 및 L. acidophilus LA1)은 각 균주간의 차이를 거의 확인할 수 없을 정도로 매우 유사하였다.
도 6은 실시예 4를 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1를 비롯한 10종 균주들 중에서, L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 및 L. acidophilus LA1의 CRISPR 구조 분석 결과이다. 구체적으로 도 6은 실시예 4로부터 분석한 L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 및 L. acidophilus LA1의 전체 게놈 정보 중에서 CRISPR 지역만을 따로 분석한 결과이다.
이를 살펴보면, CRISPR 지역에서, L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4과 L. acidophilus LA1 균주들의 염기서열에 명확한 차이가 있음을 확인하였다. 특히 L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 균주에서는 32개 spacer 지역이 존재하는 반면에 L. acidophilus LA1에서는 6~17번 spacer 지역이 전부 소실 되어 있다.
따라서 CRISPR 구조의 차이를 이용하여, 일반 시료에서 L. acidophilus 균주를 특이적으로 구분 및 검출할 수 있을 뿐만 아니라, 구체적으로는 상기 균주들 중에서 L. acidophilus LA1 균주를 특이적으로 검출할 수 있는 마커를 설계하고자 하였고, 이를 도 7에 나타내었다. 보다 상세하게 도 7은 L. acidophilus LA1를 특이적으로 검출할 수 있는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때 인 실리코 분석(in silico)을 통해 각 균주의 PCR 산물 크기를 도시화한 것이다.
도 7에 나타난 바와 같이, L. acidophilus 균주는 종래 다른 균주들과는 달리 CRISPR 영역을 포함하고 있으므로, 이를 통해 특이적으로 구분할 수 있음을 알 수 있다. 또한 L. acidophilus LA1 균주는 다른 균주들과는 달리, CRISPR 6~17번 영역의 염기서열이 소실되어 있다는 점에 특징이 있으므로, 이러한 특징을 통해 L. acidophilus LA1 균주를 분명히 구분할 수 있음을 확인하였다. 이를 위해 상기 CRISPR 6~17번 영역을 포함하는 프라이머를 개발함으로써, L. acidophilus 균주 바람직하게는 L. acidophilus LA1 균주를 특이적으로 검출할 수 있는 마커를 제작하였다. 구체적으로 L. acidophilus NCFM, Lacidophilus La-14 및 L. acidophilus FSI4 기준으로 6번 spacer 지역에서 left primer를 제작하였고, 20번 spacer 지역에서 right primer 제작하였고, 이를 통해 본 발명의 L. acidophilus LA1 균주를 확실히 구별할 수 있음을 알 수 있다.
또한 본 발명을 통해 설계된 프라이머 세트를 이용하여, 각 균주에 PCR을 수행하여 PCR 산물을 얻을 경우, PCR 산물의 길이를 인실리코 모델링(in silico modeling)을 이용하여 분석하였고, 그 결과를 도 7의 하단에 표기하였다. 분석 결과 L. acidophilus NCFM, Lacidophilus La-14, L. acidophilus FSI4 등의 타 L. acidophilus 균주에서는 PCR 산물의 길이가 약 898bp(883bp + 8bp의 프라이머와 7bp의 다이서)임을 확인하였고, L. acidophilus LA1의 PCR 산물의 길이는 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)로 확인되었다.
즉, 본 발명에 다른 프라이머 세트를 이용할 경우, 시료에서 L. acidophilus 균주의 존재 유무를 검출할 수 있고, PCR 산물의 길이만으로도 상기 L. acidophilus 균주들 중에서 L. acidophilus LA1를 확실히 구별할 수 있음을 알 수 있다.
다음, 인 실리코(in silico)에서, 본 발명의 L. acidophilus 균주 판별용 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, BLASTN 이란 서열검색 프로그램으로 sequence를 분석하였다.
20bp 가량의 짧은 서열을 검색하기 위하여 BLAST 검색조건 중 task 는 "blastn-short" 로, e-value 는 1.0, low-complexity 필터링 조건인 dust을 제외하고 검색했다. 검색한 결과는 하기 표 2 내지 9의 "align_code" 열 에서 보듯이 일치하는 코드는 'O', 불일치하는 코드는 '/', 그리고 align 되지 않은 부분은 '-'로 표시하여 시각적으로 유사도를 판단했다. 검색결과 L. acidophilus 종은 모두 프라이머 세트와 동일했고, 나머지 종에서는 최소 2개 이상 코드에서 불일치 또는 align 없음으로 판별되었다.
본 발명에서 L. acidophilus 판별용 프라이머 세트를 제조하기 위하여, 가장 중요하게 여긴 것은 전체 프라이머의 길이로, 18 내지 23(최적길이 20)을 가지도록 디자인하였다. 또한 상기 프라이머는 Melting temperature(Tm)이 57 ℃ 내지 62 ℃, 바람직하게는 59 ℃로 디자인 하였고, 프라이머 간의 최대 Tm 차이는 5도 이내로 한정하였다. 또한, 상기 프라이머는 GC%가 35 내지 65%, 바람직하게 50%로 설계하였다.
이렇게 제작된 서열번호 8 및 16의 프라이머 세트 조성물이 L. acidophilus 균주, 특히 L. acidophilus LA1에 대하여 특이성을 가지는지 여부를 in silico 분석 및 현존 NCBI DB상의 sequence match를 통해 분석하였고, 그 결과를 살펴보면(표 2 내지 9), 본 발명을 통해 설계된 프라이머 세트 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종만을 선택적으로 증폭시키는 것을 확인하였다. 나아가 검출된 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종의 균주들 중에서 LA1의 경우 PCR 산물이 720bp만큼 더 작은 것을 확인하였고, 이를 통해 LA1 균주를 명확하고 정확하게 판별할 수 있음을 확인하였다.
실시예 5. 락토바실러스 애시도필러스( Lactobacillus acidophilus ) YT1 균주 배양
락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 게놈 해독을 위해, 특허공개공보 제10-2018-0052569호에 공지된 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주(기탁번호 KCCM11808P)를 이용하여 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다.
실시예 6. 락토바실러스 애시도필러스( Lactobacillus acidophilus ) YT1 균주의 게놈 확보
락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 게놈 해독을 위해, 실시예 5의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하고, PacBio RS II 시퀀싱 플랫폼(sequencing platform)을 이용하여 전체 게놈 염기서열을 확보하였다.
유전체 결과는 HGAP 3.0을 이용하여, 각 염기서열(sequence read) 조립(assembly)을 수행하였으며, 수행과정에서 전체 유전체의 시작점을 확정하기 위해 chromosomal replication 개시 유전자인 dnaA의 위치를 확인하였다.
실시예 7. 락토바실러스 애시도필러스( Lactobacillus acidophilus ) YT1 균주의 게놈 비교
락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 게놈상에 존재하는 유전자의 기능을 확인하기 위하여 NCBI Prokaryotic Genome Annotation Pipeline(PGAAP)를 활용하였다.
이후, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 게놈과 동일 종에 속하는 21종의 균주들의 게놈을 비교 분석하였다. 구체적으로 상기 21종 균주는 다음과 같다. L. acidophilus NCFM (GCA 000011985.1), L. acidophilus ATCC 4796 (GCA 000159715.1), L. acidophilus La-14 (GCA 000389675.2), L. acidophilus DSM 20242 (GCA 000442825.1), L. acidophilus CIRM-BIA 442 (GCA 000442865.1), L. acidophilus CIP 76.13 (GCA 000469705.1), L. acidophilus DSM 9126 (GCA 000469745.1), L. acidophilus CIRM-BIA 445 (GCA 000469765.1), L. acidophilus CFH (GCA 000497795.1), L. acidophilus JCM 1132 (GCA 000615165.1), L. acidophilus ATCC 4356 (GCA 000786395.1), L. acidophilus FSI4 (GCA 000934625.1), L. acidophilus DSM 20079 (GCA 001433895.1), L. acidophilus NBRC 13951 (GCA 001591845.1), L. acidophilus WG-LB-IV (GCA 001639165.1), L. acidophilus KLDS 1.0901 (GCA 001868765.1), L. acidophilus L-55 (GCA 001950045.1), L. acidophilus ATCC 53544 (GCA 002224305.1), L. acidophilus LA1 (GCA 002286215.1), L. acidophilus P2 (GCA 002406675.1), L. acidophilus LMG P-21904 (GCA 002914945.1). 이러한 21종 균주의 게놈을 확보하여 전체 게놈 정보를 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주와 동일한 방법으로 분석하였다.
락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 포함한 락토바실러스 애시도필러스(Lactobacillus acidophilus) 22종 균주의 16S rRNA 유전자 정보를 활용하여 Tamura-Nei model에 근거한 maximum likelihood 방법으로 분자 계통도를 작성하였다. 분자 계통도의 out group으로 Lactobacillus helveticus CAUH18의 16S rRNA를 이용했다. 완전한 길이의 16S rRNA를 가지지 않은 일부 유전체를 고려하여 NCFM 16S rRNA 서열을 기준으로 18 ~ 784의 범위를 대상으로 계산하였다.
전체 게놈의 유사도 분석을 위해 average nucleotide identity(ANI) 기술을 구현한 프로그램 pyani를 이용하여 게놈 비교 후 전체 게놈정보에 기반한 분자 계통도를 함께 작성하여 실제로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 연관 미생물들이 얼마나 관련이 있는지를 확인하였다.
추가적으로, 각 균주에서, 파지(phage) 감염 정보를 알 수 있는 CRISPR 지역을 CRISPR finder 통해 분석하였고, 각 균주의 CRISPR 구성을 비교하였다.
도 8은 실시예 6을 통해 분석한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1의 전체 게놈 구성도로, 이를 살펴보면, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 게놈 분석결과 YT1의 전체 게놈은 2.09-Mbp의 circular chromosome(34.7% G+C content)이며, 1,913개의 기능 유전자를 가지고 있고, 83개의 RNA gene와 93개의 pseudo gene을 가지고 있는 것으로 확인되었다.
도 9a는 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 비롯한 23종 균주의 16S rRNA 유전자를 활용한 계통도이고, 도 9b는 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 비롯한 22종 균주의 ANI genome 비교를 활용한 계통도이다.
도 9에 나타난 바와 같이 16S rRNA 유전자 및 ANI를 이용한 분자계통도를 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 포함하여 총 22종의 균주들의 유연관계를 확인할 수 있었다. 구체적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 YT1을 제외한 21종은 모두 ANI 기준 99.7% 이상의 유사도를 가질 정도로 균주간의 차이를 거의 확인할 수 없을 정도로 매우 유사하였다. YT1은 타 종과 비교하여 ANI 기준 99.5% 이하의 유사도를 가지므로 기존에 알려진 L. acidophilus 종내 균들과는 전체 게놈상에서 약간의 차이가 있음을 확인하였다.
도 10은 실시예 7을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 비롯한 22종 균주들 중에서, L. acidophilus NCFM 과 L. acidophilus YT1의 CRISPR 구조 분석 결과이다.
구체적으로 도 10은 실시예 7로부터 분석한 L. acidophilus NCFM 과 L. acidophilus YT1의 전체 게놈 정보 중에서 CRISPR 지역만을 따로 분석한 결과이다.
이를 살펴보면, CRISPR 지역에서, L. acidophilus NCFM과 L. acidophilus YT1 균주들의 염기서열에 명확한 차이가 있음을 확인하였다. 특히 L. acidophilus NCFM 균주에서는 32개 spacer 지역이 존재하는 반면에 L. acidophilus YT1에서는 두 개의 CRISPR로 분리되어 일부만 보존된 형태임을 확인하였다. 구체적으로 NCFM의 spacer 1번부터 5번까지가 YT1의 첫번째CRISPR에 존재하고, NCFM의 spacer 22번부터 26번까지가 YT1의 두 번째CRISPR에 존재한다.
L. acidophilus YT1 균주는 다른 균주들과는 달리, 두 개의 CRISPR 영역으로 이루어져 있고, CRISPR의 일부만 타 균주와 겹치고 기존 균주에서 보고되지 않은 신규 서열이 CRISPR 내에 존재한다. 이러한 특징을 통해 L. acidophilus YT1 균주를 분명히 구분할 수 있음을 확인하였다.
따라서 CRISPR 구조의 차이를 이용하여, 상기 균주들 중에서 L. acidophilus YT1 균주를 특이적으로 검출할 수 있는 마커를 설계하고자 하였고, 이를 도 11에 나타내었다. 보다 상세하게 도 11은 L. acidophilus YT1을 특이적으로 검출할 수 있는 프라이머 세트와 상기 프라이머 세트로 PCR하였을 때 인 실리코 분석(in silico)을 통해 해당 균주의 PCR 산물 크기를 도시화한 것이다.
이를 위해 도 11에 나타난 바와 같이, 상기 첫 번째 CRISPR 영역 (YT1 CRISPR 1)에서 YT1 특이 spacer 들을 포함하는 프라이머를 개발함으로써, L. acidophilus YT1 균주를 특이적으로 검출할 수 있는 마커를 제작하였다. 구체적으로 L. acidophilus YT1 5번 spacer 지역의 6번째 nucleotide부터 25번째 nucleotide 까지 20 bp의 left primer를 제작하였고, d번 spacer 지역의 1번째 nucleotide부터 20번째 nucleotide까지 20bp의 right primer 제작하였고, 이를 통해 본 발명의 L. acidophilus YT1 균주를 확실히 구별할 수 있음을 알 수 있다.
