WO2019177424A1 - 호흡기 질환의 예방 또는 치료용 생약 조성물 - Google Patents

호흡기 질환의 예방 또는 치료용 생약 조성물 Download PDF

Info

Publication number
WO2019177424A1
WO2019177424A1 PCT/KR2019/003056 KR2019003056W WO2019177424A1 WO 2019177424 A1 WO2019177424 A1 WO 2019177424A1 KR 2019003056 W KR2019003056 W KR 2019003056W WO 2019177424 A1 WO2019177424 A1 WO 2019177424A1
Authority
WO
WIPO (PCT)
Prior art keywords
extract
present
respiratory diseases
hours
herbal
Prior art date
Application number
PCT/KR2019/003056
Other languages
English (en)
French (fr)
Inventor
손미원
배민정
이원우
이두석
Original Assignee
주식회사 헬릭스미스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190028956A external-priority patent/KR102210566B1/ko
Application filed by 주식회사 헬릭스미스 filed Critical 주식회사 헬릭스미스
Priority to CN201980019847.5A priority Critical patent/CN112236158A/zh
Priority to EP19768358.4A priority patent/EP3766509A4/en
Priority to JP2020549806A priority patent/JP7255901B2/ja
Priority to US16/980,917 priority patent/US11541097B2/en
Publication of WO2019177424A1 publication Critical patent/WO2019177424A1/ko
Priority to JP2022128989A priority patent/JP2022163181A/ja
Priority to US18/148,130 priority patent/US20230218704A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/28—Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • A61K36/288—Taraxacum (dandelion)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/53—Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/894—Dioscoreaceae (Yam family)
    • A61K36/8945—Dioscorea, e.g. yam, Chinese yam or water yam
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/04—Drugs for disorders of the respiratory system for throat disorders

Definitions

  • the present invention relates to a herbal composition for the prevention or treatment of respiratory diseases, and in particular, a composition for the prevention, treatment or improvement of respiratory diseases, including extracts of dioscoreae Rhizoma, Taraxaci Herba and Schizonepetae Spica It is about.
  • Respiratory disease is a disease associated with the lungs and airways, and may be mainly caused by inhalation and aging of harmful particles due to a decrease in immunity, inflammatory action, infection of bacteria or viruses, fine dust, or smoking.
  • Representative respiratory diseases include pneumonia, rhinitis, asthma and bronchitis, tuberculosis, chronic obstructive pulmonary disease (COPD), and the like.
  • COPD chronic obstructive pulmonary disease
  • chronic obstructive pulmonary disease is also called emphysema and chronic bronchitis.
  • Therapeutic agents for these respiratory diseases are mainly developed to target anti-inflammatory action or airway expansion effect.
  • An example of a respiratory disease therapeutic agent showing an anti-inflammatory or airway expansion effect is glucocorticoid steroid drugs (glucocorticoid steroid drug), a beta-adrenoceptor agonist (beta 2 -adrenergic receptor agonist), wherein the leukotrienes (leukotriene receptor antagonist) and a phosphine Phosphodiesterase-4 inhibitors (PDE4 inhibitors).
  • these conventional respiratory disease therapies have been limited to the treatment of allergic asthma in infants or children and chronic obstructive pulmonary disease (COPD) in smokers.
  • COPD chronic obstructive pulmonary disease
  • the therapeutic agents are mostly for the purpose of alleviating symptoms, and there is a limit in that the progression of the disease may not be slowed or stopped by eliminating the intrinsic cause of respiratory diseases.
  • a conventional treatment using a single component since most of the respiratory diseases are caused by a combination of causes and symptoms, a conventional treatment using a single component, a single treatment mechanism is not suitable for treatment. Therefore, there is an urgent need for the development of new therapeutic agents for preventing and treating respiratory diseases in a more diversified and complex manner.
  • the present inventors earnestly researched to develop a respiratory disease therapeutic agent having a new therapeutic mechanism in order to overcome the limitations of the aforementioned conventional respiratory disease therapeutic agents.
  • the present inventors have found that the herbal extract, poongongyoung, complex herbal extract (mixture extract) has the effect of inhibiting inflammation, oxidative stress and aging action induced by fine dust as well as damage to lung tissue.
  • the invention was completed.
  • an object of the present invention is a mixed extract of the medicine (Dioscoreae Rhizoma), Pogongyoung (Taraxaci Herba) and mold (Schizonepetae Spica) as an active ingredient; And it provides a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a pharmaceutically acceptable carrier.
  • Another object of the present invention is to provide a food composition for preventing or improving respiratory diseases, including a mixed extract of Dioscoreae Rhizoma, Poxa (Taraxaci Herba), and Schizonepetae Spica as an active ingredient.
  • the present invention (a) as an active ingredient (Dioscoreae Rhizoma), Poongyoung (Taraxaci Herba) and the extract of (Schizonepetae Spica); And (b) provides a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a pharmaceutically acceptable carrier.
  • the medicine (Dioscoreae Rhizoma) is dried or steamed as a root stem (dough body) from which the cuticles of hemp (Dioscorea batatas Decaisne) or yam (Dioscorea japonica Thunberg) are removed.
  • the drug is native to China but is native or cultivated in Korea, Japan and Taiwan.
