WO2011081501A2 - 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법 - Google Patents

핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법 Download PDF

Info

Publication number
WO2011081501A2
WO2011081501A2 PCT/KR2010/009633 KR2010009633W WO2011081501A2 WO 2011081501 A2 WO2011081501 A2 WO 2011081501A2 KR 2010009633 W KR2010009633 W KR 2010009633W WO 2011081501 A2 WO2011081501 A2 WO 2011081501A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
pcr
nuclear
sequence
Prior art date
Application number
PCT/KR2010/009633
Other languages
English (en)
French (fr)
Other versions
WO2011081501A3 (ko
Inventor
김신제
윤길영
이순봉
연초롱
Original Assignee
주식회사 에프앤피
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 에프앤피 filed Critical 주식회사 에프앤피
Priority claimed from KR1020100139957A external-priority patent/KR101892461B1/ko
Publication of WO2011081501A2 publication Critical patent/WO2011081501A2/ko
Publication of WO2011081501A3 publication Critical patent/WO2011081501A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a molecular marker for determining a nuclear male sterile genetic factor that can easily determine the nuclear male sterility stabilizing gene and an assay method using the same.
  • F1 hybrids are hybrids between the inbred lines, and hybrid vigor between two species has a higher production potential than either parent, or hybrid vigor.
  • artificial pollination should be performed instead of natural self pollination.
  • Vegetables, etc. which have large flowers and have many seeds in one fruit, are easy to artificially pollinate, and many seeds are contained in one fruit, so that many hybrid seeds can be obtained by one crossing, while onions and carrots are flowers. Due to its small size, artificial breeding is difficult, and the number of seeds obtained by one breeding is very small. Therefore, it is not practical to produce hybrids by artificial breeding.
  • Hermaphrodite a plant capable of both self- and other pollination, must be removed from the mother's surgery before artificial breeding.
  • the method of obtaining coarse hybrids through natural moisture without the efforts of artificial moisture without omitting the difficult defrosting work is to use the male sterile fertility as the mother and the normal fertility as the patriline.
  • fertilization and infertility are shown as 1: 1, which reduces the effort of deunging to remove maternal surgery.
  • Male sterility is a type of mutation that occurs in the natural world, and it is a phenomenon in which moisture, fertilization, and seed phenomena are not produced because male organs, ie, fertilizers that cannot fertilize due to morphological or functional defects of surgery, cannot be produced. Production of large hybrids using male sterility may include onions, peppers, radishes, green onions, and the like. When using male sterility, it is possible to cultivate very high purity hybrid seeds. Male sterility can be largely divided into genetic male sterility (GMS) and cytoplasmic male sterility (CMS) according to genetic patterns.
  • GGS genetic male sterility
  • CMS cytoplasmic male sterility
  • GMS Genetic male infertility
  • Cytoplasmic male infertility is a case where male infertility is caused by the cytoplasm and is presumed to be due to the genetic material contained in the mitochondria in the cytoplasm, and thus has a maternal inheritance. Cytoplasmic male infertility has a cytoplasmic inheritance, so any gestational crosses along the mother line yields infertility. It is easy to maintain and maintain the cellular male infertility, but one-to-one hybrids that will be distributed to farms will also come out of infertility, so in order to obtain fruit or seeds, you need to plant pollen to supply pollen separately.
  • a restore gene in the nucleus that restores cytoplasmic male infertility is used.
  • This method is cytoplasmic genic male sterility (CGMS) and is used in peppers and onions.
  • CGMS cytoplasmic genic male sterility
  • Rf nuclear recovery factor
  • SRfRf and SRfrf states that have a nuclear repair gene capable of restoring the infertility cytoplasm, even if the male sterility cytoplasm is fertile, and the normal cytoplasm is always fertile regardless of the gene in the nucleus.
  • red pepper is the highest yielding vegetable crop in Korea, and has a high hardness.
  • most of the hybrid seeds are produced using male infertility and recovery.
  • research on cytoplasmic infertility and the recovery factor in the nucleus that restores it at the molecular level is very poor.
  • the present inventors completed the present invention by developing a molecular marker for the determination of genetic male sterility genetic factors in pepper using RAPD analysis method to solve the problems of the prior art.
  • an object of the present invention is a molecular marker for determining a nuclear male sterile genetic factor, a primer for detecting a nuclear male sterile gene, a method for assaying a nuclear male sterile gene, and a kit for detecting a nuclear male sterile gene To provide.
  • the present invention provides a molecular marker for determining a nuclear male sterile genetic factor ( ms 3 ) comprising a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 6.
  • the present invention also provides a primer for detecting a nuclear male sterility factor ( ms 3 ) consisting of a series of nucleotide sequences selected from the nucleotide sequences of SEQ ID NO: 6 and capable of amplifying the gene described in SEQ ID NO: 6. do.
  • ms 3 nuclear male sterility factor
  • the primer may be composed of any one base sequence selected from the group consisting of the base sequence of SEQ ID NO: 2 to 5 and SEQ ID NO: 7 to 15 or a base sequence complementary thereto.
  • the present invention provides a method for assaying a genetically infertile genetic factor in a genome comprising analyzing a genomic DNA of a plant using a primer according to the present invention.
  • the analysis is restriction fragment length polymerphism (RFLP), randomly amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), sequence tagged site (STS) , Expressed sequence tag (EST), sequence characterized amplified regions (SCAR), inter-simple sequence repeat amplication (ISSR), amplified fragment length polymorphism (AFLP), cleaved amplified polymorphic sequence (CAPS), single-strand conformation polymorphism, PCR (Polymerase Chain Reaction), RT-PCR (Reverse transcriptase PCR), DNA sequencing, hybridization by microarray, Northern blot and Southern blot It may be performed by one or more methods selected from the crowd.
  • RFLP restriction fragment length polymerphism
  • RAPD randomly amplified polymorphic DNA
  • DAF DNA amplification fingerprinting
  • AP-PCR arbitrarily primed PCR
  • STS sequence tagged site
  • EST Expressed sequence tag
  • the present invention provides a method for determining the genotype of a nuclear male sterile plant in a plant comprising continuously obtaining and analyzing genomic DNA of a plant using a nucleic acid according to the present invention or a primer of the present invention. .
  • the molecular marker for determining the nuclear genetic male infertility factor ms 3 according to the present invention can easily determine the presence or absence of the nuclear genetic male infertility genetic factor of pepper, and the genotype of various genes in the laboratory using the molecular marker Genetic factors can be easily identified through analysis, and the objectivity and reliability of discrimination can be enhanced. In addition, it is possible to expect the effect of maximizing the selection efficiency and shortening the selection time in the breeding process, by enabling genotyping of fertility and infertility individuals at the time can be useful for effective breeding.
  • Figure 1 shows the results of performing the RAPD analysis using the UBC primers, primers showing polymorphism in Ms 3 (F, red) and ms 3 (S, blue) was selected.
  • Figure 2 is carried out PCR using the primer pairs of SEQ ID NO: 2 and 3, and compares the base sequence of Ms 3 and ms 3 , and shows the position of the newly prepared primer.
  • F is 692bp
  • S is 701bp
  • the red marker is the primary PCR primer position
  • the blue marker is the secondary PCR primer position.
  • Figure 3 shows the band difference according to each genetic factor after restriction enzyme Alu1 treatment using the Nested PCR product.
  • Figure 4 shows the band difference according to each genetic factor after the PCR product analyzed by using a primer pair of SEQ ID NO: 12 and 15 prepared in the base sequence of SEQ ID NO: 6 which is an extended base sequence.
  • FIG. 5 shows PCR products analyzed using primers of SEQ ID NOs: 11 and 5 prepared in the expanded base sequence SEQ ID NO: 6 and the existing base sequence (SEQ ID NO: 1). The band difference is shown.
  • the present invention relates to the development of molecular markers for the determination of nuclear male sterile genetic factors of red pepper, which is a gene molecular marker found by using a random amplified polymorphic DNA (RAPD) analysis method.
  • RAPD random amplified polymorphic DNA
  • the present invention by confirming the polymorphism analysis of fertility and infertility molecular markers, to prepare a primer that can amplify the part showing the polymorphism difference of the molecular marker, using the material-specific chromosome fragments After amplification by PCR (PCR), the PCR product was cut using Alu1 restriction enzyme and subjected to electrophoresis on agarose gel.
  • PCR PCR
  • the present invention provides a molecular marker for discriminating nuclear male sterility genetic factors.
  • nuclear male sterility genetic factor molecular marker for discriminating ms 3 is located in the genome of a plant in close proximity to the gene of the nuclear male sterility genetic factor, the trait of the nuclear male sterility genetic factor of the plant Nucleic acid is highly associated with. Therefore, any polymorphism represented by the nucleotide sequence of the nucleic acid can be used to confirm the presence or absence of genetically male infertile genetic factors in plants, and can be used to select fertility and infertile individuals at the time.
  • Molecular markers for determining the nuclear male sterility genetic factor includes a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 6.
  • Nucleic acid herein includes all RNA, DNA and cDNA, preferably refers to DNA.
  • the molecular marker of the sequence of the base sequence name selected from the nucleotide sequence of SEQ ID NO: 6 includes a primer for detecting the genetic factor of SEQ ID NO: 6, specifically, SEQ ID NO: 2 to Amplified by any one primer selected from the group consisting of a nucleotide sequence and the base sequence of SEQ ID NO: 7 to 15, preferably a primer combination consisting of the base sequence of SEQ ID NO: 2 and 3, the base of SEQ ID NO: 4 and 5
  • the present invention also provides a primer for detecting a nuclear genetic male infertility gene consisting of a series of nucleotide sequences selected from the nucleotide sequences of SEQ ID NO: 6 and capable of amplifying the gene described in SEQ ID NO: 6.
  • the primer consists of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 5 and SEQ ID NO: 7 to SEQ ID NO: 15 or a base sequence complementary thereto.
  • the primer for detecting a nuclear male sterile genetic factor refers to a primer capable of complementarily hybridizing to a gene of a nuclear male sterile factor, and preferably a specific gene of the nuclear male sterile genetic factor. It can be a primer or a primer pair capable of amplifying.
  • amplifiable primer means template-directed DNA synthesis under appropriate conditions (eg, four different nucleoside triphosphates and polymerizers such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. Refers to a single-stranded oligonucleotide that can act as a starting point.
  • the primers of the present invention may be modified (e.g., added, deleted, substituted) without affecting the detection of polymorphisms associated with a nuclear male sterile genetic factor trait and need not be completely complementary to the template. It must be complementary enough to hybridize with the mold.
  • a primer selected from the group consisting of the nucleotide sequence of SEQ ID NO: 2 to SEQ ID NO: 5 and SEQ ID NO: 7 to SEQ ID NO: 15 may be used as the primer capable of detecting a nuclear male sterility genetic factor.
  • a primer combination consisting of the nucleotide sequences of SEQ ID NOs: 2 and 3, a primer combination consisting of the nucleotide sequences of SEQ ID NOs: 4 and 5, a primer combination consisting of the nucleotide sequences of SEQ ID NOs: 12 and 13, and nucleotide sequences of SEQ ID NOs: 12 and 15
  • a primer combination consisting of a primer combination consisting of a nucleotide sequence of SEQ ID NOs: 11 and 14, and a primer pair consisting of a nucleotide sequence of SEQ ID NOs: 11 and 5, and a complementary nucleotide sequence of an individual nucleotide sequence constituting these primer pairs. It may be a primer pair selected from the group consisting of a pair.