또한 본 발명을 통해 설계된 프라이머 세트를 이용하여, PCR을 수행하여 PCR 산물을 얻을 경우, PCR 산물의 길이를 인실리코 모델링(in silico modeling)을 이용하여 분석하였고, 그 결과를 도 11의 하단에 표기하였다. 분석 결과 L. acidophilus YT1의 PCR 산물의 길이는 320 bp(32 bp의 spacer 4개(spacer a,a,b,c) 와 28 bp의 dicer 5개(DP5), 그리고 spacer 5의 left primer 포함 27 bp, spacer d의 right primer 포함 20 bp)로 확인되었다.
즉, 본 발명에 따른 프라이머 세트를 이용할 경우, 시료에서 L. acidophilus YT1 균주의 존재 유무를 검출할 수 있다.
본 발명에서 L. acidophilus YT1 판별용 프라이머 세트를 제조하기 위하여, 가장 중요하게 여긴 것은 전체 프라이머의 길이로, 18 내지 23(최적길이 20)을 가지도록 디자인하였다. 또한 상기 프라이머는 Melting temperature(Tm)이 57℃ 내지 62℃, 바람직하게는 60℃로 디자인 하였고, 프라이머 간의 최대 Tm 차이는 5도 이내로 한정하였다. 또한, 상기 프라이머는 GC%가 35 내지 65%, 바람직하게 50%로 설계하였다.
이렇게 제작된 서열번호 7 및 15의 프라이머 세트 조성물이 L. acidophilus YT1에 대하여 특이성을 가지는지 여부를 in silico 분석 및 현존 NCBI DB상의 sequence match를 통해 분석하였고, 그 결과를 살펴보면(도 12), 본 발명을 통해 설계된 프라이머 세트 조성물은 NCBI에 등록된 서열 중 증폭할 수 있는 균주가 없음을 확인하였다.
도 12는 인 실리코(in silico)에서, 본 발명의 L. acidophilus YT1 균주 판별용 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, Primer-BLAST란 서열검색 프로그램으로 sequence를 분석한 결과이다. 구체적으로는 Primer-BLAST 웹서비스에 접속하여 PCR Template 로 CP025200.1, forward primer의 범위 557,700 ~ 557,800, reverse primer 의 범위 558,00~558,100 로 지정한 후 Primer Parameters의 forward primer 서열에 CRISPR_YT1_R 를, reverse primer 서열에 CRISPR_YT1_F를 입력한 후 데이터베이스를 "nr" 로 지정했다. 나머지 설정은 기본설정을 유지한 상태로 프로그램을 실행했다.
그 결과 L. acidophilus YT1 균주 판별용 프라이머 세트는 NCBI에 현존하는 서열에서 L. acidophilus YT1(Accession No. CP025200.1) 유전체만 특이적으로 증폭한다는 분석결과를 얻었다. 구체적으로는 도 12의 "Specificity of primers" 항목에서 다음과 같이 표시되었다. "Primer pairs are specific to input template as no other targets were found in selected database: Nucleotide collection (nt)".
도 12를 참조할 때 주의할 점은 프라이머의 제작을 진행하는 과정에서 프라이머 템플릿을 유전체의 역방향 서열을 이용했기 때문에 reverse primer 인 CRISPR_YT1_R이 유전체상 forward primer인 CRISPR_YT1_F 보다 앞쪽에 위치하게 되었다. Primer-BLAST에서는 유전체상 앞쪽에 위치한 primer를 무조건 forward로 인식하기에 "Forward primer"에 역방향 프라이머가, "Reverse primer" 에 정방향 프라이머가 표시되었다.
실험예 1. 16S rRNA 유전자 염기서열 분석방법
1) 락토바실러스 애시도필러스(Lactobacillus acidophilus) 및 근연종의 16S 유전자 유사도 비교
락토바실러스 애시도필러스(Lactobacillus acidophilus)는 종 내에서도 유사도가 높은 종으로 보고되어 있고, NCBI 에 보고된 서열 중에서도 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 60 종의 균주들의 16S rRNA 간의 유사도는 97.5 ~ 100%이다. 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM과 락토바실러스 애시도필러스(Lactobacillus acidophilus) EMBS082는 유사도가 97.5%로 가장 큰 차이를 보이는 것으로 확인되었다.
일반적으로 16S rRNA 판별방법은, 97% 이상의 유사도를 가지면 같은 종으로 판단한다. 이에 따라 락토바실러스 애시도필러스(Lactobacillus acidophilus) 유전체의 대표인 NCFM(Accession No. CP000033.3)의 16S rRNA 유전자 정보를 기준으로 NCBI에 보고된 16S 유전자 중 유사한 유전자의 검색 및 비교를 수행하였다. NCBI NT 데이터베이스에 BLASTN 검색을 수행하고 결과 중 97% 이상의 유사성을 가진 서열 중 Uucultured strain을 제외한 414 개의 서열이 검색되었다.
즉, 16S rRNA 염기서열을 단순히 비교하는 종래의 기술만으로는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종이 아닌 354개의 균주 역시 락토바실러스 애시도필러스(Lactobacillus acidophilus)로 오판될 수 있는 가능성이 높음을 알 수 있다.
계통학적 비교를 하기 전에 유사도만으로 분석한 결과, 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주(60 종)를 제외하고도, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM와 97% 이상의 유사도를 갖는 균주로 락토바실러스 헬베티쿠스(Lactobacillus helveticus) 균주 252종, 락토바실러스 크리스파투스(Lactobacillus crispatus) 균주 33종, 락토바실러스 아밀로보러스(Lactobacillus amylovorus) 균주 18종, 락토바실러스(Lactobacillus sp.) 균주 16종, 락토바실러스 갈리나룸(Lactobacillus gallinarum) 균주 9종, 락토바실러스 케피라노팍시엔스(Lactobacillus kefiranofaciens) 균주 8종, 락토바실러스 선토리우스(Lactobacillus suntoryeus) 균주 6종, 락토바실러스 키타사토니스(Lactobacillus kitasatonis) 균주 4종, 락토코쿠스 락티스(Lactococcus lactis) 균주 1종, 락토바실러스 울투넨시스(Lactobacillus ultunensis), 락토바실러스 소브리우스(Lactobacillus sobrius), 락토바실러스 페르멘툼(Lactobacillus fermentum), 락토바실러스 카제이(Lactobacillus casei), 락토바실러스 박테리움(Lactobacillaceae bacterium), 박테리움 ic1256(Bacterium ic1256), 바실러스 푸밀루스(Bacillus pumilus)가 확인되었다(총 414종).
2) 락토바실러스 애시도필러스(Lactobacillus acidophilus) 및 근연종의 16S 유전자 계통도 비교
도 13은 앞선 1)을 통해 확인한 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM과 97% 이상의 유사도를 갖는 총 414 종의 16S rRNA 서열의 계통도 분석을 수행하였고, 그 중에서 일부를 발췌한 것이다. 락토바실러스 애시도필러스(Lactobacillus acidophilus) 이외의 종에 해당하는 서열은 도 13에서 붉은색 및 우측상단 별표(*)로 표기하였다.
즉, 단순히 16S rRNA의 염기서열 유사도만을 비교하는 것이 아닌, 각 염기서열의 위치 및 배열을 함께 고려하여, 도 13과 같이 계통학적 비교를 수행한 결과, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종과 구분이 불가능한 균주는 5개로 각각 락토바실러스(Lactobacillus sp.) 균주 3종과 락토바실러스 키타사토니스(Lactobacillus kitasatonis) 균주 2종이 확인되었다(7.7%의 오판율).
구체적으로 도 13에서와 같이 계통학적 군집분석결과, 계통나무 상에 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 60개의 균주가 하나의 계통으로 분류되는 가지 "A"내에는 락토바실러스(Lactobacillus sp.)(Accession No. EU600905.1, KF952776.1, MH782151.1)와 락토바실러스 키타사토니스(Lactobacillus kitasatonis) 균주(Accession No. AB186333.1, AB186339.1)가 존재하고 있음을 확인할 수 있다.
따라서, 16S rRNA 유전자 정보에 기반한 현재의 미생물 계통분류만으로는 락토바실러스 속 중에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종만을 특이적으로 검출, 판별 및 동정할 수 없음을 확인하였다.
즉 16S rRNA 판별방법만으로는 공지된 균주조차 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종외에 다른 속종의 균주들을 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종으로 구별하고 있으므로, 미지의 시료로부터 해당 종의 균주를 명확히 검출, 판별하는데 사용에 제한이 있음을 알 수 있다. 만일 상기 방법으로 판별할 경우, 보다 정확한 검출, 판별을 위해서 이차적 단계 혹은 검증 단계가 요구됨을 알 수 있다.
실험예 2. 실시예 1의 락토바실러스 애시도필러스( Lactobacillus acidophilus ) 종 판별용 조성물의 PCR 분석
도 2에서 제작된 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물(서열번호 1 및 9의 프라이머 세트)이 특이적으로 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 특이적으로 판별하는지를 확인하고자 하였다.
우선, 락토바실러스 헬베티쿠스(Lactobacillus helveticus) ATCC 13866, 락토바실러스 아밀로보러스(Lactobacillus amylovorus) ATCC 33620, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 및 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주들을 각각 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다. 이후 상기 각각의 균주의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하였다.
추출한 DNA 30 ng에 대하여 thermal cycling(PCR)을 실시하였다. PCR 반응시 총 반응액은 30 ㎕이고, 2.0 mM dNTP(Fermentas, USA), 1.0 unit의 내열성 DNA 중합효소(e-taq polymerase, Solgent), 20 pmol CRISPR_LA_uni_F(서열번호 1), 20 pmol CRISPR_LA_uni_R 프라이머(서열번호 9), 20 ng 각각의 균주 DNA 및 완충액(10mM Tris-HCl(pH 8.0), 50mM KCl, 1.5mM MgCl2, 0.01 % 젤라틴)을 완전히 혼합한 용액을 준비한다.
PCR반응은 Dyad(Bio-rad)를 사용하여 실시하였고, 반응조건은 초기 95 ℃에서 300초간 유지한 뒤, 95 ℃에서 30초간 처리하여 DNA를 변성시키고, 60 ℃에서 30초간 어닐링한 후, 72 ℃에서 90초간 증폭(extension)(DNA 중합)하였고, 이러한 과정을 28회 반복(95 ℃, 30초(변성) -> 60 ℃, 30초(재결합) -> 72 ℃, 90초(DNA 중합))하고, 72 ℃ 300 초간 마지막 합성을 실시하였다.
PCR 반응 용액 함량(㎕)
SP taq. 0.5
10x SP taq buffer 2.5
dNTPs 2.0
Tuning Buffer 5.0
Template(균주 DNA) 1.0
Forward primer (5 uM)CRISPR_LA_uni_F 프라이머(서열번호 1) 1.0
Reverse primer (5 uM) CRISPR_LA_uni_R 프라이머(서열번호 9) 1.0
D.W 12
상기 과정으로 증폭된 증폭산물(PCR 산물)을 1.2%의 아가로스 젤에서 전기영동하고, Safeview(iNtRON Biotechnology, Korea)로 염색하여 DNA 다형성 밴드를 UV로 조사하여 검출하였으며, Gel-Doc system(Bio-rad)으로 저장하고 인쇄하여 도 14에 나타내었다.
도 14는 본 발명의 서열번호 1, 9로 표시되는 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM, 락토바실러스 애시도필러스(Lactobacillus acidophilus) CB_LA1, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1)에 대해 PCR을 수행하여 분석한 결과이고, 도 15는 본 발명의 서열번호 1, 9로 표시되는 프라이머 세트를 이용하여, 대표로 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후 이를 아가로스 겔 전기영동으로 분석하는 과정을 두 번 반복(Uni-a, Uni-b)한 결과이다.
이때, M은 DNA 크기 표준 마커(Sizer™ 100bp DNA Marker(cat.No,24073)이고, 1은 Lactobacillus helveticus ATCC 13866이고, 2는 Lactobacillus amylovorus ATCC 33620이며, 3은 Lactobacillus acidophilus ATCC 4356이며, 4는 Lactobacillus acidophilus NCFM 균주이고, 5는 Lactobacillus acidophilus LA1(CB_LA1이라고도 한다), 6은 Lactobacillus acidophilus YT1이다.
도 14에 나타난 바와 같이, 본 발명의 서열번호 1 및 서열번호 9로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물은 약 267bp 크기의 DNA 단편을 증폭시켰음을 확인하였다.
게놈분석을 통해 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종은 특이적으로 CRISPR 영역 중 spacer 1번 부터 5번까지를 공통으로 갖고 있음을 확인하였고, spacer 1번 내지 5번을 증폭할 수 있는 범용 프라이머(서열번호 1의 정방향 프라이머와 서열번호 9의 역방향 프라이머를 포함하는 프라이머 세트)(도 2 참조)를 설계 및 제작하여 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 판별할 수 있는 프라이머 조성물을 완성하였다.
본 발명에 따른 상기 프라이머 조성물을 이용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주의 표적 서열(CRISPR 영역)을 증폭하면, 회수된 267bp의 PCR 산물을 얻을 수 있다.
