WO2017188797A1 - In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법 - Google Patents

In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법 Download PDF

Info

Publication number
WO2017188797A1
WO2017188797A1 PCT/KR2017/004610 KR2017004610W WO2017188797A1 WO 2017188797 A1 WO2017188797 A1 WO 2017188797A1 KR 2017004610 W KR2017004610 W KR 2017004610W WO 2017188797 A1 WO2017188797 A1 WO 2017188797A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
guide rna
rna
target
oligonucleotide
Prior art date
Application number
PCT/KR2017/004610
Other languages
English (en)
French (fr)
Inventor
김형범
김희권
송명재
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to EP17789981.2A priority Critical patent/EP3450570B1/en
Priority to US16/096,849 priority patent/US20190136211A1/en
Priority to JP2018556336A priority patent/JP2019514379A/ja
Priority to CN201780040689.2A priority patent/CN109415756B/zh
Publication of WO2017188797A1 publication Critical patent/WO2017188797A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G16B30/20—Sequence assembly
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a method for evaluating the activity of RNA-guided nucleases in a high-throughput manner in vivo , specifically cells, and specifically, guide RNAs. It relates to a method for assessing the activity of RNA-guided nucleases from the indel frequency of a cell library, comprising isolated oligonucleotides comprising a coding sequence and a target sequence.
  • Type 2 CRISPR-Cas clustered regularly interspaced short palindromic repeats and CRISPR-associated protein
  • RNA-guided nucleases derived from the prokaryotic immune system provide a means of correcting the genome.
  • sgRNAs single guide RNAs
  • Cas9 proteins Cell, 2014, 157: 1262-1278.
  • CRISPR-Cas9 single guide RNA
  • sgRNA single guide RNA
  • Cpf1 protein CRISPR from Prevotella and Francisella 1
  • Cpf1 has several advantages in that it cuts into the 5 'overhang, the shorter length of the guide RNA, and the longer between the seed sequence and the cleavage site.
  • Cpf1 there is a lack of studies on the properties of Cpf1, particularly related to target and non-target effects in human and other eukaryotic cells.
  • RNA-guided nucleases Although the activity and accuracy are very important in the application of RNA-guided nucleases to genome calibration, much time and effort is required to confirm the targeted and non-target activity of RNA-guided nucleases. The accuracy of predictions for target and nontarget activity in in silico is limited (Nat Biotechnol, 2014, 32: 1262-1267), and comprehensive in vivo experiments on RNA-guided nuclease activity are needed for the development of computerized predictive models. Characterization of nucleases via
  • the present invention has been completed by developing a pair library system using urea.
  • One object of the present invention comprises (a) a base sequence encoding a guide RNA, into which an RNA-guided nuclease is introduced, and a target base sequence to which the guide RNA is desired. Performing sequencing using DNA obtained from a cell library comprising isolated oligonucleotides; And
  • Another object of the present invention is to provide a cell library comprising two or more kinds of cells comprising a nucleotide sequence encoding a guide RNA and an oligonucleotide comprising the target nucleotide sequence.
  • Another object of the present invention is to provide a vector comprising a nucleotide sequence encoding a guide RNA and an isolated oligonucleotide comprising the target nucleotide sequence of the guide RNA, and a vector library.
  • Another object of the present invention is to set the target sequence to be targeted with (a) RNA-guided nuclease; (b) designing a base sequence encoding a guide RNA to form a base pair with a complementary chain of the set target sequence; (c) designing an oligonucleotide comprising the target sequence and a guide RNA for the purpose; And (d) repeating the steps (a) to (c) one or more times.
  • Another object of the present invention is an isolated guide RNA comprising a sequence capable of forming a base pair with a complementary strand of a target sequence, adjacent to a proto-spacer-adjacent Motif (PAM) sequence, TTTV or CTTA.
  • PAM proto-spacer-adjacent Motif
  • Another object of the present invention is to provide a composition for genome calibration, comprising the isolated guide RNA, or a nucleic acid encoding the same.
  • Another object of the present invention is the isolated guide RNA, or a nucleic acid encoding the same; And it provides a system for genome correction in mammalian cells, including Cpf1 protein or nucleic acid encoding the same.
  • Another object of the present invention is the guide RNA or a nucleic acid encoding the same; And introducing a Cpf1 protein or a nucleic acid encoding the same into a mammalian cell, which are sequentially or simultaneously separated, thereby providing a method for genome editing with Cpf1 in a mammalian cell.
  • Methods for assessing the activity of RNA-guided nucleases using the guide RNA-target sequence pair library of the present invention are RNA-guided nucleases in a high-throughput manner in vivo . Since it is possible to evaluate the activity of the agent, it can be very useful in all fields of applying RNA-guided nuclease.
  • FIG. 1 shows a schematic of an oligonucleotide comprising a pair of target sequence and guide RNA sequence for evaluating the activity of Cpf1.
  • FIG. 2 shows a schematic diagram of the AsCpf1 lentiviral vector map.
  • Psi packaging signal
  • RRE rev response element
  • WPRE posttranscriptional regulatory element of woodchuck hepatitis virus
  • U6, U6 pol III promoter U6, U6 pol III promoter
  • cPPT central polypurine tract
  • EFS elongation factor 1a short promoter
  • BlastR blasticidin resistance gene.
  • Figure 3 shows a schematic of the LbCpf1 lentiviral vector map.
  • Psi packaging signal
  • RRE rev response element
  • WPRE posttranscriptional regulatory element of woodchuck hepatitis virus
  • cPPT central polypurine tract
  • EFS elongation factor 1a short promoter
  • BlastR blasticidin resistance gene.
  • FIG. 4 shows a schematic of a lentiviral vector comprising a backbone vector for preparing a plasmid library and a pair of target and guide RNA sequences.
  • Psi packaging signal
  • RRE rev response element
  • WPRE posttranscriptional regulatory element of woodchuck hepatitis virus
  • cPPT central polypurine tract
  • DR direct repeat of Cpf 1
  • GS guide sequence of guide RNA
  • T polyT
  • B barcode
  • TS target sequence
  • HS homology sequence
  • EF1 ⁇ elongation factor 1 ⁇ promoter
  • PuroR puromycin resistance gene.
  • FIG. 5 is a schematic diagram briefly showing the entire process of the high throughput analysis system using the pair library of the present invention.
  • FIG. 6 shows the relative copy numbers of each pair in oligonucleotide populations, plasmid libraries, and cell libraries.
  • FIG. 7 shows the normalized pair copy numbers of the plasmid library and the cell library by pair copy numbers of the oligonucleotide population and the plasmid library, respectively.
  • FIG. 10 shows the correlation between the pair copy number of the plasmid library and the oligonucleotide population by deep sequencing.
  • FIG. 11 shows the correlation between pair copies numbers of cell libraries and oligonucleotide populations by deep sequencing.
  • FIG. 12 shows the correlation between pair copy numbers of cell library and plasmid library evaluated by deep sequencing.
  • FIG. 13 schematically shows a process for identifying the PAM sequences of AsCpf1 and LbCpf1.
  • FIG. 15 shows indel frequencies for four TTTN PAM sequences of AsCpf1. Error bars represent standard deviations. * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001.
  • 16 shows indel frequencies according to the potential PAM sequences of LbCpf1. ANNNN sequences were tested as potential PAM sequences. For simplicity, “A” is omitted.
  • FIG. 17 shows indel frequencies for four types of TTTN PAM sequences of LbCpf1. Error bars represent standard deviations. * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001.
  • Figure 18 shows the comparison of PAM sequences by in vivo and in vitro analysis.
  • the PAM sequences of a and b, (a) AsCpf1 and (b) LbCpf1 were confirmed by in vitro analysis.
  • In vivo analysis confirmed the relationship between the indel frequencies of c and d, (c) AsCpf1 and (d) LbCpf1, and the potential PAM sequences.
  • FIG. 19 shows indel frequencies for four NTTTA PAM sequences, AsCpf1 (left) and LbCpf1 (right). Error bars represent standard error of mean (SEM). * P ⁇ 0.05 ANOVA followed by Tukey's post hoc test.
  • Figure 21 shows the base affinity at each position of the AsCpf1 target sequence for the top 20% of high activity guide RNA. P-values were calculated with a binomial distribution with a baseline probability of 0.2 using guide RNA from Nat Biotechnol, 2014, 32: 1262-1267 and 1,251 pairs of target sequences.
  • Figure 22 shows the relationship between the GC content of the target sequence and the observed indels.
  • a, b, and c represent populations with statistically different indel frequencies ( P > 0.05). Error bars represent standard deviations. * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001.
  • Figure 23 shows the mean indel frequency over time after delivery of a Cpf1-expressing lentiviral vector to the cell library. Error bars indicate standard deviation. ** P ⁇ 0.01, *** P ⁇ 0.001.
  • FIG. 24 shows indel frequencies at each target sequence at 3, 5, and 31 days after transduction of Cpf1 expressing lentiviruses into the cell library.
  • Fig. 25 schematically shows an experimental design for analyzing indel frequencies according to base mismatches between guide RNA coding sequences and target sequences.
  • FIG. 26 shows indel frequencies according to base mismatch positions in non-target sequences.
  • FIG. 27 shows normalized indel frequencies along the guide RNA length in target sequences and non-target sequences with one base mismatch by indel frequency in the target sequence.
  • FIG. 28 shows the relative indel frequency according to the number of mismatched bases in the non-target sequence.
  • FIG. 29 shows the effect of mismatched base numbers on regions in the target sequence on non-target indel frequencies induced by Cpf1. Non-target indel frequency was normalized to indel frequency in the target sequence.
  • FIG. 30 shows the effect of multi-base mismatches of regions within target sequences on non-target indel frequencies induced by Cpf1.
  • Non-target indel frequency was normalized to indel frequency in the target sequence.
  • FIG. 31 shows the effect of the type of mismatch on the relative indel frequency in the seed region of a nontarget sequence. ** P ⁇ 0.01.
  • RNA-guided nucleases have been measured in individual and difficult methods (small systems, stomach).
  • the present invention allows for high throughput evaluation (factory system, below), thus providing a new method for easily evaluating RNA-guided nucleases in large quantities.
  • FIG. 35 shows a schematic of oligonucleotides comprising a pair of target sequence and guide RNA sequence for evaluating the activity of Cas9.
  • Figure 37 shows the results of the guide RNA activity measurement using the guide RNA-target sequence pair library.
  • Figure 38 shows the results of the measurement of guide RNA activity measured using the pair library of the present invention.
  • FIG. 39 is A diagram showing the interaction between crRNA nuclease at position 1 and Thr16 of the Cpf1 WED domain.
  • the hydroxy sidechain of the Thr16 residue in the WED domain has a polar interaction with N2 of guanine base (blue dotted line in red circle).
  • Side chains of other nucleobases such as thymine and O2 of uracil, may have similar polar interactions with the Thr16 residues.
  • moieties do not exist in adenine, and in crRNA adenine ribonucleobases, they are unstable with thymine at position 1 of the target DNA strand next to the PAM motif.
  • 40 is a diagram showing the relationship between intrinsic target position and indel frequency in the corresponding introduced synthetic sequence. Scatter plots of 82 analyzed endogenous sites are shown.
  • Figure 41 shows the relationship between intrinsic target position and indel frequency in the corresponding introduced synthetic sequence. Scatter plots of the top 25% of the DNase sensitive sites were shown.
  • FIG. 42 shows a correlation between intrinsic target position and indel frequency in introduced sequence.
  • FIG. (a) Top 25-50% (b) Top 50-75% (c) 75-100% of the scattering sites for DNase sensitive sites.
  • Figure 43 shows the correlation between indel frequencies in biological replicates.
  • Two different libraries (Libraries A and B) were prepared by independent lentiviral production and transduction. The two libraries were transfected with a plasmid encoding Cpf1 and 4 days later, the indel frequency was analyzed in the cell library.
  • FIG. 44 shows the correlation between indel frequencies after two different Cpf1 delivery methods.
  • Cell libraries were transfected with Cpf1 plasmids or transduced with Cpf1 lentiviral vectors. After 4 days (transfection) or 5 days (transduction), indel frequencies were analyzed in the cell library.
  • FIG. 45 is a diagram comparing the cost between traditional individual evaluations for evaluating Cpf1 activity in target sequences and the high throughput mode evaluation method of the present invention. Material (left) and labor (right) costs were compared. The cost is USD, and the labor unit shows the maximum amount that an experienced person can do in one hour. If more than one hour of break, such as incubation time, was not counted as labor.
  • RNA-guided nucleases derived from a type 2 CRISPR / Cas (clustered regularly interspaced repeat / CRISPR-associated) prokaryotic-acquired immune system, have attracted attention for their usefulness.
  • it is very important to design the guide RNA for the target sequence of the nuclease which is on-target activity and non-target activity according to the sequence of the guide RNA (off-target activity) may vary. Accordingly, the present inventors have attempted to develop a method capable of evaluating the activity of RNA-guided nucleases in a high throughput manner in vivo .
  • RNA-guided nuclease RNA-guided nuclease
  • target RNA RNA-guided nuclease
  • detecting the indel frequency of each guide RNA-target sequence pair from the data obtained through the sequencing.
  • RNA-guided nuclease How to assess the activity of. We named this method “Guide RNA-Target Sequence Pair Library Analysis”, which used RNA-guided nucleases using a cell library in which the guide RNA coding sequence and the target sequence were introduced in pair form. Means a method of evaluating the activity of.
  • RNA-guided nucleases measured using the pair library of the present invention is highly correlated with the activity of RNA-guided nucleases that act on endogenous genes in real cells. It was confirmed that the method for evaluating the activity of the RNA-guided nuclease of the present invention may be useful not only in vitro but also in vivo .
  • Genomic Correction / Genetic Correction technology is a technology that can introduce targeted mutations into genomic sequences of animal and plant cells, including human cells, knock-out or knock-in a specific gene, Mutations can also be introduced in non-coding DNA sequences that do not produce
  • the method of the present invention can analyze the target and non-target activity of RNA-guided nucleases used in the genome correction / genetic correction technique in a high throughput manner, which acts specifically at the target site. It can be usefully used to develop cleases.
  • RNA-guided nuclease refers to a nuclease capable of recognizing and cleaving a specific position on a desired genome, in particular a nuclease having target specificity by guide RNA.
  • the RNA-guided nuclease is not limited thereto, and specifically, may include Cas9 protein derived from CRISPR, which is a microbial immune system, specifically Cas9 (CRISPR-Associated Protein 9), Cpf1, and the like.
  • the RNA-guided nuclease can recognize a specific nucleotide sequence in the genomes of animal and plant cells and other animal cells, causing a double strand break (DSB), and may form nicks (nickase activity).
  • the double helix cut includes both cutting the double helix of the DNA to create a blunt end or a cohesive end.
  • DSBs are efficiently repaired by homologous recombination or non-homologous end-joining (NHEJ) mechanisms within cells, which allows the researchers to introduce desired mutations into the target site.
  • NHEJ non-homologous end-joining
  • the RNA-guided nuclease may be artificial or engineered non-naturally occurring.
  • Cas protein is a major protein component of the CRISPR / Cas system, which is a protein that can act as an activated endonuclease or nickase.
  • the Cas protein may form a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) to show its activity.
  • the Cas protein or genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas protein may be a Cas9 protein.
  • the Cas protein is not limited thereto, Streptococcus genus, Neisseria genus, Pasteurella genus Francisella genus Campylobacter genus Campylobacter genus Cas protein may be derived, and specifically, may be derived from Streptococcus pyogenes . More specifically, it may be a Cas9 protein, specifically, a Cas9 protein derived from Streptococcus pyogenes .
  • the present invention is not limited to the examples described above as long as it has the activity of the RNA-guided nucleases described above.
  • the Cas protein may be a recombinant protein.
  • Cpf1 is a nuclease of a new CRISPR system which is distinguished from the CRISPR / Cas system, and the role of Cpf1 as a genetic scissors has only recently been reported (Cell, 2015, 163 (3): 759-71 ).
  • Cpf1 is a nuclease driven by a single RNA, which does not require tracrRNA and has a relatively small size compared to Cas9.
  • thymine-rich PAM protospacer-adjacent motif
  • the Cpf1 but are not limited to, in particular Candida tooth paseyi bakteo (Candidatus Paceibacter), La pants Spira (Lachnospira), A beauty Lee V. (Butyrivibrio) in, Ferre Greenwich bacteria (Peregrinibacteria), axial domino nose kusu (Acidominococcus) in , Genus Porphyromonas , Genus Prevotella , Genus Francisella , Candidatus Methanoplasma , or Eubacterium genus.
  • the present invention is not limited to the examples described above as long as it has the activity of the RNA-guided nucleases described above.
  • the Cpf1 protein may be a recombinant protein.
  • recombinant when used to refer to a cell, nucleic acid, protein or vector, etc., for example, introduces a heterologous nucleic acid or protein or alters a native nucleic acid or protein, or is derived from a modified cell.
  • Cell, nucleic acid, protein, or vector modified by the cell can be made by reconstructing a sequence encoding the Cas9 or Cpf1 protein using a human codon table.
  • the Cas9 or Cpf1 protein may be in a form that allows the protein to function in the nucleus and may be in a form that is easy to be introduced into a cell.
  • the Cas9 or Cpf1 protein may be linked to a cell penetrating peptide or protein transduction domain.
  • the protein transfer domain may be, but is not limited to, poly-arginine or HIV derived TAT protein.
  • Cell penetrating peptides or protein delivery domains are known in the art in addition to the examples described above, so those skilled in the art are not limited to these examples, and various examples can be applied to the present invention.
  • nucleic acid encoding the Cas9 or Cpf1 protein may further comprise a nuclear localization signal (NLS) sequence.
  • NLS nuclear localization signal
  • an expression cassette comprising a nucleic acid encoding the Cas9 or Cpf1 protein may comprise an NLS sequence in addition to a regulatory sequence such as a promoter sequence for expressing the Cas9 or Cpf1 protein.
  • a regulatory sequence such as a promoter sequence for expressing the Cas9 or Cpf1 protein.
  • Cas9 or Cpf1 proteins may be linked with tags that are advantageous for isolation and / or purification.
  • tags that are advantageous for isolation and / or purification.
  • a small peptide tag such as a His tag, a Flag tag, an S tag, or a GST (Glutathione S-transferase) tag, a MBP (Maltose binding protein) tag, or the like may be connected depending on the purpose, but is not limited thereto.
  • the present invention provides a method for characterizing the RNA-guided nuclease.
  • each step of the method will be described in detail.
  • the definitions and aspects of the terms described above are also applied as described above.
  • Step (a) is a step of performing deep sequencing using DNA obtained from a cell library comprising an isolated oligonucleotide comprising a guide RNA coding sequence and a target sequence.
  • Guide nucleases work with various guide RNAs and target sequences to obtain data for analysis from a population of cells in which various indels (insertion and deletion) have occurred due to target and non-target activity.
  • step (a) Specifically, in step (a),
  • the cell library from which the DNA of step (iv) is obtained is a RNA-guided nuclease introduced into the cell library constructed in step (iii), and the activity of RNA-guided nuclease is induced by culturing the cell. Can be.
  • the term "library” means a pool or population containing two or more kinds of substances of different properties.
  • the oligonucleotide library may be a population comprising two or more kinds of oligonucleotides having different nucleotide sequences, such as guide RNAs, PAM sequences, and / or two kinds of oligonucleotides having different target sequences, and include a vector library (eg, a viral vector).
  • Library can be a population comprising two or more vectors that differ in sequence or component, for example, a population of vectors for each oligonucleotide of the oligonucleotide library, with differences in the oligonucleotides constituting the vector.
  • the cell library may be a population of two or more cells of different nature, specifically for the purposes of the invention, oligonucleotides contained by each cell, for example, a number and / or type of vectors introduced, particularly cells of different types. .
  • it is intended to evaluate the activity of RNA-guided nucleases in a high-throughput manner using a cell library, and thus oligonucleotides and vectors (eg, viral vectors) constituting the respective libraries.
  • the type of cells may be at least two, and the upper limit thereof is not limited as long as the evaluation method is normally operated.
  • the term "oligonucleotide” refers to a substance in which several hundreds to hundreds of nucleotides are linked by phosphodiester bonds.
  • the oligonucleotide may be double-stranded DNA.
  • the oligonucleotide used in the present invention may have a length of 20 to 300 bp, specifically, 50 to 200 bp, more specifically, 100 to 180 bp.
  • the oligonucleotide includes a guide RNA coding sequence and a target sequence.
  • the oligonucleotide may comprise additional sequences to which primers can be bound so as to be PCR amplified.
  • the guide RNA in a single oligonucleotide can be Cis-acting to the target sequence present adjacent thereto. That is, the guide RNA may be designed to confirm the cleavage of adjacent target sequences.
  • the oligonucleotide may be introduced into a cell and integrated into the chromosome.
  • guide RNA refers to a target DNA specific RNA, and the RNA-guided nuclease may cleave the target sequence in whole or in part by complementary binding with the target sequence.
  • guide RNAs include two RNAs: dual RNAs comprising as components a crRNA (CRISPR RNA) and a tracrRNA (trans-activating crRNA); Or a form comprising a first site comprising a sequence in whole or in part complementary to a sequence in a target DNA and a second site comprising a sequence interacting with an RNA-guided nuclease, wherein the RNA-guided nuclease is a target Any form that can have activity in the sequence can be included in the scope of the present invention without limitation.
  • CRISPR RNA crRNA
  • tracrRNA trans-activating crRNA
  • the guide RNA when the guide RNA is applied to Cpf1, the guide RNA may be a crRNA, and when applied to Cas, particularly Cas9, a double RNA form including crRNA and tracrRNA as components or a major portion of crRNA and tracrRNA are fused. It may be in the form of a single-chain guide RNA (sgRNA).
  • the sgRNA may comprise a portion having a sequence complementary to a sequence in the target DNA (also termed a spacer region, a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure for binding Cas, in particular Cas9 protein. Can be.
  • RNA may be used in the present invention as long as the guide RNA includes a main portion of crRNA or all or part complementary portions of a target DNA.
  • the guide RNA specifically crRNA or sgRNA, comprises a sequence that is partially or partially complementary to the sequence in the target DNA and comprises one or more additional nucleotides upstream of the crRNA or sgRNA, specifically at the 5 'end of the sgRNA or crRNA.
  • the additional nucleotide may be guanine (G), but is not limited thereto.
  • the guide RNA may comprise a scaffold sequence that aids in the attachment of RNA-guided nucleases.
  • target sequence or target sequence refers to a sequence where an RNA-guided nuclease is expected to be targeted, and in the present invention, the guide RNA-target sequence pair of the present invention is further extended. (pair) It includes the meaning of the target sequence to be analyzed through the library analysis method.
  • the guide RNA present in one oligonucleotide or vector is assigned to the target sequence.
  • on-target activity or effect, on-target effect
  • off-target activity or effect, off-target effect
  • target activity refers to an activity that, for a sequence that is completely complementary to all or part of the sequence of the guide RNA, the RNA-guided nuclease cleaves that sequence and can further cause indel at the cleavage site.
  • Non-target activity means that in a sequence where some sequences mismatch, rather than completely complementary to all or some of the sequence of the guide RNA, the RNA-guided nuclease cleaves the sequence and further indels the cleavage site. It means activity that can cause.
  • the target activity and the non-target activity are concepts determined by whether or not the sequence cleaved by the RNA-guided nuclease is completely complementary to all or part of the guide RNA sequence.
  • a target sequence refers to a sequence for analyzing whether the activity of RNA-guided nucleases generated by guide RNAs present in pair form. That is, this may be determined by the practitioner at each oligonucleotide design or preparation stage constituting the oligonucleotide library of the present invention, and the practitioner may target the pair guide RNA according to the purpose of the implementation at the design stage. Sequences that expect activity and sequences that expect non-target activity can be selected and designed as target sequences.
  • the target sequence may include, but is not limited to, a protospacer-adjacent motif (PAM) sequence recognized by an RNA-guided nuclease.
  • PAM protospacer-adjacent motif
  • the design of the oligonucleotides can be freely performed by those skilled in the art for the purpose of evaluating the activity of RNA-guided nucleases.
  • the pair may be composed of a sequence having a target activity for a specific guide RNA sequence, and the pair may be composed of a sequence having non-target activity with respect to the guide RNA sequence.
  • guide RNA sequences specifically, some complementary sequences that are completely complementary to the crRNA sequence or some bases mismatch.
  • the oligonucleotide may further include any one or more selected from the group consisting of a direct repeat sequence, a poly T sequence, a barcode sequence, a constant region sequence, a promoter sequence, and a scaffold sequence, but is not limited thereto.
  • the oligonucleotide may be composed of the length as described above, specifically, 100 to 200 base sequences, but is not limited thereto, and may be appropriately controlled by those skilled in the art according to the type of RNA-guided nuclease used, analytical purposes, and the like. Can be.
  • the oligonucleotide described above may include the target sequence and the guide RNA coding sequence in the order of 5 'to 3', and may be designed to include the guide RNA and the target sequence in the order of 5 'to 3'.
  • the oligonucleotide includes a target sequence, a guide RNA coding sequence, and specifically includes a target sequence, a barcode sequence, and a guide RNA coding sequence, and may be constructed in the following order, but is not particularly limited thereto. .
  • the oligonucleotide may include a guide RNA coding sequence, a barcode sequence, and a target sequence in the order of 5 'to 3', and specifically, may include a guide RNA coding sequence, a barcode sequence, a PAM sequence, and a target sequence.
  • it may include a direct repeat sequence, a guide RNA coding sequence, a barcode sequence, a PAM sequence, and a target sequence, and may include a direct repeat sequence, a guide RNA coding sequence, a barcode sequence, a target sequence, and a PAM sequence.
  • may comprise a direct repeat sequence, a guide RNA coding sequence, a barcode sequence, a target sequence, a PAM sequence, and Constant region sequences may be included, but are not particularly limited thereto.
  • It may further comprise a scaffold sequence that aids in binding the RNA-guided nuclease adjacent to the guide RNA coding sequence.
  • it can include a scaffold sequence, guide RNA coding sequence, barcode sequence, PAM sequence, and target sequence. However, it is not particularly limited thereto.
  • a promoter sequence may be included at the 5 'end portion for expression.
  • the U6 promoter was used.
  • May comprise a target sequence, a barcode sequence, and a guide RNA coding sequence in a 5 'to 3' order and specifically may include a target sequence, a PAM sequence, a barcode sequence, and a guide RNA coding sequence, and include a PAM sequence, a target Sequences, barcode sequences, and guide RNA coding sequences, and may include target sequences, PAM sequences, barcode sequences, poly T sequences, and guide RNA coding sequences, and include PAM sequences, target sequences, barcode sequences, poly T sequences, and guide RNA coding sequences, and more specifically may include target sequences, PAM sequences, barcode sequences, guide RNA coding sequences, and direct repeat sequences, and include PAM sequences, target sequences, barcode sequences , Guide RNA coding sequences, and direct repeat sequences, and may include target sequences, PAM sequences, barcode sequences, poly T sequences, guide RNA coding sequences, and direct repeat sequences, and
  • Sequences, and direct repeat sequences may include, but are not limited to, constant region sequences, PAM sequences, target sequences, barcode sequences, poly T sequences, guide RNA coding sequences, and direct repeat sequences.
  • It may further comprise a scaffold sequence that aids in binding the RNA-guided nuclease adjacent to the guide RNA coding sequence.
  • RNA coding sequence may include, but is not limited to, a target sequence, a PAM sequence, a barcode sequence, a guide RNA coding sequence, and a scaffold sequence.
  • a promoter sequence may be included at the 5 'end portion for expression.
  • the oligonucleotide may further include a primer attachment sequence to enable PCR amplification at the 5 'and 3' ends in addition to the above-described components.
  • a primer attachment sequence to enable PCR amplification at the 5 'and 3' ends in addition to the above-described components.
  • it is not particularly limited thereto.
  • the target sequence may have a length of 10 to 100 bp, specifically 20 to 50 bp, more specifically 23 to 34 bp, but is not particularly limited thereto.
  • the guide RNA coding sequence may have a length of 10 to 100 bp, specifically 15 to 50 bp, even more specifically 20 to 30 bp, but is not particularly limited thereto.
  • the barcode sequence means a nucleotide sequence for identifying each oligonucleotide.
  • the barcode sequence herein may not include two or more repeating nucleotides (AA, TT, CC, GG), but is not particularly limited so long as it is designed to identify each oligonucleotide.
  • the barcode sequence may be designed so that at least two bases are different so that each oligonucleotide can be identified.
  • the barcode sequence may have a length of 5 to 50 bp, but is not particularly limited thereto.
  • oligonucleotide libraries were prepared comprising the species' guide RNA-target sequence pair oligonucleotides.
  • Each oligonucleotide constituting the oligonucleotide library is 122-130 bases in total, comprising different guide RNA-coding sequences and target sequence pairs, the specific configuration of which is shown in FIG. 1.
  • an oligonucleotide library including guide RNA-target sequence pair oligonucleotides was prepared by synthesizing 89,592 oligonucleotides against Streptococcus pyogenes- derived Cas9 (SpCas9).
  • the oligonucleotide comprises a guide RNA-coding sequence and a target sequence, totaling 120 bases in length (FIG. 35).
  • a vector library (eg, a viral vector) may be prepared using the oligonucleotide library.
  • RNA-guided nuclease activity evaluation method using the guide RNA-target sequence pair of the present invention is to introduce the pair into a cell using a virus.
  • Guide RNAs corresponding to target sequences are introduced into the cells in pairs, minimizing the effects of copy number variations that may occur in oligonucleotide libraries, vector libraries, and cell libraries, and integrating them into genomic DNA through viruses. Therefore, unlike the analysis method by the transient expression, it is possible to analyze the target and non-target activity over time, and can be relatively less affected by epigenetics factors.
  • the vector is a virus
  • a viral library may be introduced into the cell, followed by production of the virus therefrom, which may be used to infect the cell, and this process may be performed by those skilled in the art using methods known in the art. Can be appropriately performed.
  • the vector may include an oligonucleotide comprising each guide RNA coding sequence and a target sequence.
  • the vector may be a viral vector or a plasmid vector, and the viral vector may be specifically a lentiviral vector or a retroviral vector, but the present invention is not limited thereto and a person skilled in the art can achieve the object of the present invention. Can be used freely.
  • vector is meant a medium, such as a genetic construct, that enables delivery of the oligonucleotide into a cell.
  • the vector may comprise an essential regulatory element operably linked to the insert when present in the cell of the individual, ie the oligonucleotide is to be expressed.
  • the vector can be prepared and purified using standard recombinant DNA techniques.
  • the type of the vector is not particularly limited as long as it can function in cells of interest such as prokaryotic cells and eukaryotic cells.
  • Vectors can include promoters, initiation codons, and termination codon terminators.
  • DNAs encoding signal peptides, and / or enhancer sequences, and / or non-translated regions on the 5 'and 3' sides of the desired gene, and / or selectable marker regions, and / or replicable units may be appropriately used. It may also include.
  • a lentiviral vector library was prepared by cloning each oligonucleotide of the oligonucleotide library in a lentiviral vector (FIGS. 4 and 36), and expressing it in a cell to obtain a virus.
  • the next step is to introduce the vector into a target cell to prepare a cell library.