  • the specific gene of the nuclear male sterile genetic factor in the primer pair for detecting a nuclear male sterile genetic factor, in the case of a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 2 and 3 described below, the specific gene of the nuclear male sterile genetic factor was amplified to about 675 bp.
  • SEQ ID NO: 3 (FPG2MSA02-R): 5'-CAGGCGCACATCAAAGTGAAAACC-3 '
  • the specific gene of the nuclear male sterility gene factor was amplified to about 476 bp.
  • SEQ ID NO: 4 (FPMS2-3-F): 5'-GTAGATAGCATTTCTAGGCATGTA-3 '
  • SEQ ID NO: 5 (FPMS2-3-R): 5'-GTTTCCATAGAGTAGTTGTGCATG-3 '
  • the primers of the present invention include restriction fragment length polymerphism (RFLP), randomly amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), sequence tagged site (STS), and expressed sequence tag (EST).
  • RFLP restriction fragment length polymerphism
  • RAPD randomly amplified polymorphic DNA
  • DAF DNA amplification fingerprinting
  • AP-PCR arbitrarily primed PCR
  • STS sequence tagged site
  • EST expressed sequence tag
  • Sequence characterized amplified regions SCAR
  • inter-simple sequence repeat amplication ISSR
  • amplified fragment length polymorphism AFLP
  • cleaved amplified polymorphic sequence CRISPR-SSCP
  • PCR-SSCP single-strand conformation polymorphism
  • PCR polymerase chain
  • Various DNA known in the art such as Reaction, RT-PCR (Reverse transcriptase PCR), DNA sequencing, hybridization by microarray, Northern blot, Southern blot, etc. It can be designed to be suitable for polymorphic analysis.
  • primers consisting of 5 to 8 bases can be designed and used.
  • primers for STS analysis can be designed to match the terminal sequence of the RFLP label
  • primers for SCAR analysis can be designed based on the terminal sequence of the RAPD label
  • primers for CAPS analysis can be designed to include appropriate restriction enzyme sites.
  • the molecular marker for determining the nuclear genetic male infertility genetic factor of the present invention facilitates genotyping in breeding for seed production of red pepper, thereby enabling genotyping of fertility and infertile individuals at the time, which is useful for effective breeding. Can be used.
  • the present invention provides a method for assaying the nuclear genotype male sterility genetic factor comprising analyzing the genomic DNA of pepper by amplifying by the nucleic acid or primer to express a specific nucleotide band.
  • the method may include, but is not limited to, for example, restriction fragment length polymerphism (RFLP), randomly amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR (AP-PCR), and sequence (STS).
  • RFLP restriction fragment length polymerphism
  • RAPD randomly amplified polymorphic DNA
  • DAF DNA amplification fingerprinting
  • AP-PCR arbitrarily primed PCR
  • STS sequence
  • RNA sequencing hybridization by microarray, northern blot, and southern blot Can be performed by one or more methods selected from the group consisting of Preferably it may be RFLP, RAPD or CAPS analysis.
  • the assay method may be performed through CAPS analysis including the following steps.
  • the primer of step (a) may be a primer comprising a series of nucleotide sequences selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 5 and SEQ ID NO: 7 to SEQ ID NO: 15.
  • the restriction enzyme of step (b) may be used without limitation as long as it is a restriction enzyme present in the nucleotide sequence of SEQ ID NO: 6, preferably Alu1 can be used.
  • the assay method may be performed through RAPD analysis including the following steps.
  • the primer of step (a) may have any base sequence that can be designed by those skilled in the art to amplify the nucleic acid described in SEQ ID NO: 6, preferably SEQ ID NO: 2 to SEQ ID NO: 5 and SEQ ID NO: 7 to SEQ ID NO: It may be a primer comprising a series of nucleotide sequences selected from the group consisting of 15.
  • the present invention continuously obtains genomic DNA of a plant using a primer consisting of a base sequence selected from a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 6 or a nucleic acid consisting of a nucleotide sequence of SEQ ID NO: 6, and It provides a method for determining the genotype (geneotype) of the nuclear endogenous male infertility plants comprising the analysis.
  • the molecular marker of the present invention in the breeding of red pepper ms 3 With arguments It can be used to determine the presence or absence of genetically heterozygous stabilizing genetic factors in a population. Accordingly, the present invention provides a method for determining the genotype of a nuclear endogenous male infertility gene comprising analyzing the genomic DNA of a plant in the presence of a nucleic acid or primer of the invention. The method may be performed through various DNA polymorphism assays known in the art, and specific methods are as mentioned above.
  • the branched crops such as radish, cabbage, cauliflower, which belongs to eggplant, tomato, petunia, etc. It may include flower plants belonging to the family Liliaceae, Asteraceae, and other woody plants such as poplar, preferably red pepper.
  • the present invention provides a kit for detecting a nuclear male sterility genetic factor comprising a primer consisting of a series of nucleotide sequences selected from nucleotide sequences consisting of nucleotide sequences of SEQ ID NO: 6.
  • the primer may be a primer including a base sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 5 and SEQ ID NO: 7 to SEQ ID NO: 15.
  • the kit may include conventional components of the microorganism or virus detection kit using the nucleic acid or primer and PCR, and the conventional components may include reaction buffer, DNA polymerase, dNTP, and the like.
  • the experimental procedures e.g., PCR, Southern blot, etc.
  • various reagents necessary for confirming the results such as PCR reaction mixtures, restriction enzymes, Agarose, a buffer required for hybridization or electrophoresis may be further included.
  • Molecular genetic techniques as used in the present invention are used for breeding peppers to find and use molecular markers such as RELP, AFLP, RAPD, SSR closely related to the target traits to give objectivity and purpose to selection, increase the selection effect and The effect of shortening the selection time can be expected.
  • the developed molecular markers are genetic factors through DNA analysis in the laboratory, without observing the structure of pollen and the production of pollen during flowering, while cultivating the genotypes of various genes existing in nature or obtained through cross-breeding. Can be easily determined. This not only shortens the analysis time, but also increases the objectivity and reliability of the discrimination because it is not influenced by the environment at all. It can be omitted to maximize the selection efficiency in the breeding process.
  • gDNA from the bred ms 3 (1: 1) population 750 ⁇ l of 2 ⁇ CTAB buffer (1% PVP + 0.2% mercaptoethanol) was added to 100 mg of pepper leaves, and the leaves were crushed using a grinder. It was made to react at 1 degreeC. Next, 750 ⁇ l of chloroform was added to the mixture, and the mixture was stored at room temperature for 5 minutes, and then centrifuged at 12,000 rpm for 10 minutes using a centrifuge.
  • Randomly Amplified Polymorphic DNA was performed by the method of BSA (Bulked Segregant Analysis) using the gDNA isolated in ⁇ Example 2>. Using the separated gDNA, a total of four bulks were prepared, two of Ms and 5, respectively, and then amplified by PCR. PCR reaction composition was prepared by mixing 50 ng of template DNA, 10 ⁇ PCR buffer with 1.5 mM MgCl 2 , dNTPs 200 ⁇ M, taq DNA polymerase 2 Unit, primer 10 ⁇ M and adjusting the total volume to 25 ⁇ l with distilled water (DW). The solution was formed. When performing BSA-RAPD, screening was performed using 520 Operon primers and 800 UBC primers.
  • the PCR reaction solution was denatured at 94 ° C. for 4 minutes, followed by a total of 45 repetitions of 1 minute at 94 ° C., 1 minute at 37 ° C., 1 minute 30 seconds at 72 ° C., and then 10 at 72 ° C.
  • the reaction was conducted for a minute to synthesize.
  • the reaction product was confirmed by electrophoresis on 1.5% agarose gel.
  • PCR was performed using the UBC 284 primer selected in ⁇ Example 3>, and the nucleotide sequences were analyzed by cloning the bands of Ms 3 and ms 3 to confirm the information of a total of 696 nucleotides (SEQ ID NO: 1 ).
  • Primers were prepared using the analyzed nucleotide sequences of SEQ ID NO: 1, and the nucleotide sequences of the prepared primers are shown in Table 1 below.
  • PCR was performed using the prepared primers, and PCR conditions include initial denaturation (predenaturation); 3 min at 94 ° C., denaturation; 30 seconds at 94 ° C., primer annealing; 30 seconds at 60 ° C., polymerization; 25 cycles of one minute at 72 ° C. were carried out, followed by further polymerization (post-extension); The reaction was carried out at 72 ° C. for 10 minutes. Using the PCR product obtained through this process as a template was carried out the same experiment as in Example 5.
  • PCR was performed using the primers prepared in ⁇ Example 4>, and the base sequences were analyzed by cloning the bands of Ms 3 and ms 3, respectively.
  • polymorphism was confirmed in the nucleotide sequence of Ms 3 and ms 3 as shown in SEQ ID NO: 2, a new primer was prepared in the nucleotide sequence of SEQ ID NO: 1.
  • the base sequences of the prepared primers are shown in Table 2 below.
  • the secondary PCR was performed using the FPMS2-3 F / R primer combination using the primary PCR product as a template.
  • Secondary PCR includes dedenaturation; 3 min at 94 ° C., denaturation; 30 seconds at 94 ° C., primer annealing; 30 seconds at 58 ° C., polymerization; After repeating a total of 25 times with one cycle at 72 °C 1 cycle, post-extension; The reaction was carried out at 72 ° C. for 10 minutes. After completion of the reaction, the PCR reaction product was digested with Alu1 restriction enzyme at 37 ° C. for 1 hour and 30 minutes and confirmed on 2% agarose gel.
  • the size of the DNA fragment amplified by the primer combination of base sequences 4 and 5 is 476 bp.
  • Treatment of this reaction product with restriction enzymes resulted in fertility individuals as 303 bp and 162 bp, and infertility as a 476 bp band.
  • MsMs form Gaimhetero was confirmed as 476bp, 303bp, 162bp.
  • the present inventors performed the following experiment to obtain a base sequence which is further extended than that of FIG. This experiment was carried out to determine whether the molecular marker having a more extended nucleotide sequence than the molecular marker having the nucleotide sequence of SEQ ID NO: 1 can be found, and the expanded nucleotide sequence was obtained through inverse PCR, that is, Inverse PCR was performed twice using restriction enzymes such as Spe I and Hinc II.
  • Inverse PCR conditions include initial denaturation; 5 min at 94 ° C., denaturation; 1 minute at 94 ° C., primer annealing; 1 minute at 62 ° C., polymerization; A total of 40 repetitions of 2 minutes at 72 DEG C in one cycle, followed by further post-extension; The reaction was carried out at 72 ° C. for 10 minutes. PCR products obtained through this process was extended to the base sequence through the cloning process, the primer sequence used in the PCR is as shown in Table 3 below.
  • a new primer was prepared in the nucleotide sequence of SEQ ID NO: 6 obtained as a result of Example 6, and the nucleotide sequences of the prepared primers are shown in Table 4 below, and SEQ ID NOs: 12 and 13 and SEQ ID NO: 12 of the prepared primers.
  • PCR reactions using primer pairs of 15, SEQ ID NOs: 11, and 14, and the nucleotide sequence of SEQ ID NO: 6 identified in the present invention through analysis using restriction enzymes was identified as a genetic male sterility marker ( ms 3 ). It was investigated whether it can be used as.
  • the PCR reaction is denatured (predenaturation); 3 min at 94 ° C., denaturation; 30 seconds at 94 ° C., primer annealing; 30 seconds at 62 ° C., polymerization; After a total of 25 repetitions with one cycle at 72 ° C., post-extension; The reaction was carried out at 72 ° C. for 10 minutes. After completion of the reaction, the PCR reaction product was digested with Alu1 restriction enzyme at 37 ° C. for 1 hour and 30 minutes, and then cleaved on 1.5% agarose gel.
  • the present inventors further extended the base sequence from the base sequence of SEQ ID NO: 1 (ie, the base sequence part of the base sequence of SEQ ID NO. 1, which was not present in the base sequence of SEQ ID NO: 6), and the base sequence of the existing SEQ ID NO: 1.
  • the PCR reaction was performed using the primer pair of SEQ ID NO: 11 and 5.
  • PCR is dedenaturation; 4 min at 94 ° C., denaturation; 1 minute at 94 ° C., primer annealing; 1 minute at 60 ° C., polymerization; 35 cycles of 1 minute 30 seconds at 72 ° C., followed by post-extension;
  • the reaction was carried out at 72 ° C. for 10 minutes.
  • the reaction product was digested with Alu1 restriction enzyme at 37 ° C. for 1 hour and 30 minutes and confirmed on 1.5% agarose gel.
  • tacttttaac aagaaattgg ttgtcatgca tcctaacaat acctagagta tcacaaagg 540