전기영동 겔(gel electrophoresis) 상에서 미세한 차이(전기영동이 1base단위 정밀한 resolution을 보여주지 않음)를 고려하면, PCR 산물이 200 내지 300 bp(바람직하게는 260 내지 280 bp)에서 검출되었다 하더라도, 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주의 CRISPR 구간에 대한 PCR 산물 267 bp를 근간으로 도출된 결과이므로, 본 발명의 범주에 속하는 결과라 할 것이다.
따라서, PCR 산물은 정확하게는 267 bp 인 것이 바람직하나, 상술한 다양한 조건들을 고려하였을 때, 실제 적용하여 도출된 PCR 산물이 200 내지 300 bp, 바람직하게는 260 내지 280 bp에 해당한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus)인 것으로 판별할 수 있다(마커로 측정가능한 영역에도 영향을 받음).
이를 증명하기 위하여 본 실시예에서 회수된 상기 락토바실러스 애시도필러스(Lactobacillus acidophilus)의 PCR 산물에 대해서만 DNA 염기서열을 확인하였다.
이에 반해 락토바실러스 애시도필러스(Lactobacillus acidophilus)와는 다른 Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620에 대해서는 전혀 증폭된 DNA 단편이 발견되지 않았다.
따라서, 본 발명에 따른 서열번호 1 및 서열번호 9로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 대해서만 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물로 활용가능하다.
도 15는 본 발명에 따른 프라이머 조성물을 사용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 DNA를 주형으로 PCR을 수행하여 그 산물(amplicon)을 정제하고, 이에 대하여 시퀀스를 분석한 것으로, 락토바실러스 애시도필러스(Lactobacillus acidophilus)에서만 확인된 증폭산물의 크기는 프라이머(primer)를 포함하여 267 bp 인 것으로 측정되었고, 증폭서열은 다음과 같다.
[서열번호 17]
TAAAAGCTACAGAGTTACCATCGAGGATCACCTCCACTTTCGTGGAGAAAATTGGAATCTCATCGTAAGAAATAAGTCGCATATAGGATCACCTCCACATACGTGGAGAAAATCCTTTTCCTAGGATCTTCATAAGCTTCTCGCCAGGATCACCTCCACATACGTGGAGAAAATATCGTAGTCAATCTCGTACTTAAAACCACCCTGGGATCACCTCCACATACGTGGAGAAAATCCAGGTTGACTTGCGCTAGGTGTTGCATCAAT
락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 모든 균주는 CRISPR 영역 중 spacer 1번 부터 5번까지를 공통으로 가지고 있으므로, 인 실리코(in silico) 상에서, 본 발명에 따른 프라이머 조성물을 이용하여 증폭하였을 때, 동일한 앰플리콘(amplicon)이 만들어진다. 도 15에 나타난 바와 같이, 본 발명에 따른 프라이머 조성물을 사용하여 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 DNA를 주형으로 PCR을 수행하여 그 산물(amplicon)을 정제하였을 때, 실제 게놈상에 존재하는 시퀀스와 동일한지를 재-시퀀싱(re-sequencing)한 결과, 일치하는 것으로 확인하였다.
특히, 실질적으로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 대한 PCR 산물의 염기서열 해독 길이가 267 bp이며, 게놈상에서 예측된 염기서열과 100% 일치함을 확인하였다. 즉, 전기영동 시 육안으로 약 270 bp에 가까운 것으로 보였으나, 실질적으로 증폭된 서열의 길이는 267 bp로, 예측길이와 완벽하게 일치하고 염기서열 또한 동일함을 알 수 있다.
이를 통해 본 발명에 따른 본 발명의 서열번호 1 및 서열번호 9로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물은 모든 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주를 다른 종 균주들과 명백히 구별가능함을 알 수 있다.
따라서, 본 발명에 따른 서열번호 1 및 서열번호 9로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 에서만 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 조성물로 활용가능함을 다시 한 번 확인할 수 있었다.
실험예 3. 실시예 1의 락토바실러스 애시도필러스( Lactobacillus acidophilus ) 종 판별용 조성물의 인 실리코 분석
실험예 1에서 계통학적 분석에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM과 유사도가 높아 락토바실러스 애시도필러스(Lactobacillus acidophilus)로 동정되었던, 균주들 중에서 NCBI에 공개된 락토바실러스 키타사토니스(Lactobacillus kitasatonis) 균주 DSM 16761(Genbank accession: GCA_001434435.1)와 JCM 1039(Genbank accession: GCA_000615285.1)를 준비하였다.
상기 균주들을 대상으로 실시예 1에서 설계된 서열번호 1, 9로 표시되는 프라이머를 포함하는 프라이머 세트와 더불어 서열번호 2, 10의 프라이머 세트; 서열번호 3, 11의 프라이머 세트; 서열번호 4, 12의 프라이머 세트; 서열번호 5, 13의 프라이머 세트 및 서열번호 6, 14의 프라이머 세트에 대해서 결합 부위를 갖는지, 혹은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종이 공통적으로 지니고 있는 CRISPR 영역의 spacer 1번부터 5번까지의 영역 중 어느정도 일치하는지를 인 실리코(in-sillico) 분석을 통해 확인하고자 하였다.
그 결과, NCBI에 공개된 락토바실러스 키타사토니스(Lactobacillus kitasatonis) DSM 16761(Genbank accession: GCA_001434435.1)와 JCM 1039(Genbank accession: GCA_000615285.1)의 유전체를 대상으로, 본 발명에서 설계한 프라이머 세트(서열번호 1 및 9, 서열번호 2 및 10, 서열번호 3 및 11, 서열번호 4 및 12, 서열번호 5 및 13, 서열번호 6 및 14)로 탐색한 결과, 상기 프라이머 세트와 결합 부위가 관찰되지 않았으며, 따라서 PCR 산물의 생성 가능성이 없음을 확인하였다. 또한 락토바실러스 애시도필러스(Lactobacillus acidophilus)에서 얻은 약 100 내지 300 bp의 PCR 증폭산물(각각 267 bp, 209 bp, 147 bp, 207 bp, 148 bp, 146 bp)의 서열 중 일치하는 부분이 전혀 발견되지 않았다.
게다가, 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종이 공통적으로 지니고 있는 CRISPR 영역의 spacer 1번부터 5번까지의 영역 중 어느 하나라도 일치하는 부분이 전혀 없음을 확인하였다.
종합하면, 16S rRNA 유전자 정보 판별방법으로는 락토바실러스 애시도필러스(Lactobacillus acidophilus)로 판별되던, 락토바실러스 애시도필러스(Lactobacillus acidophilus)와 매우 유사한 16S rRNA 유전자를 가지고 있는 락토바실러스 키타사토니스(Lactobacillus kitasatonis)마저도 본 발명의 프라이머 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하지 않음을 분명히 구별 및 판별할 수 있음을 알 수 있다. 종래 16S rRNA 유전자 판별방법보다 본 발명에 따른 프라이머 조성물이 정확히 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종에 속하는 균주와 속하지 않는 균주를 정확히 판별, 구별, 검출이 가능함을 알 수 있으며, 본 발명의 프라이머 조성물을 사용한다면 제품이나 시료 상에 락토바실러스 애시도필러스(Lactobacillus acidophilus)가 존재하는지 여부를 비롯하여, 미분류된 균주가 락토바실러스 애시도필러스(Lactobacillus acidophilus)에 속하는 균주인지를 정확히 동정할 수 있음을 알 수 있다.
실험예 4. 실시예 4의 락토바실러스 애시도필러스 (Lactobacillus acidophilus) 개별 균주 판별용 조성물의 PCR 분석-1.
도 6, 7에서 제작된 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 조성물이 특이적으로 L. acidophilus 균주 특히, L. acidophilus LA1 균주를 판별하는지를 확인하고자 하였다.
실시예 4에서 언급한 인 실리코(in silico)에서, 본 발명의 L. acidophilus 개별 균주 판별용 프라이머 세트를 NCBI 사이트로부터 제공되는 데이터베이스와 대조하여, BLASTN 이란 서열검색 프로그램으로 sequence를 분석한 결과를 하기 표 2 내지 표 9에 구체적으로 나타내었다.
>> region for left primer
query NCFM.spacer5 NCFM.spacer5 NCFM.spacer5 NCFM.spacer5 NCFM.spacer5
sbjct CP010432.1 CP005926.2 CP000033.3 XM_020260620.1 LL191556.1
qlen 33 33 33 33 33
blast_ident 100 100 100 95.652 100
blast_cov 100 100 100 70 58
qstart 1 1 1 10 7
qend 33 33 33 32 25
sstart 1541590 1540886 1541311 2410 33751
send 1541622 1540918 1541343 2432 33769
strand plus plus plus minus minus
evalue 2.42E-08 2.42E-08 2.42E-08 5.5 5.5
align_ident 100 100 100 78.788 78.788
align_match 33 33 33 26 26
align_gap 0 0 0 0 2
xstart 1541590 1540886 1541311 2409 33743
xend 1541622 1540918 1541343 2441 33775
qry_align CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGT--TGACTTGCGCTAGGTGTTGCATCAATA
sbj_align CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA CCAGGTTGACTTGCGCTAGGTGTTGCATCAATA GCTGGTGACCTTGCGCTAGGTGTTGCAACAATT --AGCTCCTGACTTGCGCTAGGTGTTGAAAAAACA
align_code OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO /O/OOO///OOOOOOOOOOOOOOOOOO/OOOO/ --OO/O--OOOOOOOOOOOOOOOOOOO/O//OO/O
sbjct_title Lactobacillus acidophilus strain FSI4, complete genome Lactobacillus acidophilus La-14, complete genome Lactobacillus acidophilus NCFM, complete genome Talaromyces atroroseus hypothetical protein mRNA Heligmosomoides polygyrus genome assembly H_bakeri_Edinburgh ,scaffold HPBE_scaffold0003172
>> region for right primer 1
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct CP010432.1 CP006811.1 CP005926.2 FN298497.1 CP000033.3 AE017198.1
qlen 33 33 33 33 33 33
blast_ident 100 100 100 100 100 100
blast_cov 100 100 100 100 100 100
qstart 1 1 1 1 1 1
qend 33 33 33 33 33 33
sstart 233474 301267 233173 273991 233176 288059
send 233506 301299 233205 274023 233208 288091
strand minus minus minus minus minus minus
evalue 2.42E-08 2.42E-08 2.42E-08 2.42E-08 2.42E-08 2.42E-08
align_ident 100 100 100 100 100 100
align_match 33 33 33 33 33 33
align_gap 0 0 0 0 0 0
xstart 233474 301267 233173 273991 233176 288059
xend 233506 301299 233205 274023 233208 288091
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
align_code OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
sbjct_title Lactobacillus acidophilus strain FSI4, complete genome Lactobacillus johnsonii N6.2, complete genome Lactobacillus acidophilus La-14, complete genome Lactobacillus johnsonii FI9785, complete genome Lactobacillus acidophilus NCFM, complete genome Lactobacillus johnsonii NCC 533, complete genome
>> region for right primer 2
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct CP016400.1 CP002464.1 CP002609.1 CP002559.1 CP002338.1 AP014808.1
qlen 33 33 33 33 33 33
blast_ident 96.97 96.97 96.875 96.875 96.875 96.154
blast_cov 100 100 97 97 97 79
qstart 1 1 2 2 2 8
qend 33 33 33 33 33 33
sstart 1608361 297768 242626 239350 266408 308621
send 1608393 297800 242657 239381 266439 308646
strand minus minus minus minus minus minus
evalue 5.89E-06 5.89E-06 2.33E-05 2.33E-05 2.33E-05 0.089
align_ident 96.97 96.97 93.939 93.939 93.939 87.879
align_match 32 32 31 31 31 29
align_gap 0 0 0 0 0 0
xstart 1608361 297768 242626 239350 266408 308621
xend 1608393 297800 242658 239382 266440 308653
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align TCAAGATCAACCATTTATTTGCCACGCAAATCG TCAAGATCAACCATTTATTTGCCACGCAAATCG CCAAGATCAACCATTTATTTGCCACGCAAATCG CCAAGATCAACCATTTATTTGCCACGCAAATCG CCAAGATCAACCATTTATTTGCCACGCAAATCG TCAGAACCAACCATTCATTTGTCACGCAAATCG