  • the method of delivering the vector to cells for preparing a library can be accomplished using various methods known in the art. For example, calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroshock, microinjection, liposome fusion, lipofectamine and protoplast fusion It can be carried out by a variety of methods known in the art.
  • viral particles can be used to deliver a target product, ie, a vector, into a cell by means of infection.
  • vectors can be introduced into cells by gene bombardment or the like.
  • the introduced vector may be present as a vector itself in a cell or integrated into a chromosome, but is not particularly limited thereto.
  • the cell library prepared herein refers to a cell population into which an oligonucleotide comprising a guide RNA-target sequence has been introduced.
  • each cell may be introduced into a vector, specifically, a type and / or number of viruses.
  • the analytical method of the present invention is performed using the entire cell library, and since the base sequence and the target sequence encoding the guide RNA are introduced in pair form, it greatly affects the variation of cell infection efficiency and the number of copies of oligonucleotides. It is possible to interpret the data depending on each pair without receiving (FIGS. 6-12).
  • RNA-guided nucleases may be further introduced to induce indels into the constructed cell library.
  • the nuclease may exhibit different degrees of activity depending on the type and / or number of guide RNA-target sequence pairs of the introduced cells.
  • the RNA-guided nuclease may be delivered to the cell via a plasmid vector or viral vector, or the RNA-guided nuclease protein itself may be delivered to the cell, and the RNA-guided nuclease may be active in the cell. It does not restrict
  • RNA-guided nucleases eg, Cas proteins, Cpf1 proteins
  • the like may be delivered in a form linked with a protein delivery domain, but are not limited thereto.
  • the protein delivery domain various kinds known in the art may be used, and as mentioned above, poly-arginine or HIV-derived TAT protein may be used. However, it is not particularly limited thereto.
  • the type of cells into which the vector may be introduced may be appropriately selected by those skilled in the art according to the type of the vector and / or the type of cells desired.
  • bacteria such as E. coli, Streptomyces, Salmonella typhimurium, etc.
  • Yeast cells Fungal cells such as Pchia pastoris; Insect cells such as Drozophila and Spodoptera Sf9 cells; Chinese hamster ovary cells (CHO), SP2 / 0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma), 293T, Bow melanoma cells, HT-1080, BHK ( Animal cells such as baby hamster kidney cells, baby hamster kidney cells, HEK (human embryonic kidney cells), and PERC.6 (human retinal cells); Or plant cells.
  • CHO Chinese hamster ovary cells
  • SP2 / 0 mouse myeloma
  • human lymphoblastoid COS
  • NSO mouse myeloma
  • 293T Bow melanoma cells
  • HT-1080 BHK
  • Animal cells such as baby hamster kidney cells, baby hamster kidney cells, HEK (human embryonic kidney cells), and PERC
  • nuclease activity can be exhibited by introduced guide RNA-target sequence pair oligonucleotides and RNA-guided nucleases. That is, DNA cleavage by RNA-guided nuclease may occur with respect to the introduced target sequence, and thus indels may appear.
  • the term “indel” refers to a variation in which some bases are inserted or deleted in the base sequence of DNA.
  • indels are directed to target sequences in the course of repair by homologous recombination or non-homologous end-joining (NHEJ) mechanisms when RNA-guided nucleases cleave double helixes of DNA. May be introduced.
  • NHEJ non-homologous end-joining
  • the methods of the present invention may comprise obtaining a DNA sequence from a cell in which the activity of the introduced RNA-guided nuclease is shown.
  • DNA harvesting can be performed using various DNA separation methods known in the art.
  • the base of the target sequence can be sequenced, such as deep sequencing or RNA-seq, to obtain data accordingly. have.
  • the assay results are more reliable than the artificial assays compared to other assay methods performed in vitro . Can be obtained.
  • step (b) is to obtain an indel frequency of each guide RNA-target sequence pair from the data obtained through sequencing.
  • each indel can occur dependent on each guide RNA-target sequence pair, such that the indel frequency can be assessed to the extent of activity of the RNA-guided nuclease by the guide RNA-target sequence pair. Can be.
  • each pair may be distinguished by inserting a specific sequence to distinguish the oligonucleotides constituting the oligonucleotide library, it is possible to classify and analyze the data based on the distinguished sequence in the data analysis step.
  • each oligonucleotide is prepared by including a barcode sequence that does not include two or more repeating nucleotides (ie, AA, CC, TT, and GG), each of which is designed with at least two bases different from each other. .
  • the pair library of the present invention has a high correlation with the activity of RNA-guided nucleases that act on endogenous genes in vivo, thereby providing a more accurate and predictable method for assessing activity of RNA-guided nucleases.
  • the activity of the gene scissors measured through the library has a high correlation with the activity of the gene scissors acting on the endogenous gene in the actual cell.
  • the pair library of the present invention has the advantage of being able to evaluate the activity of RNA-guided nucleases with high accuracy.
  • the activity ranks of the guide RNAs of the human CD15 gene and the human MED1 gene obtained using the pair library of the present invention and the activity ranks of the previously known guide RNAs (Nat Biotechnol, 2014, 32 : 1262-1267, Nat Biotechnol, 2016, 34: 184-191) to evaluate the accuracy of the pair library.
  • the guide RNAs targeting the human CD15 and the human MED1 genes showed a high spearman correlation coefficient, which showed a high correlation with a known guide RNA activity ranking (FIG. 37).
  • RNA-guided nucleases analyzed in the present invention are, for example,
  • RNA-guided nuclease to be analyzed may vary depending on the design of the oligonucleotide, which results in interpretation from the indel frequency obtained through deep sequencing of the cell library.
  • the PAM sequence of an RNA-guided nuclease in the design process of an oligonucleotide, it has potential PAM sequences having various nucleotide sequences at the 5 'end of the target sequence and / or nucleotide sequences having different base numbers of PAM sequences. Can be designed to Accordingly, the PAM sequence of the RNA-guided nuclease can be confirmed by analyzing the indel frequency for each PAM sequence.
  • One specific embodiment of the invention the result of analysis by using a guide RNA- target sequence pair libraries the sequence of the PAM Cpf1 (each AsCpf1 and LbCpf1) of Acidaminococcus and Lachnospiraceae origin, as opposed to an existing, known as TTTN TTTV, additionally is CTTA was confirmed to be the true PAM sequence of AsCpf1 and LbCpf1 (FIGS. 13-19).
  • various guide RNAs and corresponding target sequences can be designed to characterize on-target activity, or analyzed by varying the conditions of application of RNA-guided nucleases. This provides information that can maximize the target effect when designing guide RNA.
  • the target activity was analyzed by varying the type of RNA-guided nuclease, analyzing the positional characteristics of the guide RNA having high activity, or analyzing the GC content of the target sequence ( 20 to 22), in another specific example, target activity was analyzed by varying the delivery time of the lentiviral (FIGS. 23 and 24).
  • oligonucleotides can be designed such that some sequences are mismatched between the guide RNA and the target sequence to characterize off-target activity, wherein the location of the target sequence is specifically identified. can do. This can confirm the effect of the base mismatch according to the position of the target sequence, which can obtain information to minimize the non-target effect in the design of the guide RNA.
  • oligonucleotides were designed such that base mismatches with corresponding guide RNAs exist for each position of the target sequence, and the relationship between base mismatches and non-target effects at each position of the target sequence was analyzed (FIG. 25). To FIG. 33).
  • RNA-guided nuclease shows an example of assessing the activity of RNA-guided nuclease using the guide RNA-target sequence pair library of the present invention
  • the scope of the present invention is limited to the above example It cannot be interpreted as.
  • a key technical feature of the present invention is to assess the activity of RNA-guided nucleases in a high throughput manner in cells using a cell library comprising guide RNA-target sequence pairs.
  • the design of the underlying oligonucleotides and the interpretation of the analysis results can be fully extended by the intention and purpose of those skilled in the art and the type of RNA-guided nuclease.
  • Another aspect of the present invention is a cell library comprising two or more kinds of cells comprising a nucleotide sequence encoding a guide RNA and an oligonucleotide comprising the target nucleotide sequence of the guide RNA.
  • Another aspect of the present invention is a vector comprising a base sequence encoding a guide RNA and an isolated oligonucleotide comprising the target sequence of interest, and a vector library.
  • Another aspect of the present invention is an isolated oligonucleotide comprising a base sequence encoding a guide RNA and a target sequence of interest to the guide RNA, and an oligonucleotide library.
  • the cell library, vector, vector library, oligonucleotide and oligonucleotide library are as described above.
  • Another aspect of the invention comprises the steps of (a) setting a target sequence to be targeted with RNA-guided nuclease; (b) designing a base sequence encoding a guide RNA to form a base pair with a complementary chain of the set target sequence; (c) designing an oligonucleotide comprising the target sequence and a guide RNA for the purpose; And (d) repeating steps (a) to (c) one or more times, specifically two or more times.
  • the design process may be to design several target sequences having different lengths and / or nucleotide sequences for one guide RNA, and the differences in length and / or nucleotide sequences for one target sequence may vary. I may be designing several guide RNAs, and the two processes may be mixed.
  • Step (c) or step (d) may comprise the step of synthesizing the further designed oligonucleotide.
  • Another aspect of the invention is an isolated, comprising a sequence capable of forming base pairs with the complementary strand of the target sequence, adjacent to the proto-spacer-adjacent Motif (PAM) sequence, TTTV or CTTA.
  • PAM proto-spacer-adjacent Motif
  • composition for genome editing comprising the isolated guide RNA, or a nucleic acid encoding the same.
  • the isolated guide RNA may be an RNA-guided nuclease used with the Cpf1 protein.
  • Another aspect of the invention is the isolated guide RNA, or nucleic acid encoding the same; And a Cpf1 protein or nucleic acid encoding the same.
  • Another aspect of the invention is the guide RNA or nucleic acid encoding the same; And introducing a Cpf1 protein or a nucleic acid encoding the same into a mammalian cell which is sequentially or simultaneously separated.
  • the PAM sequence of the Cpf1 protein has been proved to be TTTV or CTTA rather than TTTN, which is known in the art.
  • the present invention can be usefully used for genome calibration of guide RNA using TTTV or CTTA as a PAM sequence.
  • the oligonucleotides contained the same 27 base (SEQ ID NO: 1) and 22 base (SEQ ID NO: 2) sequences at both ends so that the oligonucleotides could be used as binding positions of the forward and reverse primers.
  • a unique 15 base barcode sequence was inserted at the center of each oligonucleotide to identify each oligonucleotide.
  • the barcode sequence did not contain two or more repeating nucleotides (ie AA, CC, TT, GG) and all barcodes were designed differently at least two bases from each other.
  • the guide RNA and target sequence in each oligonucleotide were located upstream and downstream of the barcode sequence, respectively.
  • lentiviral vectors expressing Cpf1 sequences encoding AsCpf1 and LbCpf1 from plasmids (Addgene; # 69982, # 69988) were cloned into lentiCas9-Blast plasmids (Addgene; # 52962), respectively, and they were each cloned into Lenti_AsCpf1.
  • -Blast SEQ ID NO: 3
  • Lenti_LbCpf1-Blast SEQ ID NO: 4
  • the SpCas9 scaffold region was removed from the lentiGuide-Puro vector (Addgene; Number 5) (FIG. 4).
  • the oligonucleotides synthesized in Example 1 (122-130 bases each) were amplified by PCR using Phusion polymerase (NEB), and the MEGAquick-spin TM Total Fragment DNA Purification Kit (Intron) was used. Gel purification was performed. The Lenti-gRNA-Puro vector and the purified PCR product were then assembled using the NEBuidler HiFi DNA Assembly Kit (NEB). After assembly, 2 ⁇ l of the reaction was transformed into 25 ⁇ l of electrocompetent cells (Lucigen) via electroporation with MicroPulser (BioRad). The transformed cells were then inoculated in LB agar medium containing 100 ⁇ g / ml ampicillin. Finally, 30 times as many colonies as the library range were obtained. The colonies were taken and plasmid DNA was extracted with Plasmid Maxiprep kit (Qiagen).
  • HEK293T cells (ATCC) were incubated in a 100 mm petri dish coated with 0.01% poly-L-lysine (Sigma) until 80-90% confluency.
  • the transfer plasmid prepared in Example 3 and psPAX2 and pMD2.G were mixed in a weight ratio of 4: 3: 1.
  • virus-containing medium Primary and secondary batches of virus-containing medium were mixed and centrifuged at 3,000 rpm for 5 minutes at 4 ° C. Then, the supernatant was filtered with a Millex-HV 0.45 ⁇ m low protein binding membrane (Millipore) and stored at ⁇ 80 ° C. until use.
  • Millex-HV 0.45 ⁇ m low protein binding membrane Millex-HV 0.45 ⁇ m low protein binding membrane
  • lentiviral vectors were transduced into HEK293T cells (1.5 ⁇ 10 6 to 2.0 ⁇ 10 6 ) attached to 100 mm dishes. After 3 days from transduction, cells were treated with 2 ⁇ g / ml of puromycin for 3-5 days. To preserve the library during the study of the present invention, and maintain cells containing the library with at least 3 x 10 6 pieces / density of the 100 mm culture plate. The number of copies of the lentiviral vector element WPRE was compared with the number of copies of ALB , an endogenous human gene, to confirm the multiplicity of infection (MOI) of transduction.
  • MOI multiplicity of infection
  • the first cell library were inoculated into 100 mm Petri dishes (2 x 10 6 3 x 10 6 pieces) for 24 hours prior to transduction.
  • the cells were transduced with AsCpf1-expressing viral vectors in DMEM containing 10% FBS (fetal bovine serum, Gibco), and then 10% FBS and 10 ⁇ g / ml blasticidin S (blasticidin S, InvivoGen) It was kept in the containing DMEM.
  • FBS fetal bovine serum, Gibco
  • the cell library (3 ⁇ 10 6 ) was first seeded in three 60 mm dishes 6 hours prior to transfection. The cells were then transfected with 4 ⁇ g of Lenti_AsCpf1-Blast or Lenti_LbCpf1-Blast plasmid, and 8 ⁇ l of Lipofectamine2000 (Invitrogen). After incubation overnight, the medium was replaced with DMEM containing 10% FBS. Transfected cells were then incubated for 4 days in culture medium containing 10 ⁇ g / mL blasticidine from day 1 post transfection.
  • Genomic DNA was isolated from the cell library using the Wizard Genomic DNA purification kit (Promega). Then, for indel frequency analysis, the inserted target sequence was first amplified by PCR using Phusion polymerase (NEB). To achieve more than 100-fold coverage of the cell library, 13 ⁇ g of genomic DNA per sample was used as template in the primary PCR (assume 10 ⁇ g of genomic DNA for 1 ⁇ 10 6 293T cells). For each sample, 13 independent 50 ⁇ l reactions were performed with 1 ⁇ g genomic DNA per reaction and the reaction products were mixed.
  • NEB Phusion polymerase
  • PCR products were then purified using a MEGAquick-spin TM Total Fragment DNA Purification Kit (Intron).
  • Intron a MEGAquick-spin TM Total Fragment DNA Purification Kit
  • 20 ng of the purified product of the primary PCR was attached together with the Illumina adapter and barcode sequence. Primers used in the PCR reaction are shown in Table 1 below.
  • the final product was isolated, purified, mixed and analyzed using MiSeq or HiSeq (Illumina).
  • FP forward primer
  • RP reverse primer
  • Deep Python sequencing data was classified and analyzed using custom Python scripts. Data classification of each guide RNA-target pair was performed based on a 15-base barcode sequence and a 4-base constant sequence downstream thereof, ie, a total of 19-base sequences. Insertions or deletions located around the expected cleavage site (ie, 8 bp region in the middle of the cleavage site) were considered mutations caused by Cpf1. Single base substitutions were excluded from the analysis. The actual indel frequency derived from the activity of Cpf1 and guide RNA was calculated by subtracting the background indel frequency in the cell library that did not deliver Cpf1 from the observed indel frequency. The background indel frequency mainly occurs in oligonucleotide synthesis. To increase the accuracy of the analysis, the deep sequencing data were classified according to the number of readings and the background indel frequency per pair (Table 2).
  • HEK293T cells were seeded in 48 well dishes and transduced with independent lentiviral vectors comprising guide RNA-coding sequences and target sequences. Three days after transduction, cells were treated with 2 ⁇ g / mL puromycin for 3-5 days to remove untransduced cells. Cpf1 was delivered to the transduced cells as described above using a lentiviral vector expressing AsCpf1. Five days after Cpf1 introduction, DNA was isolated from cells and deep sequencing was performed.
  • the DNase I sensitivity score was calculated using the DNase-seq (ENCFF000SPE) data derived from ENCODE.
  • the DNase I sensitivity score at each location of the target site was calculated by first counting the number of DNase-seq sequencing read fragments that overlap at that location.
  • the score at that position was assumed to be 2.
  • Each site is 27 bp in length including PAM and target sequence.
  • the DNase I sensitivity score of the target site was obtained by averaging 27 scores at each location.
  • the scores were widely distributed (0% to 99.99%) when the DNase I scores of 82 target sites in the 3.2 billion locations of the human genome (hg19 / GRCh37 from UCSC genome browser) were ordered.
  • oligonucleotides were synthesized for Cas9 (SpCas9) derived from Streptococcus pyogenes in CustomArray (Bothell, WA), Twist Bioscience (San Francisco, CA).
  • the oligonucleotides were designed to include a guide RNA-coding sequence and a target sequence with a total length of 120 bases (FIG. 35).
  • the oligonucleotide has the same 26 at both ends so that it can be used as a binding position of the forward and reverse primer in PCR amplification.
  • Sequences of base (TATCTTGTGGAAAGGACGAAACACCG, SEQ ID NO: 23) and 29 base (GTTTTAGAGCTAGAAATAGCAAGTTAAAA, SEQ ID NO: 24) were included, respectively.
  • a unique 15 base barcode sequence was inserted at the center of each oligonucleotide to identify each oligonucleotide.
  • the barcode sequence did not contain two or more repeating nucleotides (ie AA, CC, TT, GG) and all barcodes were designed differently at least two bases from each other.
  • the target sequence and guide RNA in each oligonucleotide were located upstream and downstream of the barcode sequence, respectively.
  • the oligonucleotides 120 bases each
  • the oligonucleotides 120 bases each
  • the LentiGuide_Puro (Addgene, # 52963) vector and the purified PCR product were then assembled using the NEBuidler HiFi DNA Assembly Kit (NEB). After assembly, 2 ⁇ l of the reaction was transformed into 25 ⁇ l of electrocompetent cells (Lucigen) via electroporation with MicroPulser (BioRad).
  • the transformed cells were then inoculated in LB agar medium containing 100 ⁇ g / ml ampicillin. Finally, a colony of 17-18 times the library range was obtained. The colonies were taken and plasmid DNA was extracted with Plasmid Maxiprep kit (Qiagen).
  • HEK293T cells ATCC were incubated in a 100 mm petri dish coated with 0.01% poly-L-lysine (Sigma) until 80-90% confluency.
  • the supernatant was filtered with a Millex-HV 0.45 ⁇ m low protein binding membrane (Millipore) and stored at ⁇ 80 ° C. until use.
  • Millex-HV 0.45 ⁇ m low protein binding membrane Millex-HV 0.45 ⁇ m low protein binding membrane (Millipore)
  • the lentiviral vector prepared in the above example was transduced into HEK293T cells (7.0 ⁇ 10 6 cells per dish) attached to three 150 mm dishes.
  • cells were treated with 2 ⁇ g / ml of puromycin for 3-5 days.
  • cells containing the library were kept in three 150 mm dishes (7.0 x 10 6 cell density per each dish).
  • the cell library (2.1 ⁇ 10 7 cells) prepared in the above example was first inoculated in three 150 mm petri dishes 24 hours before transfection.
  • the cells were then transduced with SpCas9-expressing viral vectors in DMEM containing 10% FBS (fetal bovine serum, Gibco), followed by 10% FBS and 10 ⁇ g / ml blasticidin S (InvivoGen). It was kept in the containing DMEM.
  • FBS fetal bovine serum, Gibco
  • Genomic DNA was isolated from the cell library prepared in Example using Wizard Genomic DNA purification kit (Promega).
  • the inserted target sequence was first amplified by PCR using Phusion polymerase (NEB).
  • NEB Phusion polymerase
  • 180 ⁇ g of genomic DNA per sample was used as template in the primary PCR (assume 10 ⁇ g of genomic DNA for 1 ⁇ 10 6 293T cells).
  • 90 independent 50 ⁇ l reactions were performed with 2 ⁇ g genomic DNA per reaction and the reaction products were mixed.
  • PCR products were then purified using a MEGAquick-spin TM Total Fragment DNA Purification Kit (Intron).
  • the inventors performed the Cas9 activity evaluation in a manner similar to the Cpf1 activity evaluation in the above example using the pair library prepared from the above example.
  • a pool of array-synthesized oligonucleotides (FIG. 1) comprising the target sequence and corresponding guide RNA sequences (FIG. 1) were amplified by PCR and cloned into lentiviral plasmids using Gibson assembly (FIG. 4).
  • the direct repeat sequence (SEQ ID NO: 20) is the position to which the forward primer binds
  • the guide sequence is the sequence for the crRNA.
  • the target sequence comprises a PAM sequence and the constant (SEQ ID NO: 21) is the position at which the reverse primer binds to the constant region vector annealing site.
  • the sequence of the plasmid cloned through the above process has the nucleotide sequence of SEQ ID NO: 3.
  • Lentivirus libraries prepared from the plasmid library were processed to HEK293T cells to make a library of cells expressing guide RNA and corresponding target sequences in the genome (FIG. 5).
  • the plasmid encoding Cpf1 is transfected into the cell or the lentiviral vector expressing Cpf1 is transduced into the cell so as to induce cleavage and indel formation by guide RNA to the target sequence inserted into the genome.
  • Cpf1 was delivered to the cell library.
  • Target sequences were then amplified by PCR and deep sequencing-based analysis was performed to assess indel frequency.
  • deep sequencing confirmed that the relative copy number of each pair in the oligonucleotide population was different. That is, based on the copy number, 99% oligonucleotides except the upper 0.5% having the maximum copy number and the lower 0.5% of the oligonucleotide having the minimum copy number showed up to 130 times difference. (FIG. 6).
  • plasmids and cell libraries showed slightly higher levels of variation in copy number.
  • the number of pair copies of the plasmid and cell library was normalized to the number of pair copies of the oligonucleotide and plasmid, respectively, and as a result, it was confirmed that a low level of variation appeared compared to the copy number variation of the oligonucleotide population. .
  • Most of the copy number variation additionally occurring in the plasmid library and cell library generation process was found to be within the range of pair copy number variation of the oligonucleotide and plasmid library, respectively (FIGS. 8 and 9).
  • the copy number of each pay in the oligonucleotide population, plasmid library, and cell library was highly correlated (FIGS. 10-12).
  • Table 4 summarizes oligonucleotide design and filtering conditions for analysis.
  • Table 5 summarizes the number of pairs in oligonucleotide populations and cell libraries.
  • Chromatin accessibility which affects the efficiency of Cas9-mediated indel formation, depends on the intrinsic site, but because chromati accessibility is higher at the site of introduction, since lentiviruses are more integrated into the active transcription region. It is expected.
  • chromatin accessibility of HEK293T cells was calculated using DNase I hypersensitivity data obtained from DNase0seq values obtained from the Encyclopedia of DNA element (ENCODE).
  • the indel frequency at the introduced sequence was higher than the indel frequency at the corresponding intrinsic target site, especially at the low chromatin access area.
  • the cell library had similar variability in the number of copies of each component as the library used in previous studies (FIGS. 6-11).
  • the inventors proceeded with the transduction of Cpf1 through the lentiviral vector, except for the LbCpf1 PAM determination experiment conducted by transient plasmid transfection.
  • the present inventors tried to confirm the in vivo system, Acidaminococcus (As) or Lachnospiraceae (Lb) PAM (protospacer adjacent motif) using the Cpf1 derived sequences of the present invention.
  • the PAM sequences used by RNA-programmable nucleases have only been identified in vitro conditions or bacterial systems, not in mammalian cells.
  • TTTN is the most frequently used PAM sequence and that the structure of AsCpf1 supports TTTN as a potential PAM sequence
  • the co-crystal structure of AsCpf1, crRNA, and target DNA indicates that the first three bases (5'-TTT-3 '), which do not contain the fourth base of PAM, interact with the Cpf1 protein, 5'-TTTN-3 '"as the PAM sequence.
  • Our in vivo validation studies help to understand PAM preference in mammalian cells from TTTN to TTTV.
  • Indel frequency did not change between aTTTA, tTTTA, cTTTA, and gTTTA (FIGS. 19, 39 a), while the indel frequency of LbCpf1 was significantly lower than aTTTA or tTTTA when cTTTA was used as the PAM sequence. It confirmed that it was high (FIG. 39B).
  • the inventors sought to identify the characteristics of the target sequence related to the guide RNA efficiency. Given that screening multiple guide RNAs is an essential starting step in genome calibration, characterizing target sequences will facilitate the development of genome calibration techniques.
  • Thr16 of the hydroxy side chain in the WED domain forms a stable polar interaction with N2 of guanine base and also with O2 of uracil and thymine (FIG. 39).
  • adenine does not have a corresponding moiety that can interact with the hydroxy side chain of Thr16, resulting in an unstable crRNA adenine ribonucleotide position.
  • thymine present at position 1 of the target DNA strand is not preferred.
  • Indel frequency is also influenced by the length of time Cas9 and guideRNA are expressed in the cell.
  • Previous studies have reported a time-dependent increase in indel frequency and knockout efficiency over time when prolonged incubation, such as 6 to 11 days after transduction of lentiviral vectors expressing Cas9 and guide RNA.
  • guide RNAs 1, 5 or 6
  • long-term culture overcomes the sequence limitations in guide RNA efficiency. It has not been clearly identified whether it can cause sufficient indel frequency.
  • the present inventors cannot accept sequence mismatches in 18 nucleotides (nt) of the seed region and the trunk region of the guide RNA in AsCpf1 (intolerable), and accept the sequence mismatches in the promiscuous region. It was judged to be tolerable. This is consistent with the results of previous studies that in vitro DNA cleavage of FnCpf1 is efficient enough to cleave 6 nt of the 3 'end of the guide RNA or to preserve 18 nt of the guide sequence. In Cas9, it was also reported that the guide RNA region far from the PAM sequence was not important.
  • the inventors evaluated the effect of the mismatched base number in five regions consisting of a seed region, a region followed by a trunk, a trunk region, a region between a trunk and a promiscuous region, and a promiscuous region. As a result, it was confirmed that as the number of mismatched bases increased in all regions, it caused a low indel frequency. However, this tendency was unclear in the promiscuous region, which showed significant indel frequency even up to 4 or 5 discrepancies (FIGS. 29 and 30). In addition, three or more discrepancies in the region where the seed or trunk is connected, almost completely inhibited indel formation.
  • FIG. 35 A pool of array-synthesized oligonucleotides (FIG. 35) comprising the target sequence and corresponding guide RNA sequences (FIG. 35) was amplified by PCR and cloned into lentiviral plasmids using Gibson assembly (FIG. 36).
  • Lentivirus libraries prepared from the plasmid library were processed to HEK293T cells to make a library of cells expressing guide RNA and corresponding target sequences in the genome (FIG. 5).
  • a lentiviral vector expressing Cas9 was transduced into the cells so as to induce cleavage and indel formation by guide RNA to the target sequence inserted into the genome, and the Cas9 was delivered to the cell library.
  • Target sequences were then amplified by PCR and deep sequencing-based analysis was performed to assess indel frequency.
  • the pair library prepared in the above example was used to evaluate the Cas9 activity of the guide RNA of the human CD15 gene and the human MED1 gene.
  • the accuracy of the pair library was compared by comparing the activity ranking of the guide RNA obtained using the pair library with that of the guide RNA of Nat Biotechnol, 2014, 32: 1262-1267, Nat Biotechnol, 2016, 34: 184-191. Was evaluated.
  • the present inventors attempted to compare the correlation between the activity of the guide RNA obtained using the pair library method and the activity of the guide RNA obtained by directly analyzing target sequences present in the cells.
  • HEK293T cells were seeded in 48-well dishes and then transduced lentiviral vectors containing guide RNA-target sequence pairs. Three days after the transduction, cells were treated with 2 ⁇ g / ml of puromycin to select only the transduced cells.
  • the cells were then transduced with SpCas9-expressing viral vectors in DMEM containing 10% FBS (fetal bovine serum, Gibco), followed by 10% FBS and 10 ⁇ g / ml blasticidin S (InvivoGen). It was kept in the containing DMEM.
  • FBS fetal bovine serum
  • FBS fetal bovine serum
  • 10 ⁇ g / ml blasticidin S InvivoGen
  • the high throughput mode activity evaluation method of the present invention was compared with the existing individual evaluation method.
  • the cost is USD
  • the labor unit represents the maximum amount an experienced person can do in one hour. If more than one hour of break, such as incubation time, was not counted as labor.
  • the present invention provides a high throughput evaluation method for identifying guide RNA activity for a specific target sequence in mammalian cells.
  • Guide RNAs can be designed for genome correction or knockout of specific genes in specific regions on the genome, where indel frequency is identified primarily by simple means of delivery, such as transient transfection.
  • indel frequency is influenced by the transfection efficiency as well as the efficiency of the guide RNA itself. Therefore, such an indel frequency confirmation method cannot stably identify an optimal guide RNA sequence due to variation in transfection or delivery efficiency.
  • a single batch of transduction and / or transfection of cell populations confirmed the efficiency of more than 10,000 guide RNAs at once, minimizing errors that could be caused by delivery variations between different batches.
  • a slightly lower transfection or transduction efficiency than usual may reduce the efficiency of all guide RNAs tested, but the activity ranking or “relative” activity of the guide RNAs is maintained, thus having the highest activity among those tested. Selection of guide RNAs is possible.
  • One way to minimize errors that can be caused by different transfer efficiencies is to perform repetitive experiments, but this is expensive and expensive.
  • the method using the pair library of the present invention is hardly affected by epigenetic factors that appear in various ways depending on the state and type of cells. Since lentiviral vectors are mainly inserted into the transcriptional active region, delivery of a pair library to a cell population using a lentiviral vector can minimize indel frequency deviations that can result in epigenetic conditions.
  • Deviations in delivery efficiency, cell state and cell type have been raised as one of the most serious problems in comparing guide RNA efficiency.
  • the pair libraries of the present invention can reliably assess guide RNA efficiency based on sequence, reducing the likelihood that variations in delivery or epigenetic status will affect efficiency.
  • the reaction between the synthesized target sequence and the guide RNA that does not correspond to the sequence can be ignored if several pairs are delivered to the cell.
  • almost all cells contain a single guide RNA and the DNA encoding the corresponding synthetic target sequence in one copy to prevent variations related to copy number.
  • the reaction between the guide RNAs of the other pairs and the target sequences does not appear to be significant, so that non-target effects can be assessed.
  • the copy number introduced can be controlled by dilution of the lentiviral vector.
  • the present invention can also determine parameters that affect RNA-guided genome engineering. That is, the target sequence, type of effector nuclease ortholog, structural region of guide RNA, epigenetic state of target DNA, concentration and duration of exposure to guide RNA and effector nuclease, and guide RNA and Various factors, such as effector nuclease delivery efficiency, can be used to determine indel frequency at target and nontarget locations. It is anticipated that the pair libraries of the present invention will allow testing of the effect of each parameter on a variety of target sequences in a high throughput manner.
  • Non-target effects can be predicted through an in silico approach based on guide-sequence similarity and measured experimentally.
  • Unbiased experimental methouds such as GUIDE-seq, Digenome-seq, BLESS, IDLV capture, and HTGTS have been introduced, but they are not all perfectly fine or sophisticated.
  • RNA-guided nuclease activity is now library-based, rather than through a traditional, difficult and individual measurement system. Measurements can be made in vivo under a high throughput method (a factory system) (FIG. 34).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Evolutionary Biology (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 세포에서 RNA-가이드 뉴클레아제 (RNA-guided nuclease)의 활성을 고처리량 방식 (high-throughput manner)으로 평가하는 방법에 관한 것으로, 구체적으로 가이드 RNA (guide RNA) 코딩 염기서열 및 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는, 세포 라이브러리의 인델 빈도 (indel frequency)로부터 RNA-가이드 뉴클레아제의 활성을 평가하는 방법에 관한 것이다. 본 발명의 가이드 RNA-표적서열 페어 (pair) 라이브러리를 이용한 RNA-가이드 뉴클레아제의 특성을 분석하는 방법은 세포 내 (in vivo)에서 고처리량 방식 (high-throughput manner)으로 RNA-가이드 뉴클레아제의 활성을 평가할 수 있도록 하므로, RNA-가이드 뉴클레아제를 적용하는 모든 분야에서 매우 유용하게 활용될 수 있다.