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 핵내유전자적 웅성불임성 유전인자 ms 3 판별용 분자마커 및 이를 이용한 검정방법에 관한 것으로, 보다 상세하게는 서열번호 6의 염기서열로 이루어진 핵산을 포함하는 핵내유전자적 웅성불임성 유전인자인 ms 3 판별용 분자마커 및 이를 이용한 검정방법에 관한 것이다. 본 발명에 따른 핵내유전자적 웅성불임성 유전인자 판별용 분자마커는 고추의 핵내유전자적 웅성불임성 유전인자의 유무를 용이하게 판별할 수 있으며, 분자마커를 이용해 다양한 유전자들의 유전형을 실험실내에서 DNA 분석을 통하여 유전인자를 손쉽게 판별할 수 있으며, 판별의 객관성 및 신뢰도를 높일 수 있는 효과가 있다. 또한, 육종 과정에서의 선발 효율을 극대화시키고 선발시간을 단축시키는 효과를 기대할 수 있으며, 당대에 가임 및 불임 개체의 유전자형 판별을 가능하게 함으로써 효과적인 품종육성에 유용하게 사용될 수 있는 효과가 있다.

Description

핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법
본 발명은 핵내유전자적 웅성불임성 안정화 유전인자를 용이하게 판별할 수 있는 핵내유전자적 웅성불임성 유전인자 판별용 분자마커 및 이를 이용한 검정방법에 관한 것이다.
품종육성에서 일대잡종(F1 hybrid)은 근교계(Inbred line)간의 교배로, 두 종의 순계간의 교배 자손이 양친 중 어느 한 쪽보다도 높은 생산 잠재력을 갖는 것을 잡종강세(Hybrid vigor)라고 한다. 이러한 잡종강세 일대잡종 종자를 얻기 중한 방법으로 자연적인 자가수분이 아닌 인공수분을 실시해야 한다. 꽃이 크고 한 개의 과실에 종자가 많이 들어있는 박과채소 등은 인공수분이 쉽고, 한 개의 과실 내에 종자가 많이 들어 있어 한 번의 교배로 많은 잡종종자를 얻을 수 있는 반면, 양파, 당근 등은 꽃이 작아 인공교배가 어렵고 한 번의 교배로 얻어지는 종자 수도 매우 적어 인공교배로 잡종을 생산하는 것은 현실성이 없다. 또한 자가수분과 타가수분이 동시에 가능한 식물인 양전화식물(Hermaphrodite)은 인공교배 전에 모계의 수술을 제거해 주어야한다. 이런 경우에 까다로운 제웅작업을 생략하면서 인공수분의 노력없이 자연수분을 통해 일대잡종을 얻는 방법이 웅성불임계를 모계로 사용하고, 정상의 가임계를 부계로 사용하는 것이다. 고추에서는 가임화와 불임화가 1:1로 나타나기 때문에 모계의 수술을 제거해 주는 제웅작업의 노력이 줄어든다.
웅성불임성(male sterility)은 자연계에서 일어나는 일종의 돌연변이로 웅성기관, 즉 수술의 형태적 또는 기능적 결함으로 인하여 수정능력이 있는 화분을 생산하지 못해 수분, 수정, 종자현상이 이루어지지 않는 현상을 말한다. 웅성불임성을 이용한 일대잡종 생산은 양파, 고추, 무, 파 등을 들 수 있는데, 웅성불임성을 이용할 경우 순도가 매우 높은 일대잡종 종자를 채종할 수 있는 장점이 있다. 웅성불임성은 유전양식에 따라 크게 유전자적 웅성불임성(genic male sterility, GMS)과 세포질적 웅성불임성(cytoplasmic male sterility, CMS)으로 나눌 수 있다.
유전자적 웅성불임성(GMS)은 웅성불임성이 모본과 부본의 핵내 유전자의 상호작용에 의해서 일어나는 경우로 웅성불임성이 생존에 불리하게 작용하기 때문에 열성유전이 주로 발견되며 열성동형(homozygously recessive)인 경우에 불임성을 나타나게 된다. 웅성불임인자는 Ms로 표시하며 msms는 불임, Msms와 MsMs는 가임의 유전형이다.
세포질적 웅성불임성(CMS)은 웅성불임성이 세포질에 의해 일어나는 경우로 세포질에 있는 미토콘드리아에 들어 있는 유전물질에 의한 것으로 추정되고 있으며, 따라서 모계유전(maternal inheritance)을 한다. 세포질 웅성불임은 세포질 유전을 하므로 모계를 따라가 어느 가임계를 교배하더라도 불임주가 나온다. 세포질 웅성불임계의 유지가 쉬워 이용하기 편리하나, 농가에 보급하게 될 일대잡종도 불임계가 나오게 되므로 과실이나 종자를 얻기 위해서 화분을 공급할 수 있는 수분주를 따로 심어야 하므로 현실성이 없다.
이를 해결하기 위해서 세포질 웅성불임성을 회복시키는 핵내의 회복유전자(restore gene)를 이용하는데, 이러한 방법이 세포질-유전자적 웅성불임성(cytoplasmic genic male sterility, CGMS)이며 고추, 양파 등에 이용되고 있다. 이 경우 웅성불임 세포질을 S, 정상의 세포질을 N, 핵 내 회복인자를 Rf라고 표기하면 웅성불임세포질에 회복유전자를 가지지 않은 상태를 Srfrf로 표현할 수 있고 이런 상태에서는 불임이 된다. 웅성불임의 세포질을 가지고 있더라도 불임세포질을 회복시킬 수 있는 핵내 회복유전자를 가지는 SRfRf, SRfrf 상태는 가임이 되며, 정상의 세포질을 가지는 경우는 핵 내 유전자와 관계없이 항상 가임이 된다.
최근에 고추는 국내에서 채소작물로는 생산량이 가장 높고 경세성이 우수한 작물로 현재 대부분의 일대잡종 종자생산에는 웅성불임과 회복친을 사용하고 있다. 이에 비해 분자수준에서 세포질웅성불임과 이를 회복하는 핵 내 회복인자에 대한 연구는 매우 저조하다.
고추에 있어 일대잡종이 잡종강세를 나타낸다는 것은 일반적으로 알려져 있다. 고추는 낙화가 심하고 1과당 종자수가 적어 인공교배로 1일대잡종을 채종할 경우 교배화당 채종량이 노력에 비해 적다. 따라서 인공교배에 의한 F1 종자의 대량생산이 어렵고 그에 따른 종자 값이 매우 비싸게 된다. 이러한 문제점을 해결하기 위하여 고추에서 발견된 세포질-유전자적 웅성불임성과 유전자적 웅성불임성의 이용이 필요하게 되어 이러한 고추의 웅성불임성을 이용한 일대잡종 육성이 상업화되어 가고 있는 실정이다. 그러나 현재 품질에 관한 과학적인 육종 기준 및 분자표지 개발과 같은 기초 연구가 미흡하며, 경제 형질들의 대부분은 양적 형질로서 육종에 어려움이 있으며, 이러한 문제의 대안으로 분자유전학적 기술을 사용하는 것이 제시되고 있다.
이에 본 발명자들은 이러한 종래기술의 문제점을 해결하고자 RAPD 분석 방법을 이용하여 고추 핵내유전자적 웅성불임성 유전인자 판별용 분자표지 마커를 개발함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 핵내유전자적 웅성불임성 유전인자 판별용 분자마커, 핵내유전자적 웅성불임성 유전인자 검출용 프라이머, 핵내유전자적 웅성불임성 유전인자의 검정방법 및 핵내유전자적 웅성불임성 유전인자 검출용 키트를 제공하는 것이다.
상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 서열번호 6의 염기서열로 이루어진 핵산을 포함하는 핵내유전자적 웅성불임성 유전인자(ms 3 ) 판별용 분자마커를 제공한다.
또한, 본 발명은 서열번호 6의 염기서열 중에서 선택되는 일련의 염기서열로 이루어지고, 상기 서열번호 6으로 기재되는 유전자를 증폭시킬 수 있는 핵내유전자적 웅성불임인자(ms 3 ) 검출용 프라이머를 제공한다.
본 발명의 일실시예에 있어서, 상기 프라이머는 서열번호 2 내지 5 및 서열번호 7 내지 15의 염기서열로 이루어진 군 중에서 선택되는 어느 하나의 염기서열 또는 이에 상보적인 염기서열로 이루어진 것일 수 있다.
또한, 본 발명은 상기 본 발명에 따른 프라이머를 이용하여 식물체의 게놈 DNA를 분석하는 것을 포함하는 핵내유전자적 웅성불임성 유전인자의 검정방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 분석은 RFLP(restriction fragment length polymerphism), RAPD(randomly amplified polymorphic DNA), DAF(DNA amplification fingerprinting), AP-PCR(arbitrarily primed PCR), STS(sequence tagged site), EST(expressed sequence tag), SCAR(sequence characterized amplified regions), ISSR(inter-simple sequence repeat amplication), AFLP(amplified fragment length polymorphism), CAPS(cleaved amplified polymorphic sequence), PCR-SSCP(single-strand conformation polymorphism), PCR(Polymerase Chain Reaction), RT-PCR(Reverse transcriptase PCR), DNA 시퀀싱(DNA sequencing), 마이크로어레이(microarray)에 의한 혼성화, 노던 블럿(Northern blot) 및 서던 블럿(Southern blot)으로 이루어진 군중에서 선택된 하나 이상의 방법에 의하여 수행될 수 있다.
나아가 본 발명은 본 발명에 따른 핵산, 또는 본 발명의 프라이머를 이용하여 식물체의 게놈 DNA를 연속적으로 획득 및 분석하는 것을 포함하는 핵내유전자적 웅성불임성 식물체의 유전자형(genotype)을 결정하는 방법을 제공한다.
본 발명에 따른 핵내유전자적 웅성불임성 유전인자 ms3 판별용 분자마커는 고추의 핵내유전자적 웅성불임성 유전인자의 유무를 용이하게 판별할 수 있으며, 분자마커를 이용해 다양한 유전자들의 유전형을 실험실내에서 DNA 분석을 통하여 유전인자를 손쉽게 판별할 수 있으며, 판별의 객관성 및 신뢰도를 높일 수 있는 효과가 있다. 또한, 육종 과정에서의 선발 효율을 극대화시키고 선발시간을 단축시키는 효과를 기대할 수 있으며, 당대에 가임 및 불임 개체의 유전자형 판별을 가능하게 함으로써 효과적인 품종육성에 유용하게 사용될 수 있는 효과가 있다.
도 1은 UBC 프라이머를 이용하여 RAPD 분석을 수행한 결과를 나타낸 것으로, Ms3(F, 빨간색)와 ms3(S, 파란색)에서 다형성을 나타내는 프라이머를 선발하였다.
도 2는 서열번호 2와 3의 프라이머 쌍을 이용하여 PCR을 수행한 후, Ms3와 ms3의 염기서열을 비교 분석하고, 새롭게 제조된 프라이머의 위치를 나타낸 것이다. 그림에서 F는 692bp, S는 701bp, 빨간 지표는 1차 PCR 프라이머 위치, 파란지표는 2차 PCR 프라이머 위치를 나타낸다.
도 3은 Nested PCR 산물을 이용한 제한효소 Alu1 처리 후 각 유전인자에 따른 밴드 차이를 나타낸 것이다.
도 4는 확장된 염기서열인 서열번호 6의 염기서열 내에서 제작된 서열번호 12와 15의 프라이머쌍을 이용하여 분석한 PCR 산물을 제한효소 Alu1 처리 후 각 유전인자에 따른 밴드 차이를 나타낸 것이다.
도 5는 확장된 염기서열인 서열번호 6과 기존 염기서열(서열번호 1의 염기서열)내에서 제작된 서열번호 11과 5의 프라이머를 이용하여 분석한 PCR 산물을 제한효소 Alu1 처리 후 각 유전인자에 따른 밴드 차이를 나타낸 것이다.
본 발명은 고추의 핵내유전자적 웅성불임성 유전인자 판별용 분자마커 개발에 관한 것으로 RAPD(Random Amplified Polymorphic DNA) 분석 방법을 이용하여 찾은 유전자 분자마커이다. 본 발명의 일실시예에 따르면, 가임주와 불임주 분자마커의 다형성 분석 확인하여, 분자마커의 다형성 차이를 보이는 부분을 증폭할 수 있는 프라이머를 제작하였고, 이를 이용하여 공시재료분자특이적인 염색체 단편을 중합효소연쇄반응(PCR)을 이용하여 증폭시킨 다음, PCR 산물을 Alu1 제한효소를 이용하여 자르고 아가로스겔에 전기영동 결과 고추의 핵내유전자적 웅성불임 유전인자를 판별할 수 있었다.