align_code OOOOOOOOOOOOOOO/OOOOOOOOOOOOOOOOO OOOOOOOOOOOOOOO/OOOOOOOOOOOOOOOOO /OOOOOOOOOOOOOO/OOOOOOOOOOOOOOOOO /OOOOOOOOOOOOOO/OOOOOOOOOOOOOOOOO /OOOOOOOOOOOOOO/OOOOOOOOOOOOOOOOO OOO//O/OOOOOOOOOOOOOO/OOOOOOOOOOO
sbjct_title Lactobacillus johnsonii strain BS15, complete genome Lactobacillus johnsonii DPC 6026, complete genome Lactobacillus amylovorus GRL1118, complete genome Lactobacillus amylovorus strain 30SC, complete genome Lactobacillus amylovorus GRL 1112, complete genome Lactobacillus acetotolerans DNA, complete genome, strain: NBRC 13120
>> region for right primer 3
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct CP002764.1 LM149353.1 CP016827.1 XM_008236577.2 XM_008236576.2 CP012890.1
qlen 33 33 33 33 33 33
blast_ident 93.103 100 95.652 100 100 95.652
blast_cov 88 61 70 58 58 70
qstart 2 2 1 5 5 1
qend 30 21 23 23 23 23
sstart 2053473 27748 1189326 3966 47 308956
send 2053501 27767 1189348 3984 65 308978
strand minus minus plus minus minus plus
evalue 0.35 1.4 5.5 5.5 5.5 5.5
align_ident 87.879 63.636 84.848 69.697 69.697 84.848
align_match 29 21 28 23 23 28
align_gap 0 0 0 0 0 0
xstart 2053470 27736 1189326 3956 37 308956
xend 2053502 27768 1189358 3988 69 308988
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align CCAAGATCAACCTTTCGTTTGCCACGCAAACCG GCAAGATCAACCATTCATTTGATTTTCTGTCAA TCAAGATCAACCTTTCATTTGCCGTGCTAACCG GTTGGATCAACCATTCATTTGCCGCAAAACTGT GTTGGATCAACCATTCATTTGCCGCAAAACTGT TCAAGATCAACCTTTCATTTGCCGTGCTAACCG
align_code /OOOOOOOOOOO/OOO/OOOOOOOOOOOOO/OO /OOOOOOOOOOOOOOOOOOOO/////O////// OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO ////OOOOOOOOOOOOOOOOOOO/O//OO/O// ////OOOOOOOOOOOOOOOOOOO/O//OO/O// OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO
sbjct_title Lactobacillus kefiranofaciens ZW3, complete genome Schistosoma mattheei genome assembly S_mattheei_Denwood ,scaffold SMTD_scaffold0000035 Lactobacillus helveticus strain D76, complete genome PREDICTED: Prunus mume ABC transporter C family member 10-like (LOC103333683), mRNA PREDICTED: Prunus mume ABC transporter C family member 10-like (LOC103333682), mRNA Lactobacillus gallinarum strain HFD4, complete genome
>> region for right primer 4
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct CP012381.1 CP011386.1 XM_012224715.1 CP009907.1 XM_011037590.1 LN005319.1
qlen 33 33 33 33 33 33
blast_ident 95.652 95.652 100 95.652 100 100
blast_cov 70 70 58 70 58 58
qstart 1 1 2 1 6 6
qend 23 23 20 23 24 24
sstart 251207 226916 1501 426446 319 825
send 251229 226938 1519 426468 337 843
strand minus minus plus minus plus minus
evalue 5.5 5.5 5.5 5.5 5.5 5.5
align_ident 84.848 84.848 69.697 84.848 78.788 66.667
align_match 28 28 23 28 26 22
align_gap 0 0 0 0 2 0
xstart 251197 226906 1500 426436 314 816
xend 251229 226938 1532 426468 346 848
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAG--ATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align TCAAGATCAACCTTTCATTTGCCGTGCTAACCG TCAAGATCAACCTTTCATTTGCCGTGCTAACCG CCAAGATCAACCATTCATTTCTCAAACTACCAA TCAAGATCAACCTTTCATTTGCCGTGCTAACCG --AAGCCATCAACCATTCATTTGCCAATACAATCA AACGCATCAACCATTCATTTGCCATTCGACTAT
align_code OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO /OOOOOOOOOOOOOOOOOOO//OO//O/O//// OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO --OOO--OOOOOOOOOOOOOOOOOOO////OOOO/ /////OOOOOOOOOOOOOOOOOOO//O/O/O//
sbjct_title Lactobacillus helveticus strain CAUH18, complete genome Lactobacillus helveticus strain MB2-1, complete genome PREDICTED: Jatropha curcas probable inactive receptor kinase At2g26730 (LOC105640414), mRNA Lactobacillus helveticus strain KLDS1.8701, complete genome PREDICTED: Populus euphratica peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A-like (LOC105133547), mRNA Spirometra erinaceieuropaei genome assembly S_erinaceieuropaei ,scaffold SPER_scaffold0005269
>> region for right primer 5
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct LM433701.1 LL911802.1 XM_008611536.1 XM_008611535.1 XM_007218824.1 CP002427.1
qlen 33 33 33 33 33 33
blast_ident 100 100 100 100 100 95.652
blast_cov 58 58 58 58 58 70
qstart 7 12 2 2 5 1
qend 25 30 20 20 23 23
sstart 16932 11466 732 681 3396 214426
send 16950 11484 750 699 3414 214448
strand minus plus minus minus minus minus
evalue 5.5 5.5 5.5 5.5 5.5 5.5
align_ident 69.697 60.606 69.697 69.697 69.697 84.848
align_match 23 20 23 23 23 28
align_gap 0 0 1 1 0 0
xstart 16924 11455 719 668 3386 214416
xend 16956 11487 751 700 3418 214448
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG- TCAAGATCAACCATTCATTTGCCACGCAAATCG- TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align GCTCAGTCAACCATTCATTTGCCACTCTGACCT ATTTATTTTGGCATTCATTTGCCACGCAAACGT ACAAGATCAACCATTCATTT-TCGTTTAGACCTT ACAAGATCAACCATTCATTT-TCGTTTAGACCTT GTTGGATCAACCATTCATTTGCCGCAAAACTGT TCAAGATCAACCTTTCATTTGCCGTGCTAACCG
align_code /O////OOOOOOOOOOOOOOOOOOO/O//O/O/ //////O////OOOOOOOOOOOOOOOOOOO/// /OOOOOOOOOOOOOOOOOOO-/O////O/O/O/- /OOOOOOOOOOOOOOOOOOO-/O////O/O/O/- ////OOOOOOOOOOOOOOOOOOO/O//OO/O// OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO
sbjct_title Nippostrongylus brasiliensis genome assembly N_brasiliensis_RM07_v1_5_4 ,scaffold NBR_scaffold0000318 Schistocephalus solidus genome assembly S_solidus_NST_G2 ,scaffold SSLN_contig0000609 Saprolegnia diclina VS20 hypothetical protein mRNA Saprolegnia diclina VS20 hypothetical protein, variant mRNA Prunus persica hypothetical protein (PRUPE_ppa000197mg) mRNA, complete cds Lactobacillus helveticus H9, complete genome
>> region for right primer 6
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct XM_002316157.2 CP002081.1 CP003799.1 FQ310506.3 CP002429.1 CP000517.1
qlen 33 33 33 33 33 33
blast_ident 100 95.652 95.652 100 95.652 95.652
blast_cov 58 70 70 58 70 70
qstart 6 1 1 1 1 1
qend 24 23 23 19 23 23
sstart 214 2121640 242872 12901448 245193 255376
send 232 2121662 242894 12901466 245215 255398
strand plus plus minus minus minus minus
evalue 5.5 5.5 5.5 5.5 5.5 5.5
align_ident 72.727 84.848 84.848 75.758 84.848 84.848
align_match 24 28 28 25 28 28
align_gap 0 0 0 1 0 0
xstart 209 2121640 242862 12901434 245183 255366
xend 241 2121672 242894 12901466 245215 255398
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATT-TGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align AAACCATCAACCATTCATTTGCCAATACAATCA TCAAGATCAACCTTTCATTTGCCGTGCTAACCG TCAAGATCAACCTTTCATTTGCCGTGCTAACCG TCAAGATCAACCATTCATTAAGCCCTGCTTGCC- TCAAGATCAACCTTTCATTTGCCGTGCTAACCG TCAAGATCAACCTTTCATTTGCCGTGCTAACCG
align_code //O//OOOOOOOOOOOOOOOOOOO////OOOO/ OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO OOOOOOOOOOOOOOOOOOO-/OOO//OO////O- OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO
sbjct_title Populus trichocarpa hypothetical protein (POPTR_0010s19250g) mRNA, complete cds Lactobacillus helveticus CNRZ32, complete genome Lactobacillus helveticus R0052, complete genome Dicentrarchus labrax chromosome sequence corresponding to linkage group 1, top part, complete sequence Lactobacillus helveticus H10, complete genome Lactobacillus helveticus DPC 4571, complete genome
>> region for right primer 7
query NCFM.spacer20 NCFM.spacer20 NCFM.spacer20 NCFM.spacer20
sbjct BX248127.9 BX119963.5 Z38063.1 U34257.1
qlen 33 33 33 33
blast_ident 100 95.652 95.652 95.652
blast_cov 58 70 70 70
qstart 3 8 1 1
qend 21 30 23 23
sstart 22022 19894 1020 1151
send 22040 19916 1042 1173
strand plus plus plus plus
evalue 5.5 5.5 5.5 5.5
align_ident 69.697 78.788 84.848 84.848
align_match 23 26 28 28
align_gap 0 0 0 0
xstart 22020 19887 1020 1151
xend 22052 19919 1052 1183
qry_align TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG TCAAGATCAACCATTCATTTGCCACGCAAATCG
sbj_align TTAAGATCAACCATTCATTTGTGAATTACAGGC TCATTGGCAACCATTCATTTGTCACGCAAAACC TCAAGATCAACCTTTCATTTGCCGTGCTAACCG TCAAGATCAACCTTTCATTTGCCGTGCTAACCG