  • a potion is rhizome in columnar or uneven columnar form. Usually, the rhizome is taken in autumn, peeled off, and dried in the shade.
  • Taraxaci Herba is a Dandelion (Taraxacum platycarpum H. Dahlstedt), Dandelion (Taraxacum officinale Weber), Taraxac mongolicum Handel-Mazzetti, Taraxacum coreanum Nakai (Allgrass) It is indicated that consent is said to have a good effect on the detoxification, severance, swelling, undressing, and elimination.
  • Schizonepetae Spica is a flower band (flower ear, ⁇ ) of the mold (Schizonepeta tenuifolia Briquet).
  • the stem is flower ear, long and long barley ear, 5-10 cm long, purpleish greenish brown to greenish brown.
  • Schizonepetae Spica is known for its temper to be nontoxic and tasteless.
  • the extracts of the powder, pogongyoung, and mold of the invention used in the present invention can be obtained or obtained by extracting directly from the herbal medicine.
  • the extraction may be carried out after cutting or grinding each herbal medicine to an appropriate size.
  • the extract used in the composition of the present invention is obtained by extracting directly from the herbal medicine, poongongyoung, and the herbal medicine of the mold, various extraction solvents such as a polar solvent or a nonpolar solvent may be used.
  • Suitable polar solvents include (i) water, (ii) C1 to C6 lower alcohols (specifically methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2 Butoxyethanol or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO) and (v) dimethylsulfoxide (DMSO).
  • C1 to C6 lower alcohols specifically methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2 Butoxyethanol or ethylene glycol
  • acetic acid acetic acid
  • DMFO dimethyl-formamide
  • DMSO dimethylsulfoxide
  • Suitable as nonpolar solvents are acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1- Pentene, 1-chlorobutane, 1-chloropentane, o-xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl ether, diethyl sulfide, chloroform, dichloro Methane, 1,2-dichloroethane, anneal, diethylamine, ether, carbon tetrachloride and THF (Tetrahydrofuran).
  • the amount of the extraction solvent may vary depending on the amount of powder, poongongyoung and mold opening to be extracted, specifically, 1 to 20 times the volume, specifically 5 times to the weight of the powder, poongongyeong, mold opening or mixtures thereof. 15 times the volume, more specifically 5-12 times the volume or 7-12 times the volume. Most specifically, it is 10 times the weight of powder, pogongyoung, mold opening or mixtures thereof.
  • Extraction temperature of the extract of the present invention is not particularly limited, for example, may be 0 °C to 120 °C, specifically may be 15 °C to 95 °C. In one embodiment of the invention the extraction temperature of the present invention is room temperature.
  • Extraction time of the extract of the present invention is not particularly limited, and may be, for example, 1 hour to 10 days, specifically 1 hour to 72 hours, 1 hour to 48 hours, 1 hour to 36 hours, 1 hour to 24 hours. Time, 1 hour to 12 hours, 1 hour to 10 hours, 1 hour to 6 hours.
  • the extraction time is more specifically 2 hours to 72 hours, 2 hours to 48 hours, 2 hours to 36 hours, 2 hours to 24 hours, 2 hours to 12 hours, 2 hours to 10 hours, 2 hours to 6 hours, 3 hours to 72 hours, 3 hours to 48 hours, 3 hours to 36 hours, 3 hours to 24 hours, 3 hours to 12 hours, 3 hours to 10 hours, 5 hours to 48 hours, 5 hours to 36 hours, 5 hours To 24 hours, 5 hours to 12 hours, 5 hours to 10 hours, 6 hours to 12 hours, or 6 hours to 10 hours, most specifically 8 hours.
  • Extract of the present invention can be extracted by known natural product extraction method.
  • it can be extracted by cold extraction, hot water extraction, ultrasonic extraction, reflux cooling extraction, heating extraction method, specifically can be extracted by cold extraction method, 1 to 10 times, more specifically 2 to 7 times Can be extracted repeatedly.
  • the extract of the powder, pogongyoung and mold of the present invention can be extracted with an organic solvent, water, or a mixed solvent thereof.
  • the organic solvent includes C1 to C6 lower alcohols, petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, acetone, and the like.
  • the concentration of the organic solvent is 1 to 100% (v / v), specifically 10 to 100% (w / w), 20 to 100% (w / w), 30 to 100% (w / w), 40 to 100% (w / w), 50 to 100% (w / w), 60 to 100% (w / w), 70 to 100% (w / w), 80 to 100% (w / w), more specifically 10 to 90% (w / w), 10 to 80% (w / w), 10 to 70% (w / w), 10 to 60% (w / w), 10 to 50% (w / w), 10 to 40% (w / w), 10 to 30% (w / w), even more specifically 20 to 80% (w / w), 20 to 70% (w / w), 20 to 60% (w / w / / ), even more specifically 20 to 80% (w / w), 20 to 70% (w / w), 20 to 60% (w / w / / ), even more specifically 20 to
  • the extract, pogongyoung and mold extract of the present invention is extracted with water, C1 to C6 lower alcohol or a mixed solvent thereof, or extracted and concentrated (decompression)
  • the petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, acetone may be further extracted or fractionated with an organic solvent selected from the group consisting of.