따라서, 본 발명은 핵내유전자적 웅성불임성 유전인자 판별용 분자마커를 제공한다.
본 발명에서 “핵내유전자적 웅성불임성 유전인자 ms 3 판별용 분자마커”란 식물체의 게놈 내에서 핵내유전자적 웅성불임성 유전인자의 유전자와 상당히 근접하여 위치하고, 식물체의 핵내유전자적 웅성불임성 유전인자의 형질과 연관 정도가 높은 핵산을 말한다. 따라서, 핵산의 염기서열이 나타내는 어떠한 다형성을 사용하더라도 식물체의 핵내유전자적 웅성불임성 유전인자의 유무를 확인할 수 있으며, 당대에 가임 및 불임 개체를 선발하는데 이용할 수 있다.
본 발명에서 제공하는 핵내유전자적 웅성불임성 유전인자 판별용 분자마커는 서열번호 6의 염기서열로 이루어진 핵산을 포함한다. 여기에서 핵산은 RNA, DNA 및 cDNA를 모두 포함하며, 바람직하게는 DNA를 말한다. 또한, 본 발명의 상기 분자마커는 서열번호 6의 염기서열 중에서 선택되는 일련의 염기서열명의 상기 분자마커는 서열번호 6의 유전인자 검출용 프라이머를 포함하며, 구체적으로 서열번호 2 내지 서열번호 5의 염기서열 및 서열번호 7 내지 15의 염기서열로 이루어진 군 중에서 선택된 어느 하나의 프라이머에 의해 증폭될 수 있으며, 바람직하게는 서열번호 2 및 3의 염기서열로 이루어진 프라이머 조합, 서열번호 4 및 5의 염기서열로 이루어진 프라이머 조합, 서열번호 12 및 13의 염기서열로 이루어진 프라이머 조합, 서열번호 12 및 15의 염기서열로 이루어진 프라이머 조합, 서열번호 11 및 14의 염기서열로 이루어진 프라이머 조합, 및 서열번호 11 및 5의 염기서열로 이루어진 프라이머 조합에 의해 증폭될 수 있다.
또한, 본 발명은 서열번호 6의 염기서열 중에서 선택되는 일련의 염기서열로 이루어지고, 상기 서열번호 6으로 기재되는 유전자를 증폭시킬 수 있는 핵내유전자적 웅성불임성 유전인자 검출용 프라이머를 제공한다. 바람직하게 상기 프라이머는 서열번호 2 내지 서열번호 5의 염기서열 및 서열번호 7 내지 서열번호 15로 이루어진 군 중에서 선택된 어느 하나의 염기서열 또는 이에 상보적인 염기서열로 이루어진다.
본 발명에 따른 상기 핵내유전자적 웅성불임성 유전인자 검출용 프라이머는 핵내유전자적 웅성불임인자의 유전자에 상보적으로 혼성화될 수 있는 프라이머를 말하며, 바람직하게는 상기 핵내유전자적 웅성불임성 유전인자의 특이 유전자를 증폭할 수 있는 프라이머 또는 프라이머 쌍일 수 있다. 상기 “증폭할 수 있는 프라이머”란 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드를 말한다.
본 발명의 프라이머는 핵내유전자적 웅성불임성 유전인자 형질에 연관된 다형성 검출에 영향을 주지 않는 범위 내에서 변형(예를 들면: 부가, 결실, 치환)될 수 있으며, 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화할 정도로 충분히 상보적이어야 한다.
본 발명에 있어서 핵내유전자적 웅성불임성 유전인자를 검출할 수 있는 상기 프라이머로는 서열번호 2 내지 서열번호 5의 염기서열 및 서열번호 7 내지 서열번호 15로 이루어진 군 중에서 선택되는 프라이머를 사용할 수 있으며, 바람직하게는 서열번호 2 및 3의 염기서열로 이루어진 프라이머 조합, 서열번호 4 및 5의 염기서열로 이루어진 프라이머 조합, 서열번호 12 및 13의 염기서열로 이루어진 프라이머 조합, 서열번호 12 및 15의 염기서열로 이루어진 프라이머 조합, 서열번호 11 및 14의 염기서열로 이루어진 프라이머 조합, 및 서열번호 11 및 5의 염기서열로 이루어진 프라이머쌍 및 이들 프라이머 쌍을 구성하는 개별 염기서열의 상보적인 염기서열로 구성되는 프라이머 쌍으로 이루어진 군 중에서 선택되는 프라이머 쌍일 수 있다.
본 발명의 일실시예에 따르면 상기 핵내유전자적 웅성불임성 유전인자 검출용 프라이머 쌍에 있어서, 하기에 기재된 서열번호 2 및 3의 염기서열로 이루어진 프라이머 쌍의 경우 핵내유전자적 웅성불임성 유전인자의 특이 유전자를 약 675bp로 증폭시켰다.
서열번호 2(FPG2MSA-F) : 5'-CACAAAGAGCGTAGGGAAAGGTGT-3'
서열번호 3(FPG2MSA02-R) : 5'-CAGGCGCACATCAAAGTGAAAACC-3'
또한, 하기에 기재된 서열번호 4 및 5의 염기서열로 이루어진 프라이머 쌍의 경우 핵내유전자적 웅성불임성 유전인자의 특이 유전자를 약 476bp로 증폭시켰다.
서열번호 4(FPMS2-3-F) : 5'-GTAGATAGCATTTCTAGGCATGTA-3'
서열번호 5(FPMS2-3-R) : 5'-GTTTCCATAGAGTAGTTGTGCATG-3'
본 발명의 프라이머는 RFLP(restriction fragment length polymerphism), RAPD(randomly amplified polymorphic DNA), DAF(DNA amplification fingerprinting), AP-PCR(arbitrarily primed PCR), STS(sequence tagged site), EST(expressed sequence tag), SCAR(sequence characterized amplified regions), ISSR(inter-simple sequence repeat amplication), AFLP(amplified fragment length polymorphism), CAPS(cleaved amplified polymorphic sequence), PCR-SSCP(single-strand conformation polymorphism), PCR(Polymerase Chain Reaction), RT-PCR(Reverse transcriptase PCR), DNA 시퀀싱(DNA sequencing), 마이크로어레이(microarray)에 의한 혼성화, 노던 블럿(Northern blot), 서던 블럿(Southern blot) 등과 같이 당업계에 공지된 다양한 DNA 다형성 분석에 적합하도록 디자인될 수 있다. DAF 분석을 위해서는 5~8개의 염기로 이루어진 프라이머를 디자인하여 사용할 수 있다. 예컨대, STS 분석을 위한 프라이머는 RFLP 표지의 말단 염기서열과 일치하게 디자인할 수 있으며, SCAR 분석을 위한 프라이머는 RAPD 표지의 말단 염기서열에 입각하여 디자인할 수 있다. 또한, CAPS 분석을 위한 프라이머는 적절한 제한효소 자리가 포함되도록 디자인할 수 있다.
본 발명의 핵내유전자적 웅성불임성 유전인자 판별용 분자마커는 고추의 종자 생산을 위한 육종에 있어 유전자형의 판별을 용이하게 하여 당대에 가임 및 불임 개체의 유전자형 판별을 가능하게 함으로써 효과적인 품종육성에 유용하게 사용될 수 있다.
한편, 본 발명은 상기 핵산 또는 프라이머에 의해 증폭시켜 특정 뉴클레오티드 밴드를 발현시킴으로써 고추의 게놈 DNA를 분석하는 것을 포함하는 핵내유전자적 웅성불임성 유전인자의 검정방법을 제공한다. 상기 방법으로는, 이에 제한되지는 않으나, 예를 들어, RFLP(restriction fragment length polymerphism), RAPD(randomly amplified polymorphic DNA), DAF(DNA amplification fingerprinting), AP-PCR(arbitrarily primed PCR), STS(sequence tagged site), EST(expressed sequence tag), SCAR(sequence characterized amplified regions), ISSR(inter-simple sequence repeat amplication), AFLP(amplified fragment length polymorphism), CAPS(cleaved amplified polymorphic sequence), PCR-SSCP(single-strand conformation polymorphism), PCR(Polymerase Chain Reaction), RT-PCR(Reverse transcriptase PCR), DNA 시퀀싱(DNA sequencing), 마이크로어레이(microarray)에 의한 혼성화, 노던 블럿(Northern blot) 및 서던 블럿(Southern blot)으로 이루어진 군중에서 선택된 하나 이상의 방법에 의하여 수행할 수 있다. 바람직하게는 RFLP, RAPD 또는 CAPS 분석일 수 있다.
구체적으로, 상기 검정방법은 하기의 단계를 포함하는 CAPS 분석을 통해 수행될 수 있다.
(a) 임성주와 불임주로부터 얻은 각 게놈 DNA를 주형으로 하고, 서열번호 6의 염기서열 중에서 선택되는 일련의 염기를 포함하는 프라이머를 이용하여 PCR을 수행하는 단계;
(b) PCR 산물을 제한효소로 절단하는 단계;
(c) 절단된 DNA 단편들을 아가로스 겔에 로딩하여 전기영동하는 단계; 및
(d) 전기영동이 완료된 겔의 DNA 밴드 양상을 비교하는 단계.
상기 (a) 단계의 프라이머는 서열번호 2 내지 서열번호 5 및 서열번호 7 내지 서열번호 15로 이루어진 군 중에서 선택된 일련의 염기서열을 포함하는 프라이머일 수 있다. 또한, 상기 (b) 단계의 제한효소는 서열번호 6의 염기서열 내에 존재하는 제한효소라면 제한없이 사용될 수 있으며, 바람직하게는 Alu1을 사용할 수 있다.
또한, 상기 검정방법은 하기의 단계를 포함하는 RAPD 분석을 통해 수행될 수 있다.
(a) 임성주와 불임주로부터 얻은 각 게놈 DNA를 주형으로 하고, 서열번호 6으로 기재되는 염기서열을 증폭할 수 있는 프라이머를 이용하여 PCR을 수행하는 단계;
(b) PCR 산물을 아가로스 겔에 로딩하여 전기영동하는 단계; 및
(c) 전기영동이 완료된 겔의 DNA 밴드 양상을 비교하는 단계.
상기 (a) 단계의 프라이머는 서열번호 6으로 기재되는 핵산을 증폭하기 위해 당업자가 디자인할 수 있는 모든 염기서열을 가질 수 있으며, 바람직하게는 서열번호 2 내지 서열번호 5 및 서열번호 7 내지 서열번호 15로 이루어진 군 중에서 선택된 일련의 염기서열을 포함하는 프라이머일 수 있다.
나아가, 본 발명은 서열번호 6의 염기서열을 포함하는 핵산 또는 서열번호 6의 염기서열로 이루어진 핵산의 염기서열 중에서 선택되는 일련의 염기서열로 이루어진 프라이머를 이용하여 식물체의 게놈 DNA를 연속적으로 획득 및 분석하는 것을 포함하는 핵내유전자적 웅성불임 식물체의 유전자형(genotype)을 결정하는 방법을 제공한다.
한편, 본 발명의 분자마커는 고추의 육종에 있어서 ms 3 인자를 보유한 집단 내에서 핵내유전자적 웅성불임성 안정화 유전인자의 유무를 판별하는데 사용할 수 있다. 따라서 본 발명은 본 발명의 핵산 또는 프라이머의 존재 하에서 식물체의 게놈 DNA를 분석하는 것을 포함하는 핵내유전자적 웅성불임성 유전인자의 유전자형을 결정하는 방법을 제공한다. 상기 방법은 당업계에 공지된 다양한 DNA 다형성 분석을 통하여 수행될 수 있으며, 구체적인 방법은 위에서 언급한 바와 같다.
본 발명에 따른 상기 방법을 통해 핵내유전자적 웅성불임성 유전인자를 확인하기 위한 대상으로는 고추가 속한 가지과 작물인 가지, 토마토, 페튜니아 등과 애기장대가 속한 무, 양배추, 꽃양배추와 같은 십자화과 작물들, 백합과, 국화과에 속하는 화훼 작물들, 그 외 포플라와 같은 목본 식물을 포함할 수 있으며, 바람직하게는 고추이다.