align_code O/OOOOOOOOOOOOOOOOOOO//O///O/O/// OOO////OOOOOOOOOOOOOO/OOOOOOOO/O/ OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO OOOOOOOOOOOO/OOOOOOOOOO//OO/OO/OO
sbjct_title Zebrafish DNA sequence from clone CH211-117N7 in linkage group 13, complete sequence Zebrafish DNA sequence from clone DKEY-6A5 in linkage group 4, complete sequence L.helveticus pepD gene for dipeptidase Lactobacillus helveticus hypothetical XylS/AraC-type transcription factor gene, partial cds, and dipeptidase gene, complete cds
우선, Lactobacillus acidophilus LA1, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356 및 Lactobacillus acidophilus NCFM 균주들을 각각 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다. 이후 상기 각각의 균주의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하였다.
추출한 DNA 30 ng에 대하여 thermal cycling(PCR)을 실시하였다. PCR 반응시 총 반응액은 20 ㎕이고, 2.0 mM dNTP(Fermentas, USA), 1.0 unit의 내열성 DNA 중합효소(e-taq polymerase, Solgent), 20 pmol CRISPR F(써열번호 8), 20 pmol CRISPR R 프라이머(서열번호 16), 20 ng 각각의 균주 DNA 및 완충액(10mM Tris-HCl(pH 8.0), 50mM KCl, 1.5mM MgCl2, 0.01 % 젤라틴)을 완전히 혼합한 용액을 준비한다.
PCR 반응은 Dyad(Bio-rad)를 사용하여 실시하였고, 반응조건은 초기 95 ℃에서 300초간 유지한 뒤, 95 ℃에서 30초간 처리하여 DNA를 변성시키고, 55 ℃에서 30초간 어닐링한 후, 72 ℃에서 90초간 증폭(extension)(DNA 중합)하였고, 이러한 과정을 30회 반복(95 ℃, 30초(변성) -> 55 ℃, 30초(재결합) -> 72 ℃, 90초(DNA 중합) -> 95 ℃, 30초(변성))하고, 72 ℃, 300 초간 마지막 합성을 실시하였다.
상기 과정으로 증폭된 증폭산물(PCR 산물)을 1.2%의 아가로스 젤에서 전기영동하고, Safeview(iNtRON Biotechnology, Korea)로 염색하여 DNA 다형성 밴드를 UV로 조사하여 검출하였으며, Gel-Doc system(Bio-rad)으로 저장하고 인쇄하여 도 16에 나타내었다.
도 16은 본 발명의 L. acidophilus 개별 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 분석한 결과이다.
이때, M은 DNA 크기 표준 마커(Sizer™ 100bp DNA Marker(cat.No,24073)이고, 1은 Lactobacillus helveticus ATCC 13866이고, 2는 Lactobacillus amylovorus ATCC 33620이며, 3은 Lactobacillus acidophilus ATCC 4356이며, 4는 Lactobacillus acidophilus NCFM 균주이고, 5는 Lactobacillus acidophilus LA1(CB_LA1이라고도 한다)이다.
나타난 바와 같이, 본 발명의 서열번호 8 및 서열번호 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주에 대해서만 특이적으로 PCR 산물(100~1000 bp)을 형성함을 확인하였다.
또한, 본 발명의 서열번호 8 및 서열번호 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1에서 약 200bp 크기의 DNA 단편을 증폭시켰음을 확인하였다.
게놈분석을 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주는 특이적으로 CRISPR 구간에서의 염기서열이 다른 균주(동속, 동종의 균주)들과 달리 6~17 번의 spacer 지역이 소실되어 있으므로, 서열번호 8, 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 조성물을 통해 회수한 PCR 산물(증폭된 DNA 단편, 엠플리콘(amplicon))의 크기가 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)이라 여겼다. 허나, 실질적으로는 약 200 bp의 크기에서 PCR 산물이 확인되었다. 이러한 차이는 PCR 산물의 확인에서 프라이머(primer)로 사용된 서열번호 8과 서열번호 16의 길이가 합해졌기 때문이다. 구체적으로 프라이머 세트로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 CRISPR 구간에 대한 PCR 산물(150 bp)과 서열번호 8 및 16의 프라이머 세트 서열(40 bp)가 합해져서 약 190bp에서 측정된 것이라 볼 수 있다.
게다가 전기영동 겔(gel electrophoresis) 상에서 미세한 차이(전기영동이 1base단위 정밀한 resolution을 보여주지 않음)를 고려하면, PCR 산물이 200 bp에서 검출되었다 하더라도, 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 CRISPR 구간에 대한 PCR 산물 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)를 근간으로 도출된 결과이므로, 본 발명의 범주에 속하는 결과라 할 것이다.
따라서, PCR 산물은 정확하게는 165 bp(150bp + 8bp의 프라이머와 7bp의 다이서)인 것이 바람직하나, 상술한 다양한 조건들을 고려하였을 때, 실제 적용하여 도출된 PCR 산물이 150 내지 250 bp, 바람직하게는 150 내지 200 bp에 해당한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주인 것으로 판별할 수 있다(마커로 측정가능한 영역에도 영향을 받음).
이를 증명하기 위하여 본 실시예에서 회수된 상기 L. acidophilus 3 종의 균주의 PCR 산물에 대해 DNA 염기서열을 확인하였다.
이에 반해 LA1 균주와는 다른 종의 Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620에 대해서는 전혀 증폭된 DNA 단편이 발견되지 않았으며, 동일한 종의 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, Lactobacillus acidophilus NCFM 균주에 대해서는 약 900bp, 1000bp 크기의 DNA 단편을 증폭시켰음을 확인하였다.
따라서, 본 발명에 따른 서열번호 8 및 서열번호 16으로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus)종 중에서 LA1 균주만 선택적으로 CRISPR 타겟 부위의 서열을 증폭시키므로, 다양한 균주들 중에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주를 검출 및 판별할 수 있다. 또한, 본 발명에 따른 서열번호 8 및 서열번호 16으로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종간에도 각 균주(strain) 별로 다른 크기의 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주만을 분명하게 판별할 수 있는 조성물로 활용가능하다.
실험예 5. 실시예 4의 락토바실러스 애시도필러스( Lactobacillus acidophilus) 개별 균주 판별용 조성물의 PCR 분석-2.
앞선 실험예 4로부터 측정된 바와 같이, 본 발명의 서열번호 8 및 서열번호 16로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 조성물을 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM로부터 분리된 각각의 DNA에 처리하여, 중합효소연쇄반응을 수행함으로써, PCR 산물을 얻고, 이의 크기를 분석하고자 하였다.
우선, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주들을 각각 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다. 이후 상기 각각의 균주의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하였다.
추출한 DNA에 대하여 하기 표 10의 PCR 반응액을 통해 thermal cycling(PCR)을 실시하였다. 추출한 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 DNA 및 완충액(10mM Tris-HCl(pH 8.0), 50mM KCl, 1.5mM MgCl2, 0.01 % 젤라틴)을 완전히 혼합한 용액을 준비하였다.
PCR반응은 Dyad(Bio-rad)를 사용하여 실시하였고, 반응조건은 초기 95 ℃에서 5 분간 유지한 뒤, 95 ℃에서 30초간 처리하여 DNA를 변성시키고, 55 ℃에서 30초간 어닐링한 후, 72 ℃에서 90초간 증폭(extension)(DNA 중합)하였고, 이러한 과정을 30회 반복(95 ℃, 30초(변성) -> 55 ℃, 30초(재결합) -> 72 ℃, 90초(DNA 중합) -> 95 ℃, 30초(변성))하고, 72 ℃, 5분 간 마지막 합성을 실시하였다.
PCR 반응 용액 함량(㎕)
SP taq. 0.5
10x SP taq buffer 2.5
dNTPs 2.0
Tuning Buffer 5.0
Template(균주 DNA) 1.0
Forward primer (5 uM)CRISPR F 프라이머(서열번호 8) 1.0
Reverse primer (5 uM) CRISPR R 프라이머(서열번호 16) 1.0
D.W 12
상기 과정으로 증폭된 증폭산물(PCR 산물)을 1.2%의 아가로스 젤에서 전기영동하고, Safeview(iNtRON Biotechnology, Korea)로 염색하여 DNA 다형성 밴드를 UV로 조사하여 검출하였으며, Gel-Doc system(Bio-rad)으로 저장하고 인쇄하여 도 17 내지 19에 나타내었다.
도 17은 DNA 크기 표준 마커에 대해 PCR을 수행하여 분석한 결과이고, 도 18은 본 발명의 L. acidophilus 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 아가로스 겔 전기영동으로 분석한 결과이며, 도 19는 본 발명의 L. acidophilus 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus acidophilus LA1, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM)에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후, 이를 아가로스 겔 전기영동으로 분석한 결과이다.
이때, 양쪽에 별도의 표기가 없는 lane은 DNA 크기 표준 마커이고, 1, 4, 7, 10은 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356이고, 2, 5, 8, 11은 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주이고, 3, 6, 9, 12은 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1(CB_LA1이라고도 한다)이다.
도 17 내지 19로부터 확인된 증폭산물에 대하여 시퀀스를 분석하였다. 우선 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주의 경우 프라이머(primer)를 제외하고 898 bp인 것으로 측정되었고, 증폭서열은 다음과 같다.
[서열번호 18]
CATCAATAGGATCACCTCCACATACGTGGAGAAAATTAGGCAAATAGCCAATTTTTATCATACATTCCGGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATAAATAAGGAAGATATTGCCACCCTCGGTACCCAGGATCACCTCCACATACGTGGAGAAAATACAAGTTTTGCTCTAACCATGATGTTGTAAACAGGATCACCTCCACATACGTGGAGAAAATACGTTAAAGCGGACAATAAGCTTCAACGTTTTAGGATCACCTCCACATACGTGGAGAAAATCGTGCTTGAAATTGCTCTCGGGGTTTCGCCTAAGGATCACCTCCACATACGTGGAGAAAATATTTGCTGCGAGTAACTCTGACTTGTTTACCCGGGATCACCTCCACATACGTGGAGAAAATTTTAGCTAAGTTTAAGACCGAAGATGGCCAAAGGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATACAAGTTTTGCTCTAACCATGATGTTGTAAACAGGATCACCTCCACATACGTGGAGAAAATAGCTATCCAAATATTAAATTTGCACTAGTTAAGGGGATCACCTCCACATACGTGGAGAAAATGAAGAATTTTATCTTCTAGGTGGCTTTTTTGTGGGATCACCTCCACATACGTGGAGAAAATAGAAATATTTGATTTTGATAGTGAAAAAGAATAGGATCACCTCCACATACGTGGAGAAATTCAGTCC
락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주의 예측길이는 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주의 CRISPR 영역을 기준으로 하고, 초기 예측길이는 프라이머 기준이 아닌 프라이머에 인접한 다이서(dicer) 서열을 기준으로 하기 때문에, 예측시 누락된 left 프라이머와 인접 다이서(dicer) 사이의 8 bp 서열과, right 프라이머와 인접 다이서 사이의 7 bp 서열을 포함할 경우 실제 예측길이는 898 bp임을 확인하였다.
유전체 서열 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM과 비교하여 1 bp 결손( deletion) 부분이 890 bp에서 확인되었는데, 이는 Sanger 시퀀싱의 품질저하 때문에 발생한 결손인 것으로 여겨진다. 따라서 본 발명에서 본 발명의 서열번호 8 및 서열번호 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 조성물을 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주에 적용할 경우, 예상되는 크기만큼 증폭한 것을 확인하였다.
다음으로, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356 균주의 경우 프라이머(primer)를 제외하고 837 bp인 것으로 측정되었고, 증폭서열은 다음과 같다.
[서열번호 19]