  • the mixed extract of the extract of the powder, pogongyoung and molds used in the present invention can be prepared by mixing the individual extracts of powders, pogongyoung, and mold of each other, or by treating the extraction solvent to a mixture of powders, pogongyoung and mold of wild herbs It can also manufacture.
  • the extract of the powder, pogongyoung and hyeongjeong can use the crude extract form extracted by the solvent, can also be used to refine the high purity.
  • extracts of pomegranate, pogongyoung, and brother-in-law include not only those obtained by using the aforementioned extraction solvent, but also those obtained by additionally applying a purification process thereto.
  • the fraction obtained through the purification method is also included in the extract of the powder, pogongyoung and mold of the present invention.
  • the powder, pogongyoung and mold extract used in the present invention may be prepared in powder form by an additional process such as distillation under reduced pressure and freeze drying or spray drying.
  • Dioxcoreae Rhizoma, Taxaxa Herba, and Schizonepetae Spica are washed and dried, and then mixed at a predetermined weight ratio, respectively, after 1-20 times the weight of the mixture (g).
  • the solution was added to a volume (ml) of extraction solvent and then extracted with good stirring at 15-95 ° C. for 1-48 hours.
  • the extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a complex herbal extract (mixture extract) in powder form.
  • each extract was filtered, concentrated under reduced pressure at 50-65 ° C., and then lyophilized to obtain a crude herbal extract in powder form, and then, each herbal extract was mixed in a predetermined weight ratio to obtain a composite herbal extract in powder form (mixture extract). To obtain.
  • the weight of ethanol is added and extracted for 8 hours at room temperature.
  • the extract was concentrated under reduced pressure at 50-65 ° C., and the concentrated solution was lyophilized to obtain an extract of a compound herbal medicine, poongongyoung, and mold.
  • the three kinds of extracts of the powder, pogongyoung and hyunggong used in the present invention are extracts of the herbal medicine, pogongyoung and hyunggung, respectively, 1-10: 1-10: 1-10, 1: 1-10: 1-10, 1-10: 1-10: 1, 1: 1: 1-10, 1: 1-10: 1, or 1-10: 1: 1, or 1 -5: 1-5: 1-5, 1: 1-5: 1-5, 1-5: 1: 1: 1-5, 1-5: 1-5: 1-5: 1, 1: 1: 1-5, 1 : 1-5: 1, 1-5: 1, or 1-4: 1-4: 1-4, 1: 1-4: 1-4, 1-4: 1: 1- 4, 1-4: 1-4: 1, 1: 1: 1-4, 1: 1-4: 1, 1-4: 1: 1 or 1-3: 1-3: 1 -3, 1: 1-3: 1-3, 1-3: 1: 1-3, 1-3: 1-3: 1, 1: 1: 1-3, 1: 1-3: 1, 1: 1-3: 1,
  • the mixing ratio between the herbal ingredients described herein is calculated based on the weight of solids (in the case of a mixture of herbal extracts) from which the solvent is removed or the weight of the herbal medicine itself (in the case of extracts of the mixed herbal medicines).
  • the terms '-' or '-' described between two numerical values refer to the interval between the numerical values including the numerical values set forth before and after.
  • composition of the present invention may be prepared as a pharmaceutical composition.
  • the composition of the present invention (a) the above-mentioned mixed extract of powder, pogongyoung and mold of the active ingredient; And (b) a pharmaceutically acceptable carrier.
  • the term "pharmaceutically effective amount” means an amount sufficient to achieve the therapeutic or prophylactic efficacy of the above-mentioned mixed extract of pox, poongongyeong and mold of the respiratory tract well.
  • the present invention is a composition comprising extracts extracted from natural plant materials, such as powder, pogongyoung, and hyunghyeong, and there is no side effect to the human body even when administered in excess, so the upper limit of the amount of the extracts contained in the composition of the present invention is selected within the appropriate range by those skilled in the art Can be carried out.
  • the term “respiratory disease” includes but is not limited to colds, rhinitis, pharyngitis, laryngitis, pharyngitis, acute or chronic pneumonia, acute or chronic bronchitis, asthma, and chronic obstructive pulmonary disease. It doesn't happen.
  • administration of the powder, pogongyoung and hyunghap combined herbal extracts (mixture extracts) of the present invention has the effect of significantly reducing lung tissue damage in emphysema mouse models.
  • the complex herbal extract of the present invention significantly inhibits the generation of telomerase, which significantly inhibits the generation of free radicals, apoptosis, and aging of lung epithelial cell lines induced by fine dust, and extends the length of telomeres. Increase.
  • the complex herbal extract of the present invention exhibits excellent anti-inflammatory effect by inhibiting NO production of mouse macrophage lines treated with LPS.
  • the herbal extract of the present invention exhibits excellent anti-inflammatory effect by inhibiting the expression of inflammatory factors (IL-6, IL-1 ⁇ , iNOS) expressed in LPS-treated mouse macrophage lines.
  • inflammatory factors IL-6, IL-1 ⁇ , iNOS
  • the complex herbal extract of the present invention shows an excellent antioxidant effect by increasing the expression of the antioxidant factor HO-1 in the LPS-treated mouse macrophage line, even when the complex herbal extracts containing the herbal medicine at various ratios Increasing the expression of HO-1 shows excellent antioxidant effects in a range of herbal ratios.