나아가 본 발명은 서열번호 6의 염기서열로 이루어진 핵산의 염기서열 중에서 선택되는 일련의 염기서열로 이루어진 프라이머를 포함하는 핵내유전자적 웅성불임성 유전인자 검출용 키트를 제공한다. 상기 프라이머는 바람직하게 서열번호 2 내지 서열번호 5 및 서열번호 7 내지 서열번호 15로 이루어진 군에서 선택된 염기서열을 포함하는 프라이머일 수 있다. 상기 키트에는 상기 핵산 또는 프라이머 및 PCR을 이용한 미생물 또는 바이러스 검출키트의 통상적인 구성성분을 포함할 수 있으며, 상기 통상적인 구성성분으로는 반응완충액, DNA 중합효소, dNTP 등을 포함할 수 있다. 또한, 상기 핵산 또는 프라이머를 이용하여 핵내유전자적 웅성불임성 유전인자를 검출하는데 필요한 실험과정(예: PCR, 서던 블럿 등) 및 결과 확인에 필요한 여러 가지 시약들, 예컨대, PCR 반응 혼합물, 제한효소, 아가로스, 혼성화 또는 전기영동에 필요한 완충용액 등이 추가로 포함될 수 있다.
본 발명에서와 같은 분자유전학적 기술은 고추의 육종에 이용되면서 목적 형질에 밀접히 연관된 RELP, AFLP, RAPD, SSR 등 분자표지를 찾아내어 사용함으로써 선발에 객관성, 목적성을 부여하며, 선발효과를 증대하고 선발시간을 단축시키는 효과를 기대할 수 있다. 또한, 개발된 분자마커는 자연계에 존재하거나 교배를 통해 얻어진 다양한 유전자들의 유전형을 식물체를 포장에서 직접 재배하면서 개화기에 화기의 구조 및 화분의 생성 유무를 관찰하지 않고 실험실내에서 DNA 분석을 통한 유전인자를 손쉽게 판별할 수 있다. 이는 일반적인 교배를 이용한 판별 방법보다 분석시간을 단축시킬 뿐만 아니라, 환경의 영향을 전혀 받지 않기 때문에 판별의 객관성 및 신뢰도를 높일 수 있고 실제 육종을 하면서 인공 교배 단계와 육안으로 확인하는 임성의 안정성 확인 단계를 생략할 수 있어 육종 과정에서의 선발 효율을 극대화 시킬 수 있다.
이하, 본 발명을 실시예 및 도면을 참조하여 상세히 설명하기로 한다. 그러나 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
<실시예 1>
ms 3 유전인자 보유 계통을 이용한 집단육성 및 임성조사
본 발명자들은 Ms3Ms3×ms3ms3의 교배를 통해 육성된 F1(Ms3ms3) 개체를 자가수분시켜 Ms3Ms3:Ms3ms3:ms3ms3=1:2:1로 분리되는 집단을 육성하였다. 이렇게 육성된 각 개체의 임성조사 및 후대 임성조사를 통하여 웅성불임성 관련 유전인자를 조사하였다. 일반적으로 고추와 관련된 GMS현상은 자연발생적인 것 또는 x-ray, gamma rays 및 ethylmethanesulfonate(EMS)에 의한 돌연변이에서 나타나는데, 이러한 다양한 GMS resources중에 ms 1 , ms 3 및 ms k 는 일반적으로 잡종종자 생산에 이용된다. 본 발명에서 사용한 웅성불임성 관련 유전인자인 ms 3 는 P. Kapia No.794에 X-ray를 처리하여 유기한 것이다.
<실시예 2>
고추 잎으로부터 gDNA 추출
육종된 ms 3 (1:1)집단의 gDNA 추출을 위해서 고추 잎 100㎎에 2×CTAB 버퍼(1% PVP + 0.2% mercaptoethanol) 750㎕를 첨가하여 그라인더(grinder)를 이용하여 잎을 파쇄하고 60℃에서 1시간 반응시켰다. 다음으로, 클로로폼 750㎕를 넣고 섞어준 뒤, 상온에서 5분 보관 후 원심분리기를 이용하여 12,000rpm에서 10분간 원심분리하였다. 원심분리 후, 상층액만을 수거(450∼500㎕)하여 새로운 1.7㎖ 튜브에 넣고 3M NaOAC 50㎕와 100% 에탄올 1㎖를 넣은 후 섞고 -4℃에서 1시간 배양하였다. 원심분리기를 이용하여 12,000rpm, 4℃에서 15분간 원심분리한 후, 상층액을 버리고 70% 에탄올 500㎕를 첨가하여 12,000rpm에서 3분간 원심분리 후 상층액을 버리고 건조시켰다. 다음으로 TE 버퍼를 넣은 후 37℃에서 1시간∼3시간 반응시켜 게놈DNA를 분리하였다.
<실시예 3>
BSA-RAPD 수행
상기 <실시예 2>에서 분리된 gDNA를 이용하여 BSA(Bulked Segregant Analysis)의 방법으로 RAPD(Randomly Amplified Polymorphic DNA)를 수행하였다. 분리된 gDNA를 이용하여 Ms와 ms를 각각 5개씩 섞어 2개 씩 총 4개의 벌크(bulk)를 만든 후, PCR하여 선택증폭을 하였다. PCR 반응 조성물은 주형 DNA 50 ng, 10×PCR 완충액(1.5mM MgCl2 포함), dNTPs 200μM, taq DNA 중합효소 2 Unit, 프라이머 10μM를 혼합하고 증류수(D.W.)로 총 부피를 25㎕로 조정하여 반응액을 조성하였다. BSA-RAPD 수행시 Operon 프라이머 520개와 UBC 프라이머 800개를 이용하여 스크리닝을 수행하였다. 그런 다음, PCR 반응액을 94℃에서 4분간 변성시킨 후, 94℃에서 1분, 37℃에서 1분, 72℃에서 1분 30초를 한 사이클로 하여 총 45회 반복실시한 후, 72℃에서 10분간 반응시켜 합성하였다. 반응이 끝난 PCR 반응 산물을 1.5% 아가로스 겔 상에서 전기영동으로 확인하였다.
그 결과, 도 1에 나타낸 바와 같이, Ms3와 ms3에서 차이를 나타내는 UBC 284 프라이머를 선발하였다(도 1 참조).
<실시예 4>
RAPD 후 선발된 프라이머를 이용한 PCR 및 염기서열 분석
상기 <실시예 3>에서 선발된 UBC 284 프라이머를 이용하여 PCR을 수행한 후, Ms3와 ms3 각각의 밴드를 클로닝하여 염기서열을 분석하여 총 696bp의 뉴클레오타이드의 정보를 확인하였다(서열번호 1). 분석된 서열번호 1의 염기서열을 이용하여 프라이머를 제작하였으며, 제작된 프라이머의 염기서열을 하기 표 1에 기재하였다.
표 1 프라이머 서열
순서 프라이머명 염기서열 (5‘→3’) 서열번호
1 FPG2MSA-F CACAAAGAGCGTAGGGAAAGGTGT 2
2 FPG2MSA02-R CAGGCGCACATCAAAGTGAAAACC 3
제작된 프라이머를 이용하여 PCR을 수행하였으며, PCR 조건은 초기 변성(predenaturation); 94℃에서 3분, 변성(denaturation); 94℃에서 30초, 프라이머 접합(annealing); 60℃에서 30초, 중합반응(extension); 72℃에서 1분을 한 사이클로 하여 총 25회 반복 실시한 후, 추가 중합반응(post-extension); 72℃에서 10분간 반응시켰다. 이런 과정을 통해 얻어진 PCR 산물을 주형으로 이용하여 다음의 실시예 5와 같은 실험을 수행하였다.
<실시예 5>
Nested PCR을 통한 유전인자 표지마커 개발
상기 <실시예 4>에서 제작된 프라이머를 이용하여 PCR을 수행한 후, Ms3와 ms3 각각의 밴드를 클로닝하여 염기서열을 분석하였다. 그 결과 도 2의 서열번호와 같이 Ms3와 ms3의 염기서열에서 다형성을 확인하였고, 서열번호 1의 염기서열 내에서 새로운 프라이머를 제작하였다. 제작된 프라이머의 염기서열을 하기 표 2에 기재하였다.
표 2 프라이머 서열
순서 프라이머명 염기서열 (5‘→3’) 서열번호
1 FPMS2-3-F GTAGATAGCATTTCTAGGCATGTA 4
2 FPMS2-3-R GTTTCCATAGAGTAGTTGTGCATG 5
FPG2MSA-F/FPG2MSA02-R 프라이머 조합을 이용하여 1차 PCR 수행 후, 1차 PCR 산물을 주형(template)으로 이용하여 FPMS2-3 F/R 프라이머 조합을 이용하여 2차 PCR을 수행하였다. 2차 PCR은 변성(predenaturation); 94℃에서 3분, 변성(denaturation); 94℃에서 30초, 프라이머 접합(annealing); 58℃에서 30초, 중합반응(extension); 72℃에서 1분을 한 사이클로 하여 총 25회 반복 실시한 후, 추가중합반응(post-extension); 72℃에서 10분간 반응시키는 조건으로 수행하였다. 반응이 끝난 PCR 반응 산물에 Alu1 제한효소를 1시간 30분간 37℃에서 처리하여 절단한 후 2% 아가로스 겔 상에서 확인하였다.
그 결과, 염기서열 4 및 5의 프라이머 조합으로 증폭된 DNA 단편의 크기는 476bp이다. 이 반응 산물에 제한효소를 처리함으로써 가임개체들은 303bp, 162bp로 나타나고, 불임개체는 476bp 밴드가 확인되었다. 또한 MsMs 형태인 가임헤테로 경우에는 476bp, 303bp, 162bp로 확인할 수 있었다.
이와 같은 방법으로 도 3에 나타낸 바와 같이, 가임과 불임뿐만 아니라 가임 유전집단내에서 호모와 헤테로 구분이 가능한 CAPS 마커로 전환하였다. 이를 통해 MS3 유전인자 집단에 이용되는 유전자적 웅성불임성(GMS) 분자표지 마커로 활용이 가능함을 확인하였다.
<실시예 6>
Inverse PCR을 통한 염기서열 확장
나아가 본 발명자들은 도 2, 즉 서열번호 1의 염기서열보다 더 확장된 염기서열을 수득하기 위해 다음과 같은 실험을 수행하였다. 이러한 실험은 서열번호 1의 염기서열을 갖는 분자마커보다 더 확장된 염기서열을 갖는 분자마커를 발굴할 수 있는지를 확인하기 위해 수행한 것으로서, Inverse PCR을 통해 확장된 염기서열을 수득하였는데, 즉, Inverse PCR은 SpeⅠ, HincⅡ와 같은 제한효소를 이용하여 두 차례에 걸쳐 수행하였다. Inverse PCR 조건은 초기 변성(predenaturation); 94℃에서 5분, 변성(denaturation); 94℃에서 1분, 프라이머 접합(annealing); 62℃에서 1분, 중합반응(extension); 72℃에서 2분을 한 사이클로 하여 총 40회 반복 실시한 후, 추가 중합반응(post-extension); 72℃에서 10분간 반응시켰다. 이런 과정을 통해 얻어진 PCR 산물은 클로닝 과정을 통해 염기서열을 확장하시켰으며, 상기 PCR에서 사용한 프라이머 서열은 하기 표 3에 기재된 바와 같다.
표 3 염기서열 확장을 위해 수행된 inverse PCR시 사용된 프라이머
프라이머명 염기서열 (5‘→3’) 서열번호
FPG2AI602-F CACAATATTCCAAGTTTGTAAGAG 7
FPG2AI521-R ATGGGTCTTCCTTTTGTGATACTC 8
FPG2AI144-F GTAGTCCCTAAATAGACATAAACC 9
FPG2AI72-R CCTTCATGTGTTTTCTATGTTAAG 10
그 결과, 서열번호 1보다 염기서열이 더 확장된 서열번호 6의 염기서열을 갖는 약 1.4kb의 DNA를 확보할 수 있었다.
<실시예 7>
확장된 염기서열을 통한 유전인자 표지마커 개발
상기 실시예 6의 결과 수득한 서열번호 6의 염기서열 내에서 새로운 프라이머를 제작하였는데, 제작된 프라이머의 염기서열은 하기 표 4에 기재하였고, 제작된 프라이머들 중 서열번호 12 및 13, 서열번호 12 및 15, 서열번호 11 및 14의 프라이머 쌍을 이용하여 PCR 반응을 수행하였고, 제한효소를 이용한 분석을 통해 본 발명에서 규명한 서열번호 6의 염기서열을 유전자적 웅성불임성(ms 3 ) 분자표지 마커로 사용할 수 있는지를 조사하였다. 먼저 PCR 반응은 변성(predenaturation); 94℃에서 3분, 변성(denaturation); 94℃에서 30초, 프라이머 접합(annealing); 62℃에서 30초, 중합반응(extension); 72℃에서 1분을 한 사이클로 하여 총 25회 반복 실시한 후, 추가중합반응(post-extension); 72℃에서 10분간 반응시키는 조건으로 수행하였다. 반응이 끝난 PCR 반응 산물은 다시 Alu1 제한효소를 1시간 30분간 37℃에서 처리하여 절단한 후 1.5% 아가로스 겔 상에서 절단 여부를 확인하였다.