CATCAATAGGATCACCTCCACATACGTGGAGAAAATTAGGCAAATAGCCAATTTTTATCATACATTCCGGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATAAATAAGGAAGATATTGCCACCCTCGGTACCCAGGATCACCTCCACATACGTGGAGAAAATACGTTAAAGCGGACAATAAGCTTCAACGTTTTAGGATCACCTCCACATACGTGGAGAAAATCGTGCTTGAAATTGCTCTCGGGGTTTCGCCTAAGGATCACCTCCACATACGTGGAGAAAATATTTGCTGCGAGTAACTCTGACTTGTTTACCCGGGATCACCTCCACATACGTGGAGAAAATTTTAGCTAAGTTTAAGACCGAAGATGGCCAAAGGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATCGGCAATTTTTGAAACAAACAACTATGTATATAGGATCACCTCCACATACGTGGAGAAAATACAAGTTTTGCTCTAACCATGATGTTGTAAACAGGATCACCTCCACATACGTGGAGAAAATAGCTATCCAAATATTAAATTTGCACTAGTTAAGGGGATCACCTCCACATACGTGGAGAAAATGAAGAATTTTATCTTCTAGGTGGCTTTTTTGTGGGATCACCTCCACATACGTGGAGAAAATAGAAATATTTGATTTTGATAGTGAAAAAGAATAGGATCACCTCCACATACGTGGAGAAATTCAGATAC
락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356 균주의 예측길이는 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 균주의 CRISPR 영역을 기준으로 하였고, 초기 예측길이는 프라이머 기준이 아닌 프라이머에 인접한 다이서(dicer) 서열을 기준으로 하기 때문에, 예측시 누락된 left 프라이머와 인접 다이서(dicer) 사이의 8 bp 서열과, right 프라이머와 인접 다이서 사이의 7 bp 서열을 포함할 경우 실제 예측길이는 898 bp이였다.
그러나, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356의 CRISPR 영역은 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM의 9 번째 스페이서(spacer)(33 bp)와 다이서(28 bp)가 삭제된 형태임을 확인하였는 바, 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356의 CRISPR 영역은 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 보다 61 bp 짧은 837 bp일 것이라 예상할 수 있었다.
실질적으로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356의 서열길이가 837 bp임을 확인하였고, 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM 보다 61 bp 짧은 서열이 검출된 것을 확인하였다.
이를 통해 본 발명에 따른 본 발명의 서열번호 8 및 서열번호 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) NCFM와 락토바실러스 애시도필러스(Lactobacillus acidophilus) ATCC 4356을 정확하게 구분할 수 있음을 확인하였을 뿐만 아니라, 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1과도 명백히 구별할 수 있음을 다시한번 확인하였다.
마지막으로 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 경우 프라이머(primer)를 제외하고 165 bp인 것으로 측정되었고, 증폭서열은 다음과 같다.
[서열번호 20]
CATCAATAGGATCACCTCCACATACGTGGAGAAAATGAAGAATTTTATCTTCTAGGTGGCTTTTTTGTGGGATCACCTCCACATACGTGGAGAAAATAGAAATATTTGATTTTGATAGTGAAAAAGAATAGGATCACCTCCACATACGTGGAGAAAATTCAAGAT
락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 예측길이는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주의 CRISPR 영역을 기준으로 하였고, 초기 예측길이는 프라이머 기준이 아닌 프라이머에 인접한 다이서(dicer) 서열을 기준으로 하기 때문에, 예측시 누락된 left 프라이머와 인접 다이서(dicer) 사이의 8 bp 서열과, right 프라이머와 인접 다이서 사이의 7 bp 서열을 포함할 경우 실제 예측길이는 165 bp이였다.
실질적으로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1의 서열길이가 165 bp임을 확인한 바, 예측된 길이와 100% 일치함을 확인하였다. 즉, 전기영동시 육안으로 약 200 bp에 가까운 것으로 보였으나, 실질적으로 증폭된 서열의 길이는 165 bp로, 예측길이와 완벽하게 일치하고 있음을 알 수 있다.
이를 통해 본 발명에 따른 본 발명의 서열번호 8 및 서열번호 16으로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1을 동종 동속의 균주들 속에서 명백히 구별가능함을 알 수 있다.
따라서, 본 발명에 따른 서열번호 8 및 서열번호 16으로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus)종의 균주만 선택적으로 CRISPR 타겟 부위의 서열을 증폭시키므로, 다양한 균주들 중에서 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출 및 판별할 수 있다. 또한, 본 발명에 따른 서열번호 8 및 서열번호 16으로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종간에도 각 균주(strain) 별로 다른 크기의 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) LA1 균주 판별용 조성물로 활용가능함을 다시한번 확인할 수 있었다.
실험예 6. 실시예 7의 락토바실러스 애시도필러스( Lactobacillus acidophilus) 균주 판별용 조성물의 PCR 분석.
도 11에서 제작된 본 발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 판별용 조성물이 특이적으로 L. acidophilus 균주 특히, L. acidophilus YT1 균주를 판별하는지를 확인하고자 하였다.
우선, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1 및 Lactobacillus acidophilus YT1 균주들을 각각 MRS 배지(Difco, 288110)로 37 ℃, 18 시간동안 배양하였다. 이후 상기 각각의 균주의 배양액으로부터 균체를 회수하여 QIAamp DNA Mini kit(Qiagen, Germany)으로 Genomic DNA를 추출하였다.
추출한 DNA 30 ng에 대하여 thermal cycling(PCR)을 실시하였다. PCR 반응시 총 반응액은 20 ㎕이고, 2.0 mM dNTP(Fermentas, USA), 1.0 unit의 내열성 DNA 중합효소(e-taq polymerase, Solgent), 20 pmol CRISPR YT1 F(서열번호 7), 20 pmol CRISPR YT1 R 프라이머(서열번호 15), 20 ng 각각의 균주 DNA 및 완충액(10mM Tris-HCl(pH 8.0), 50mM KCl, 1.5mM MgCl2, 0.01 % 젤라틴)을 완전히 혼합한 용액을 준비한다.
PCR반응은 Dyad(Bio-rad)를 사용하여 실시하였고, 반응조건은 초기 95 ℃에서 300초간 유지한 뒤, 95 ℃에서 30초간 처리하여 DNA를 변성시키고, 60 ℃에서 30초간 어닐링한 후, 72 ℃에서 90초간 증폭(extension)(DNA 중합)하였고, 이러한 과정을 28회 반복(95 ℃, 30초(변성) -> 60 ℃, 30초(재결합) -> 72 ℃, 90초(DNA 중합))하고, 72 ℃, 300 초간 마지막 합성을 실시하였다.
PCR 반응 용액 함량(㎕)
SP taq. 0.5
10x SP taq buffer 2.5
dNTPs 2.0
Tuning Buffer 5.0
Template(균주 DNA) 1.0
Forward primer (5 uM)CRISPR YT1 F 프라이머(서열번호 7) 1.0
Reverse primer (5 uM) CRISPR YT1 R 프라이머(서열번호 15) 1.0
D.W 12
상기 과정으로 증폭된 증폭산물(PCR 산물)을 1.2%의 아가로스 젤에서 전기영동하고, Safeview(iNtRON Biotechnology, Korea)로 염색하여 DNA 다형성 밴드를 UV로 조사하여 검출하였으며, Gel-Doc system(Bio-rad)으로 저장하고 인쇄하여 도 20에 나타내었다.
도 20은 본 발명의 L. acidophilus YT1 균주 판별용 프라이머 세트를 이용하여, 각각의 균주(Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, Lactobacillus acidophilus YT1)에 대해 PCR을 수행하여 분석한 결과이다.
이때, M은 DNA 크기 표준 마커(Sizer™ 100bp DNA Marker(cat.No,24073)이고, 1은 Lactobacillus helveticus ATCC 13866이고, 2는 Lactobacillus amylovorus ATCC 33620이며, 3은 Lactobacillus acidophilus ATCC 4356이며, 4는 Lactobacillus acidophilus NCFM 균주이고, 5는 Lactobacillus acidophilus LA1(CB_LA1이라고도 한다), 6은 Lactobacillus acidophilus YT1이다.
나타난 바와 같이, 본 발명의 서열번호 7 및 서열번호 15로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1에서 약 320 bp 크기의 DNA 단편을 증폭시켰음을 확인하였다.
게놈분석을 통해 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주는 특이적으로 CRISPR 구간에서의 염기서열이 다른 균주(동속, 동종의 균주)들과 달리 두 개의 CRISPR를 가지고 다른 균주의 CRISPR 영역이 일부만 보존된 형태임을 확인하였다. 구체적으로 NCFM의 spacer 1번부터 5번까지가 YT1의 첫번째CRISPR에 존재하고, NCFM의 spacer 22번부터 26번까지가 YT1의 두 번째CRISPR에 존재했다. spacer 5번의 6번째 nucleotide부터 spacer d번의 20번째 nucleotide 까지 320 bp 가 증폭대상이고, 서열번호 7, 15로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 조성물을 통해 회수한 PCR 산물의 크기 또한 320 bp 로 측정된 것이라 볼 수 있다.
전기영동 겔(gel electrophoresis) 상에서 미세한 차이(전기영동이 1base단위 정밀한 resolution을 보여주지 않음)를 고려하면, PCR 산물이 320 bp에서 검출되었다 하더라도, 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 CRISPR 구간에 대한 PCR 산물 320 bp를 근간으로 도출된 결과이므로, 본 발명의 범주에 속하는 결과라 할 것이다.
따라서, PCR 산물은 정확하게는 320 bp 인 것이 바람직하나, 상술한 다양한 조건들을 고려하였을 때, 실제 적용하여 도출된 PCR 산물이 250 내지 400 bp, 바람직하게는 300 내지 350 bp에 해당한다면 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주인 것으로 판별할 수 있다(마커로 측정가능한 영역에도 영향을 받음).
이를 증명하기 위하여 본 실시예 에서 회수된 상기 L. acidophilus YT1 균주의 PCR 산물에 대해서만 DNA 염기서열을 확인하였다.
이에 반해 YT1 균주와는 다른 Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1 에 대해서는 전혀 증폭된 DNA 단편이 발견되지 않았다.
따라서, 본 발명에 따른 서열번호 7 및 서열번호 15로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1에 대해서만 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 조성물로 활용가능하다.
이후, YT1 균주 검출에 대하여 반복실험을 수행함과 동시에, PCR 증폭산물을 정제하여 시퀀싱하였다. 도 21은 본 발명의 L. acidophilus YT1 균주 판별용 프라이머 세트를 이용하여 YT1 균주에 대해 PCR을 수행하여 얻은 PCR 증폭산물을 정제한 후 이를 아가로스 겔 전기영동으로 분석한 것으로, 이는 10회의 반복실험 중에서 대표적인 결과이다.
도 21에서 M은 SizerTM 100bp DNA Marker(Cat. No. 24073)이고, N은 Blank이며, YT1-a와 b는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1로, 2차례의 실험을 의미한다.
도 21에 나타난 바와 같이, 본원발명의 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 조성물은 수회의 반복실험에도 불구하고 일정한 결과를 도출하고 있음을 확인하였다. 빠르고 간편할 뿐만 아니라 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주를 정확하고 재현있게 판별할 수 있음을 알 수 있다.
또한 도 21로부터 확인된 증폭산물에 대하여 시퀀스를 분석한 결과, 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주의 경우에서만 확인된 증폭산물의 크기는 두 실험 모두 프라이머(primer)를 포함하여 320 bp인 것으로 측정되었고, 증폭서열은 다음과 같다.
[서열번호 21]
TTGACTTGCGCTAGGTGTTGCATCAATAGGATCACCTCCACATACGTGGAGAAAATGACACCAAAAAGGGCGGTGGAAAACTTTTCAAAGGATCACCTCCACATACGTGGAGAAAATGACACCAAAAAGGGCGGTGGAAAACTTTTCAAAGGATCACCTCCACATACGTGGAGAAAATACTTCAACTAATCCTAATTATCCTGGCAATCCAGGATCACCTCCACATACGTGGAGAAAATGCCTAGTGCCTTACCAGCCTCGGCAAAACTGTGGGATCACCTCCACATACGTGGAGAAAATGGAACAACGCTTTCTGGTGA
실질적으로 증폭된 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1의 염기서열을 분석한 결과 게놈상에서 예측된 320 bp의 염기서열과 100% 일치함을 확인하였다. 즉, 전기영동시 육안으로 약 300 bp에 가까운 것으로 보였으나, 실질적으로 증폭된 서열의 길이는 320 bp이며, 게놈상에서 예측한 염기서열과 완벽하게 일치하고 있음을 알 수 있다.
이를 통해 본 발명에 따른 본 발명의 서열번호 7 및 서열번호 15로 표시되는 프라이머를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 조성물은 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1을 동종 동속의 균주들 속에서 명백히 구별가능함을 알 수 있다.
따라서, 본 발명에 따른 서열번호 7 및 서열번호 15로 표시되는 프라이머는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 에서만 앰플리콘(amplicon)을 생성하기에 신속, 정확하게 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 조성물로 활용가능함을 다시 한번 확인할 수 있었다.