  • the complex herbal extract of the present invention exhibits an excellent anti-inflammatory effect by inhibiting the expression of inflammatory factors (iNOS) even when extracted with various concentrations of the extraction solvent (ethanol), and even when the concentration and type of the extraction solvent are different.
  • iNOS inflammatory factors
  • the combined herbal extract of the present invention significantly inhibits the expression of inflammatory factors (IL-6, IL-1 ⁇ , TNF- ⁇ ) in the lung tissue of LPS-induced pulmonary inflammatory mouse model compared to the single herbal extract.
  • IL-6, IL-1 ⁇ , TNF- ⁇ inflammatory factors
  • it shows a synergistic effect in the anti-inflammatory effect compared to a single herbal extract.
  • the composition comprising the complex herbal extract of the present invention can be used for the prevention, improvement or treatment of respiratory diseases caused by inflammation and aging, such as pneumonia, bronchitis, chronic obstructive pulmonary disease, asthma, conventional respiratory system It can be used as a substitute for the disease treatment agent.
  • respiratory diseases caused by inflammation and aging such as pneumonia, bronchitis, chronic obstructive pulmonary disease, asthma, conventional respiratory system It can be used as a substitute for the disease treatment agent.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is conventionally used in the preparation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mann
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration, intranasal administration, intramucosal administration, intradural administration, intraperitoneal administration It can be administered by administration, intraocular administration, or the like, specifically, orally.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and reaction sensitivity of the patient, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.001-1000 mg / kg.
  • the daily dosage of the pharmaceutical composition of the present invention is, for example, 0.1-1000 mg / kg, 0.1-900 mg / kg, 0.1-800 mg / kg, 0.1-700 mg / kg, 0.1-600 mg / kg, 0.1 -500 mg / kg, 0.1-400 mg / kg, 0.1-300 mg / kg, 0.1-200 mg / kg, 0.1-100 mg / kg, 0.1-50 mg / kg, 0.1-30 mg / kg, 0.1- 20 mg / kg, 0.1-10 mg / kg, 0.1-7 mg / kg, 0.1-5 mg / kg, 1-1000 mg / kg, 1-900 mg / kg, 1-800 mg / kg, 1-700 mg / kg, 1-600 mg / kg, 1-500 mg / kg, 1-400 mg / kg, 1-300 mg / kg, 1-200 mg / kg, 1-100 mg / kg, 1 -50 mg / kg, 1-30 mg / kg, 1-20 mg / kg, 1-10 mg / kg
  • the daily dosage of the pharmaceutical composition of the present invention is 100-900 mg / kg, 100-800 mg / kg, 100-700 mg / kg, 100-600 mg / kg, It can be 100-500 mg / kg, 100-400 mg / kg, 100-300 mg / kg, 100-200 mg / kg, 200-900 mg / kg, 200-800 mg / kg, 200-700 mg / kg, 200-600 mg / kg, 200-500 mg / kg, 200-400 mg / kg, 200-300 mg / kg, and 300-900 mg / kg, 300-800 mg / kg, 300-700 mg / kg, 300-600 mg / kg, 300-500 mg / kg, 300-400 mg / kg, 400-900 mg / kg, 400-800 mg / kg, 400-700 mg / kg, 400 -600 mg / kg, 400-500 mg / kg, more specifically 100 mg / kg, 200 mg / kg, 300 mg / kg, 400 mg / kg,
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • the pharmaceutical composition of the present invention can be administered in parallel with known compounds or pharmaceutical compositions having the effect of preventing and treating respiratory diseases or symptoms associated with respiratory diseases.
  • the present invention provides a food composition for the prevention or improvement of respiratory diseases comprising a mixed extract of Dioscoreae Rhizoma, Taraxaci Herba and Schizonepetae Spica as an active ingredient.
  • the food composition may be used as a health functional food or added to various foods.
  • the present invention also provides a health functional food comprising the food composition.
  • the health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, ice cream, alcoholic beverages, vitamin complexes or health supplements.
  • the content of the mixed extract of the present invention contained in the food composition may be appropriately adjusted according to the form of the food, the desired use, and the like, and there is no particular limitation.
  • the content of the mixed extract may be 0.001 to 30% by weight or 0.01 to 20% by weight of the total food weight, 0.001 to 15 g, 0.02 to 10 g, or 0.3 to 1 based on 100 ml for the health beverage composition g, but is not limited thereto.
  • composition comprising a mixed extract of the present invention (Dioscoreae Rhizoma), Poongayoung (Taraxaci Herba) and Schizonepetae Spica is prepared as a food composition, as well as the extract as an active ingredient, it is usually added during food preparation It may include a component to be.
  • additive ingredients include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents.
  • Examples of the above carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And sugars such as conventional sugars such as polysaccharides such as dextrin, cyclodextrin and the like and xylitol, sorbitol, erythritol.
  • As the flavoring agent natural flavoring agents [tauumatin, stevia extract (for example rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.
  • citric acid liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, tofu extract, jujube extract, licorice extract, and the like may be further included.
  • citric acid liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, tofu extract, jujube extract, licorice extract, and the like may be further included.