Description

IN VIVO에서 RNA-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법
본 발명은 in vivo, 구체적으로 세포에서 RNA-가이드 뉴클레아제 (RNA-guided nuclease)의 활성을 고처리량 방식 (high-throughput manner)으로 평가하는 방법에 관한 것으로, 구체적으로 가이드 RNA (guide RNA) 코딩 염기서열 및 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는, 세포 라이브러리의 인델 빈도 (indel frequency)로부터 RNA-가이드 뉴클레아제의 활성을 평가하는 방법에 관한 것이다.
제2형 CRISPR-Cas (clustered regularly interspaced short palindromic repeats and CRISPR-associated protein) 원핵 면역 시스템 유래의 RNA-가이드 뉴클레아제 (RNA-guided nuclease)는 유전체를 교정할 수 있는 수단을 제공해준다. 특히, 단일 가이드 RNA (sgRNA)와 Cas9 단백질을 이용하여 세포 및 기관의 유전체를 편집할 수 있는 기술과 관련된 연구들이 활발히 진행되어왔다 (Cell, 2014, 157:1262-1278). 특히, CRISPR-Cas9 시스템에서 단일 가이드 RNA (single guide RNA, sgRNA)의 활성을 예측하기 위한 연구가 진행되고 있으며(ACS Synth Biol., 2017, Feb 10; Sci Rep, 2016, 6:30870, Nat Biotechnol, 34, 184-191), 및 CRISPR-Cas9에 의해 PD-1을 코딩하는 유전자가 제거된 세포를 폐암 환자에 주입하여, 질병의 치료에 CRISPR-Cas9을 이용하려는 연구가 중국에서 진행되고 있다 (Nature, 2016, 539:479).최근, Cpf1 단백질 (Prevotella 및 Francisella 1 유래의 CRISPR)이 클래스 2 CRISPR-Cas 시스템의 또 다른 뉴클레아제 단백질로서 보고되었고 (Cell, 2015, 163:759-771), 이에 따라 유전체 교정에 있어서 선택의 폭이 넓어졌다. Cpf1은 5' 돌출부 형태로 절단하는 점, 가이드 RNA의 길이가 더 짧은 점, 시드 (seed) 서열 및 절단 위치 사이가 더 길다는 점에서 여러 장점을 가진다. 다만, 인간 및 다른 진핵 세포 내에서 특히 표적 및 비표적 효과와 관련된 Cpf1의 특성에 대한 연구가 부족한 실정이다.
유전체 교정에 RNA-가이드 뉴클레아제를 적용하는데 있어서 그 활성 및 정확성이 매우 중요하나, RNA-가이드 뉴클레아제의 표적 및 비표적 활성을 확인하기 위해서는 많은 시간과 노력이 필요하다. In silico 에서 표적 및 비표적 활성에 대한 예측의 정확도는 제한적이며 (Nat Biotechnol, 2014, 32:1262-1267), 컴퓨터 예측 모델의 발전을 위해서는 RNA-가이드 뉴클레아제 활성에 대한 종합적인 in vivo 실험을 통한 뉴클레아제의 특성 규명이 필요하다.
본 발명자들은 in vivo 조건에서 고처리량 방식 (high-throughput manner)으로 RNA-가이드 뉴클레아제의 활성을 평가할 수 있는 시스템을 개발하기 위해 예의 노력한 결과, 가이드 RNA 및 표적 서열 페어 (pair)를 주요 구성 요소로 하는 페어 라이브러리 시스템을 개발하여 본 발명을 완성하였다.
본 발명의 하나의 목적은 (a) RNA-가이드 뉴클레아제 (RNA-guided nuclease)가 도입된, 가이드 RNA (guide RNA)를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 세포 라이브러리로부터 수득한 DNA를 이용하여 서열분석을 수행하는 단계; 및
(b) 상기 서열분석을 통해 수득한 데이터로부터 각 가이드 RNA-표적 서열 페어 (pair)의 인델 빈도 (indel frequency)를 검출하는 단계를 포함하는, RNA-가이드 뉴클레아제 (RNA-guided nuclease)의 활성을 평가하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포를 2 종 이상 포함하는 세포 라이브러리를 제공하는 것이다.
본 발명의 다른 목적은 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 벡터, 및 벡터 라이브러리를 제공하는 것이다.
본 발명의 다른 목적은 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드, 및 올리고뉴클레오티드 라이브러리를 제공하는 것이다.
본 발명의 다른 목적은 (a) RNA-가이드 뉴클레아제로 타겟팅하고자 하는 표적 염기서열을 설정하는 단계; (b) 상기 설정된 표적 염기서열의 상보적 사슬과 염기쌍을 형성하는, 가이드 RNA를 코딩하는 염기 서열을 설계하는 단계; (c) 상기 표적 염기서열과 이를 목적으로 하는 가이드 RNA를 포함하는 올리고뉴클레오티드를 설계하는 단계; 및 (d) 상기 (a) 내지 (c) 단계를 1 회 이상 반복하는 단계를 포함하는 단계를 포함하는, 올리고뉴클레오티드 라이브러리를 구축하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 TTTV 혹은 CTTA인 PAM (proto-spacer-adjacent Motif) 서열에 인접한, 표적 염기서열의 상보적 사슬 (complementary strand)과 염기쌍을 형성할 수 있는 서열을 포함하는, 분리된 가이드 RNA를 제공하는 것이다.
본 발명의 다른 목적은 상기 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산을 포함하는, 유전체 교정을 위한 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산; 및 Cpf1 단백질 혹은 이를 코딩하는 핵산을 포함하는, 포유 동물 세포에서의 유전체 교정을 위한 시스템을 제공하는 것이다.
본 발명의 다른 목적은 상기 가이드 RNA 혹은 이를 코딩하는 핵산; 및 Cpf1 단백질 혹은 이를 코딩하는 핵산을 순차적으로 혹은 동시에 분리된 포유동물 세포에 도입하는 단계를 포함하는, 포유동물 세포에서 Cpf1으로 유전체 교정을 하는 방법을 제공하는 것이다.
본 발명의 가이드 RNA-표적서열 페어 (pair) 라이브러리를 이용한 RNA-가이드 뉴클레아제의 활성을 평가하는 방법은 세포 내 (in vivo)에서 고처리량 방식 (high-throughput manner)으로 RNA-가이드 뉴클레아제의 활성을 평가할 수 있도록 하므로, RNA-가이드 뉴클레아제를 적용하는 모든 분야에서 매우 유용하게 활용될 수 있다.
도 1은 Cpf1의 활성을 평가하기 위한, 표적 서열 및 가이드 RNA 서열의 페어 (pair)를 포함하는 올리고뉴클레오티드의 모식도를 나타낸 것이다.
도 2는 AsCpf1 렌티바이러스 벡터 지도의 모식도를 나타낸 것이다. Psi, packaging signal; RRE, rev response element, WPRE, posttranscriptional regulatory element of woodchuck hepatitis virus; U6, U6 pol III promoter; cPPT, central polypurine tract; EFS, elongation factor 1a short promoter; BlastR, blasticidin resistance gene.
도 3은 LbCpf1 렌티바이러스 벡터 지도의 모식도를 나타낸 것이다. Psi, packaging signal; RRE, rev response element, WPRE, posttranscriptional regulatory element of woodchuck hepatitis virus; U6, U6 pol III promoter; cPPT, central polypurine tract; EFS, elongation factor 1a short promoter; BlastR, blasticidin resistance gene.
도 4는 플라스미드 라이브러리를 제조하기 위한 기본 벡터 (backbone vector) 및 표적 서열 및 가이드 RNA 서열의 페어 (pair)를 포함하는 렌티바이러스 벡터의 모식도를 나타낸 것이다. Psi, packaging signal; RRE, rev response element; WPRE, posttranscriptional regulatory element of woodchuck hepatitis virus; cPPT, central polypurine tract; DR, direct repeat of Cpf1; GS, guide sequence of guide RNA; T, polyT; B, barcode; TS, target sequence; HS, homology sequence; EF1α, elongation factor 1 α promoter; PuroR, puromycin resistance gene.
도 5는 본 발명의 페어 (pair) 라이브러리를 이용한 고처리량 분석 시스템의 전체 과정을 간략히 나타낸 모식도이다.
도 6은 올리고뉴클레오티드 집단, 플라스미드 라이브러리 및 세포 라이브러리에서 각 페어 (pair)의 상대적 카피 수를 나타낸 것이다.
도 7은 플라스미드 라이브러리 및 세포 라이브러리의 페어 카피 수를 각각 올리고뉴클레오티드 집단 및 플라스미드 라이브러리의 페어 카피 수로 표준화하여 나타낸 것이다.
도 8은 플라스미드 라이브러리 및 세포 라이브러리의 각 페어의 상대적 카피 수를 올리고뉴클레오티드 집단에서의 카피 수 순서대로 나타낸 것이다.
도 9는 세포 라이브러리의 각 페어의 상대적 카피 수를 플라스미드 라이브러리에서의 카피 수 순서대로 나타낸 것이다.
도 10은 플라스미드 라이브러리 및 올리고뉴클레오티드 집단의 페어 카피 수 간의 상관관계를 딥 시퀀싱 (deep sequencing)으로 평가하여 나타낸 것이다.
도 11은 세포 라이브러리 및 올리고뉴클레오티드 집단의 페어 카피 수 간의 상관관계를 딥 시퀀싱 (deep sequencing)으로 평가하여 나타낸 것이다.
도 12는 세포 라이브러리 및 플라스미드 라이브러리의 페어 카피 수 간의 상관관계를 딥 시퀀싱 (deep sequencing)으로 평가하여 나타낸 것이다.
도 13은 AsCpf1 및 LbCpf1의 PAM 서열을 확인하기 위한 과정을 모식적으로 나타낸 것이다.
도 14는 AsCpf1의 잠재적 PAM 서열에 따른 인델 빈도를 나타낸 것이다. ANNNN 서열을 잠재적인 PAM 서열로서 실험하였다. 간단히 나타내기 위해, “A”는 생략하였다.
도 15는 AsCpf1의 네 종류의 TTTN PAM 서열에 대한 인델 빈도를 나타낸 것이다. 에러 막대는 표준편차를 나타낸다. *P < 0.05, **P < 0.01, ***P < 0.001.
도 16은 LbCpf1의 잠재적 PAM 서열에 따른 인델 빈도를 나타낸 것이다. ANNNN 서열을 잠재적인 PAM 서열로서 실험하였다. 간단히 나타내기 위해, “A”는 생략하였다.
도 17은 LbCpf1의 네 종류의 TTTN PAM 서열에 대한 인델 빈도를 나타낸 것이다. 에러 막대는 표준편차를 나타낸다. *P < 0.05, **P < 0.01, ***P < 0.001.
도 18은 In vivo 및 in vitro 분석으로 PAM 서열을 비교 확인한 것이다. a 및 b, (a) AsCpf1 및 (b) LbCpf1의 PAM 서열을 In vitro 분석으로 확인한 것이다. c 및 d, (c) AsCpf1 및 (d) LbCpf1의 인델 빈도와 잠재적 PAM 서열 (potential PAM sequences) 간의 관련성을 in vivo 분석으로 확인한 것이다.
도 19는 AsCpf1(좌) 및 LbCpf1(우)의 네 종류의 NTTTA PAM 서열에 대한 인델 빈도를 나타낸 것이다. 에러 막대는 표준편차(standard error of mean, SEM)를 나타낸다. *P< 0.05 ANOVA followed by Tukey's post hoc test.
도 20은 정방향 또는 역방향 표적 서열을 이용하여 AsCpf1 및 SpCas9 간의 인델 빈도 순위를 비교한 것이다. SpCas9 및 Cpf1의 정방향 (좌측) 및 역방향 (우측) 표적 서열에 대한 인델 빈도 순위의 상관관계를 나타내었다. 빨간색으로 표시한 5'-GGG-3'와 5'-TTTA-3' 서열은 각각 SpCas9과 AsCpf1 표적 서열에 대한 PAM 서열로 사용하였다. SpCas9 표적 서열에 대한 활성 순위는 Nat Biotechnol, 2014, 32:1262-1267 문헌을 참고하였다.
도 21은 활성이 높은 상위 20 %의 가이드 RNA에 대해, AsCpf1 표적 서열의 각 위치에서의 염기 선호도를 확인한 것이다. Nat Biotechnol, 2014, 32:1262-1267 문헌의 가이드 RNA 및 표적 서열 1,251 쌍을 이용해 0.2의 기준 확률 (baseline probability)로, 이항 분포로 P-값을 계산하였다.
도 22는 표적 서열의 GC 함량과 관찰된 인델 사이의 관계를 나타낸 것이다. a, b, 및 c는 통계적으로 다른 인델 빈도를 가지는 집단을 나타낸다 (P > 0.05). 에러 막대는 표준편차를 나타낸다. *P < 0.05, **P < 0.01, ***P < 0.001.
도 23은 세포 라이브러리에 Cpf1-발현 렌티바이러스 벡터를 전달한 후 시간에 따른 평균 인델 빈도를 나타낸 것이다. 에러 바는 표준편차를 나타낸다. **P < 0.01, ***P < 0.001.
도 24는 세포 라이브러리에 Cpf1 발현 렌티바이러스를 형질도입한 후 3, 5, 31일째에 각각의 표적 서열에서의 인델 빈도를 나타낸 것이다.
도 25는 가이드 RNA 코딩 서열과 표적 서열의 염기 불일치에 따른 인델 빈도를 분석하기 위한 실험 설계를 모식적으로 나타낸 것이다.
도 26은 비표적 서열에서 염기 불일치 위치에 따른 인델 빈도를 나타낸 것이다.
도 27은 표적 서열 및 1 개의 염기 불일치를 가지는 비표적 서열에서 가이드 RNA 길이에 따른 인델 빈도를 표적 서열에서의 인델 빈도로 표준화하여 나타낸 것이다.
도 28은 비표적 서열에서 불일치 염기 수에 따른 상대적 인델 빈도를 나타낸 것이다.
도 29는 Cpf1으로 유도되는 비표적 인델 빈도에 있어서, 표적 서열 내 영역에 따른 불일치 염기 수의 효과를 나타낸 것이다. 비표적 인델 빈도는 표적 서열에서의 인델 빈도로 표준화하였다.
도 30은 Cpf1으로 유도되는 비표적 인델 빈도에 있어서, 표적 서열 내 영역의 다중-염기 불일치의 효과. 비표적 인델 빈도는 표적 서열에서의 인델 빈도로 표준화하였다.
도 31은 비표적 서열의 시드 (seed) 영역에서의 상대적 인델 빈도에 대한 불일치 유형의 효과를 나타낸 것이다. **P < 0.01.
도 32는 비표적 서열의 트렁크 (trunk) 영역에서의 상대적 인델 빈도에 대한 불일치 유형의 효과를 나타낸 것이다. **P < 0.01.
도 33은 비표적 서열의 프로미스큐어스 (promiscuous) 영역에서의 상대적 인델 빈도에 대한 불일치 유형의 효과를 나타낸 것이다. **P < 0.01.
도 34는 본 발명의 페어 라이브러리를 이용한 in vivo 고처리량 평가 시스템의 개념을 보여주는 삽화이다. 종래에, RNA-가이드 뉴클레아제는 개별적이고 어려운 방법으로 측정되었으나 (소규모 시스템, 위). 본 발명은 고처리량 평가가 가능하므로 (공장 시스템, 아래), RNA-가이드 뉴클레아제를 대량으로 손쉽게 평가할 수 있는 새로운 방법을 제공한다.
도 35는 Cas9의 활성을 평가하기 위한, 표적 서열 및 가이드 RNA 서열의 페어 (pair)를 포함하는 올리고뉴클레오티드의 모식도를 나타낸 것이다.
도 36은 Cas9 렌티바이러스 벡터 지도의 모식도를 나타낸 것이다.
도 37은 가이드 RNA-표적 서열 페어 라이브러리를 이용한 가이드 RNA 활성 측정 결과를 나타낸 것이다.도 38은 본 발명의 페어 라이브러리를 이용해 측정한 가이드 RNA의 활성 측정 결과를 나타낸 것이다.
도 39은 위치 1에서의 crRNA 뉴클레아제와 Cpf1 WED 도메인의 Thr16 간의 상호 작용을 나타낸 도이다. WED 도메인 내 Thr16 잔기의 하이드록시 사이드체인은 구아닌 염기의 N2와 극성 상호작용을 한다 (붉은 원 안의 파란 점선). 티민 및 우라실의 O2와 같은 다른 뉴클레오베이스의 사이드 체인은 상기 Thr16 잔기와 유사한 극성 상호작용을 할 수 있다. 그러나, 아데닌에서는 상기와 같은 모이어티가 존재하지 않아서, crRNA 아데닌 리보뉴클레오베이스에서는 PAM 모티프의 옆에 있는 타겟 DNA 가닥의 위치 1에 존재하는 티민과 불안정한 결합을 한다. crRNA 리보뉴클레오티드 (구아닌이 표시됨)과 타겟 서열 뉴클레오티드 (위치 1의 시토신이 표시됨)간의 보완적인 상호작용이 존재한다. PDB 5B43의 데이터를 기초로 도면을 작성하였다.
도 40은 내재적 표적 위치 및 대응하는 도입된 합성 서열에서의 인델 빈도의 관계를 나타낸 도이다. 82개의 분석된 내재적 부위에 대한 산점도를 나타내었다.
도 41는 내재적 표적 위치 및 대응하는 도입된 합성 서열에서의 인델 빈도의 관계를 나타낸 도이다. 총 82개 부위 중 상위 25%의 DNase 민감성 부위에 대한 산점도를 나타내었다.
도 42은 내재적 표적 위치 및 도입된 서열에서의 인델 빈도간의 상관 관계를 나타낸 도이다. (a) 상위 25~50% (b) 상위 50~75% (c) 75~100%의 DNase 민감성 부위에 대한 산점도를 나타내었다.
도 43는 생물학적 모사체 (replicate)에서의 인델 빈도 간의 상관 관계를 나타낸 도이다. 독립적인 렌티바이러스 생산 및 형질도입으로 두 개의 서로 다른 라이브러리 (라이브러리 A 및 B)를 제조하였다. 상기 두 라이브러리는 Cpf1을 코딩하는 플라스미드로 형질 감염시켰으며, 4일 후, 세포 라이브러리에서 인델 빈도를 분석하였다.
도 44는 두 가지의 서로 다른 Cpf1 전달 방법 후의 인델 빈도 간의 상관 관계를 나타낸 도이다. 세포 라이브러리를 Cpf1 플라스미드에 의해 형질감염시키거나, 또는 Cpf1 렌티바이러스 벡터로 형질도입하였다. 4일 후 (형질감염) 또는 5일 후 (형질도입), 세포 라이브러리에서 인델 빈도를 분석하였다.
도 45은 표적 서열에서의 Cpf1 활성을 평가하기 위한 전통적인 개별 평가 및 본 발명의 고처리량 방식 평가 방법 간의 비용을 비교한 도이다. 재료 (좌) 및 노동 (우) 비용을 비교하였다. 비용은 USD로, 노동 단위는 한 시간에 숙련된 사람이 최대로 할 수 있는 양을 나타내었다. 배양 시간과 같은 한 시간이 넘는 중단(break)이 있을 경우, 노동으로 계산되지 않았다.
유전자 가위 (programmable nuclease)는 세포 및 개체의 유전체 교정에 널리 사용되고 있으며, 상기 유전자 가위를 이용한 유전체 교정 기술은 생명과학, 생명공학 및 의학분야 등에서 다양한 목적으로 이용될 수 있는 매우 유용한 기술이다. 특히, 최근에는 제2형 CRISPR / Cas (clustered regularly interspaced repeat / CRISPR-associated) 원핵생물 획득 면역 시스템 유래 RNA-가이드 뉴클레아제 (RNA-guided nuclease)인 Cas9 및 Cpf1 등이 그 유용성으로 주목 받고 있다. 다만, 상기 RNA-가이드 뉴클레아제를 활용하기 위해서는 뉴클레아제의 표적서열에 대한 가이드 RNA를 설계하는 것이 매우 중요한데, 이는 가이드 RNA가 가지는 서열에 따라 표적 활성 (on-target activity) 및 비표적 활성 (off-target activity)이 달라질 수 있기 때문이다. 이에, 본 발명자들은 RNA-가이드 뉴클레아제의 활성을 in vivo에서 고처리량 방식으로 평가할 수 있는 방법을 개발하고자 하였다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
상기 목적을 달성하기 위한 본 발명의 하나의 양태는 (a) RNA-가이드 뉴클레아제 (RNA-guided nuclease)가 도입된, 가이드 RNA (guide RNA) 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포 라이브러리로부터 수득한 DNA를 이용하여 서열분석을 수행하는 단계; 및 (b) 상기 서열분석을 통해 수득한 데이터로부터 각 가이드 RNA-표적 서열 페어 (pair)의 인델 빈도 (indel frequency)를 검출하는 단계를 포함하는, RNA-가이드 뉴클레아제 (RNA-guided nuclease)의 활성을 평가하는 방법이다. 본 발명자들은 상기 방법을 “가이드 RNA-표적 서열 페어 (pair) 라이브러리 분석”으로 명명하였으며, 이는 가이드 RNA 코딩 염기서열 및 표적 염기서열이 페어 형태로 도입된 세포 라이브러리를 이용하여 RNA-가이드 뉴클레아제의 활성을 평가하는 방법을 의미한다.
특히, 본 발명자들은 본 발명의 페어 라이브러리를 이용해 측정한 RNA-가이드 뉴클레아제의 활성은 실제 세포 내에서 내재 유전자에 작용하는 RNA-가이드 뉴클레오제의 활성과 높은 연관성이 있음을 확인하여, 본 발명의 RNA-가이드 뉴클레아제의 활성 평가 방법이 in vitro 뿐만 아니라, in vivo에서도 유용할 수 있음을 확인하였다.
유전체 교정 / 유전자 교정 기술은, 인간 세포를 비롯한 동식물 세포의 유전체 염기서열에 표적지향형 변이를 도입할 수 있는 기술로서, 특정 유전자를 낙아웃 (knock-out) 또는 낙인 (knock-in)하거나, 단백질을 생성하지 않는 비-코딩 DNA 서열에도 변이를 도입할 수 있다. 본 발명의 방법은 상기 유전체 교정 / 유전자 교정 기술에 사용되는 RNA-가이드 뉴클레아제의 표적 및 비표적 활성을 고처리량 방식으로 분석할 수 있고, 이는 표적 위치에만 특이적으로 작동하는 RNA-가이드 뉴클레아제를 개발하는데 유용하게 이용될 수 있다.
본 발명에서 용어 "RNA-가이드 뉴클레아제"는 목적하는 유전체 상의 특정 위치를 인식하여 절단할 수 있는 뉴클레아제로서, 특히 가이드 RNA에 의해 표적 특이성을 갖는 뉴클레아제를 말한다. 상기 RNA-가이드 뉴클레아제는 이에 제한되는 것은 아니나, 구체적으로 미생물 면역체계인 CRISPR에서 유래한 Cas9 단백질, 구체적으로 Cas9 (CRISPR-Associated Protein 9) 및 Cpf1 등이 포함될 수 있다.
상기 RNA-가이드 뉴클레아제는 인간 세포를 비롯한 동식물 세포의 유전체에서 특정 염기서열을 인식해 이중나선절단 (double strand break, DSB)을 일으킬 수 있으며, nick을 형성할 수 있다 (nickase 활성). 상기 이중나선절단은 DNA의 이중 나선을 잘라 둔단 (blunt end) 또는 점착종단 (cohesive end)을 만드는 것을 모두 포함한다. DSB는 세포 내에서 상동재조합 (homologous recombination) 또는 비상동재접합 (non-homologous end-joining, NHEJ) 기작에 의해 효율적으로 수선되는데 이 과정에 연구자가 원하는 변이를 표적 장소에 도입할 수 있다. 상기 RNA-가이드 뉴클레아제는 인공적인, 혹은 조작된 비자연적으로 발생된 (non-naturally occurring)것일 수 있다.
본 발명에서 용어, "Cas 단백질"은 CRISPR/Cas 시스템의 주요 단백질 구성 요소로, 활성화된 엔도뉴클레아제 또는 니카아제(nickase)로 작용할 수 있는 단백질이다. 상기 Cas 단백질은 crRNA (CRISPR RNA) 및 tracrRNA (trans-activating crRNA)와 복합체를 형성하여 이의 활성을 나타낼 수 있다.
Cas 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 구체적으로, 상기 Cas 단백질은 Cas9 단백질일 수 있다. 또한, 상기 Cas 단백질은 이에 제한되는 것은 아니나, 스트렙토코커스 (Streptococcus) 속, 네이세리아 (Neisseria) 속, 파스테우렐라 (Pasteurella) 속, 프란시셀라 (Francisella) 속, 캄필로박터 속 (Campylobacter) 속 유래의 Cas 단백질일 수 있고, 구체적으로, 스트렙토코서스 피요젠스 (Streptococcus pyogenes)유래일 수 있다. 보다 구체적으로 Cas9 단백질, 구체적으로 스트렙토코커스 피요젠스 (Streptococcus pyogenes) 유래의 Cas9 단백질 일 수 있다. 그러나, 상술한 RNA-가이드 뉴클레아제의 활성을 갖는 한, 상기 기술된 예에 본 발명이 제한되는 것은 아니다. 본 발명에서 상기 Cas 단백질은 재조합 단백질일 수 있다.
본 발명에서 용어 "Cpf1"은 상기 CRISPR/Cas 시스템과는 구별되는 새로운 CRISPR 시스템의 뉴클레아제로서, Cpf1의 유전자 가위로서의 역할은 최근에서야 보고되었다 (Cell, 2015, 163(3): 759-71). 상기 Cpf1은 단일 RNA에 의해 구동되는 뉴클레아제로, tracrRNA가 필요 없고 Cas9에 비해 상대적으로 크기가 작은 특징을 가진다. 또한, 티민 (thymine)이 풍부한 PAM (protospacer-adjacent motif) 서열을 이용하며 DNA의 이중 사슬을 잘라 점착종단 (cohesive end)을 만드는 것으로 알려져있다. 상기 Cpf1은 이에 제한되는 것은 아니나, 특히 캔디다투스 파세이박터 (Candidatus Paceibacter), 라치노스피라 (Lachnospira) 속, 뷰티리비브리오 (Butyrivibrio) 속, 페레그리니박테리아 (Peregrinibacteria), 액시도미노코쿠스 (Acidominococcus) 속, 포르파이로모나스 (Porphyromonas) 속, 프레보텔라 (Prevotella) 속, 프란시셀라 (Francisella) 속, 캔디다투스 메타노플라스마 (Candidatus Methanoplasma), 또는 유박테리움 (Eubacterium) 속 유래일 수 있다. 그러나, 상술한 RNA-가이드 뉴클레아제의 활성을 갖는 한, 상기 기술된 예에 본 발명이 제한되는 것은 아니다. 본 발명에서 상기 Cpf1 단백질은 재조합 단백질일 수 있다.
상기 용어 "재조합"은, 예컨대 세포, 핵산, 단백질 또는 벡터 등을 언급하며 사용될 때, 이종 (heterologous) 핵산 또는 단백질의 도입 또는 천연형 (native) 핵산 또는 단백질의 변경, 또는 변형된 세포로부터 유래한 세포에 의해 변형된 세포, 핵산, 단백질, 또는 벡터를 나타낸다. 따라서, 예컨대, 재조합 Cas9 또는 재조합 Cpf1 단백질은 인간 코돈 표 (human codon table)를 이용하여 Cas9 또는 Cpf1 단백질을 암호화하는 서열을 재구성함으로써 만들 수 있다.
상기 Cas9 또는 Cpf1 단백질은 상기 단백질이 핵 내에서 작용할 수 있게 하는 형태일 수 있고, 세포 내로 도입되기에 용이한 형태일 수 있다. 그 예로 Cas9 또는 Cpf1 단백질은 세포 침투 펩타이드 또는 단백질 전달 도메인 (protein transduction domain)과 연결될 수 있다. 상기 단백질 전달 도메인은 폴리-아르기닌 또는 HIV 유래의 TAT 단백질일 수 있으나, 이에 제한되지 않는다. 세포 침투 펩타이드 또는 단백질 전달 도메인은 상기 기술된 예 외에도 다양한 종류가 당업계에 공지되어 있으므로, 당업자는 상기 예에 제한되지 않고 다양한 예를 본 발명에 적용할 수 있다.
또한, 상기 Cas9 또는 Cpf1 단백질을 코딩하는 핵산은 추가적으로 핵 위치 신호 (nuclear localization signal, NLS) 서열을 포함할 수 있다. 따라서, 상기 Cas9 또는 Cpf1 단백질을 코딩하는 핵산을 포함하는 발현 카세트는 상기 Cas9 또는 Cpf1 단백질을 발현시키기 위한 프로모터 서열 등 조절 서열 외에도 NLS 서열을 포함할 수 있다. 그러나 이에 제한되지 않는다.
Cas9 또는 Cpf1 단백질은 분리 및/또는 정제에 유리한 태그와 연결될 수 있다. 그 예로, His 태그, Flag 태그, S 태그 등과 같은 작은 펩타이드 태그, 또는 GST (Glutathione S-transferase) 태그, MBP (Maltose binding protein) 태그 등을 목적에 따라 연결할 수 있으나, 이에 제한되지 않는다.
본 발명은 상기 RNA-가이드 뉴클레아제의 특성을 분석하는 방법을 제공한다. 이하 상기 방법의 각 단계에 대해서 상세히 설명한다. 한편, 상술한 바와 같이 상기에서 기술한 용어들의 정의 및 양태는 하기에도 적용됨이 분명하다.
(a) 단계는 가이드 RNA (guide RNA) 코딩 염기서열 및 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 세포 라이브러리로부터 수득한 DNA를 이용하여 딥 시퀀싱 (deep sequencing)을 수행하는 단계로서, RNA-가이드 뉴클레아제가 다양한 가이드 RNA 및 표적 서열에 의해 작용하여 표적 및 비표적 활성에 의해 다양한 인델 (indel; insertion and deletion)이 발생한 세포 집단으로부터 분석에 필요한 데이터를 수득하는 단계이다.
구체적으로, (a) 단계에서는,
(i) 가이드 RNA 코딩 염기서열 및 표적 염기서열, 즉 가이드 RNA 및 표적 염기서열 페어 (pair)를 포함하는 올리고뉴클레오티드 라이브러리를 제조하는 단계,
(ii) 상기 올리고뉴클레오티드 라이브러리를 이용하여 벡터 라이브러리, 구체적으로 바이러스 벡터 라이브러리를 제조하는 단계, 구체적으로 상기 올리고뉴클레오티드 라이브러리의 각각의 올리고뉴클레오티드에 대한 벡터를 제조하여 벡터 라이브러리를 제조하는 단계,
(iii) 상기 벡터 라이브러리, 구체적으로 바이러스 벡터 라이브러리를 이용하여 세포 라이브러리를 제조하는 단계, 구체적으로, 상기 벡터 라이브러리의 각각의 벡터를 세포에 도입하여, 세포 라이브러리를 구축하는 단계, 및
(iv) 상기 세포 라이브러리로부터 수득한 DNA를 이용하여 서열분석, 예컨대 딥 시퀀싱 (deep sequencing)을 수행하는 단계로 진행될 수 있다.
상기 (iv) 단계의 DNA를 수득한 세포 라이브러리는 상기 (iii) 단계에서 구축된 세포 라이브러리에 RNA-가이드 뉴클레아제가 도입되고, 상기 세포를 배양하여 RNA-가이드 뉴클레아제의 활성이 유도된 것일 수 있다.
본 발명에서 용어 "라이브러리"는 특성이 다른 동종의 물질이 2 종 이상 포함된 집단 (pool or population)을 의미한다. 따라서, 올리고뉴클레오티드 라이브러리는 염기서열이 다른 2 종 이상의 올리고뉴클레오티드, 예컨대 가이드 RNA, PAM 서열, 및/또는 표적 서열이 다른 2종의 올리고뉴클레오티드를 포함하는 집단일 수 있고, 벡터 라이브러리(예, 바이러스 벡터 라이브러리)는 서열 또는 구성요소를 달리하는 2 종 이상의 벡터를 포함하는 집단일 수 있으며, 예컨대, 상기 올리고뉴클레오티드 라이브러리의 각각의 올리고뉴클레오티드에 대한 벡터들의 집단으로, 해당 벡터를 구성하는 올리고뉴클레오티드에 차이가 있는 2 이상의 벡터들의 집단일 수 있다. 세포 라이브러리는 특성이 다른 2 종 이상의 세포, 구체적으로 본 발명의 목적상 각각의 세포가 포함하는 올리고뉴클레오티드가 다른, 예컨대 도입된 벡터의 수 및/또는 종류, 특히 종류가 다른 세포들의 집단일 수 있다. 본 발명에서는 세포 라이브러리를 이용하여 RNA-가이드 뉴클레아제의 활성을 고처리량 방식 (high-throughput manner)으로 평가하는 것을 목적으로 하므로, 상기 각각의 라이브러리를 구성하는 올리고뉴클레오티드, 벡터(예, 바이러스 벡터) 및 세포의 종류는 적어도 2 이상일 수 있으며, 상기 평가 방법이 정상적으로 작동하는 한 그 상한은 제한되지 않는다.