그 결과, 도 4에 나타낸 바와 같이, 가임과 불임뿐만 아니라 가임 유전집단내에서 호모와 헤테로 구분이 가능한 CAPS 마커로 전환이 가능하였고, 이를 통해 확장된 염기서열내에서 개발된 유전자적 웅성불임성(ms 3 ) 분자표지 마커로 활용이 가능함을 확인할 수 있었다.
표 4 확장된 1.4kb 염기서열내에서 제작된 프라이머 서열
프라이머명 염기서열 (5‘→3’) 서열번호
FPG2NE01-F CCACCCTAAGATGGTTCTAGGATA 11
FPG2NE02-F GTAGCCATGGCTGTGGTTTTCAAC 12
FPG2E04-R TTGGGTCCGTCTATTCGTGTCTAC 13
FPG2E05-R CGTTGTATTTGTTGGTTCAAGTCC 14
FPG2E04p-R GTTTTGGGTCCGTCTATTCGTGTCTAC 15
<실시예 8>
기존 염기서열과 확장된 염기서열에서 유전인자 표지마커 개발
나아가 본 발명자들은 서열번호 1의 염기서열에서 앞쪽으로 더 확장된 염기서열(즉, 서열번호 6의 염기서열 중 서열번호 1의 염기서열에는 없었던 앞쪽의 염기서열 부분)과 기존 서열번호 1의 염기서열을 토대로 새로운 프라이머 조합을 제작하였는데, 즉 서열번호 11 및 5의 프라이머 쌍을 이용하여 PCR 반응을 수행하였다. PCR은 변성(predenaturation); 94℃에서 4분, 변성(denaturation); 94℃에서 1분, 프라이머 접합(annealing); 60℃에서 1분, 중합반응(extension); 72℃에서 1분 30초를 한 사이클로 하여 총 35회 반복 실시한 후, 추가중합반응(post-extension); 72℃에서 10분간 반응시키는 조건으로 수행하였다. 반응이 끝난 PCR 반응 산물에 Alu1 제한효소를 1시간 30분간 37℃에서 처리하여 절단한 후 1.5% 아가로스 겔 상에서 확인하였다.
그 결과, 도 5에 나타낸 바와 같이, 본 발명에서 제작한 프라이머를 이용하여 PCR을 수행한 후, 제한효소 처리를 통한 분석으로 가임과 불임뿐만 아니라 가임 유전집단내에서 호모와 헤테를 구분할 수 있는 CAPS 마커로 사용할 수 있음을 알 수 있었으며, 이를 통해 확장된 염기서열(즉, 서열번호 6의 염기서열)은 유전자적 웅성불임성(ms 3 ) 분자표지 마커로 활용이 가능함을 확인하였다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
<110> FNP, Inc.
<120> Molecular marker for discrimination genetic male sterility gene
and detection method using the same
<130> OP10-1044
<150> KR10-2010-0139957
<151> 2010-12-31
<160> 15
<170> KopatentIn 1.71
<210> 1
<211> 696
<212> DNA
<213> Capsicum annuum
<220>
<221> gene
<222> (1)..(696)
<223> ms3 gene
<400> 1
caggcgcaca aagagcgtag ggaaaggtgt catcatacaa gtacttacta attttaagct 60
cattgtcatt agcaatctta acatagaaaa cacatgaagg aggagtagat agcatttcta 120
ggcatgtaac actttctctt tcaagagagt agtccctaaa tagacataaa ccatcatgga 180
cagaaaaggg atcacaatca aaaccaactt tacaagaaca aatactaacc gggttttcta 240
gacatttaag aacgtcaagg tcatcgtcac ccgattgatc atttttcaaa tcctcactag 300
ttgttggcaa cttatataca ctcaccttgg ttttcacaag ggtcaactag tgtgtaatac 360
ccttattaaa tggcaatgaa atcttactca agtcacaagt gctagtagct ctagatggac 420
ataaatcatt cttaatagaa gaattaattt tgtcatctaa aggatcaact agtgcttgct 480
tacttttaac aagaaattgg ttgtcatgca tcctaacaat acctagagta tcacaaaagg 540
aagacccatg cacaactact ctatggaaac ccgaaatgac tccaatatgg atactactag 600
ccacatcaca atattccaag tttgtaagag tatgcggatt agaattttta ccttgtaact 660
cacatgaatt acggttttca ctttgatgtg cgcctg 696
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2MSA-F
<400> 2
cacaaagagc gtagggaaag gtgt 24
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2MSA01-R
<400> 3
caggcgcaca tcaaagtgaa aacc 24
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPMS2-3-F
<400> 4
gtagatagca tttctaggca tgta 24
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPMS2-3-R
<400> 5
gtttccatag agtagttgtg catg 24
<210> 6
<211> 1396
<212> DNA
<213> Capsicum annuum
<220>
<221> gene
<222> (1)..(1396)
<223> extended ms3 gene
<400> 6
ctttcccacc ctaagatggt tctaggataa aaagggcaaa gtagccatgg ccgtggtttt 60
caaccatact tactttctcc taaggtgccg ccctaaaaac taggcatacc ctctatatca 120
ctatagaaaa tatcatgcgc acaaagagcg tagggaaagg tgtcatcatc caagtactta 180
ctaattttaa gctcattgtc attagcaatc ttaacataga aaacacatga aggaagagta 240
gatagcattt ctaggcatgt aacactttct ctttcaagag agtagtccct aaatagacat 300
aaaccatcat ggacagaaaa gggatcacaa tcaaagccaa ctttacaaga acaaatacta 360
accgggtttt ctagacattc aagaacgtca aggtcatcgt cacccgattg atcatttttc 420
aaatcctcac tagttgttgg caacttatat accaacttag actcaccttg gttttcacaa 480
gggtcaacta gtgtgtgaat acccttatta aatggcaatg aaaccttact caagtcacaa 540
gtgctagtag cactagatgg acataaatca ttcttaatag aagaattaat tttgtcatct 600
aaaggatcaa ctagtgcttg cttactttta acaagaaatt ggttatcatg catcctaaca 660
atacctagag tatcacaaaa ggaagaccca tgcacaacta ctctatggaa acccgaaatg 720
actcccatat ggatactact agccacatca caatattcca agtttgtaag agtatgcgga 780
ttagaatttt accttgtaac tcacatgaat tacggttttc actttgatgt gcgcctgaca 840
acccacttgt acctttgaca agttctcatc acaagggaga ctttgatata gtggtttgta 900
tgtcatccat tccctttctc atctttcaca atcacagagg atagtttcaa gatgggccat 960
taatccttgg tcaagtggaa gttggattaa tggttttgga tttggggagt caagcatgtg 1020
acgtagtctt tcaaggtttt ggtggacata ttcaagggct gccttggaag tactgtcatc 1080
catcatgtga cataagaaag acaacaaaag aaacaaacaa acaacttgtt agctcaaatt 1140
agcctcacca tgctctcact ctcgatttta cctcacactt agtttcacaa gtgttgaaag 1200
ccgacttgta ctttgtgagt gattgaggga tgagtccgtc ttggcccgga atagattttc 1260
atttgagttg actcaaataa aatttgtttc ggacttgaac caacaaatac aacgaattta 1320
caaaagagaa aaacacacaa agaaagtaga cacgaataga cggacccaaa actatcttac 1380
aatctagtag ataatt 1396
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2AI602-F primer
<400> 7
cacaatattc caagtttgta agag 24
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2AI521-R primer
<400> 8
atgggtcttc cttttgtgat actc 24
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2AI144-F primer
<400> 9
gtagtcccta aatagacata aacc 24
<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2AI72-R primer
<400> 10
ccttcatgtg ttttctatgt taag 24
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2NE01-F primer
<400> 11
ccaccctaag atggttctag gata 24
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2NE02-F primer
<400> 12
gtagccatgg ctgtggtttt caac 24
<210> 13
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2E04-R primer
<400> 13
ttgggtccgt ctattcgtgt ctac 24
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2E05-R primer
<400> 14
cgttgtattt gttggttcaa gtcc 24
<210> 15
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> FPG2E04p-R primer
<400> 15
gttttgggtc cgtctattcg tgtctac 27