  • Food composition for preventing or ameliorating respiratory diseases of the present invention is the same as the above-mentioned "pharmaceutical composition for the prevention or treatment of respiratory diseases" because it contains a mixed extract of powder, poongongyeong and molds as an active ingredient, common matter between the two inventions Omit the description in order to avoid excessive redundancy of the present specification.
  • the present invention provides a method for treating a respiratory disease comprising administering to a subject a pharmaceutical composition comprising the above-mentioned mixed extract of the powder, poongongyeong and mold of the present invention as an active ingredient.
  • a pharmaceutical composition comprising the above-mentioned mixed extract of the powder, poongongyeong and mold of the present invention as an active ingredient.
  • the present invention is a respiratory disease comprising administering to the subject a food composition comprising the above-mentioned mixed extract of the powder, poongongyeong and mold of the present invention as an active ingredient Provide prevention or improvement.
  • the respiratory disease which is a target disease of the treatment method or improvement method of the present invention is as defined in relation to the respiratory disease which is a disease to be treated of the pharmaceutical composition.
  • administer refers to the formation of the same amount in a subject's body by directly administering a therapeutically or improved effective amount of a composition of the invention to a subject (an individual) suffering from respiratory disease. Say what you can.
  • a “therapeutically effective amount” of the composition means a content of the composition sufficient to provide a therapeutic or prophylactic effect to a subject to which the composition is to be administered, and means to include a “prophylactically effective amount”.
  • the term "subject” is a mammal, including humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons and rhesus monkeys. Most specifically, the subject of the present invention is a human.
  • the method for preventing, improving or treating the respiratory disease of the present invention is a method comprising administering a pharmaceutical composition for preventing or treating a respiratory disease, or a food composition for preventing or improving the respiratory disease, which is an aspect of the present invention.
  • the description is omitted in order to avoid excessive redundancy of the present specification.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of respiratory diseases, including a mixed extract of powder, poongongyoung, and mold of the respiratory disease and a food composition for the prevention or improvement of respiratory diseases.
  • composition comprising the mixed extract of the powder, pogongyoung and mold of the present invention has the effect of preventing and improving the symptoms of respiratory diseases, as well as recovering damage to lung tissue as well as inflammation and oxidation induced by fine dust Efficacy in inhibiting red stress and aging.
  • the composition of the present invention is expected to be able to fundamentally treat degenerative respiratory diseases induced by fine dust, unlike conventional symptomatic agents, by increasing the expression of telomerase that extends the length of telomeres.
  • Figure 1 is a diagram showing the microscopic observation of the lung tissue of the PPE-induced emphysema mouse model to confirm the effect of inhibiting lung tissue damage of the complex herbal extract of the present invention.
  • Figure 2 is a graph showing the comparison of the degree of active oxygen production of lung epithelial cell line induced by fine dust in order to confirm the inhibitory effect on the production of reactive oxygen species (ROS) of the complex herbal extract of the present invention.
  • ROS reactive oxygen species
  • Figure 3 compares the cell survival rate (100, 200, 400, 800 ⁇ g / ml) by the treatment concentration of the composite herbal extracts of the lung epithelial cell line treated with fine dust in order to confirm the cell death inhibition efficacy of the composite herbal extracts of the present invention It is a graph shown.
  • Figure 4 is a diagram showing the results of senescence beta-galactosidase staining after treating the fine dust in the lung epithelial cell line to confirm the anti-aging efficacy of the complex herbal extract of the present invention.
  • FIG. 5 is a diagram showing the degree of telomerase expression according to the complex herbal extract treatment concentration (100, 200 ⁇ g / ml) of the lung epithelial cell line treatment concentration in order to confirm the anti-aging efficacy of the complex herbal extract of the present invention by Western blot.
  • Figure 6 shows the degree of NO (Nitric Oxide) generation of mouse macrophage line treated with LPS to determine the anti-inflammatory efficacy of the complex herbal extract of the present invention by the treatment concentration of the complex herbal extract (0.5, 1, 2, 4 mg / graph shown in ml).
  • Figures 7a to 7c is a combination herbal of the present invention for the expression of inflammatory factors (IL-6, IL-1 ⁇ , and iNOS) of the mouse macrophage line treated with LPS to confirm the anti-inflammatory efficacy of the complex herbal extract of the present invention It is a graph showing the inhibitory effect of the extract.
  • inflammatory factors IL-6, IL-1 ⁇ , and iNOS
  • HO-1 an antioxidant factor
  • LPS LPS
  • Figure 9 is a graph showing the comparison of the expression of the antioxidant factor HO-1 in various herbal ratios in the LPS-treated mouse macrophage line to confirm the antioxidant efficacy according to the mixed ratio of the herbal extracts of the present invention.
  • Figure 10 Expression of inflammatory factor (iNOS) in the mouse macrophage line treated with LPS to determine the anti-inflammatory and antioxidant efficacy according to the extraction method (hot water extraction) and the concentration of the extraction solvent (ethanol) of the complex herbal extract of the present invention Amount and the expression amount of HO-1, which is an antioxidant factor, are compared by the extraction method (hot water extraction, 0%) and the concentration of the extraction solvent (ethanol) (25, 50, 70, 90%).