본 발명에서 용어 "올리고뉴클레오티드 (oligonucleotide)"는 수 내지 수백 개의 뉴클레오티드가 포스포다이에스터 결합으로 연결된 물질을 말하며, 본 발명의 목적상 상기 올리고뉴클레오티드는 이중나선 DNA일 수 있다. 본 발명에서 사용되는 상기 올리고뉴클레오티드는 20 내지 300 bp, 구체적으로, 50 내지 200 bp, 보다 구체적으로, 100 내지 180 bp의 길이를 가질 수 있다. 본 발명에서 상기 올리고뉴클레오티드는 가이드 RNA 코딩 염기서열 및 표적 염기서열을 포함한다. 또한, 상기 올리고뉴클레오티드는 PCR 증폭될 수 있도록 프라이머가 결합될 수 있는 추가의 서열을 포함할 수 있다.
구체적으로 단일 올리고뉴클레오티드에서 가이드 RNA는 이와 인접하게 존재하는 표적 염기서열에 Cis-acting 할 수 있다. 즉, 상기 가이드 RNA는 인접한 표적 염기서열의 절단 여부를 확인하기 위해 설계된 것일 수 있다.
상기 올리고뉴클레오티드는 세포에 도입되어 염색체 내에 통합 (integration)되는 것일 수 있다.
본 발명에서 용어 "가이드 RNA (guide RNA)"는 표적 DNA 특이적인 RNA를 의미하며, 표적 서열과 전부 또는 일부 상보적으로 결합하여 RNA-가이드 뉴클레아제가 표적 서열을 절단할 수 있다.
통상적으로 가이드 RNA는 두 개의 RNA, 즉, crRNA (CRISPR RNA) 및 tracrRNA (trans-activating crRNA)를 구성요소로 포함하는 이중 RNA (dual RNA); 또는 표적 DNA 내 서열과 전부 또는 일부 상보적인 서열을 포함하는 제1 부위 및 RNA-가이드 뉴클레아제와 상호작용하는 서열을 포함하는 제2 부위를 포함하는 형태를 말하나, RNA-가이드 뉴클레아제가 표적 서열에서 활성을 가질 수 있는 형태라면 제한 없이 본 발명의 범위에 포함될 수 있다. 일례로, 상기 가이드 RNA를 Cpf1에 적용할 경우 가이드 RNA는 crRNA일 수 있고, Cas, 특히 Cas9에 적용할 경우에는 crRNA 및 tracrRNA를 구성요소로 포함하는 이중 RNA 형태 또는 crRNA 및 tracrRNA의 주요 부분이 융합된 형태인 단일-사슬 가이드 RNA (single-chain guide RNA; sgRNA) 형태일 수 있다. 상기 sgRNA는 표적 DNA 내 서열과 상보적인 서열을 가지는 부분 (이를 Spacer region, Target DNA recognition sequence, base pairing region 등으로도 명명함) 및 Cas, 특히 Cas9 단백질 결합을 위한 헤어핀 (hairpin) 구조를 포함할 수 있다. 보다 구체적으로, 표적 DNA 내 서열과 전부 또는 일부 상보적인 서열을 가지는 부분, Cas, 특히 Cas9 단백질 결합을 위한 헤어핀 구조 및 터미네이터(Terminator) 서열을 포함할 수 있다. 상기 기술된 구조는 5'에서 3' 순으로 순차적으로 존재하는 것일 수 있다. 그러나, 이에 제한되는 것은 아니며, 상기 가이드 RNA가 crRNA의 주요 부분 또는 표적 DNA의 전부 또는 일부 상보적인 부분을 포함하는 경우라면 어떠한 형태의 가이드 RNA도 본 발명에서 사용될 수 있다.
상기 가이드 RNA, 구체적으로 crRNA 또는 sgRNA는 표적 DNA 내 서열과 전부 또는 일부 상보적인 서열을 포함하며, crRNA 또는 sgRNA의 업스트림 부위, 구체적으로 sgRNA 또는 crRNA의 5' 말단에 하나 이상의 추가의 뉴클레오티드를 포함할 수 있다. 상기 추가의 뉴클레오티드는 구아닌 (guanine, G)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 가이드 RNA는 RNA-가이드 뉴클레아제가 부착되는 것을 돕는 스캐폴드 서열을 포함할 수 있다.
본 발명에서 용어, "표적 염기서열 또는 타겟 서열 (target sequence)"은 RNA-가이드 뉴클레아제가 표적으로 할 것으로 예상되는 염기서열을 말하며, 본 발명에서는 더 나아가 본 발명의 가이드 RNA-표적 염기서열 페어 (pair) 라이브러리 분석 방법을 통해 분석하고자 하는 목적 서열의 의미까지 포함한다. 본 발명에서 상기 올리고뉴클레오티드 라이브러리 및 벡터 라이브러리를 이루는 각각의 올리고뉴클레오티드 및 벡터에는 가이드 RNA와 표적 서열이 페어 (pair) 형태로 존재하므로, 하나의 올리고뉴클레오티드 또는 벡터에 존재하는 가이드 RNA는 그 표적 서열에 대응된다.
본 발명에서 표적 활성 (on-target activity) (또는 효과, on-target effect) / 비표적 활성 (off-target activity) (또는 효과, off-target effect)과 상기 표적 염기서열은 전혀 별개의 의미로 이해되어야 한다.
상기 "표적 활성"은 가이드 RNA의 전부 또는 일부 서열과 완전히 상보적인 서열에 대하여, RNA-가이드 뉴클레아제가 그 서열을 절단하고, 더 나아가 상기 절단 부위에 인델을 야기할 수 있는 활성을 의미한다.
"비표적 활성"은 가이드 RNA의 전부 또는 일부 서열과 완전히 상보적인 서열이 아닌 일부 서열이 불일치 (mismatch)하는 서열에서, RNA-가이드 뉴클레아제가 그 서열을 절단하고, 더 나아가 상기 절단 부위에 인델을 야기할 수 있는 활성을 의미한다. 즉, 상기 표적 활성 및 비표적 활성은 RNA-가이드 뉴클레아제에 의해 절단되는 서열이 가이드 RNA 서열의 전부 또는 일부와 완전히 상보적으로 일치하는지 여부에 의해 결정되는 개념이다.
반면, 본 발명에서 사용된 "표적 서열 (target sequence)"은 페어 형태로 존재하는 가이드 RNA에 의해 발생하는 RNA-가이드 뉴클레아제의 활성이 작용하는지 여부를 분석하고자 하는 서열을 말한다. 즉, 이는 본 발명의 올리고뉴클레오티드 라이브러리를 구성하는 각각의 올리고뉴클레오티드 설계 (design) 또는 제조 단계에서 실시자에 의해 결정될 수 있는 것으로, 실시자는 상기 설계 단계에서 그 실시 목적에 따라 페어 가이드 RNA에 대해 표적 활성을 기대하는 서열 및 비표적 활성을 기대하는 서열을 선택하여 표적 서열로 설계할 수 있다. 상기 표적 서열은 RNA-가이드 뉴클레아제가 인식하는 PAM (protospacer-adjacent motif) 서열을 포함할 수 있으나, 이에 제한되지 않는다.
올리고뉴클레오티드의 설계는 RNA-가이드 뉴클레아제의 활성을 평가하기 위한 목적 하에 당업자가 자유롭게 수행할 수 있다. 예컨대, 특정 가이드 RNA 서열에 대해서 표적 활성을 가지는 서열로 페어를 구성할 수 있고, 또한 상기 가이드 RNA 서열에 대해서 비표적 활성을 가지는 서열로 페어를 구성할 수 있다. 예컨대, 가이드 RNA 서열, 구체적으로, crRNA 서열과 완전히 상보적인 서열 또는 일부 염기가 불일치하는 일부 상보적인 서열을 설계할 수 있다.
또한, 당업자는 본 발명의 가이드 RNA-표적 서열 페어 라이브러리 분석을 수행하기 위해 올리고뉴클레오티드에 추가적인 구성요소를 포함시킬 수 있다. 예컨대, 상기 올리고뉴클레오티드는 직접 반복 서열, 폴리 T 서열, 바코드 서열, 불변부 서열, 프로모터 서열, 및 스캐폴드 서열로 이루어진 군에서 선택되는 어느 하나 이상을 추가로 포함할 수 있으나, 이에 제한되지 않는다.
상기 올리고뉴클레오티드는 상술한 바와 같은 길이, 구체적으로 100 내지 200 개의 염기서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니고, 사용되는 RNA-가이드 뉴클레아제의 종류, 분석 목적 등에 따라 당업자에 의해 적절히 조절될 수 있다.
한편, 상술한 올리고뉴클레오티드는, 5'에서 3' 순으로 표적서열 및 가이드 RNA 코딩 서열을 포함할 수 있고, 반대로 5'에서 3' 순으로 가이드 RNA 및 표적서열을 포함하도록 설계될 수 있다.
예컨대, 상기 올리고뉴클레오티드는 표적서열, 가이드 RNA 코딩 서열을 포함하며, 구체적으로 표적서열, 바코드 서열, 및 가이드 RNA 코딩 서열을 포함하며, 다음과 같은 순서로 구축될 수 있으나, 특별히 이에 제한되는 것이 아니다.
상기 올리고뉴클레오티드는 5'에서 3' 순으로 가이드 RNA 코딩 서열, 바코드 서열, 및 표적서열을 포함할 수 있고, 구체적으로 가이드 RNA 코딩 서열, 바코드 서열, PAM 서열, 및 표적 서열을 포함할 수 있고, 가이드 RNA 코딩 서열, 바코드 서열, 표적 서열, 및 PAM 서열을 포함할 수 있고, 가이드 RNA 코딩 서열, 폴리 T 서열, 바코드 서열, PAM 서열, 및 표적 서열을 포함할 수 있고, 가이드 RNA 코딩 서열, 폴리 T 서열, 바코드 서열, 표적 서열 및 PAM 서열을 포함할 수 있다.
보다 더 구체적으로, 직접 반복 서열, 가이드 RNA 코딩 서열, 바코드 서열, PAM 서열, 및 표적 서열을 포함할 수 있고, 직접 반복 서열, 가이드 RNA 코딩 서열, 바코드 서열, 표적 서열, 및 PAM 서열을 포함할 수 있고, 직접 반복 서열, 가이드 RNA 코딩 서열, 바코드 서열, PAM 서열, 표적 서열, 및 불변부 서열을 포함할 수 있고, 직접 반복 서열, 가이드 RNA 코딩 서열, 바코드 서열, 표적 서열, PAM 서열, 및 불변부 서열을 포함할 수 있으나, 특별히 이에 제한되지 않는다.
또한, 가이드 RNA 코딩 서열에 인접하여 RNA-가이드 뉴클레아제가 결합하는 것을 돕는 스캐폴드 서열을 더 포함할 수 있다.
예컨대, 스캐폴드 서열, 가이드 RNA 코딩 서열, 바코드 서열, PAM 서열, 및 표적 서열을 포함할 수 있다. 그러나, 특별히 이에 제한되는 것은 아니다.
또한, 발현을 위하여 5' 말단 부위에 프로모터 서열을 포함할 수 있다. 본원의 실시예에서는 U6 프로모터를 사용하였다.
5'에서 3' 순으로 표적 서열, 바코드 서열, 및 가이드 RNA 코딩 서열을 포함할 수 있고, 구체적으로 표적 서열, PAM 서열, 바코드 서열, 및 가이드 RNA 코딩 서열을 포함할 수 있으며, PAM 서열, 표적 서열, 바코드 서열, 및 가이드 RNA 코딩 서열을 포함할 수 있으며, 표적 서열, PAM 서열, 바코드 서열, 폴리 T 서열, 및 가이드 RNA 코딩 서열을 포함할 수 있으며, PAM 서열, 표적 서열, 바코드 서열, 폴리 T 서열, 및 가이드 RNA 코딩 서열을 포함할 수 있으며, 보다 더 구체적으로 표적 서열, PAM 서열, 바코드 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으며, PAM 서열, 표적 서열, 바코드 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으며, 표적 서열, PAM 서열, 바코드 서열, 폴리 T 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으며, PAM 서열, 표적 서열, 바코드 서열, 폴리 T 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으며, 불변부 서열, 표적 서열, PAM 서열, 바코드 서열, 폴리 T 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으며, 불변부 서열, PAM 서열, 표적 서열, 바코드 서열, 폴리 T 서열, 가이드 RNA 코딩 서열, 및 직접 반복 서열을 포함할 수 있으나, 특별히 이에 제한되지 않는다.
또한, 가이드 RNA 코딩 서열에 인접하여 RNA-가이드 뉴클레아제가 결합하는 것을 돕는 스캐폴드 서열을 더 포함할 수 있다.
예컨대, 표적 서열, PAM 서열, 바코드 서열, 가이드 RNA 코딩 서열, 및 스캐폴드 서열을 포함할 수 있으나, 특별히 이에 제한되는 것은 아니다. 또한, 발현을 위하여 5' 말단 부위에 프로모터 서열을 포함할 수 있다.
또한, 상술한 바와 같이, 상기 올리고뉴클레오티드는 상술한 구성요소 외에도 5' 및 3' 말단에 PCR 증폭이 가능하도록 하는 프라이머 부착 서열을 더 포함할 수 있다. 그러나, 특별히 이에 제한되는 것은 아니다.
상기 표적 서열은 10 내지 100 bp, 구체적으로는 20 내지 50 bp, 보다 더 구체적으로는 23 내지 34 bp의 길이를 가질 수 있으나, 특별히 이에 제한되는 것은 아니다.
또한, 상기 가이드 RNA 코딩 서열은 10 내지 100 bp, 구체적으로는 15 내지 50 bp, 보다 더 구체적으로는 20 내지 30 bp의 길이를 가질 수 있으나, 특별히 이에 제한되는 것은 아니다.
또한, 상기 바코드 서열은 각 올리고뉴클레오티드를 식별하도록 하기 위한 뉴클레오티드 서열을 의미한다. 본원에서 상기 바코드 서열은 2 이상의 반복 뉴클레오티드 (AA, TT, CC, GG)를 포함하지 않는 것일 수 있으나, 각 올리고뉴클레오티드를 식별하도록 설계된 것이라면 특별히 이에 제한되는 것은 아니다. 복수의 올리고뉴클레오티드들에 있어, 상기 바코드 서열은 각 올리고뉴클레오티드가 식별될 수 있도록 적어도 2 개의 염기가 다르도록 설계된 것일 수 있다. 상기 바코드 서열은 5 내지 50 bp의 길이를 가질 수 있으나, 특별히 이에 제한되지 않는다.
본 발명의 구체적인 일 실시예에서는 Acidaminococcus 유래 Cpf1 (AsCpf1) 및 Lachnospiraceae 유래 Cpf1 (LbCpf1)에 대해 각각 가이드 RNA 및/또는 표적 서열을 달리하여 각각 8,327 종 및 3,634 종의 페어 올리고뉴클레오티드를 합성하여, 총 11,961 종의 가이드 RNA-표적 서열 페어 올리고뉴클레오티드를 포함하는 올리고뉴클레오티드 라이브러리를 제조하였다. 상기 올리고뉴클레오티드 라이브러리를 구성하는 각각의 올리고뉴클레오티드는 총 122 내지 130 염기 길이로, 각기 다른 가이드 RNA-코딩 서열 및 표적 염기서열 페어를 포함하며, 이의 구체적인 구성은 도 1에 나타내었다.
또한, 본 발명의 다른 실시예에서는 Streptococcus pyogenes 유래 Cas9 (SpCas9)에 대하여 89,592 개의 올레고뉴클레오타이드를 합성하여, 가이드 RNA-표적 서열 페어 올리고뉴클레오티드를 포함하는 올리고뉴클레오티드 라이브러리를 제조하였다. 상기 올리고뉴클레오티드는 총 120 염기 길이로 가이드 RNA-코딩 서열 (Guide sequence)과 표적 서열 (Target sequence)을 포함한다 (도 35).
다음으로, 상기 올리고뉴클레오티드 라이브러리를 이용하여 벡터 라이브러리(예, 바이러스 벡터)를 제조할 수 있다.
본 발명의 가이드 RNA-표적서열 페어 (pair)를 이용한 RNA-가이드 뉴클레아제 활성 평가 방법이 가지는 장점 중 하나는 상기 페어를 바이러스를 이용하여 세포에 도입하는데 있다. 표적 서열에 대응하는 가이드 RNA가 페어 형태로 세포에 도입되므로 올리고뉴클레오티드 라이브러리, 벡터 라이브러리 및 세포 라이브러리에서 발생할 수 있는 카피 수 편차에 의한 영향을 최소화할 수 있고, 바이러스를 통해 유전체 DNA에 삽입 (integration)되어 일시적 발현에 의한 분석 방법과는 달리 시간에 따른 표적 및 비표적 활성의 분석이 가능하고, 나아가 후생학적 (epigenetics) 요인에 의한 영향을 상대적으로 적게 받을 수 있다. 상기 벡터가 바이러스인 경우, 바이러스 라이브러리를 세포에 도입한 뒤, 이로부터 바이러스를 생산하여 수득할 수 있으며, 이를 이용하여 세포를 감염시킬 수 있으며, 이러한 과정은 당업계에 공지된 방법을 사용하여 당업자가 적절히 수행할 수 있다.
본 발명에서 벡터는 각각의 가이드 RNA 코딩 염기서열 및 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함할 수 있다. 상기 벡터는 바이러스 벡터 또는 플라스미드 벡터일 수 있고, 바이러스 벡터는 구체적으로 렌티바이러스 벡터 또는 레트로바이러스 벡터 등이 사용될 수 있으나, 이에 제한되는 것은 아니고 당업자는 본 발명의 목적을 달성할 수 있는 한 공지된 벡터를 자유롭게 사용할 수 있다.
상기 벡터는 상기 올리고뉴클레오티드를 세포 내에 전달할 수 있도록 하는 매개체, 예컨대 유전적 작제물을 의미한다. 구체적으로, 상기 벡터는 개체의 세포 내에 존재하는 경우 삽입물, 즉 올리고뉴클레오티드가 발현될 수 있도록 삽입물에 작동가능하게 연결된 필수적인 조절 요소를 포함할 수 있다.
상기 벡터는 표준적인 재조합 DNA 기술을 이용하여 제조 및 정제될 수 있다. 상기 벡터의 종류는 원핵세포 및 진핵세포 등 목적하는 세포에서 작용할 수 있도록 하는 한, 특별히 한정되지 않는다. 벡터는 프로모터, 개시코돈, 및 종결코돈 터미네이터를 포함할 수 있다. 그 외에 시그널 펩타이드를 코드하는 DNA, 및/또는 인핸서 서열, 및/또는 원하는 유전자의 5'측 및 3'측의 비번역 영역, 및/또는 선택마커 영역, 및/또는 복제가능단위 등을 적절하게 포함할 수도 있다.
본 발명의 구체적인 실시예에서는 렌티바이러스 벡터에 상기 올리고뉴클레오티드 라이브러리의 각각의 올리고뉴클레오티드를 클로닝하여 렌티바이러스 벡터 라이브러리를 제조하였고 (도 4 및 36), 이를 세포에서 발현시켜 바이러스를 수득하였다.
다음 단계는, 상기 벡터를 목적 세포에 도입하여 세포 라이브러리를 제조하는 단계이다. 구체적으로, 상기 벡터를 라이브러리를 제조하기 위한 세포에 전달하는 방법은 당업계에 공지된 다양한 방법을 이용하여 달성될 수 있다. 예컨대, 칼슘 포스페이트-DNA 공침전법, DEAE-덱스트란-매개 트랜스펙션법, 폴리브렌-매개 형질감염법, 전기충격법, 미세주사법, 리포좀 융합법, 리포펙타민 및 원형질체 융합법 등의 당 분야에 공지된 여러 방법에 의해 수행될 수 있다. 또한, 바이러스 벡터를 이용하는 경우, 감염(infection)을 수단으로 하여 바이러스 입자를 사용하여 목적물, 즉 벡터를 세포 내로 전달시킬 수 있다. 아울러, 유전자 밤바드먼트 등에 의해 벡터를 세포 내로 도입할 수 있다.
상기 도입된 벡터는 세포 내에서 벡터 자체로 존재하거나, 염색체 내에 통합될 수 있으나, 특별히 이에 제한되는 것은 아니다.
본원에서 제조된 세포 라이브러리는 가이드 RNA-표적 서열을 포함하는 올리고뉴클레오티드가 도입된 세포 집단을 말한다. 이때 각각의 세포들은 벡터, 구체적으로 바이러스의 종류 및/또는 수가 다르게 도입된 것일 수 있다. 다만, 본 발명의 분석 방법은 세포 라이브러리 전체를 이용하여 수행되고, 가이드 RNA를 코딩하는 염기서열 및 표적 서열이 페어 형태로 도입되기 때문에 세포 감염 효율, 올리고뉴클레오티드의 카피 수 등의 편차에 크게 영향을 받지 않고 (도 6 내지 도 12) 각 페어에 의존적으로 데이터 해석이 가능하다.
상기 구축된 세포 라이브러리에 인델을 유도하기 위하여 RNA-가이드 뉴클레아제가 추가로 도입될 수 있다.
상기 뉴클레아제는 도입된 세포가 가지고 있는 가이드 RNA-표적 서열 페어의 종류 및/또는 수에 따라 그 활성 정도가 다르게 나타날 수 있다. 상기 RNA-가이드 뉴클레아제는 플라스미드 벡터 또는 바이러스 벡터를 통해 세포에 전달되거나, RNA-가이드 뉴클레아제 단백질 그 자체로 세포 내에 전달될 수 있으며, 세포 내에서 RNA-가이드 뉴클레아제가 활성을 나타낼 수 있는 한 그 도입 방법에 특별히 제한되지 않는다. 한 예로, 단백질 전달 도메인과 연결된 형태로 RNA-가이드 뉴클레아제 (예, Cas 단백질, Cpf1 단백질) 등이 전달될 수 있으나, 이에 제한되는 것은 아니다. 단백질 전달 도메인은 당업계에 공지된 다양한 종류가 사용될 수 있으며, 상기한 바와 같이 폴리-아르기닌이나 HIV 유래의 TAT 단백질을 들 수 있다. 그러나, 특별히 이에 제한되는 것은 아니다.
또한, 상기 벡터가 도입될 수 있는 세포의 종류는, 벡터의 종류 및/또는 목적하는 세포의 종류에 따라 적절하게 당업자가 선택할 수 있으나, 그 예로, 대장균, 스트렙토미세스, 살모넬라 티피뮤리움 등의 박테리아 세포; 효모 세포; 피치아 파스토리스 등의 균류세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포; CHO(중국 햄스터 난소 세포, chinese hamster ovary cells), SP2/0(마우스 골수종), 인간 림프아구(human lymphoblastoid), COS, NSO(마우스 골수종), 293T, 보우 멜라노마 세포, HT-1080, BHK(베이비 햄스터 신장세포, baby hamster kidney cells), HEK(인간 배아신장 세포, human embryonic kidney cells), PERC.6(인간망막세포) 등의 동물 세포; 또는 식물 세포가 될 수 있다.
상기 세포 라이브러리에서는 도입된 가이드 RNA-표적 서열 페어 올리고뉴클레오티드 및 RNA-가이드 뉴클레아제에 의해 뉴클레아제 활성이 나타날 수 있다. 즉, 도입된 표적 서열에 대하여 RNA-가이드 뉴클레아제에 의한 DNA 절단이 일어날 수 있으며, 이에 따라 인델 (indel)이 나타날 수 있다. 본 발명에서 용어 "인델 (indel)"은 DNA의 염기 배열에서 일부 염기가 중간에 삽입 (insertion) 되거나 결실 (deletion) 된 변이를 총칭한다. 인델은 상술한 바와 같이 RNA-가이드 뉴클레아제가 DNA의 이중 나선을 절단하는 경우 상동재조합 (homologous recombination) 또는 비상동재접합 (non-homologous end-joining, NHEJ) 기작에 의해 수선되는 과정에서 표적 서열에 도입되는 것일 수 있다.
또한, 본 발명의 방법은 도입된 RNA-가이드 뉴클레아제의 활성이 나타난 세포로부터 DNA 서열을 수득하는 것을 포함할 수 있다. 이러한 DNA 수득은 당업계에 공지된 다양한 DNA 분리방법을 이용하여 수행될 수 있다.
세포 라이브러리를 구성하는 각각의 세포들은 도입된 표적 서열에서 인델이 발생한 것으로 예상되므로 표적 서열의 염기를 서열 분석, 예컨대 딥 시퀀싱 (deep sequencing), 또는 RNA-seq을 수행하여 이에 따른 데이터를 수득할 수 있다.
본 발명의 가이드 RNA-표적 서열 페어 라이브러리를 이용한 분석 방법은 세포 내 (in vivo)에서 수행되는 것이므로, 시험관 내 (in vitro)에서 수행되는 다른 분석 방법에 비해 인위적인 결과 (artifacts) 없이 신뢰할만한 분석 결과를 얻을 수 있다.
이에, 상기 (b) 단계는 서열분석을 통해 수득한 데이터로부터 각 가이드 RNA-표적 서열 페어의 인델 빈도 (indel frequency)를 수득하는 단계이다.
상술한 바와 같이 각각의 인델은 각 가이드 RNA-표적 서열 페어 (pair)에 의존적으로 발생할 수 있으며, 이에 따라 상기 인델 빈도는 가이드 RNA-표적 서열 페어에 의한 RNA-가이드 뉴클레아제의 활성 정도로 평가될 수 있다.
각 페어는 상기 올리고뉴클레오티드 라이브러리를 구성하는 각각의 올리고뉴클레오타이드에 이를 구별할 수 있는 특정 서열을 삽입하여 구별될 수 있으므로 데이터 분석 단계에서 이러한 구별 서열을 기준으로 데이터를 분류하여 분석이 가능하다. 일례로, 본 발명에서는 각 올리고뉴클레오타이드에 2 이상의 반복 뉴클레오티드 (즉, AA, CC, TT, GG)를 포함하지 않고, 각각이 서로 적어도 2 개의 염기가 다르게 설계된 바코드 (barcode) 서열을 포함시켜 제작하였다.
본 발명의 페어 라이브러리는 in vivo 상의 내재적 유전자에 작용하는 RNA-가이드 뉴클레아제의 활성과 높은 관련성을 가짐으로써, 보다 정확하고 예측 가능성이 높은 RNA-가이드 뉴클레아제의 활성 평가 방법을 제공한다.
본 발명의 구체적인 실시예에서는 라이브러리를 통해 측정한 유전자 가위의 활성이 실제 세포내에서 내재 유전자에 작용하는 유전자 가위의 활성과 높은 연관성이 있는 것을 확인하였다.
또한, 본 발명의 페어 라이브러리는 높은 정확도로 RNA-가이드 뉴클레아제의 활성을 평가할 수 있는 장점을 가진다.
구체적으로, 본 발명의 다른 구체적인 실시예에서는 본 발명의 페어 라이브러리를 이용하여 얻은 인간 CD15 유전자 및 인간 MED1 유전자의 가이드 RNA의 활성 순위와 기존에 공지된 가이드 RNA의 활성 순위 (Nat Biotechnol, 2014, 32:1262-1267, Nat Biotechnol, 2016, 34:184-191) 를 비교하여 페어 라이브러리의 정확도를 평가하였다. 그 결과, 인간 CD15 및 인간 MED1 유전자를 대상으로 하는 가이드 RNA 모두 높은 스피어만 상관계수를 나타내어, 공지된 가이드 RNA 활성 순위와 높은 상관 관계를 나타내는 것을 확인하였다(도 37).
또한, 본 발명의 페어 라이브러리를 이용하여 얻은 가이드 RNA의 활성도와 세포 내에 존재하는 표적 서열을 직접 분석하여 얻은 가이드 RNA의 활성도와의 상관 관계를 비교한 결과, 높은 피어슨 상관계수를 나타내는 것을 확인함으로써, 본 발명의 가이드 RNA-표적 서열 페어 라이브러리를 이용한 RNA-가이드 뉴클레아제의 활성 평가 방법이 높은 정확성을 갖는 것을 확인하였다(도 38).
본 발명에서 분석되는 상기 RNA-가이드 뉴클레아제의 특성은 예컨대,
(i) RNA-가이드 뉴클레아제의 PAM 서열,
(ii) RNA-가이드 뉴클레아제의 표적 활성 (on-target activity), 또는
(iii) RNA-가이드 뉴클레아제의 비표적 활성 (off-target activity)을 포함할 수 있다.
분석하고자 하는 RNA-가이드 뉴클레아제의 특성은 올리고뉴클레오티드의 설계에 따라 달라질 수 있으며, 이는 결과적으로 상기 세포 라이브러리의 딥 시퀀싱을 통해 얻어지는 인델 빈도로부터 해석되는 결과로 나타난다.
일례로, RNA-가이드 뉴클레아제의 PAM 서열을 확인하고자 하는 경우 올리고뉴클레오티드의 설계 과정에서 표적 서열 5' 말단에 다양한 염기서열 및/또는 PAM 서열의 염기 수가 다른 뉴클레오티드 서열을 가지는 잠재적 PAM 서열들을 가지도록 설계할 수 있다. 이에 따라 PAM 서열별로 인델 빈도를 분석함으로써 해당 RNA-가이드 뉴클레아제의 PAM 서열을 확인할 수 있다.
본 발명의 구체적인 일 실시예에서는 Acidaminococcus 및 Lachnospiraceae 유래의 Cpf1 (각각 AsCpf1 및 LbCpf1)의 PAM 서열을 가이드 RNA-표적 서열 페어 라이브러리를 이용하여 분석한 결과, 기존에 TTTN으로 알려진 것과는 달리 TTTV, 추가적으로는 CTTA가 AsCpf1 및 LbCpf1의 진정한 PAM 서열임을 확인하였다 (도 13 내지 도 19).
다른 일례로, 표적 활성 (on-target activity)에 대한 특성을 분석하기 위해 다양한 가이드 RNA 및 이에 대응하는 표적 서열을 설계하거나, RNA-가이드 뉴클레아제의 적용 조건을 달리하여 분석할 수 있다. 이를 통해 가이드 RNA 설계 시 표적 효과를 최대화 할 수 있는 정보를 얻을 수 있다.
본 발명의 구체적인 일 실시예에서는 RNA-가이드 뉴클레아제의 종류를 달리하거나, 높은 활성을 가지는 가이드 RNA의 위치 별 특성을 분석하거나, 표적 서열의 GC 함량을 분석하여 표적 활성의 특성을 분석하였으며 (도 20 내지 도 22), 다른 구체적인 일 실시예에서는 렌티바이러스의 전달 시간을 달리하여 표적 활성을 분석하였다 (도 23 및 도 24).
다른 일례로, 비표적 활성 (off-target activity)에 대한 특성을 분석하기 위해 가이드 RNA와 표적 서열 간에 일부 서열이 불일치되도록 올리고뉴클레오티드를 설계할 수 있고, 이때 표적 서열의 위치를 구체적으로 구분하여 설계할 수 있다. 이를 통해 표적 서열의 위치에 따른 염기 불일치의 효과를 확인할 수 있으며, 이는 가이드 RNA 설계 시 비표적 효과를 최소화할 수 있는 정보를 얻을 수 있다.
본 발명의 구체적인 일 실시예에서는 표적 서열의 위치 별로 대응하는 가이드 RNA와의 염기 불일치가 존재하도록 올리고뉴클레오티드를 설계하여, 표적 서열의 각 위치에서 염기 불일치와 비표적 효과와의 관계를 분석하였다 (도 25 내지 도 33).
상기 RNA-가이드 뉴클레아제의 특성은 본 발명의 가이드 RNA-표적서열 페어 라이브러리를 이용하여 RNA-가이드 뉴클레아제의 활성을 평가하는 일 예시를 보여주는 것으로, 본 발명의 범위가 상기 예시에 제한되는 것으로 해석될 수는 없다. 본 발명의 핵심적인 기술적 특징은 가이드 RNA-표적서열 페어를 포함하는 세포 라이브러리를 이용하여 세포 내 (in vivo)에서 고처리량 방식으로 RNA-가이드 뉴클레아제의 활성을 평가하는데 있다 할 것이며, 이를 위해 기본이 되는 올리고뉴클레오티드의 설계 방식 및 분석 결과의 해석은 당업자의 의도 및 목적, 그리고 RNA-가이드 뉴클레아제의 종류 등에 의해 충분히 확장될 수 있는 것이다.
본 발명의 다른 양태는, 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포를 2 종 이상 포함하는 세포 라이브러리이다.
본 발명의 또 다른 양태는, 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 벡터, 및 벡터 라이브러리이다.
본 발명의 또 다른 양태는, 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드, 및 올리고뉴클레오티드 라이브러리이다.
상기 세포 라이브러리, 벡터, 벡터 라이브러리, 올리고뉴클레오티드 및 올리고뉴클레오티드 라이브러리에 대해서는 상기 설명한 바와 같다.
본 발명의 또 다른 양태는 (a) RNA-가이드 뉴클레아제로 타겟팅하고자 하는 표적 염기서열을 설정하는 단계; (b) 상기 설정된 표적 염기서열의 상보적 사슬과 염기쌍을 형성하는, 가이드 RNA를 코딩하는 염기 서열을 설계하는 단계; (c) 상기 표적 염기서열과 이를 목적으로 하는 가이드 RNA를 포함하는 올리고뉴클레오티드를 설계하는 단계; 및 (d) 상기 (a) 내지 (c) 단계를 1 회 이상, 구체적으로 2회 이상 반복하는 단계를 포함하는 단계를 포함하는, 상기 올리고뉴클레오티드 라이브러리를 구축하는 방법이다.
올리고뉴클레오티드 라이브러리를 구축하기 위해 올리고뉴클레오티드를 설계하는 과정은 상기 설명한 바와 같다.
이는, 표적 서열을 결정한 뒤, 이에 대한 가이드 RNA의 서열을 설계하거나 또는 하나의 가이드 RNA 서열에 대하여 PAM 서열을 포함하는 표적 서열을 설계하는 것일 수 있다. 즉, 본 발명에서는 표적 활성 (on-target activity) 및 비표적 활성 (off-target activity)을 모두 분석할 수 있으므로, 가이드 RNA 서열의 전부 또는 일부가 표적 서열과 완전히 상보적이거나 또는 일부 서열이 불일치 (mismatch)된 상태로 상보적일 수 있다. 이에 설계 과정은 하나의 가이드 RNA에 대하여 서열의 길이 및/또는 염기서열이 차이가 나는 수 개의 표적 서열을 설계하는 것일 수 있고, 하나의 표적 서열에 대하여 서열의 길이 및/또는 염기서열이 차이가 나는 수 개의 가이드 RNA를 설계하는 것일 수 있으며, 상기 두 과정이 혼합적으로 이루어지는 것일 수 있다.