Claims (6)

  1. 서열번호 6의 염기서열로 이루어진 핵산을 포함하는 핵내유전자적 웅성불임성 유전인자(ms 3 ) 판별용 분자마커.
  2. 서열번호 6의 염기서열 중에서 선택되는 일련의 염기서열로 이루어지고, 상기 서열번호 6으로 기재되는 유전자를 증폭시킬 수 있는 핵내유전자적 웅성불임인자(ms3) 검출용 프라이머.
  3. 제2항에 있어서,
    상기 프라이머는 서열번호 2 내지 5 및 서열번호 7 내지 15의 염기서열로 이루어진 군 중에서 선택되는 어느 하나의 염기서열 또는 이에 상보적인 염기서열로 이루어진 것을 특징으로 하는 핵내유전자적 웅성불임성 유전인자 검출용 프라이머.
  4. 제2항 또는 제3항의 프라이머로 이루어진 군 중에서 선택된 프라이머를 이용하여 식물체의 게놈 DNA를 분석하는 것을 포함하는 핵내유전자적 웅성불임성 유전인자의 검정방법.
  5. 제4항에 있어서,
    상기 분석은 RFLP(restriction fragment length polymerphism), RAPD(randomly amplified polymorphic DNA), DAF(DNA amplification fingerprinting), AP-PCR(arbitrarily primed PCR), STS(sequence tagged site), EST(expressed sequence tag), SCAR(sequence characterized amplified regions), ISSR(inter-simple sequence repeat amplication), AFLP(amplified fragment length polymorphism), CAPS(cleaved amplified polymorphic sequence), PCR-SSCP(single-strand conformation polymorphism), PCR(Polymerase Chain Reaction), RT-PCR(Reverse transcriptase PCR), DNA 시퀀싱(DNA sequencing), 마이크로어레이(microarray)에 의한 혼성화, 노던 블럿(Northern blot) 및 서던 블럿(Southern blot)으로 이루어진 군중에서 선택된 하나 이상의 방법에 의하여 수행되는 것을 특징으로 하는 핵내유전자적 웅성불임성 유전인자의 검정방법.
  6. 제1항의 핵산, 또는 제2항 또는 제3항의 프라이머로 이루어진 군 중에서 선택된 프라이머를 이용하여 식물체의 게놈 DNA를 연속적으로 획득 및 분석하는 것을 포함하는 핵내유전자적 웅성불임성 식물체의 유전자형(genotype)을 결정하는 방법.
PCT/KR2010/009633 2009-12-31 2010-12-31 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법 WO2011081501A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20090135917 2009-12-31
KR10-2009-0135917 2009-12-31
KR1020100139957A KR101892461B1 (ko) 2009-12-31 2010-12-31 핵내유전자적 웅성불임성 유전인자인 ｍｓ3 판별용 분자마커 및 이를 이용한 검정방법
KR10-2010-0139957 2010-12-31