  • iNOS inflammatory factor
  • 11a to 11c is a inflammatory factor (IL) according to the treatment of single herbal extracts (acid powder, poongongyeong, mold opening) and complex herbal extracts in LPS-induced pulmonary inflammation mouse model to confirm the pulmonary inflammation inhibitory effect of single and complex herbal extracts -1 ⁇ , IL-6 and TNF- ⁇ ) is a graph showing the comparison of the expression level.
  • IL inflammatory factor
  • % used to indicate the concentration of a particular substance is (weight / weight)% solids / solids, (weight / volume)%, unless otherwise indicated, and Liquid / liquid is (volume / volume)%.
  • Washed and dried powder (Dioscoreae Rhizoma), Taraxaci Herba and Schizonepetae Spica were used in the experiment.
  • the acid powder, pogongyoung, hyeonghyeong herbal medicines were mixed in a weight ratio of 1: 1: 1 to a total of 60 g, and then extracted with 10 times 25% (v / v) ethanol aqueous solution and stirred well at room temperature for 8 hours.
  • the extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a composite herbal extract (mixture extract) in powder form.
  • the yield was about 12-13%.
  • Washed and dried powder (Dioscoreae Rhizoma), Taraxaci Herba and Schizonepetae Spica were used in the experiment. After mixing the acid, poongyoung, hyunggeung herbal medicine in a weight ratio (w / w) shown in Table 1 to 30g in total, 10 times of 25% (v / v) ethanol solution was added and stirred well for 8 hours at room temperature Extracted. The extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a total of seven kinds of complex herbal extract powders, the yields of which are shown in Table 1.
  • Preparation Example 3 Preparation of Complex Herbal Extracts (Mixed Extracts) by Various Extraction Solvents (Ethanol) Concentrations Washed and dried powders (Dioscoreae Rhizoma), Taraxacic Herba, and Schizonepetae Spica were used in the experiment.
  • the medicines, poongongyoung and hyunggeung herbal medicines were mixed to a total of 30 g in the weight ratio (w / w) of Preparation Example 2-1, and then 10 times 25, 50, 70, 90% ethanol was added thereto for 8 hours at room temperature. The mixture was stirred well.
  • the extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a total of four kinds of complex herbal extract powders, the yields of which are shown in Table 2.
  • Preparation Example 4 Preparation of complex herbal extract (mixture extract) through hot water extraction Washed and dried powder (Dioscoreae Rhizoma), Taraxaci Herba, and Schizonepetae Spica were used in the experiment.
  • the acid, pogongyoung, hyeongjeung herbal medicines were mixed to a total of 30 g in the weight ratio (w / w) of Preparation Example 2-1, and 10 times distilled water was added to reflux extraction for 3 hours at a temperature of 90 °C.
  • the extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a composite herbal extract powder, the yield of which was about 13.30%.
  • Washed and dried powder (Dioscoreae Rhizoma), Taraxaci Herba and Schizonepetae Spica were used in the experiment.
  • a 10-fold 25% (v / v) ethanol aqueous solution was added to 30 g of the herbal medicines, pogongyoung, and each type of herbal medicines, and extracted with stirring at room temperature for 8 hours.
  • the extract was filtered, concentrated under reduced pressure at 50-65 ° C., and lyophilized to obtain a total of three kinds of single herbal extract powders, the yields of which are shown in Table 3.
  • mice After 7-week-old male C57BL / 6 mice (Raonbio, Korea) were bred for at least one week, (1) normal group, (2) emphysema induction and complex herbal extract administration group (experimental group) (3) emphysema induction and distilled water administration group (negative Control group).
  • 1U of porcine pancreatic elastase PPE, Millipore, USA was administered in a single intratracheal drop of the mouse.
  • PBS phosphate buffered saline
  • mice were anesthetized with carbon dioxide to extract lung tissue.
  • the extracted lung tissues were fixed in formalin and subjected to H & E staining (hematoxylin and eosin staining).
  • H & E staining hematoxylin and eosin staining
  • the herbal extract of the present invention was confirmed to exhibit the effect of inhibiting damage to lung tissue in emphysema mouse model.
  • Human lung epithelial cell line NCI-H292 cells (ATCC, USA) using 37%, 5% CO 2 incubator using RPMI medium (Corning, USA) containing 10% fetal bovine serum (FBS) Incubated at.
  • the cells were prepared in 96 well-black plates at 1 ⁇ 10 4 cells per well and stabilized for 24 hours. After stabilization, the supernatant of the cells was removed and the complex herbal extract of Preparation Example 1 was treated at a concentration of 100 ⁇ g / mL and incubated for 1 hour. Next, the cells were further treated with 200 ⁇ g / mL of particulate matter (PM10) (NIST, USA) (experimental group). Normal group was not treated with both complex herbal extracts and fine dust, negative control group was treated only fine dust. After 3 hours, the production of free radicals in the cells was confirmed using DCF-DA analysis (Sigma Aldrich, USA).
  • the fine dust induction group (negative control group) increased about 125% free radicals compared to the normal group, which was inhibited by about 61% by the composite herbal extract. Therefore, the herbal extract of the present invention was found to exhibit an excellent antioxidant effect.