상기 (c) 단계 혹은 (d) 단계는 추가로 설계된 올리고뉴클레오티드를 합성하는 단계를 포함할 수 있다.
본 발명의 또 다른 양태는 TTTV 혹은 CTTA인 PAM (proto-spacer-adjacent Motif) 서열에 인접한, 표적 염기서열의 상보적 사슬 (complementary strand)과 염기 쌍을 형성할 수 있는 서열을 포함하는, 분리된 가이드 RNA이다.
본 발명의 또 다른 양태는 상기 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산을 포함하는, 유전체 교정을 위한 조성물이다.
상기 분리된 가이드 RNA는 이와 함께 사용되는 RNA-가이드 뉴클레아제가 Cpf1 단백질일 수 있다.
본 발명의 또 다른 양태는 상기 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산; 및 Cpf1 단백질 혹은 이를 코딩하는 핵산을 포함하는, 포유 동물 세포에서의 유전체 교정을 위한 시스템이다.
본 발명의 또 다른 양태는 상기 가이드 RNA 혹은 이를 코딩하는 핵산; 및 Cpf1 단백질 혹은 이를 코딩하는 핵산을 순차적으로 혹은 동시에 분리된 포유동물 세포에 도입하는 단계를 포함하는, 포유동물 세포에서 Cpf1으로 유전체 교정을 하는 방법이다.
상술한 바와 같이 본 발명에서는 Cpf1 단백질의 PAM 서열이 종래 알려진 TTTN이 아닌 TTTV 또는 CTTA임을 입증하였는바, 본 발명을 통해 TTTV 혹은 CTTA를 PAM 서열로 하는 가이드 RNA를 유전체 교정에 유용하게 이용할 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 국한되는 것은 아니다.
실시예 1: Cpf1의 활성 평가를 위한 페어 라이브러리 제조 및 활성 평가 방법
실시예 1-1: 올리고뉴클레오티드 설계
고처리량 방식 (high-throughput manner)으로 다양한 가이드 RNA에 대한 Cpf1의 활성을 평가하기 위한 플라스미드 라이브러리를 구축하기 위해, CustomArray (Bothell, WA)에서 Acidaminococcus 유래 Cpf1 (AsCpf1)에 대하여 8,327 개 및 Lachnospiraceae 유래 Cpf1 (LbCpf1)에 대하여 3,634 개의 올리고뉴클레오티드를 합성하였다. 상기 올리고뉴클레오티드는 총 122 내지 130 염기 길이로 가이드 RNA-코딩 서열 (Guide sequence)과 표적 서열 (Target sequence)을 포함하도록 설계하였다 (도 1).
내재적 위치, 및 도입된 위치에서의 인델 빈도를 비교하기 위해, RNA-코딩 서열 및 표적 서열을 포함하는 82개 에러-프리 (error-free) 올리고뉴클레오티드를 Cellemics, Inc (서울, 대한민국)에서 합성하였다.
또한 상기 올리고뉴클레오티드에는 PCR 증폭 시 정방향 및 역방향 프라이머의 결합 위치로 사용될 수 있도록 양 말단에 동일한 27 염기 (서열번호 1) 및 22 염기 (서열번호 2)의 서열을 각각 포함시켰다. 그리고 각 올리고뉴클레오티드를 식별할 수 있도록 독특한 15 염기의 바코드 서열 (barcode sequence)을 각 올리고뉴클레티드의 중앙에 삽입하였다. 상기 바코드 서열은 2 이상의 반복 뉴클레오티드 (즉, AA, CC, TT, GG)를 포함하지 않도록 하였고, 모든 바코드는 서로 적어도 2 개 염기가 다르게 설계하였다. 각 올리고뉴클레오티드에서 가이드 RNA와 표적 서열은 각각 바코드 서열의 상류 (upstream) 및 하류 (downstream)에 위치시켰다.
실시예 1-2: 벡터 클로닝
Cpf1을 발현하는 렌티바이러스 벡터를 제조하기 위해, 플라스미드 (Addgene; #69982, #69988) 유래의 AsCpf1 및 LbCpf1을 코딩하는 서열을 각각 lentiCas9-Blast 플라스미드 (Addgene; #52962) 내로 복제하였고, 이들을 각각 Lenti_AsCpf1-Blast (서열번호 3)와 Lenti_LbCpf1-Blast (서열번호 4)로 명명하였다 (도 2 및 도 3).
또한, 플라스미드 라이브러리를 제조하기 위한 기본 벡터 (backbone vector)를 얻기 위해, lentiGuide-Puro 벡터 (Addgene; #52963)로부터 SpCas9 스캐폴드 영역 (scaffold region)을 제거하였고, 이 벡터를 Lenti_gRNA-Puro 벡터 (서열번호 5)로 명명하였다 (도 4).
실시예 1-3: 플라스미드 라이브러리의 제조
플라스미드 라이브러리를 제조하기 위해, 상기 실시예 1에서 합성한 올리고뉴클레오티드 (각각 122 - 130 염기)를 Phusion 폴리머라제 (NEB)를 이용한 PCR로 증폭하였고, MEGAquick-spin™ Total Fragment DNA Purification Kit (Intron)를 이용하여 젤 정제과정을 수행하였다. 그 다음 NEBuidler HiFi DNA Assembly Kit (NEB)를 사용해 Lenti-gRNA-Puro 벡터와 상기 정제된 PCR 산물을 조립하였다. 조립 후에, 2 ㎕의 상기 반응물로 MicroPulser (BioRad)에 의한 전기천공법을 통해 25 ㎕의 전기수용성세포 (electrocompetent cells, Lucigen)를 형질전환시켰다. 그 다음 상기 형질전환된 세포를 100 ㎍/ml 앰피실린을 함유하는 LB 아가배지에 접종하였다. 최종적으로 라이브러리 범위의 30 배에 달하는 수의 콜로니를 확보하였다. 상기 콜로니를 취하여 Plasmid Maxiprep kit (Qiagen)로 플라스미드 DNA를 추출하였다.
실시예 1-4: 렌티바이러스 생산
HEK293T 세포 (ATCC)를 0.01 %의 폴리-L-라이신 (Sigma)으로 코팅된 100 mm 배양접시에서 80 - 90 % 수준 (confluency)이 될 때까지 배양하였다. 상기 실시예 3에서 제조한 운반 플라스미드 (transfer plasmid)와 psPAX2 및 pMD2.G를 중량비 4 : 3 : 1로 혼합하였다. 그 다음, 100 mm 배양접시에서 iN-fect 형질주입 시약 (Intron Biotechnology)을 이용해 제조사의 지침에 따라 상기 플라스미드 혼합물 (18 ㎍)을 세포에 도입하였다. 형질주입 15 시간 후, 12 ml의 성장 배지로 교체하였다. 상기 형질주입으로부터 39 (= 15 + 24) 및 63 (= 15 + 48) 시간 후에 바이러스를 포함하는 상층액을 수집하였다. 바이러스-함유 배지의 1 차 및 2 차 배치 (batch)를 혼합하고, 4 ℃에서 5 분간 3,000 rpm으로 원심분리하였다. 그 다음, Millex-HV 0.45 ㎛ 저단백질결합막 (low protein binding membrane, Millipore)으로 상기 상층액을 여과시킨 후 사용 전까지 -80 ℃에서 보관하였다.
실시예 1-5: 세포 라이브러리의 생성
세포 라이브러리를 만들기 위해, 렌티바이러스 벡터를 100 mm 접시에 부착된 HEK293T 세포 (1.5 x 106 ~ 2.0 x 106)에 형질도입하였다. 형질도입으로부터 3 일 후, 2 ㎍/ml의 퓨로마이신을 3 내지 5 일 동안 세포에 처리하였다. 본 발명의 연구를 진행하는 동안 라이브러리를 보존하기 위해, 상기 라이브러리를 함유하는 세포들을 최소 3 x 106 개 / 100 mm 배양접시의 밀도로 유지하였다. 렌티바이러스 벡터 요소 WPRE의 복제 수를 내인성 인간 유전자인 ALB의 복제 수와 비교하여 형질도입의 MOI (multiplicity of infection)를 확인하였다. 유전체 DNA 샘플에서 프로바이러스와 ALB 복제 수를 측정하기 위해, SYBR Advantage qPCR Premix (Clontech), 및 WPRE 또는 ALB에 특이적인 프라이머를 이용해 실시간 정량적 PCR (real-time qPCR)을 수행하였다. lentiGuide-Puro (Addgene; #52963) 및 pAlbumin으로 표준곡선을 나타내었다. 플라스미드 DNA 형성에 의한 양적 치우침 (quantification bias)을 막기 위해, 모든 주형들을 PCR 전에 AhdI으로 절단하였다. 상기 qPCR 분석에서 표준 플라스미드 DNA를 사용했기 때문에, 유전체 DNA와 플라스미드 DNA 정량화에서 효율 차이를 보완하기 위해 연어 정자 DNA를 백그라운드로 포함시켰다. HEK293세포는 거의 3 배수의 염색체를 가지지만 ALB 유전자가 위치한 4 번 염색체는 두 쌍을 가지므로, 세포 DNA에 대한 프로바이러스의 비율 (MOI)은 WPRE 복제 수/ALB 복제 수 x 0.5 로 계산하였다.
실시예 1-6: 세포 라이브러리로의 Cpf1 전달
AsCpf1- 또는 LbCpf1-발현 렌티바이러스 벡터의 형질도입을 위해, 먼저 세포 라이브러리 (2 x 106 - 3 x 106 개)를 형질 도입 24 시간 전에 100 mm 배양접시에 접종하였다. 그 다음 10 % FBS (fetal bovine serum, Gibco)을 함유하는 DMEM에서 AsCpf1-발현 바이러스 벡터를 세포에 형질도입한 후, 10 % FBS 및 10 ㎍/ml 블라스티시딘 S (blasticidin S, InvivoGen)을 함유하는 DMEM에서 유지하였다.
AsCpf1- 또는 LbCpf1-코딩 플라스미드의 형질주입의 경우, 먼저 상기 세포 라이브러리 (3 x 106 개)를 형질주입 6 시간 전에 3 개의 60 mm 접시에 접종하였다. 그 다음 Lenti_AsCpf1-Blast 또는 Lenti_LbCpf1-Blast 플라스미드 4 ㎍, 및 리포펙타민2000 (Invitrogen) 8 ㎕로 상기 세포를 형질주입시켰다. 밤새 인큐베이션한 후, 10 % FBS를 함유한 DMEM으로 배지를 교체하였다. 그 다음 형질주입된 세포를 형질주입 후 1 일째부터 10 ㎍/mL의 블라스티시딘을 함유하는 배양 배지에서 4 일 동안 배양하였다.
실시예 1-7: 딥 시퀀싱 (deep sequencing)
Wizard Genomic DNA purification kit (Promega)를 이용해 세포 라이브러리로부터 유전체 DNA를 분리했다. 그 다음 인델 빈도 분석을 위해 먼저 Phusion 폴리머레이즈 (NEB)를 이용해 삽입된 표적 서열을 PCR로 증폭시켰다. 세포 라이브러리의 100 배 이상의 범위 (coverage)를 달성하기 위해, 1 차 PCR에서 주형으로 샘플당 13 ㎍의 유전체 DNA를 사용하였다 (1 x 106 개의 293T 세포에 대한 유전체 DNA를 10 ㎍으로 가정). 각 샘플에 대하여, 각 반응당 1 ㎍의 유전체 DNA로 13 회의 독립적인 50 ㎕의 반응을 수행하였고, 반응 산물을 혼합하였다.
내재적 위치 및 도입된 위치에서의 인델 빈도를 비교하기 위해, 샘플 당 100 ng의 DNA가 도입된 표적 서열 및 내재적 표적 서열로 PCR-증폭에 이용되었다.
그 다음 PCR 산물을 MEGAquick-spin™ Total Fragment DNA Purification Kit (Intron)를 이용해 정제하였다. 2 차 PCR에서는 상기 1 차 PCR의 정제된 산물 20 ng을 일루미나 어뎁터 (Illumina adaptor) 및 바코드 서열과 함께 붙였다. PCR 반응에서 사용되는 프라이머는 하기 표 1에 나타내었다. 최종 산물을 분리, 정제, 혼합한 뒤 MiSeq 또는 HiSeq (Illumina)을 이용해 분석하였다.
프라이머 서열(5'-3')
Lenti_gRNA_Puro 클로닝 FP1 CAC CGG AGA CGT TGA CTA TCG TCT CGC TAC TCT ACC ACT TGT ACT TCA GCG GTC A (서열번호 6)
RP1 AAG CTG ACC GCT GAA GTA CAA GTG GTA GAG TAG CGA GAC GAT AGT CAA CGT CTC C (서열번호 7)
FP2 GCT TAC TCG ACT TAA CGT GCA CGT GAC ACG TTC TAG ACC GTA CAT GCT TAC ATG GGA TGA (서열번호 8)
RP2 AGC TTC ATC CCA TGT AAG CAT GTA CGG TCT AGA ACG TGT CAC GTG CAC GTT AAG TCG AGT (서열번호 9)
AsCpf1 올리고 라이브러리 증폭 FP ATT TCT TGG CTT TAT ATA TCT TGT GGA AAG GAC GAA ACA CCG TAA TTT CTA CTC TTG TAG (서열번호 10)
LbCpf1 올리고 라이브러리 증폭 FP TTT CTT GGC TTT ATA TAT CTT GTG GAA AGG ACG AAA CAC CGT AAT TTC TAC TAA GTG TAG (서열번호 11)
As/LbCpf1 올리고 라이브러리 증폭 RP GAG TAA GCT GAC CGC TGA AGT ACA AGT GGT AGA GTA GAG ATC TAG TTA CGC CAA GCT (서열번호 12)
표적화된 딥 시퀀싱 FP ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT CTT GTG GAA AGG ACG AAA CAC C (서열번호 13)
RP GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC TTT GTG GAT GAA TAC TGC CAT TTG TC (서열번호 14)
Illumina의 색인(indexing) FP AAT GAT ACG GCG ACC ACC GAG ATC TAC AC (서열번호 15) - (8bp barcode sequence) - ACA CTC TTT CCC TAC ACG AC (서열번호 16)
RP CAA GCA GAA GAC GGC ATA CGA GAT (서열번호 17) - (8bp barcode) - GTG ACT GGA GTT CAG ACG TGT (서열번호 18)
qPCR for WPRE FP GAT ACG CTG CTT TAA TGC CTT TG (서열번호 19)
RP GAG ACA GCA ACC AGG ATT TAT ACA AG (서열번호 20)
qPCR for ALB FP GCT GTC ATC TCT TGT GGG CTG T (서열번호 21)
RP ACT CAT GGG AGC TGC TGG TTC (서열번호 22)
Endogenous target 1-5 FP TTG CTG TGG CAG AGC CAG CG (서열번호 29)
RP TTG CTT CAC TTT AAT CCT TTC TTG CAG (서열번호 30)
Endogenous target 6~10 FP CTC CTG CAA GAA AGG ATT AAA GTG(서열번호 31)
RP ACC TAC CTA ATA GTT ACT TCC TGA AGG G(서열번호 32)
Endogenous target 11~14 FP CTC GTT CTT TCC ATC AAA TAG TGT GGT G(서열번호 33)
RP CTG CAG TAA TTG TTA CTC TGT GTC TTC C(서열번호 34)
Endogenous target 15~17 FP TTG AGC TGA CCC ATA AAT ACA ACA GG(서열번호 35)
RP CCC TCT TAA CTG GAT CAG CAA CGG(서열번호 36)
Endogenous target 18 FP TGG GGT CGC CAT TGT AGT TCC C(서열번호 37)
RP GTC ACA AAG ATC AGC ATC AGG CAT GG(서열번호 38)
Endogenous target 19~22 FP CGT TCA CCT GGG AGG GGA AG(서열번호 39)
RP TCT GCA AAG AAC TTT ATT CCG AGT AAG C(서열번호 40)
Endogenous target 23~28 FP CCC AAA AGA CAT ATT CAC CCA GAA TCC C(서열번호 41)
RP CAA CAT CAA GGT GTG GGC AGG GCT GC(서열번호 42)
Endogenous target 29~30 FP ACC TGG AGT CTG CAG AGC TGG(서열번호 43)
RP AAG CGG TAA ACA AAG GAT AGC TGG(서열번호 44)
Endogenous target 31~35 FP CCA TGG GAA ACG AAT ACA GGT CTC G(서열번호 45)
RP CTT CAG AAG AAA AAC CTC CAC TC(서열번호 46)
Endogenous target 36~37 FP AAC TGA GAA ACA GCC AGA GAG GAA G(서열번호 47)
RP CAT CTG ATG CTG ACT CAG AGC GC(서열번호 48)
Endogenous target 38~ 42 FP GCT GCC ACC CCC TGC TC(서열번호 49)
RP ATC AGA ATG AAA AAT CTC ACC CCT CC(서열번호 50)
Endogenous target 43~46 FP GTC TCC GTG ATG GGG GTG G(서열번호 51)
RP CTG CCT TGT AAG ACT TTA AAT ATT CTG CTC C(서열번호 52)
Endogenous target 47~48 FP AAG CCA TAT TCA GTT TTA GGG AAA AGC(서열번호 53)
RP ATT TCC AAG TAA GCT GCA AGG AAA GC(서열번호 54)
Endogenous target 49~52 FP AAG TCT TAC AAG GCA GAG TAA AGA TC(서열번호 55)
RP GCA GGG TAA AAC AAT CGG ACC(서열번호 56)
Endogenous target 53~57 FP CAA CCA CCT CAG AAG AGC CAG ATT CC(서열번호 57)
RP CTC TGT AGT TAT TTG AGC AAT GCC AC(서열번호 58)
Endogenous target 58~64 FP CAG TGA ATA TAC AGG ATT GGG GTT GTG(서열번호 59)
RP ACA ACT GGT AAG GTG GGC CCA GG(서열번호 60)
Endogenous target 65~72 FP CAA GCA CAA ACA AAT CAG GCT AAA TCC (서열번호 61)
RP CCC TGA GCT TGG GGG AGA GTT AC(서열번호 62)
Endogenous target 73~78 FP TCC TCT GGG GAA AGA GTG GCC(서열번호 63)
RP TGT GGG GTC GTT CCT GAT GAA AC(서열번호 64)
Endogenous target 79~82 FP AAC TGG TTT AGC TAG TGC ATA CAT GC(서열번호 65)
RP GGT GGG AGT TTC TGT TAC AGG CAA C(서열번호 66)
FP: 정방향 프라이머 (forward primer), RP: 역방향 프라이머 (reverse primer).
실시예 1-8: 페어 카피 수 (Pair copy number) 분석
라이브러리 내 각 페어의 카피 수를 평가하기 위해, 다음의 식을 이용하여 판독 수를 표준화하였다.
Figure PCTKR2017004610-appb-I000001
실시예 1-9: 인델 빈도의 분석
커스텀 파이선 스크립트 (custom Python scripts)를 이용해 딥 시퀀싱 데이터를 분류하고 분석하였다. 15-염기 바코드 서열 및 그 다운스트림의 4-염기 불변부 서열(constant sequence), 즉 총 19-염기의 서열을 기반으로 각각의 가이드 RNA-표적 페어 (pair)의 데이터 분류를 수행하였다. 예상되는 절단 위치 (즉, 절단 위치 중간의 8 bp 영역) 주변에 위치한 삽입 또는 결실은 Cpf1에 의해 유발된 돌연변이로 간주하였다. 단일 염기 치환은 분석에서 제외하였다. Cpf1과 가이드 RNA의 활성으로부터 유래된 실제 인델 빈도는, 관찰된 인델 빈도에서 Cpf1을 전달하지 않은 세포 라이브러리 내 백그라운드 인델 빈도를 감하여 계산하였다. 상기 백그라운드 인델 빈도는 주로 올리고뉴클레오티드 합성에서 발생된다. 분석의 정확성을 높이기 위해, 판독 횟수와 페어 당 백그라운드 인델 빈도에 따라 딥 시퀀싱 데이터를 분류하였다 (표 2).
목적 페어 (pair) 당 최소 판독 수 분석에서 제거될 백그라운드 인델 빈도를 허용하는 최대값
AsCpf1 PAM 확인 100 8 %
LbCpf1 PAM 확인 30 8 %
AsCpf1 표적 효과 프로파일링 100 8 %
AsCpf1 비표적 효과 프로파일링 100 8 %
시간 의존적 인델 빈도 분석 300 8 %
가이드 RNA 절편의 비표적 효과 프로파일링 300 8 %
실시예 1-10: 인델 빈도의 비교
HEK293T 세포를 48 웰 디쉬에 시딩하고 가이드 RNA-코딩 서열 및 표적 서열을 포함하는 독립적인 렌티바이러스 벡터로 형질도입하였다. 형질도입 3일 경과 후, 형질도입되지 않은 세포를 제거하기 위해, 상기 세포에 3 내지 5일 간 2 μg/mL 퓨로마이신 (puromycin)을 처리하였다. 상기 형질도입된 세포에 AsCpf1을 발현하는 렌티바이러스 벡터를 이용하여 상술한 바와 같이 Cpf1을 전달하였다. Cpf1 도입 5일 후, DNA를 세포로부터 분리하고 딥 시퀀싱을 수행하였다.
실시예 1-11: 크로마틴 접근성의 계산
세포 마다 4 카피가 존재하는 염색체 17번 및 22번을 제외하고, 유전체로부터 4개의 게놈 영역을 임의적으로 선택하였다. 총 82 가이드 RNA를 상기 4개 영역 내에서 임의의 위치 (loci)를 표적하도록 디자인하였다. ENCODE에서 도출된 DNase-seq (ENCFF000SPE) 데이터를 이용하여 DNase I 민감도 스코어 (sensitivity score)를 계산하였다. 타겟 부위의 각 위치에서의 상기 DNase I 민감도 스코어는, 먼저 해당 위치에서 오버래핑되는 DNase-seq 시퀀싱 판독 단편 (DNase-seq sequencing read fragments)의 수를 카운팅하여 계산하였다.
예를 들어, 표적 부위의 5번 위치 (position 5)에 두 개의 시퀀싱 판독 오버랩이 있을 경우, 상기 위치에서의 스코를 2로 가정하였다. 각 부위는 PAM 및 표적 서열을 포함하는 27 bp의 길이이다. 이에, 표적 부위의 DNase I 민감도 스코어는 각 위치에서의 27개 스코어를 평균하여 구하였다.
인간 게놈(hg19/GRCh37 from UCSC genome browser)의 32억 개 위치 내 82개 표적 부위의 DNase I 스코어를 순서화하였을 때 점수는 넓게 분포하였다 (0% ~ 99.99%).
실시예 2: Cas9의 활성 평가를 위한 페어 라이브러리 제조 및 활성 평가 방법
본 발명자들은 RNA-가이드 뉴클레아제의 다른 종류인, SpCas9을 이용하여 본 발명의 RNA-가이드 뉴클레아제의 활성 평가 방법을 확인하였다.
실시예 2-1: 올리고뉴클레오티드 설계
고처리량 방식 (high-throughput manner)으로 다양한 가이드 RNA에 대한 SpCas9의 활성을 평가하기 위한 플라스미드 라이브러리를 구축하기 위해, 본 발명자들은 상기 실시예와 유사한 방법으로 가이드 RNA-표적서열 올리고뉴클레오티드를 설계하였다.
구체적으로, CustomArray (Bothell, WA), Twist Bioscience (San Francisco, CA)에서 Streptococcus pyogenes 유래 Cas9 (SpCas9)에 대하여 89,592 개의 올레고뉴클레오타이드를 합성하였다. 상기 올리고뉴클레오티드는 총 120 염기 길이로 가이드 RNA-코딩 서열 (Guide sequence)과 표적 서열 (Target sequence)을 포함하도록 설계하였다 (도 35). 또한 상기 올리고뉴클레오티드에는 PCR 증폭 시 정방향 및 역방향 프라이머의 결합 위치로 사용될 수 있도록 양 말단에 동일한 26 염기 (TATCTTGTGGAAAGGACGAAACACCG, 서열번호 23) 및 29 염기 (GTTTTAGAGCTAGAAATAGCAAGTTAAAA, 서열번호 24)의 서열을 각각 포함시켰다. 그리고 각 올리고뉴클레오티드를 식별할 수 있도록 독특한 15 염기의 바코드 서열 (barcode sequence)을 각 올리고뉴클레티드의 중앙에 삽입하였다. 상기 바코드 서열은 2 이상의 반복 뉴클레오티드 (즉, AA, CC, TT, GG)를 포함하지 않도록 하였고, 모든 바코드는 서로 적어도 2 개 염기가 다르게 설계하였다. 각 올리고뉴클레오티드에서 표적 서열과 가이드 RNA는 각각 바코드 서열의 상류 (upstream) 및 하류 (downstream)에 위치시켰다.
실시예 2-2: 플라스미드 라이브러리의 제조
상기 실시예에서 제작한 올리고뉴클레오티드를 포함하는 플라스미드 라이브러리를 제조하기 위해, 상기 올리고뉴클레오티드 (각각 120 염기)를 Phusion 폴리머라제 (NEB)를 이용한 PCR로 증폭하였고, MEGAquick-spin™ Total Fragment DNA Purification Kit (Intron)를 이용하여 젤 정제과정을 수행하였다. 그 다음 NEBuidler HiFi DNA Assembly Kit (NEB)를 사용해 LentiGuide_Puro (Addgene, #52963) 벡터와 상기 정제된 PCR 산물을 조립하였다. 조립 후에, 2 ㎕의 상기 반응물로 MicroPulser (BioRad)에 의한 전기천공법을 통해 25 ㎕의 전기수용성세포 (electrocompetent cells, Lucigen)를 형질전환시켰다. 그 다음 상기 형질전환된 세포를 100 ㎍/ml 앰피실린을 함유하는 LB 아가배지에 접종하였다. 최종적으로 라이브러리 범위의 17-18 배에 달하는 수의 콜로니를 확보하였다. 상기 콜로니를 취하여 Plasmid Maxiprep kit (Qiagen)로 플라스미드 DNA를 추출하였다.
실시예 2-3: 렌티바이러스 생산
HEK293T 세포 (ATCC)를 0.01 %의 폴리-L-라이신 (Sigma)으로 코팅된 100 mm 배양접시에서 80 - 90 % 수준 (confluency)이 될 때까지 배양하였다. 상기 실시예 2-2에서 제조한 운반 플라스미드 (transfer plasmid)와 psPAX2 및 pMD2.G를 중량비 4 : 3 : 1로 혼합하였다.
그 다음, 100 mm 배양접시에서 iN-fect 형질주입 시약 (Intron Biotechnology)을 이용해 제조사의 지침에 따라 상기 플라스미드 혼합물 (18 ㎍)을 세포에 도입하였다. 형질주입 15 시간 후, 12ml의 성장 배지로 교체하였다. 상기 형질주입으로부터 39 (= 15 + 24) 및 63 (= 15 + 48) 시간 후에 바이러스를 포함하는 상층액을 수집하였다. 바이러스-함유 배지의 1 차 및 2 차 배치(batch)를 혼합하고, 4 ℃에서 5 분간 3,000 rpm으로 원심분리하였다.
그 다음, Millex-HV 0.45 ㎛ 저단백질결합막 (low protein binding membrane, Millipore)으로 상기 상층액을 여과시킨 후 사용 전까지 -80 ℃에서 보관하였다.
실시예 2-4: 세포 라이브러리의 생성
상기 올리고뉴클레오티드를 포함하는 세포 라이브러리를 만들기 위해, 상기 실시예에서 제조한 렌티바이러스 벡터를 세 개의 150 mm 접시에 부착된 HEK293T 세포 (각 접시 당 7.0 x 106개 세포)에 형질도입하였다.
형질도입으로부터 3 일 후, 2 ㎍/ml의 퓨로마이신을 3 내지 5 일 동안 세포에 처리하였다. 본 발명의 연구를 진행하는 동안 라이브러리를 보존하기 위해, 상기 라이브러리를 함유하는 세포들을 세 개의 150 mm 접시 (각 접시 당 7.0 x 106개 세포 밀도)에 유지하였다.
실시예 2-5: 세포 라이브러리로의 Cas9 전달
SpCas9- 발현 렌티바이러스 벡터의 형질도입을 위해, 먼저 상기 실시예에서 제조한세포 라이브러리 (2.1 x 107개)를 형질 도입 24 시간 전에 세 개의 150 mm 배양접시에 나누어 접종하였다.
그 다음 10 % FBS (fetal bovine serum, Gibco)을 함유하는 DMEM에서 SpCas9-발현 바이러스 벡터를 세포에 형질도입한 후, 10 % FBS 및 10 ㎍/ml 블라스티시딘 S (blasticidin S, InvivoGen)을 함유하는 DMEM에서 유지하였다.
실시예 2-6: 딥 시퀀싱 (deep sequencing)
Wizard Genomic DNA purification kit (Promega)를 이용해 상기 실시예에서 제조한 세포 라이브러리로부터 유전체 DNA를 분리했다.
그 다음 인델 빈도 분석을 위해 먼저 Phusion 폴리머레이즈 (NEB)를 이용해 삽입된 표적 서열을 PCR로 증폭시켰다. 세포 라이브러리의 100 배 이상의 범위 (coverage)를 달성하기 위해, 1 차 PCR에서 주형으로 샘플 당 180 ㎍의 유전체 DNA를 사용하였다 (1 x 106개의 293T 세포에 대한 유전체 DNA를 10 ㎍으로 가정). 각 샘플에 대하여, 각 반응당 2 ㎍의 유전체 DNA로 90 회의 독립적인 50 ㎕의 반응을 수행하였고, 반응 산물을 혼합하였다. 그 다음 PCR 산물을 MEGAquick-spin™ Total Fragment DNA Purification Kit (Intron)를 이용해 정제하였다.
2 차 PCR에서는 상기 1 차 PCR의 정제된 산물 20 ng을 일루미나 어뎁터(Illumina adaptor) 및 바코드 서열과 함께 붙였다. PCR 반응에서 사용되는 프라이머는 하기 표 3에 나타내었다. 최종 산물을 분리, 정제, 혼합한 뒤 MiSeq 또는 HiSeq (Illumina)을 이용해 분석하였다.
프라이머 서열 (5'-3')
SpCas9 올리고 라이브러리 증폭 FP TTG AAA GTA TTT CGA TTT CTT GGC TTT ATA TAT CTT GTG GAA AGG ACG AAA CAC C (서열번호 25)
RP TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT TAA CTT GCT ATT TCT AGC TCT AAA AC (서열번호 26)
표적화된 딥 시퀀싱 (SpCas9) FP ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT TGG ACT ATC ATA TGC TTA CCG TAA CTT G (서열번호 27)
RP GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC TTT TGT CTC AAG ATC TAG TTA CGC CAA G (서열번호 28)
본 발명자들은 상기 실시예로부터 제조된 페어 라이브러리를 이용하여, 상기 실시예에서의 Cpf1 활성 평가와 유사한 방법으로 Cas9의 활성 평가를 수행하였다.
실험예 1: 페어 라이브러리를 이용한 Cpf1의 활성 평가
실험예 1-1: 가이드 RNA-표적 서열 페어 (pair) 라이브러리의 개발
고처리량 방식 (high-throughput manner)으로 다양한 가이드 RNA와 함께 Cpf1의 활성을 평가하기 위해, 본 발명자들은 가이드 RNA-표적 서열 페어 라이브러리를 제조하였다. 상기 표적 서열 및 이에 대응하는 가이드 RNA 서열을 포함하는 11,961 개의 어레이-합성 올리고뉴클레오티드 집단 (pool of array-synthesized oligonucleotides; 도 1)을 PCR로 증폭시켰고, 깁슨 어셈블리를 이용해 렌티바이러스 플라스미드로 클로닝하였다 (도 4). 직접 반복서열 (서열번호 20)은 정방향 프라이머가 결합하는 위치이고, 가이드 서열은 crRNA에 대한 서열이다. 표적 서열은 PAM 서열을 포함하며, 불변부 (constant; 서열번호 21)는 불변 영역 벡터 부착 위치 (contant region vector annealing site)로 역방향 프라이머가 결합하는 위치이다. 상기 과정을 통해 클로닝된 플라스미드의 서열은 서열번호 3의 염기서열을 갖는다.