Publications (2)

Publication Number Publication Date
WO2011081501A2 true WO2011081501A2 (ko) 2011-07-07
WO2011081501A3 WO2011081501A3 (ko) 2011-12-01

Family

ID=44227081

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/009633 WO2011081501A2 (ko) 2009-12-31 2010-12-31 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법

Country Status (1)

Country Link
WO (1) WO2011081501A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114703309A (zh) * 2021-05-08 2022-07-05 深圳市农业科技促进中心 一种与芥蓝隐性核雄性不育相关的snp分子标记及其应用
CN113637791B (zh) * 2021-08-25 2023-05-30 青岛农业大学 一种同时鉴定辣椒雄性不育三系杂交种恢复性和真实性的分子标记及其鉴定方法

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HE, J. ET AL.: 'Fine mapping of a recessive genic male sterility gene (Bnms3) in rapeseed (Brassica napus) with AFLP- and Arabidopsis-derived PCR markers' THEOR APPL GENET vol. 117, no. 1, June 2008, pages 1 - 18 *
WANG D. J. ET AL.: 'Molecular markers linked to mono-dominant genic male sterile gene in rapeseed (Brassica napus L.)' ZHI WU SHENG LI YU FEN ZI SHENG WU XUE XUE BAO vol. 32, no. 5, October 2006, pages 513 - 518 *
WANG, Y. G. ET AL.: 'Fine mapping of the rice thermo-sensitive genic male-sterile gene tms5' THEOR APPL GENET vol. 107, no. 5, September 2003, pages 917 - 921 *
XU, Z. ET AL.: 'Fine mapping of the epistatic suppressor gene (esp) of a recessive genic male sterility in rapeseed (Brassica napus L.)' GENOME vol. 52, no. 9, September 2009, pages 755 - 760 *
YI, B. ET AL.: 'Fine mapping of the recessive genic male-sterile gene (Bnms1) in Brassica napus L.' THEOR APPL GENET vol. 113, no. 4, August 2006, pages 643 - 650 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114703309A (zh) * 2021-05-08 2022-07-05 深圳市农业科技促进中心 一种与芥蓝隐性核雄性不育相关的snp分子标记及其应用
CN114703309B (zh) * 2021-05-08 2023-08-08 深圳市农业科技促进中心 一种与芥蓝隐性核雄性不育相关的snp分子标记及其应用
CN113637791B (zh) * 2021-08-25 2023-05-30 青岛农业大学 一种同时鉴定辣椒雄性不育三系杂交种恢复性和真实性的分子标记及其鉴定方法

Also Published As

Publication number Publication date
WO2011081501A3 (ko) 2011-12-01

Similar Documents

Publication Publication Date Title
WO2016076672A1 (ko) 유전체에서 유전자 가위의 비표적 위치를 검출하는 방법
WO2017188797A1 (ko) In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법
WO2019009682A2 (ko) 표적 특이적 crispr 변이체
US20200216916A1 (en) Method for estimating additive and dominant genetic effects of single methylation polymorphisms (smps) on quantitative traits
WO2017188669A2 (ko) 절단된 상보적인 태그 절편을 이용한 표적 핵산 서열 검출 방법 및 그 조성물
WO2011025242A2 (ko) 번역 효율 증진용 ｄｎａ 단편 및 이를 포함하는 재조합 벡터
WO2018139826A1 (ko) Dna 메틸화를 이용한 연령 예측 방법
WO2011081501A2 (ko) 핵내유전자적 웅성불임성 유전인자인 엠에스3 판별용 분자마커 및 이를 이용한 검정방법
WO2020105873A1 (ko) 인간 알파코로나바이러스 전장유전체 증폭을 통한 진단키트 및 전장 유전체 서열 확인 방법
WO2021182881A1 (ko) 유방암 진단용 다중 바이오마커 및 이의 용도
WO2015167087A1 (ko) Dna 복제수 변이를 이용한 강직성 척추염 발병 위험도 예측 방법
WO2011139032A2 (ko) 표적 유전자의 다양한 변이가 존재하는 유전자 영역을 증폭하기 위한 프라이머 조성물
WO2011081502A2 (ko) 핵내유전자적 웅성불임인자(엠에스케이)와 연관된 분자마커 및 이를 이용한 검정방법
WO2022234978A1 (ko) RNAase가 풍부하게 함유된 시료로부터 핵산을 추출하는 방법
WO2016122058A1 (ko) 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법
WO2017209575A1 (en) Evaluation of specificity of oligonucleotides
WO2012177089A9 (ko) 클로렐라의 종간 및 종 내의 균주 특이적 마이크로새틀라이트 분자 마커
WO2020122679A1 (en) Method for detecting a target analyte in a sample using an s-shaped function for a slope data set
WO2012150818A9 (ko) 만성 골수성 백혈병 위험도를 예측하는 방법 및 이를 이용한 진단키트
WO2015105273A1 (ko) 식물체의 ａｂｃｇ１４ 단백질을 포함하는 사이토카이닌 수송 촉진용 조성물
WO2021075750A1 (ko) 자가 증폭이 가능한 헤어핀 구조의 ｎｇｓ 라이브러리 제작용 어댑터 및 이를 이용한 ｎｇｓ 라이브러리 제조방법
WO2020060003A1 (ko) 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법
WO2014175604A2 (ko) 아벨리노 각막이상증 진단용 조성물 및 이의 진단방법
WO2022055276A1 (ko) 여성형 탈모증 관련 유전자 다형성 마커 및 이의 용도
WO2019103475A2 (ko) 실시간 중합 효소 연쇄 반응을 이용한 ｈｌａ 대립유전자 검사 키트

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10841333

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10841333

Country of ref document: EP

Kind code of ref document: A2