  • NCI-H292 cells were prepared and stabilized in 96-well plates at 1 ⁇ 10 4 cells per well. After 24 hours, the supernatant of the cells was removed and the complex herbal extract of Preparation Example 1 was treated at concentrations of 100, 200, 400, and 800 ⁇ g / mL, respectively. After 1 hour, 50 ⁇ g / mL of fine dust (PM10) was further treated with the cells. Normal group was not treated with both complex herbal extracts and fine dust, negative control group was treated only fine dust. After 24 hours, the survival rate of the cells was confirmed by the WST-1 assay (Young Infrontier, Korea).
  • NCI-H292 cells were prepared and stabilized in 96 well-plates at 1 ⁇ 10 4 cells per well. After 24 hours, the supernatant of the cells was removed and the complex herbal extract of Preparation Example 1 was treated at a concentration of 200 ⁇ g / ml. After 1 hour, the cells were further treated with 50 ⁇ g / mL of fine dust (PM10). Normal group was not treated with both complex herbal extracts and fine dust, negative control group was treated only fine dust. After 5 days, the cells were fixed in formalin and then senescence of the cells was confirmed by ⁇ -galactosidase staining.
  • the herbal extract of the present invention was found to exhibit excellent anti-aging effect.
  • NCI-H292 cells were prepared and stabilized in 100 phi plates with 1 ⁇ 10 6 cells. After 24 hours, the cells were treated with the composite herbal extract of Preparation Example 1 at concentrations of 100 and 200 ⁇ g / ml. After 24 hours, the cells were harvested, proteins were extracted, and Western blot experiments were performed using an antibody of human telomerase reverse transcriptase (hTERT) (ab32020, Abcam, USA), which is a catalytic subunit of telomerase.
  • hTERT human telomerase reverse transcriptase
  • Raw264.7 cells (ATCC, USA), a macrophage of mice, were cultured in a 37 ° C. 5% CO 2 incubator using RPMI medium (Invitrogen, USA) containing 10% FBS.
  • the cells were prepared and stabilized in 24 well-plates at 2.5 ⁇ 10 5 cell numbers per well. After 24 hours, the supernatant of the cells was removed, and the complex herbal extract of Preparation Example 1 was treated with the cells at concentrations of 0.5, 1, 2, and 4 mg / mL. After 1 hour LPS 100 ng / mL was further treated with the cells. After 24 hours, the supernatants of the cells were collected and subjected to a Greases test to measure the change in NO production, NaNO 2 NO concentration was calculated using a standard curve for each concentration of (Sodium Nitrite) (FIG. 6).
  • the treatment of LPS increased the production of inflammatory factor NO in macrophages to 12 ⁇ M level (negative control).
  • the concentrations of NO were 13.6, 9.4, 3.6, and 3 ⁇ M, respectively, indicating a concentration-dependent decrease. Therefore, the herbal extract of the present invention was found to exhibit excellent anti-inflammatory efficacy.
  • Raw264.7 cells (ATCC, USA), a macrophage of mice, were cultured in a 37 ° C. 5% CO 2 incubator using RPMI medium (Invitrogen, USA) containing 10% FBS.
  • the cells were prepared and stabilized in 24 well-plates at 2.5 ⁇ 10 5 cell numbers per well. After 24 hours, the supernatant of the cells was removed and the cells were treated with 100 ng / mL LPS (Sigma, US) and the herbal extract of Preparation Example 1 at concentrations of 0.5, 1, and 2 mg / mL. After 24 hours, the supernatant of the cells was removed and RNA was isolated from the cells using TRIzol (Invitrogen, USA).
  • RNA obtained by performing RT-PCR was used to perform qPCR using a primer specific for IL-6, IL-1 ⁇ , and iNOS inflammatory factors and a SYBR green probe (Takara, Japan).
  • the expression change value of RNA obtained from qPCR was expressed as a relative change amount compared to the untreated group using GAPDH mRNA as a standard gene (FIGS. 7A to 7C). Primer sequences for the mouse genes used in the tests are shown in Table 4.
  • the production of inflammatory factors IL-6, IL-1 ⁇ , and iNOS in Raw264.7 macrophages was significantly increased by treatment with LPS (negative control), prepared with LPS treatment.
  • LPS negative control
  • the expression levels of IL-6, IL-1 ⁇ , and iNOS were all significantly dependent on the concentration. Therefore, the three complex herbal extracts of the present invention was found to exhibit excellent anti-inflammatory efficacy.
  • the expression level of HO-1 showed a significant increase in concentration-dependently. Therefore, the herbal extract of the present invention was found to exhibit excellent antioxidant efficacy.
  • the composite herbal extract according to the concentration of the extraction solvent (ethanol) prepared in Preparation Example 3 was found to significantly reduce the expression of iNOS increased by LPS treatment, showing excellent anti-inflammatory efficacy.
  • both the herbal extracts of Preparation Example 3 and Preparation Example 4 showed a significant increase in the amount of antioxidant expression of HO-1 exhibited excellent antioxidant efficacy.
  • mice Male C57BL / 6 mice (Raonbio, Korea) were bred for at least one week, (1) normal group, (2) LPS induction and distilled water administration group (negative control group), (3) ⁇ (5) LPS induction and Single herbal extract administration group, (6) LPS induction and complex herbal extract administration group.