가이드 RNA를 발현하고 이에 상응하는 표적 서열을 유전체 내에 포함하는 세포의 라이브러리를 만들기 위해, 상기 플라스미드 라이브러리로부터 제조된 렌티바이러스 라이브러리를 HEK293T 세포에 처리하였다 (도 5). 그 다음, 유전체에 삽입된 표적 서열에 가이드 RNA에 의한 절단과 인델 형성을 유도할 수 있도록, Cpf1을 코딩하는 플라스미드를 세포에 형질주입하거나 Cpf1을 발현하는 렌티바이러스 벡터를 세포에 형질도입하여, 상기 세포 라이브러리에 Cpf1을 전달하였다.
그 다음, 표적 서열을 PCR로 증폭하고, 인델 빈도를 평가하기 위해 딥 시퀀싱-기반 분석을 수행하였다. 그 결과, 딥 시퀀싱을 통해 올리고뉴클레오티드 집단에서 각 페어의 상대적 카피 수가 다르다는 것을 확인하였다. 즉, 카피 수를 기준으로, 최대 카피 수를 가지는 상위 0.5 %, 그리고 최소 카피 수를 가지는 하위 0.5 %의 올리고뉴클레오티드를 제외한 99 %의 올리고뉴클레오티드에서 카피 수는 최대 130 배까지 차이가 나는 것을 확인하였다 (도 6). 올리고뉴클레오티드 집단과 비교하여 플라스미드 및 세포 라이브러리는 카피 수에서 약간 더 높은 수준의 편차를 보였다. 이에, 플라스미드 및 세포 라이브러리의 페어 카피 수를 각각 올리고뉴클레오티드 및 플라스미드의 페어 카피 수에 대해 표준화하였으며, 그 결과 올리고뉴클레오티드 집단의 카피 수 편차와 비교하여 낮은 수준의 편차가 나타나는 것을 확인하였다 (도 7). 플라스미드 라이브러리 및 세포 라이브러리 생성 과정에서 추가적으로 발생하는 대부분의 카피 수 편차는 각각 올리고뉴클레오티드 및 플라스미드 라이브러리의 페어 카피 수 편차의 범위 내인 것으로 확인되었다 (도 8 및 도 9). 올리고뉴클레오티드 집단, 플라스미드 라이브러리, 및 세포 라이브러리에서 각 페이의 카피 수는 상관관계가 매우 높았다 (도 10 내지 도 12). 이를 종합하면, 이러한 편차는 세포 라이브러리를 제조하는 과정, 즉 깁슨 조립, 형질전환, 렌티바이러스 벡터 제조, 및 형질도입과 같은 과정을 거치면서 증가되고, 세포 라이브러리에서 각 페어의 카피 수 편차는 주로 올리고뉴클레오티드의 카피 수 편차에 의해 야기되는 것이라는 것을 의미한다. 한편, 세포 라이브러리 내에서 MOI는 약 7.0이었다.
하기 표 4는 분석을 위한 올리고뉴클레오티드 디자인 및 필터링 조건을 정리한 표이다.
카테고리 (목적) 디자인된 페어의 수 필터링 조건 필터링된 페어의 수 사용된 PAM 서열 디자인된 다른 가이드 서열의 수 필터링 후 다른 가이드 서열의 수
AsCpf1의 PAM 결정 1,540 100 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 1,074 70개의 다른 타입 22 18
LbCpf1의 PAM 결정 1,540 30 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 940 70개의 다른 타입 22 16
AsCpf1의 활성 2,381 100 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 1,251 ATTTA 2,381 1,251
절단된 (truncated) 가이드 RNA를 이용한 AsCpf1의 활성 420 300 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 315 ATTTA 7 7
불일치된 타겟 서열에 대한 AsCpf1의 활성 2,580 100 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 1,543 ATTTA 4 3
불일치된 타겟 서열에 대한 LbCpf1 의 활성 1,342 30 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 742 ATTTA 4 불충분한 판독수로 분석하지 않음
생물학적 모사체에서 인델 빈도의 비교 8,327 100 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 156 70개의 다른 타입 3,794 47
Cpf1 전달의 다른 두 방법 간 인델 빈도의 비교 8,327 200 이상 판독 (read), 8% 이하 백그라운드 인델 (Background indels) 233 70개의 다른 타입 3,794 49
하기 표 5는 올리고뉴클레이티드 집단 및 세포 라이브러리에서의 페어의 수를 정리한 표이다.
카테고리 AsCpf1 LbCpf1
올리고뉴클레이티드 집단 세포 라이브러리 올리고뉴클레이티드 집단 세포 라이브러리
디자인된 페어의 수 8,327 3,634
포함된 페어의 수 (1 이상의 판독) 8,313 8,146 3,626 3,497
포함된/디자인된 페어의 백분율 (%) 99.8% 97.8% 99.8% 96.2%
딥 시퀀싱에 의한 총 판독의 수 1,238,978 10,378,634 475,610 584,771
실험예 1-2: 내재적 위치 및 도입된 위치에서의 인델 빈도 비교
본 발명자들은 내재적 게놈 위치 및 해당하는 렌티바이러스에 의해 도입된 합성 위치에 위치한 특정 타겟 서열에서의 인델 빈도간 강한 상호 관련성이 있음을 확인하였다 (도 40). 이러한 높은 상호 관련성은 페어를 형성하지 않은 라이브러리를 이용했을 때 보다 높은 수준을 나타내었다.
Cas9-매개 인델 형성의 효율에 영향을 미치는 크로마틴 접근성 (chromatin accessibility)은 내재적 부위에 따라 다르지만, 렌티바이러스가 활발한 전사 영역에 보다 더 도입(integrate)되기 때문에, 도입된 부위에서 크로마틴 접근성이 높을 것으로 예상된다. 내재적 부위에서의 크로마틴 접근성의 차이로 인한 인델 빈도의 변화를 줄이기 위해, 본 발명자들은 비슷한 크로마틴 접근성을 가진 도입된 부위와 내재적 영역의 서브셋 (subset)에서의 인델 빈도 간의 상관 관계를 비교하였다.
이를 위해, Encyclopedia of DNA element (ENCODE)에서 얻은 DNase0seq 값으로부터 얻은 DNase I 과민성 데이터를 이용해 HEK293T 세포의 크로마틴 접근성을 계산하였다.
그 결과, 유사한 크로마틴 접근성 스코어를 가진 타겟 부위 서브셋에서 관련성이 높으며, 특히, 높은 크로마틴 접근성을 가진 서브셋에서 더 높은 것을 확인하였다 (도 41 및 42). 대부분의 타겟 서열에서, 도입된 서열에서의 인델 빈도는 대응되는 내재적 타겟 부위에서의 인델 빈도 보다 높았으며, 특히 낮은 크로마틴 접근성 영역에서 더 높았다.
또한, 세포 라이브러리는 각 구성 요소의 카피 수에 있어서, 이전의 연구에서 사용된 라이브러리와 유사한 변동성을 가졌다(도 6 내지 11).
한편, 세포 라이브러리의 평균 MOI는 약 7.0이었으며, 두 생물학적 모사체 (replicate) 간에 강한 상호 관련성이 있었다. 두 서로 다른 세포 라이브러리에 대한 Cpf1의 전달은 유사한 인델 빈도를 야기하였다. (도 43).
또한, Cpf1이 서로 다른 두 방법(Cpf1을 코딩하는 플라스미드의 일시적 형질 감염(transient transfection) 및 Cpf1을 코딩하는 렌티바이러스 벡터의 형질도입(transduction))으로 전달되었을 때, 본 발명자들은 인델 빈도에 명확한 연관성이 존재함을 확인하였다(도 44).
대부분의 분석된 타겟 서열에서, Cpf1을 발현하는 렌티바이러스 벡터의 형질도입 후에 인델 빈도가 더 높은 것을 확인하였다 (도 44).
따라서, 본 발명자들은, 일시적 플라스미드 형질감염으로 진행한 LbCpf1 PAM 결정 실험을 제외하고는, 렌티바이러스 벡터를 통한 Cpf1의 형질도입으로 실험을 진행하였다.
실험예 1-3: 포유류 세포에서 PAM 서열의 확인
본 발명자들은 본 발명의 in vivo 시스템으로, Acidaminococcus (As) 또는 Lachnospiraceae (Lb) 유래 Cpf1이 이용하는 PAM (protospacer adjacent motif) 서열을 확인하고자 하였다. 오늘날까지 RNA로 조작 가능한 뉴클레아제 (RNA-programmable nuclease)에 의해 사용되는 상기 PAM 서열은 포유류 세포 내에서가 아닌, in vitro 조건 또는 박테리아 시스템에서만 확인되었다. In vitro 조건에서 As 및 Lb 유래 Cpf1를 분석하였을 때 TTTN이 가장 자주 사용되는 PAM 서열인 점 및 AsCpf1의 구조가 TTTN을 잠재적인 PAM 서열로서 뒷받침하는 점을 고려해, 18 개 (As) 또는 16 개 (Lb)의 가이드 서열에 대해, 70 개 (= ANNNA로 표기되는 43 개 + ATTTB로 표기되는 3 개 + BTTTA로 표기되는 3 개)의 서로 다른 PAM 서열을 준비했다 (AsCpf1에 대해 총 1,260 개 (= 70 x 18) 및 LbCpf1에 대해 총 1,120 개 (= 70 x 16)의 표적 서열, 도 13). 그 결과, HEK293T 세포에서 TTTT를 제외하고 TTTA, TTTC 또는 TTTG가 PAM 서열로 사용되었을 때, AsCpf1 (도 14, 및 도 15) 및 LbCpf1 (도 16, 및 도 17) 모두에서 가장 높은 인델 빈도가 나타났다. 이는 포유류 세포에서 TTTN이 아닌 TTTV가 상기 두 효소에 의해 가장 많이 사용되는 PAM 서열이라는 것을 시사한다. 또한, TTTV 외에는 CTTA가 As와 Lb의 Cpf1 모두에 대해서 가장 높은 인델 빈도를 보였고, 2 차적인 PAM 서열로 고려될 수 있음을 확인하였다. In vitro 조건과 포유류 세포 조건에서 사용된 상기 PAM 서열의 차이 (도 18)는 상기 두 시스템 사이의 유전체 교정 효율성의 차이점과도 부합하며, 이는 효율적인 포유류 유전체 교정 방법을 확립하기 위해서는 in vitro가 아닌 포유류 세포 내에서 PAM 서열을 입증하는 것이 매우 중요하다는 것을 시사한다.
AsCpf1, crRNA, 및 타겟 DNA의 공동 결정 (co-crystal) 구조는, PAM의 네번째 염기는 포함하지 않는, 첫 세 염기 (5'-TTT-3')가 Cpf1 단백질과 상호 작용하는 것을 나타내며, “5'-TTTN-3'”을 PAM 서열로서 뒷받침한다. 본 발명자들의 in vivo 검증 연구는 TTTN부터 TTTV까지 포유류 세포에서 PAM 선호에 대한 이해를 돕는다.
추가적으로, AsCpf1의 인델 빈도(LbCpf1의 인델 비도는 아님)는 TTTA가 PAM 서열로서 사용되었을 때 낮은 수준의 유의적으로 높은 것을 확인하였다. 이는, 다른 잠재적인 PAM에 비해 TTTA가 AsCpf1의 PAM 서열로 미세하게 선호됨을 시사한다.
다음으로, 본 발명자들은 TTTA PAM의 5'말단 근처 염기를 변경하는 것이 유전체 교정 효율에 영향을 미치는지를 평가했다. aTTTA, tTTTA, cTTTA, 및 gTTTA 사이에 인델 빈도는 변화가 없었던 반면 (도 19, 및 39의 a), LbCpf1의 인델 빈도는 cTTTA가 PAM 서열로 사용되었을 때 aTTTA 또는 tTTTA 보다 낮은 수준의 유의적으로 높은 것을 확인하였다(도 39의 b).
실험예 1-4: 표적 활성의 고처리량 프로파일링 (high-throughput profiling)
다음으로 본 발명자들은 가이드 RNA 효율과 관련된 표적 서열의 특징을 확인하고자 했다. 복수의 가이드 RNA를 스크리닝하는 것이 유전체 교정에서 필수적인 시작 단계임을 고려할 때, 표적 서열의 특징을 규명하는 것은 유전체 교정 기술의 발달을 촉진시킬 것이다.
먼저 본 발명자들은 AsCpf1 및 Streptococcus pyogenes 유래 Cas9(SpCas9)이 동일한 표적 서열에 대해 비슷한 상대 활성을 갖는지 평가하였다. Cas9와 Cpf1의 PAM 서열의 위치가 다른 것을 고려하여, 원래의 표적 서열 및 역 표적 서열 모두를 표적으로 하는 Cas9과 Cpf1의 활성 순위를 비교했다 (도 20). 그 결과 모든 경우에 Cas9와 Cpf1 활성의 상관관계가 없음을 확인하였다.
다음으로 가장 활성이 높은 20 %의 가이드 RNA에 대해, AsCpf1 표적 서열의 각 위치에서의 뉴클레오티드 선호도를 조사하였다. 가장 두드러지는 차이점은 PAM 서열 바로 옆에 위치한 뉴클레오티드인, 위치 1에서 관찰되었다. 높은 활성을 가진 가이드 RNA에서는 상기 1 번 위치에 티민 (thymine)이 상당히 감소되어 있었다 (도 21). 비록 서열 특이적인 특징은 다르지만, 상기 PAM 바로 옆의 위치는 SpCas9에서도 매우 중요하다.
본 발명자들은 이러한 위치 1에서의 티민을 선호하지 않는 이유가 Cpf1 단백질과 타겟 뉴클레오염기의 위치 1에 결합하는 crRNA 리보뉴클레아제 간의 상호작용이 안정되지 않아서라고 판단하였다. DNA-결합 AsCpf1 구조(PDB 5B43)에 기초하여, WED 도메인 내 하이드록시 사이드 체인의 Thr16이 구아닌 염기의 N2와 안정적인 극성 상호 작용을 형성하며, 우라실 및 티민의 O2와도 형성한다 (도 39).
그러나, 아데닌에는 Thr16의 하이드록시 사이드 체인과 상호작용할 수 있는 해당 모이어티가 존재하지 않아서, crRNA 아데닌 리보뉴클레오티드의 위치가 불안정하다. 이에, 타겟 DNA 가닥의 위치 1에 존재하는 티민은 선호되지 않는다.
마지막으로, 본 발명자들은 AsCpf1이 40~60 % 사이의 GC 함량을 가지는 표적 서열에 대해 가장 높은 활성을 나타내는 것을 확인하였다 (도 22). 이는 SpCas9에 대한 이전 결과와도 유사한 것이다.
인델 빈도는 또한 Cas9과 가이드RNA가 세포에서 발현되는 시간의 길이에도 영향을 받는다. 이전 연구에서 Cas9 및 가이드 RNA를 발현하는 렌티바이러스 벡터의 형질도입 후 6 내지 11 일과 같이 장기간 배양을 하는 경우, 시간에 따라 인델 빈도 및 넉아웃 효율이 시간 의존적으로 증가한다고 보고된바 있다. 그러나 이러한 종전 연구들에서는 오직 적은 수 (1, 5 또는 6 개)의 가이드 RNA를 상대적으로 짧은 기간 (14 일 까지) 동안만 시험한 것이므로, 장기 배양이 가이드 RNA 효율에 있어서 서열에 의한 한계를 극복하기 충분한 인델 빈도를 야기할 수 있는지 명확하게 확인되지 않았다. 인델 빈도가 스크리닝 효율에 상당히 영향을 미치는 유전체 수준의 스크리닝 연구에서 주효 뉴클레아제 (즉, Cas9)와 가이드 RNA가 렌티바이러스 벡터로 전달되기 때문에, 이는 중요한 문제이다. 이에, 본 발명자들은 한 달 (31 일)까지 발현된 가이드 RNA 220 개에 대한 인델 빈도를 분석하여 상기 문제를 설명하고자 했다. AsCpf1을 렌티바이러스 벡터로 전달하였을 때, 배양 시간을 5 일까지 증가시켜 평균 및 각각의 인델 빈도 모두가 현저히 증가하였다 (도 23 및 도 24). 이는 SpCas9에 대한 종전 관찰결과와 유사한 것이다. 그러나, 형질도입 후 5, 10 및 31 일의 인델 빈도는 차이가 없었다. 이는 5 일 이상의 배양은 표적 및 가이드 RNA 서열에 의해 주로 결정되는 특정 수준 위로는 인델 빈도가 증가되지 않는다는 것을 시사하는 것이다.
실험예 1-4: 비표적 활성의 고처리량 프로파일링
다음으로, Cpf1의 비표적 활성 프로필 (off-target activity profile)을 평가하고자 하였다. 첫 번째 단계로서, 높은 표적 절단 효율을 갖는 가이드 RNA의 서열 불일치 효과 (mismatch effect)를 확인하고자 하였다. 이에, AsCpf1에 대해 4 개의 가이드 RNA와 이에 상응하는 표적 서열을 설계하였고, 이들에 대한 표적 인델 빈도는 형질도입 5 일 후에 각각 53 %, 34 %, 32 %, 및 15 % 인 것을 확인하였다. 이 중 가장 높은 표적 절단 효율을 갖는 3 개의 가이드 RNA를 비표적 효과 프로파일링을 위해 선택하였고, 상기 가이드 RNA의 각 위치에서 표적 서열과의 염기서열 불일치 효과를 분석했다 (도 25). 그 결과 1 내지 6 번 자리에서, 하나의 bp 불일치가 인델 빈도를 매우 감소시키는 것을 확인하였다 (도 26). 상기 결과는 이러한 위치가 시드 영역 (seed region)이라는 것을 의미하는 것이다. 상기와 같이 본 발명의 In vivo 조건으로 입증된 AsCpf1 가이드 RNA 시드 영역은, Francisella novicida 유래 Cpf1 (FnCpf1)에 대한 가이드 RNA의 시드 영역에 대해 대략 최초 5 개의 위치 내에 존재하는 것으로 예측했던 종래 in vitro 실험 결과와도 유사하다. 한편, 19 내지 23 번 위치에서 하나의 염기서열이 불일치하는 경우에는 인델 빈도가 소폭 감소되는 것을 확인하였다 (도 26). 따라서 본 발명자들은 이 부분을 프로미스큐어스 영역 (promiscuous region)으로 명명하였다.
나아가, 7 내지 18 번 위치의 하나의 염기서열 불일치는 인델 빈도를 중간 수준으로 낮추었다 (도 26). 본 발명자들은 이 부분을 트렁크 영역 (trunk region)으로 명명하였다.
상기 결과로부터 본 발명자들은 AsCpf1에 있어서 가이드 RNA의 시드 영역과 트렁크 영역의 18 개의 뉴클레오티드 (nt) 내에서 염기서열의 불일치는 감수할 수 없으며 (intolerable), 프로미스큐어스 영역 내의 염기서열 불일치는 감수할 수 있다 (tolerable)고 판단하였다. 이는, FnCpf1의 in vitro DNA 절단에 있어서 가이드 RNA의 3' 말단의 6 nt를 절단하거나 가이드 서열의 18 nt를 보존하더라도 충분히 효율적이라는 종래 연구 결과와 일치하는 것이다. 또한, Cas9에서도 PAM 서열로부터 멀리 떨어진 가이드 RNA 영역이 중요하지 않다는 보고도 있었다.
따라서, 다음으로 본 발명자들은 절단된 가이드 RNA를 이용해 표적 및 비표적 효과를 분석하였다. 그 결과, 가이드 RNA의 3' 말단을 4 nt까지 절단하거나 최소 19 nt까지 가이드 RNA 길이를 줄이는 것은 표적 인델 빈도를 유지하며 비표적 인델 빈도를 서서히 감소시킨다는 것을 확인하였다 (도 27). 이는 SpCas9에서 관찰된 효과와 유사하게 절단된 가이드 RNA를 이용하여 표적 효과의 감소 없이도 비표적 효과를 감소시킬 수 있음을 의미한다.
실험예 1-5: 내재적 표적 위치의 인델 빈도와 고도의 상호관련성을 가지는 Cpf1 활성의 라이브러리 기반 평가
본 발명자들은 불일치하는 염기 수와 비표적 효과 사이의 관련성을 분석하였다. 그 결과, 잠재적인 비표적 위치에서 불일치하는 염기의 수가 많을수록 비표적 효과가 감소하는 것을 확인하였다 (도 28).
나아가 본 발명자들은 시드 영역, 시드와 트렁크가 이어지는 영역, 트렁크 영역, 트렁크와 프로미스큐어스 영역 사이의 이어지는 지역, 프로미스큐어스 영역으로 이루어진 다섯 영역에서 불일치 염기 수의 효과를 평가했다. 그 결과 모든 영역에서 불일치 염기 수가 증가할 수록 낮은 인델 빈도를 유발하는 것을 확인하였다. 다만, 4 또는 5 개의 불일치까지도 상당한 인델 빈도를 보이는 프로미스큐어스 영역에서는 이러한 경향이 불명확하게 나타났다 (도 29 및 도 30). 또한, 시드 또는 시드와 트렁크가 이어지는 영역에서 3 개 이상의 불일치는 거의 완벽하게 인델 형성을 억제했다.
다음으로, 본 발명자들은 불일치의 형태가 비표적 효과에 영향을 미치는지를 조사했다. 시드 영역 및 트렁크 영역에서, 비워블 전이 (non-wobble transition) 또는 전환 불일치 (transversion mismatches) 보다 워블 전이 불일치 (wobble transition mismatches)가 높은 인델 빈도와 관련이 있다는 것을 확인하였다 (도 31 내지 도 33). 이는 SpCas9의 비표적 효과에 대한 비편향적 (unbiased)인 분석 결과와도 일치하는 것이다. 다만, 이러한 현상은 모든 유형의 불일치가 인델 빈도를 약간만 감소시키는 프로미스큐어스 영역에서는 관찰되지 않았다.
실험예 2: 페어 라이브러리를 이용한 Cas9의 활성 평가
실험예 2-1: Cas9 활성 평가를 위한 페어 라이브러리 제조
고처리량 방식 (high-throughput manner)으로 다양한 가이드 RNA와 함께 Cas9의 활성을 평가하기 위해, 본 발명자들은 가이드 RNA-표적 서열 페어 라이브러리를 제조하였다. 상기 표적 서열 및 이에 대응하는 가이드 RNA 서열을 포함하는 89,592 개의 어레이-합성 올리고뉴클레오티드 집단 (pool of array-synthesized oligonucleotides; 도 35)을 PCR로 증폭시켰고, 깁슨 어셈블리를 이용해 렌티바이러스 플라스미드로 클로닝하였다 (도 36).
가이드 RNA를 발현하고 이에 상응하는 표적 서열을 유전체 내에 포함하는 세포의 라이브러리를 만들기 위해, 상기 플라스미드 라이브러리로부터 제조된 렌티바이러스 라이브러리를 HEK293T 세포에 처리하였다 (도 5).
그 다음, 유전체에 삽입된 표적 서열에 가이드 RNA에 의한 절단과 인델 형성을 유도할 수 있도록, Cas9을 발현하는 렌티바이러스 벡터를 세포에 형질도입하여, 상기 세포 라이브러리에 Cas9을 전달하였다. 그 다음, 표적 서열을 PCR로 증폭하고, 인델 빈도를 평가하기 위해 딥 시퀀싱-기반 분석을 수행하였다.
실험예 2-2: 인간 CD15 유전자 및 인간 MED1 유전자의 가이드 RNA에 대한 Cas9 활성 평가
상기 실시예에서 제조한 페어 라이브러리를 이용하여 인간 CD15 유전자 및 인간 MED1 유전자의 가이드 RNA에 대한 Cas9 활성을 평가하였다.
구체적으로, 페어 라이브러리를 이용하여 얻은 가이드 RNA의 활성 순위와 Nat Biotechnol, 2014, 32:1262-1267, Nat Biotechnol, 2016, 34:184-191 문헌의 가이드 RNA의 활성 순위를 비교하여 페어 라이브러리의 정확도를 평가하였다.
그 결과, 인간 CD15 유전자를 대상으로 하는 가이드 RNA들의 경우 스피어만 상관계수 R=0.634를 나타내었으며, 인간 MED1 유전자(엑손 전체 길이의 상위 80% 내에서 설계된)를 대상으로 하는 가이드 RNA들의 경우 스피어만 상관계수 R=0.582를 나타내어, 두 페어 라이브러리 모두 공지된 가이드 RNA의 활성 순위와 높은 상관관계를 나타내는 것을 확인하였다 (도 37).
실험예 2-3: 세포 내 표적 서열에 대한 가이드 RNA 활성 및 페어 라이브러리의 가이드 RNA 활성 비교
본 발명자들은 페어 라이브러리 방법을 이용하여 얻은 가이드 RNA의 활성도와 세포 내에 존재하는 표적 서열을 직접 분석하여 얻은 가이드 RNA의 활성도와의 상관 관계를 비교하고자 하였다.
구체적으로, HEK293T 세포를 48-well 접시에 접종 한 후, 가이드 RNA-표적 서열 페어를 포함하는 렌티바이러스 벡터를 형질도입하였다. 형질도입 3일 후 세포에 2 μg/ml 농도의 퓨로마이신을 처리하여 형질도입된 세포만 선별하였다.
그 다음 10 % FBS (fetal bovine serum, Gibco)을 함유하는 DMEM에서 SpCas9-발현 바이러스 벡터를 세포에 형질도입한 후, 10 % FBS 및 10 ㎍/ml 블라스티시딘 S (blasticidin S, InvivoGen)을 함유하는 DMEM에서 유지하였다. SpCas9-발현 바이러스 형질 도입 6일 후 Wizard Genomic DNA purification kit (Promega)를 이용해 세포 라이브러리로부터 유전체 DNA를 분리했다. 그 다음 인델 빈도 분석을 위해 먼저 Phusion 폴리머레이즈 (NEB)를 이용해 렌티바이러스로 삽입된 표적 서열과 세포 내에 존재하는 표적 서열을 각각 PCR로 증폭시켰다. 각 샘플에 대하여, 각 반응당 100 ng의 유전체 DNA를 사용하여 20 ㎕의 반응을 수행하였다. 그 다음 PCR 산물을 MEGAquick-spin™ Total Fragment DNA Purification Kit (Intron)를 이용해 정제하였다.
2 차 PCR에서는 상기 1 차 PCR의 정제된 산물 20 ng을 일루미나 어뎁터(Illumina adaptor) 및 바코드 서열과 함께 붙였다. PCR 반응에서 사용되는 프라이머는 상기 표 3에 나타내었다. 최종 산물을 분리, 정제, 혼합한 뒤 MiSeq 또는 HiSeq (Illumina)을 이용해 분석하였다.
그 결과, 세포 내 표적 서열에 대한 가이드 RNA 활성 및 페어 라이브러리의 가이드 RNA 활성이 피어슨 상관계수 R=0.546 의 높은 상관관계를 보임을 확인하였다.
이로부터, 본 발명의 SpCas9 가이드 RNA-표적 서열 페어 라이브러리를 이용한 고처리량 방식 평가가 높은 정확성을 갖는 것을 확인하였다 (도 38).
실험예 3: 표적 서열에서의 전통적 Cpf1 활성 평가 방법과의 비교
본 발명의 고처리량 방식 활성 평가 방법과 기존의 개별 평가 방법을 비교하였다.
구체적으로, 비용은 USD로, 노동 단위는 한 시간에 숙련된 사람이 최대로 할 수 있는 양을 나타내었다. 배양 시간과 같은 한 시간이 넘는 중단(break)이 있을 경우, 노동으로 계산되지 않았다.
결과를 하기 표 6에 나타내었다.
카테고리 전통적 개별 테스트 본 발명의 방법
절차 비용 (USD) 노동 (unit) 절차 비용 (USD) 노동 (unit)
올리고뉴클레오티드 합성 합성 54,000 - 합성 2,200 -
라이브러리 제조 인산화 4,480 100 올리고뉴클레오티드 라이브러리 증폭 53 0.5
접합 (Ligation) 128 20 깁슨 어셈블리 159 0.5
형질전환 및 플레이팅 - 220 형질전환 및 플레이팅 165 1
플라스미드 제조 및 시퀀싱 30,000 200 플라스미드 제조 및 세포 라이브러리 제조 112 3
CRISPR-Cpf1 전달 형질 감염 749 100 형질 도입 - 1
딥 시퀀싱 샘플 준비 게놈 DNA 분리 - 500 게놈 DNA 분리 - 2
딥 시퀀싱을 위한 PCR - 100 딥 시퀀싱을 위한 PCR - 1
소계 89,357 1,240 2,689 9
상기 결과를 모두 종합하면, 본 발명은 포유류 세포에서 특정한 표적 서열에 대한 가이드 RNA 활성을 확인하는 고처리량 평가 방법을 제공함을 알 수 있다. 유전체 상의 특정 영역에서 유전체 교정 또는 특정 유전자의 넉아웃을 위해 가이드 RNA를 설계할 수 있고, 이때 인델 빈도는 주로 일시적 형질주입 (transient transfection)과 같이 단순한 전달 수단을 통해 확인된다. 그러나, 인델 빈도는 가이드 RNA 자체의 효율뿐만 아니라 형질주입 효율에 따라 영향을 받는다. 따라서, 이와 같은 인델 빈도 확인 방법은 형질주입 또는 전달 효율의 편차로 인해 최적의 가이드 RNA 서열을 안정적으로 확인할 수 없다. 본 발명에서는 세포 집단에 대한 단일 배치의 형질도입 및/또는 형질주입으로 10,000 개 이상의 가이드 RNA의 효율을 한번에 확인하였으며, 다른 배치 사이에 전달 편차로 유발될 수 있는 오류를 최소화하였다. 통상의 경우 보다는 다소 낮은 형질주입 또는 형질도입 효율은 시험된 모든 가이드 RNA의 효율을 감소시킬 수는 있으나, 가이드 RNA의 활성 순위 또는 "상대적" 활성은 유지되므로, 시험된 것들 중 가장 높은 활성을 가지는 가이드 RNA의 선별이 가능하다. 다른 전달 효율로 야기될 수 있는 오류를 최소화하는 한 가지 방법은 반복 실험을 수행하는 것이나, 이는 노력과 비용이 많이 소요된다. 나아가, 본 발명의 페어 라이브러리를 이용한 방법은 세포의 상태 및 종류에 따라 다양하게 나타나는 후생학적 인자에 의한 영향을 거의 받지 않는다. 렌티바이러스 벡터는 주로 전사 활성 영역에 삽입되므로, 렌티바이러스 벡터를 이용하여 세포 집단에 페어 라이브러리를 전달하는 경우 후생학적 상태로 야기될 수 있는 인델 빈도 편차를 최소화시킬 수 있다. 전달 효율, 세포 상태 및 세포 종류의 편차는 가이드 RNA 효율을 비교하는데 가장 심각한 문제 중 하나로 제기되어 왔다. 그러나, 본 발명의 페어 라이브러리는 서열에 기초하여 가이드 RNA 효율을 안정적으로 평가할 수 있고, 전달 또는 후생학적 상태의 편차가 효율에 영향을 미칠 가능성을 감소시킨다.
~1,400 개 수준의 가이드 RNA를 코딩하는 플라스미드를 세포에 공동-형질주입하여, 뉴클레오티드 서열 및 후생학적 상태와 같이 가이드 RNA 활성에 영향을 미치는 파라미터들을 확인할 수 있는 중규모 수준의 언페어 (unpair) 이중 라이브러리 접근 방식의 경우, 각각의 세포에 다수의 가이드 RNA 라이브러리가 공동 형질주입되어 비표적 효과를 분석하기 어려우며, 이에 따라 확인된 인델이 어떤 가이드 RNA에 의한 것인지 결정하기 어려운 단점을 가진다. 나아가, 가이드 RNA 카피 수는 절단 효율에 상당히 영향을 미치는데, 이 경우엔 라이브러리 내 카피 수 편차가 상당하므로 각각의 가이드 RNA의 활성을 예측하는데 어려움이 있다. 기존에 알려진 라이브러리들과 유사하게, 본 발명의 라이브러리에서도 카피 수의 편차가 존재한다. 그러나, 본 발명의 경우, 가이드 RNA 및 표적 서열이 페어 (pair) 형태로 사용되므로, 합성된 표적 서열과 그 서열에 대응하지 않는 가이드 RNA 사이의 반응은 수 개의 페어가 세포로 전달되는 경우 무시해도 될만한 수준이며, 거의 모든 세포에 특정 가이드 RNA 및 이에 대응되는 합성 표적 서열을 코딩하는 DNA가 하나의 카피로 존재하여 카피 수와 관련된 편차를 막을 수 있다. 심지어 비표적 평가를 위해 유사한 표적 서열을 사용하더라도, 가이드 RNA 서열의 다양성 보다 많은 카피 수가 도입되지 않는 이상, 다른 페어의 가이드 RNA 및 표적 서열 간의 반응은 상당한 수준으로 나타나지 않아 비표적 효과를 평가할 수 있다. 나아가, 도입되는 카피 수는 렌티바이러스 벡터를 희석하여 조절할 수 있다.
본 발명은 또한 RNA-가이드 유전체 조작에 영향을 미치는 파라미터를 결정할 수 있다. 즉, 표적 서열, 이펙터 뉴클레아제 오솔로그 (effector nuclease ortholog)의 종류, 가이드 RNA의 구조적 영역, 표적 DNA의 후생학적 상태, 가이드 RNA 및 이펙터 뉴클레아제에 노출시키는 농도 및 기간, 및 가이드 RNA 및 이펙터 뉴클레아제 전달 효율 등 다양한 인자에 의해 표적 및 비표적 위치에서 인델 빈도를 확인할할 수 있다. 본 발명의 페어 라이브러리를 통해 고처리량 방식으로 다양한 표적 서열에서 각 파라미터의 효과를 시험할 수 있을 것으로 기대된다.
상기 결과를 종합하면, 본 발명은 비표적 효과를 검출하는 새로운 수단을 제공한다. 비표적 효과는 가이드-서열 유사성에 기초한 in silico 방식의 접근을 통해 예측할 수 있으며, 실험적으로 측정할 수 있다. GUIDE-seq, Digenome-seq, BLESS, IDLV capture, 및 HTGTS 등과 같은 비편향적 실험방법 (unbiased experimental methouds)이 소개되어왔으나, 모두 완벽하게 섬세하거나 정교하지는 못하다.
본 연구는 RNA-가이드 뉴클레아제 분야에서의 '산업혁명'에 비할 수 있으며, 이제 RNA-가이드 뉴클레아제 활성은 종래의 어렵고 개별적이었던 측정 방법 (a cottage system)을 통해서가 아닌 라이브러리 기반으로, 고처리량 방식 (a factory system)으로 in vivo 조건에서 측정할 수 있다 (도 34).
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (28)