Claims (12)

  1. 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물.
  2. 제1항에 있어서,
    상기 정방향 프라이머는 5'-말단에 연결된, 형광단, 발색단, 화학발광단, 자기입자 및 방사능동위원소로 이루어진 군에서 선택된 1종 이상의 표지를 추가로 포함하는 것을 특징으로 하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 프라이머 조성물.
  3. 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물.
  4. 제3항에 있어서,
    상기 조성물은 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함하는 것을 특징으로 하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주 판별용 프라이머 조성물.
  5. 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별용 프라이머 조성물.
  6. 제1항, 제3항 및 제5항 중 어느 한 항의 프라이머 조성물을 포함하는 키트.
  7. 제6항에 있어서,
    상기 키트는 완충용액, DNA 중합효소 및 dNTP를 포함하는 것을 특징으로 하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종 판별용 키트.
  8. a) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
    b) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 종을 판별하기 위한 방법.
  9. A) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 8로 표시되는 정방향 프라이머 및 서열번호 16으로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
    B) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별하기 위한 방법.
  10. 제9항에 있어서,
    상기 A) 단계는 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 더 포함하는 것을 특징으로 하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) 개별 균주를 판별하기 위한 방법.
  11. 1) 판별 대상 시료로부터 분리된 DNA를 주형으로 하고, 서열번호 7로 표시되는 정방향 프라이머 및 서열번호 15로 표시되는 역방향 프라이머로 구성된 프라이머 세트를 사용하여 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 PCR 산물을 얻는 단계; 및
    2) 상기 PCR 산물의 존재를 확인하는 단계;를 포함하는 락토바실러스 애시도필러스(Lactobacillus acidophilus) YT1 균주 판별하기 위한 방법.
  12. 락토바실러스 애시도필러스(Lactobacillus acidophilus) 균주를 검출하기 위한, 서열번호 1 내지 8 중에서 선택되는 어느 하나 이상의 정방향 프라이머 및 서열번호 9 내지 16 중에서 선택되는 어느 하나 이상의 역방향 프라이머로 구성된 프라이머 세트의 용도.
PCT/KR2019/006460 2018-09-21 2019-05-29 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법 WO2020060003A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/278,472 US20220154250A1 (en) 2018-09-21 2019-05-29 Composition for discriminating lactobacillus acidophilus strains and discrimination method using same
EP19862761.4A EP3854888A4 (en) 2018-09-21 2019-05-29 Composition for discriminating lactobacillus acidophilus strains and discrimination method using same

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR10-2018-0113928 2018-09-21
KR1020180113928A KR102444745B1 (ko) 2017-11-29 2018-09-21 Lactobacillus acidophilus 균주 판별용 조성물 및 이를 이용한 판별방법
KR10-2019-0040985 2019-04-08
KR1020190040986A KR102142473B1 (ko) 2019-04-08 2019-04-08 락토바실러스 속 중에서 특정 종을 특이적으로 판별하기 위한 프라이머 조성물 및 이를 이용한 판별방법
KR10-2019-0040986 2019-04-08
KR1020190040985A KR102142474B1 (ko) 2019-04-08 2019-04-08 Lactobacillus acidophilus YT1 균주 판별용 조성물 및 이를 이용한 판별방법

Publications (1)

Publication Number Publication Date
WO2020060003A1 true WO2020060003A1 (ko) 2020-03-26

Family

ID=69887337

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006460 WO2020060003A1 (ko) 2018-09-21 2019-05-29 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법

Country Status (3)

Country Link
US (1) US20220154250A1 (ko)
EP (1) EP3854888A4 (ko)
WO (1) WO2020060003A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060199190A1 (en) * 2004-04-28 2006-09-07 Danisco A/S Detection and typing of bacterial strains
KR100775641B1 (ko) * 2006-05-30 2007-11-13 경희대학교 산학협력단 다중효소중합반응 방법을 이용한 기능성 식품으로부터유산균 검출방법
KR101193410B1 (ko) * 2003-02-28 2012-10-24 일동제약주식회사 락토바실러스 속 균종의 동정방법
KR20180018422A (ko) * 2016-08-12 2018-02-21 한국식품연구원 락토바실러스 아시도필루스를 포함하는 갱년기 예방 또는 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106319083A (zh) * 2016-11-11 2017-01-11 上海市质量监督检验技术研究院 嗜酸乳杆菌成分的快速定性检测试剂盒、检测方法及应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101193410B1 (ko) * 2003-02-28 2012-10-24 일동제약주식회사 락토바실러스 속 균종의 동정방법
US20060199190A1 (en) * 2004-04-28 2006-09-07 Danisco A/S Detection and typing of bacterial strains
KR100775641B1 (ko) * 2006-05-30 2007-11-13 경희대학교 산학협력단 다중효소중합반응 방법을 이용한 기능성 식품으로부터유산균 검출방법
KR20180018422A (ko) * 2016-08-12 2018-02-21 한국식품연구원 락토바실러스 아시도필루스를 포함하는 갱년기 예방 또는 치료용 조성물
KR20180052569A (ko) 2016-08-12 2018-05-18 한국식품연구원 락토바실러스 아시도필루스를 포함하는 갱년기 예방 또는 치료용 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Genbank", Database accession no. GCA_000615285.1
DATABASE NCBI. GenBank 10 April 2018 (2018-04-10), "Lactobacillus acidophilus strain DSM 20079 chromosome, complete genome", XP055694607, Database accession no. CP020620.1 *
See also references of EP3854888A4

Also Published As

Publication number Publication date
EP3854888A1 (en) 2021-07-28
US20220154250A1 (en) 2022-05-19
EP3854888A4 (en) 2022-06-29

Similar Documents

Publication Publication Date Title
WO2018001258A1 (zh) 一种用于核酸富集捕获的探针及设计方法
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2019009682A2 (ko) 표적 특이적 crispr 변이체
WO2017188669A2 (ko) 절단된 상보적인 태그 절편을 이용한 표적 핵산 서열 검출 방법 및 그 조성물
WO2010143871A2 (ko) 재설계 유전자 회로를 이용한 다양한 효소 활성의 탐색 및 정량 방법
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2020105873A1 (ko) 인간 알파코로나바이러스 전장유전체 증폭을 통한 진단키트 및 전장 유전체 서열 확인 방법
WO2019013451A1 (ko) 유전자 변이 특이성이 증가된 dna 중합효소 및 이의 활성 증가용 pcr 버퍼 조성물
WO2018139826A1 (ko) Dna 메틸화를 이용한 연령 예측 방법
WO2020060003A1 (ko) 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법
WO2018182361A1 (ko) CRISPR/Cas 시스템과 재조합 효소 및 단일가닥 올리고디옥시리보핵산을 이용한 코리네박테리움 변이균주 제조방법
WO2015167087A1 (ko) Dna 복제수 변이를 이용한 강직성 척추염 발병 위험도 예측 방법
WO2023132543A1 (ko) 포토박테리움 레이오그나티 유래의 우라실-ｄｎａ 글리코실라제를 사용하여 핵산 증폭 반응에서의 캐리오버 오염을 제거하는 방법
WO2015199386A1 (ko) 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용
WO2022045843A1 (en) Method for positive control reaction using pre-positive control composition
WO2012050353A2 (ko) 표적 폴리뉴클레오티드의 염기서열을 비특이적으로 연장하는 방법
WO2023027418A1 (ko) 구강질환 유발 세균 검출용 조성물 내지 이의 용도
WO2011139032A2 (ko) 표적 유전자의 다양한 변이가 존재하는 유전자 영역을 증폭하기 위한 프라이머 조성물
WO2016122058A1 (ko) 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법
WO2019135477A2 (ko) 다복제유전자를 이용한 쯔쯔가무시병의 진단방법
WO2011081501A2 (ko) 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법
WO2021075750A1 (ko) 자가 증폭이 가능한 헤어핀 구조의 ｎｇｓ 라이브러리 제작용 어댑터 및 이를 이용한 ｎｇｓ 라이브러리 제조방법
WO2012177089A9 (ko) 클로렐라의 종간 및 종 내의 균주 특이적 마이크로새틀라이트 분자 마커
WO2020122679A1 (en) Method for detecting a target analyte in a sample using an s-shaped function for a slope data set
WO2022265463A1 (en) Detection of multiple target nucleic acid using multiple detection temperatures

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19862761

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019862761

Country of ref document: EP

Effective date: 20210421