  1. (a) RNA-가이드 뉴클레아제 (RNA-guided nuclease)가 도입된, 가이드 RNA (guide RNA)를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포 라이브러리로부터 수득한 DNA를 이용하여 서열분석을 수행하는 단계; 및
    (b) 상기 서열분석을 통해 수득한 데이터로부터 각 가이드 RNA-표적 서열 페어 (pair)의 인델 빈도 (indel frequency)를 검출하는 단계를 포함하는,
    RNA-가이드 뉴클레아제 (RNA-guided nuclease)의 활성을 평가하는 방법.
  2. 제1항에 있어서, 상기 가이드 RNA는 crRNA (CRISPR RNA)를 포함하는 것인, 방법.
  3. 제1항에 있어서, 상기 올리고뉴클레오티드는 PAM (protospacer adjacent motif) 서열을 포함하는, 방법.
  4. 제1항에 있어서, 올리고뉴클레오티드는 5' 에서 3' 또는 그 역순으로, 가이드 RNA 코딩 서열, 바코드 서열, 및 표적 염기서열을 포함하는, 방법.
  5. 제1항에 있어서, 올리고뉴클레오티드는 5' 에서 3' 또는 그 역순으로, 가이드 RNA 코딩 서열, 바코드 서열, PAM (protospacer adjacent motif) 서열, 및 표적 염기서열을 포함하는, 방법.
  6. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 올리고뉴클레오티드는 직접 반복 서열, 폴리 T 서열, 바코드 서열, 불변부 서열, 프로모터 서열, 및 스캐폴드 서열로 이루어진 군에서 선택되는 어느 하나 이상을 추가로 포함하는, 방법.
  7. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 올리고뉴클레오티드는 100 내지 200 개의 염기서열로 이루어진, 방법.
  8. 제1항 내지 제5항 중 어느 한 항에 있어서, 하나의 올리고뉴클레오티드 상에 존재하는 가이드 RNA는 동일 올리고뉴클레오티드 상에 존재하는 표적 염기서열에 대해 Cis-작용 (Cis-acting)하는 가이드 RNA인, 방법.
  9. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 방법은
    (a) 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포 라이브러리에 RNA-가이드 뉴클레아제를 도입하는 단계;
    (b) 상기 RNA-가이드 뉴클레아제가 도입된 세포 라이브러리로부터 수득한 DNA를 이용하여 딥 시퀀싱을 수행하는 단계; 및
    (c) 상기 딥 시퀀싱으로 수득한 데이터로부터 각 가이드 RNA-표적 서열 페어의 인델 빈도를 검출하는 단계를 포함하는, 방법.
  10. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 RNA-가이드 뉴클레아제는 Cas9 단백질 또는 Cpf1 단백질인, 방법.
  11. 제10항에 있어서, 상기 Cas9 단백질은 스트렙토코커스 (Streptococcus) 속, 네이세리아 (Neisseria) 속, 파스테우렐라 (Pasteurella) 속, 프란시셀라 (Francisella) 속 및 캄필로박터 (Campylobacter) 속으로 이루어진 군에서 선택되는 하나 이상의 유래인, 방법.
  12. 제10항에 있어서, 상기 Cpf1 단백질은 캔디다투스 파세이박터 (Candidatus Paceibacter), 라치노스피라 (Lachnospira) 속, 뷰티리비브리오 (Butyrivibrio) 속, 페레그리니박테리아 (Peregrinibacteria), 액시도미노코쿠스 (Acidominococcus) 속, 포르파이로모나스 (Porphyromonas) 속, 프레보텔라 (Prevotella) 속, 프란시셀라 (Francisella) 속, 캔디다투스 메타노플라스마 (Candidatus Methanoplasma), 또는 유박테리움 (Eubacterium) 속으로 이루어진 군에서 선택되는 하나 이상의 유래인, 방법.
  13. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 RNA-가이드 뉴클레아제의 특성은,
    (i) RNA-가이드 뉴클레아제의 PAM 서열,
    (ii) RNA-가이드 뉴클레아제의 표적 활성 (on-target activity), 또는
    (iii) RNA-가이드 뉴클레아제의 비표적 활성 (off-target activity)으로 이루어진 군에서 선택되는 하나 이상을 포함하는, 방법.
  14. 제1항에 있어서, 상기 서열분석은 딥 시퀀싱 (deep sequencing)으로 수행하는 것인, 방법.
  15. 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 올리고뉴클레오티드를 포함하는 세포를 2 종 이상 포함하는, 세포 라이브러리.
  16. 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 벡터.
  17. 제16항에 있어서, 상기 벡터는 바이러스 벡터인, 벡터.
  18. 제16항에 있어서, 상기 벡터는 렌티바이러스 벡터, 레트로바이러스 벡터 및 플라스미드 벡터로 이루어진 군에서 선택된 어느 하나인, 벡터.
  19. 가이드 RNA를 코딩하는 염기서열 및 상기 가이드 RNA가 목적하는 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드를 포함하는 벡터를 2 종 이상 포함하는 벡터 라이브러리.
  20. 가이드 RNA 코딩 염기서열 및 표적 염기서열을 포함하는 분리된 올리고뉴클레오티드.
  21. 제20항의 올리고뉴클레오티드를 2 종 이상 포함하는 올리고뉴클레오티드 라이브러리.
  22. (a) RNA-가이드 뉴클레아제로 타겟팅하고자 하는 표적 염기서열을 설정하는 단계;
    (b) 상기 설정된 표적 염기서열의 상보적 사슬과 염기쌍을 형성하는, 가이드 RNA를 코딩하는 염기 서열을 설계하는 단계;
    (c) 상기 표적 염기서열과 이를 목적으로 하는 가이드 RNA를 포함하는 올리고뉴클레오티드를 설계하는 단계; 및
    (d) 상기 (a) 내지 (c) 단계를 1 회 이상 반복하는 단계를 포함하는 단계를 포함하는,
    제20항의 올리고뉴클레오티드의 라이브러리를 구축하는 방법.
  23. 제22항에 있어서,
    상기 (c) 단계 혹은 (d) 단계는 추가로 설계된 올리고뉴클레오티드를 합성하는 단계를 포함하는, 방법.
  24. TTTV 혹은 CTTA인 PAM (proto-spacer-adjacent Motif) 서열에 인접한, 표적 염기서열의 상보적 사슬 (complementary strand)과 염기쌍을 형성할 수 있는 서열을 포함하는, 분리된 가이드 RNA.
  25. 제24항에 있어서, 상기 분리된 가이드 RNA는 이와 함께 사용되는 RNA-가이드 뉴클레아제가 Cpf1 단백질인, 분리된 가이드 RNA.
  26. 제24항 또는 제25항의 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산을 포함하는, 유전체 교정을 위한 조성물.
  27. 제24항 또는 제25항의 분리된 가이드 RNA, 혹은 이를 코딩하는 핵산; 및
    Cpf1 단백질 혹은 이를 코딩하는 핵산을 포함하는,
    포유 동물 세포에서의 유전체 교정을 위한 시스템.
  28. 제24항의 가이드 RNA 혹은 이를 코딩하는 핵산; 및 Cpf1 단백질 혹은 이를 코딩하는 핵산을 순차적으로 혹은 동시에 분리된 포유동물 세포에 도입하는 단계를 포함하는,
    포유동물 세포에서 Cpf1으로 유전체 교정을 하는 방법.
PCT/KR2017/004610 2016-04-28 2017-04-28 In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법 WO2017188797A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP17789981.2A EP3450570B1 (en) 2016-04-28 2017-04-28 Method for evaluating, in vivo, activity of rna-guided nuclease in high-throughput manner
US16/096,849 US20190136211A1 (en) 2016-04-28 2017-04-28 Method For In Vivo High-Throughput Evaluating Of RNA-Guided Nuclease Activity
JP2018556336A JP2019514379A (ja) 2016-04-28 2017-04-28 Ｒｎａ誘導型ヌクレアーゼ活性のインビボ高スループット評価のための方法
CN201780040689.2A CN109415756B (zh) 2016-04-28 2017-04-28 用于以高通量方式体内评估rna引导的核酸酶的活性的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0052365 2016-04-28
KR20160052365 2016-04-28

Publications (1)

Publication Number Publication Date
WO2017188797A1 true WO2017188797A1 (ko) 2017-11-02

Family

ID=60160892

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/004610 WO2017188797A1 (ko) 2016-04-28 2017-04-28 In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법

Country Status (6)

Country Link
US (1) US20190136211A1 (ko)
EP (1) EP3450570B1 (ko)
JP (1) JP2019514379A (ko)
KR (2) KR20170123581A (ko)
CN (1) CN109415756B (ko)
WO (1) WO2017188797A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113838529A (zh) * 2021-09-27 2021-12-24 电子科技大学长三角研究院(衢州) 一种植物中sgRNA活性预测方法及装置
CN116064597B (zh) * 2023-01-17 2024-04-26 北京大学 通过自主复制rna实现哺乳动物细胞中的定向进化和达尔文适应

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020533957A (ja) 2017-07-31 2020-11-26 リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ． Ｃｒｉｓｐｒリポーター非ヒト動物およびその使用
WO2020101329A1 (ko) * 2018-11-15 2020-05-22 연세대학교 산학협력단 세포의 dna에 시간의 흐름을 기록하는 방법
CN110358767B (zh) * 2019-07-30 2021-06-08 湖北大学 一种基于CRISPR-Cas12a系统的运动发酵单胞菌基因组编辑方法及其应用
KR102412631B1 (ko) * 2019-08-09 2022-06-24 연세대학교 산학협력단 염기교정 유전자가위의 염기교정 효율 및 결과 예측 시스템
JP2022547105A (ja) * 2019-09-04 2022-11-10 博雅▲輯▼因（北京）生物科技有限公司 オフターゲット評価に基づく遺伝子編集治療の評価方法
US12047373B2 (en) * 2019-11-05 2024-07-23 Salesforce.Com, Inc. Monitoring resource utilization of an online system based on browser attributes collected for a session
WO2022040224A1 (en) * 2020-08-17 2022-02-24 Arbor Biotechnologies, Inc. Compositions comprising a nuclease and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3009511A2 (en) * 2015-06-18 2016-04-20 The Broad Institute, Inc. Novel crispr enzymes and systems

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2699523C2 (ru) * 2012-12-17 2019-09-05 Президент Энд Фэллоуз Оф Харвард Коллидж Рнк-направляемая инженерия генома человека
US9944925B2 (en) * 2013-08-02 2018-04-17 Enevolv, Inc. Processes and host cells for genome, pathway, and biomolecular engineering
WO2015040075A1 (en) * 2013-09-18 2015-03-26 Genome Research Limited Genomic screening methods using rna-guided endonucleases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3009511A2 (en) * 2015-06-18 2016-04-20 The Broad Institute, Inc. Novel crispr enzymes and systems

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
AGROTIS ET AL.: "A New Age in Functional Genomics Using CRISPR/Cas9 in Arrayed Library Screening", FRONTIERS IN GENETICS, vol. 6, no. 300, September 2015 (2015-09-01), pages 1 - 15, XP055434268 *
KIM ET AL.: "In vivo High-throughput Profiling of CRISPR-Cpfl Activity", NATURE METHODS, vol. 14, no. 2, February 2017 (2017-02-01), pages 153 - 159, XP055434289 *
NISHIMASU ET AL.: "Crystal Structure of Cas9 in Complex with Guide RNA and Target DNA", CELL, vol. 156, 27 February 2014 (2014-02-27), pages 935 - 949, XP055423859 *
O'GEEN ET AL.: "A Genome-wide Analysis of Cas9 Binding Specificity Using ChIP-seq and Targeted Sequence Capture", NUCLEIC ACIDS RESEARCH, vol. 43, no. 6, 2015, pages 3389 - 3404, XP055434273 *
PENG ET AL.: "High-throughput Screens in Mammalian Cells Using the CRISPR-Cas9 System", THE FEBS JOURNAL, vol. 282, 16 March 2015 (2015-03-16), pages 2089 - 2096, XP055434292 *
VIDIGAL ET AL.: "Rapid and Efficient One-step Generation of Paired gRNA CRISPR-Cas9 Libraries", NATURE COMMUNICATIONS, vol. 6, no. 8083, 2015, pages 1 - 7, XP055340818 *
YAMANO ET AL.: "Crystal Structure of Cpfl in Complex with Guide RNA and Target DNA", CELL, vol. 1, no. 65, 21 April 2016 (2016-04-21), pages 949 - 962, XP029530759 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113838529A (zh) * 2021-09-27 2021-12-24 电子科技大学长三角研究院(衢州) 一种植物中sgRNA活性预测方法及装置
CN116064597B (zh) * 2023-01-17 2024-04-26 北京大学 通过自主复制rna实现哺乳动物细胞中的定向进化和达尔文适应

Also Published As

Publication number Publication date
JP2019514379A (ja) 2019-06-06
CN109415756B (zh) 2022-08-09
US20190136211A1 (en) 2019-05-09
KR102227657B1 (ko) 2021-03-16
EP3450570A1 (en) 2019-03-06
KR20170123581A (ko) 2017-11-08
EP3450570A4 (en) 2019-11-20
KR20190050956A (ko) 2019-05-14
EP3450570B1 (en) 2021-03-10
CN109415756A (zh) 2019-03-01

Similar Documents

Publication Publication Date Title
WO2017188797A1 (ko) In vivo에서 rna-가이드 뉴클레아제의 활성을 고처리량 방식으로 평가하는 방법
AU2013335451C1 (en) Composition for cleaving a target DNA comprising a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein, and use thereof
WO2016021973A1 (ko) 캄필로박터 제주니 crispr/cas 시스템 유래 rgen을 이용한 유전체 교정
WO2021086083A2 (ko) CRISPR/Cas12f1 시스템 효율화를 위한 엔지니어링 된 가이드 RNA 및 그 용도
WO2019009682A2 (ko) 표적 특이적 crispr 변이체
WO2017217768A1 (ko) 온타겟 및 오프타겟의 다중 타겟 시스템을 이용하는, 표적 특이적 유전자 가위 스크리닝 방법 및 이의 용도
WO2019103442A2 (ko) CRISPR/Cpf1 시스템을 이용한 유전체 편집용 조성물 및 이의 용도
WO2020235974A9 (ko) 단일염기 치환 단백질 및 이를 포함하는 조성물
WO2015053523A1 (ko) 항체 발현용 바이시스트로닉 발현벡터 및 이를 이용한 항체의 생산 방법
WO2022075816A1 (ko) Crispr/cas12f1(cas14a1) 시스템 효율화를 위한 엔지니어링 된 가이드 rna 및 이의 용도
WO2022075813A1 (ko) Crispr/cas12f1 시스템 효율화를 위한 엔지니어링 된 가이드 rna 및 그 용도
WO2018088694A2 (ko) 인위적으로 조작된 sc 기능 조절 시스템
WO2018231018A2 (ko) 간에서 목적하는 단백질 발현하기 위한 플랫폼
WO2019066490A2 (ko) 유전자 발현 조절을 위한 인위적인 게놈 조작
WO2012115454A2 (ko) 뉴클레아제에 의해 유전자 변형된 세포를 농축시키는 방법
WO2018030874A1 (ko) 조작된 면역조절요소 및 이에 의해 변형된 면역 활성
WO2022220503A1 (ko) Crispr 시스템을 이용한 유전자 발현 조절 시스템
WO2022075808A1 (ko) Crispr/cas12f1 시스템 효율화를 위한 u-rich tail을 포함하는 엔지니어링 된 가이드 rna 및 그 용도
WO2023153845A2 (ko) 상동지정복구를 위한 target 시스템 및 이를 이용한 유전자 편집 방법
WO2023059115A1 (ko) 유전자 편집을 위한 target 시스템 및 이의 용도
WO2020218657A1 (ko) 표적 특이적 crispr 변이체
WO2022025623A1 (ko) 딥러닝을 이용한 프라임에디팅 효율 예측 시스템 및 방법
WO2022158898A1 (ko) Francisella novicida cas9 모듈 기반의 역전사 효소를 사용한 유전체 치환 및 삽입 기술
WO2020022803A1 (ko) 항응고 인자들의 유전자 에디팅
WO2018230976A1 (ko) 반복 확장 돌연변이에 대한 게놈 편집 시스템

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2018556336

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17789981

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017789981

Country of ref document: EP

Effective date: 20181128