  • Induction of acute pulmonary inflammatory response in the experimental group and negative control group was performed by a single instillation of 50 ⁇ g of LPS (Sigma, US) dissolved in 50 ⁇ l of PBS (phosphate buffered saline) 24 hours before the end of the experiment.
  • PBS phosphate buffered saline
  • mice were sacrificed with carbon dioxide, lung tissues were isolated and RNA was extracted using TRIzol (Invitrogen, USA). Thereafter, the cDNA obtained by RT-PCR was used to perform qPCR using primers specific to the inflammatory factors IL-1 ⁇ , IL-6 and TNF- ⁇ and SYBR green probes (Takara, Japan). The expression change value of RNA obtained from qPCR was expressed as a relative change amount compared to the untreated group using GAPDH mRNA as a standard gene. Primer sequences for the mouse genes used in the tests are shown in Table 6.
  • FIGS. 11A to 11C expression of inflammatory factors IL-1 ⁇ , IL-6 and TNF- ⁇ in lung tissues was increased by LPS.
  • the expression of inflammatory factors was similar to that of the negative control group.
  • the herbal extract showed a synergistic effect on anti-inflammatory efficacy by reducing the expression of inflammatory factors to a significant level compared to the negative control group.

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Pulmonology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Otolaryngology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 및 형개(Schizonepetae Spica)의 혼합추출물을 유효성분으로 포함하는 호흡기 질환의 예방 또는 치료용 약제학적 조성물 및 호흡기 질환의 예방 또는 개선용 식품 조성물에 관한 것이다. 본 발명의 산약, 포공영 및 형개의 혼합추출물을 포함하는 조성물은 호흡기 질환의 예방 및 증상을 개선하는 효과가 있고, 폐조직의 손상을 회복할 뿐만 아니라 미세먼지에 의해 유도되는 염증, 산화적 스트레스 및 노화반응을 억제하는 효능이 있다. 특히 본 발명의 조성물은 텔로미어의 길이를 연장하는 텔로머레이즈의 발현을 증가시킴으로써 종래의 증상 완화제와 달리 미세먼지에 의해 유도되는 퇴행성 호흡기 질환을 근본적으로 치료할 수 있을 것으로 기대된다.

Description

호흡기 질환의 예방 또는 치료용 생약 조성물
본 특허출원은 2018년 3월 16일에 대한민국 특허청에 제출된 대한민국 특허 출원 제10-2018-0031150호 및 2019년 3월 13일에 대한민국 특허청에 제출된 대한민국 특허 출원 제10-2019-0028956호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 호흡기 질환의 예방 또는 치료용 생약 조성물에 관한 것으로, 구체적으로 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 추출물을 포함하는 호흡기 질환의 예방, 치료 또는 개선용 조성물에 관한 것이다.
호흡기 질환은 폐 및 기도와 관련된 질환으로, 주로 면역력 저하, 염증 작용, 세균이나 바이러스의 감염, 미세먼지 또는 흡연 등으로 인한 유해입자의 흡입 및 노화 등의 원인으로 발생할 수 있다. 대표적인 호흡기 질환은 폐렴(pneumonia), 비염, 천식(asthma) 및 기관지염(bronchitis), 결핵(tuberculosis), 만성폐쇄성폐질환(chronic obstructive pulmonary disease, COPD) 등을 포함한다. 특히 최근에는 미세먼지의 증가 및 흡연 등으로 인한 만성폐쇄성폐질환 환자가 증가하고 있는추세이다. 만성폐쇄성폐질환은 폐기종(emphysema)과 만성기관지염(chronic bronchitis)으로 불리우기도 한다.
이러한 호흡기 질환의 치료제는 주로 항염증 작용이나 기도 확장 효과를 타깃으로 개발되고 있다. 항염증 또는 기도 확장 효과를 나타내는 호흡기 질환 치료제의 예로는 당질코르티코이드 스테로이드 약물(glucocorticoid steroid drug), 베타2-아드레날린 수용체 효능제(beta2-adrenergic receptor agonist), 항류코트리엔제(leukotriene receptor antagonist) 및 포스포디에스테라아제-4 억제제(phosphodiesterase-4 inhibitor, PDE4 inhibitor) 등이 있다. 그러나 이러한 기존의 호흡기 질환 치료제들은 치료목적이 유아 또는 소아 대상의 알레르기성 천식 및 흡연자 대상의 만성폐쇄성폐질환(COPD)에 한정되어져 있었다. 또한 상기 치료제들은 대부분 증상의 완화만을 목적으로 하며, 호흡기 질환의 본질적인 원인을 제거하여 병의 진행을 늦추거나 멈추지 못하는 한계가 있었다. 또한 대다수의 호흡기 질환은 그 원인과 증상이 복합적으로 나타나므로 단일 성분, 단일 치료기전을 이용한 종래의 치료제로는 적합한 치료가 불가능한 실정이다. 따라서, 보다 다각적이면서 복합적으로 호흡기 질환을 예방 및 치료하기 위한 새로운 치료제의 개발이 절실히 요구되고 있다.
[선행기술문헌]
[특허문헌]
1. 대한민국 특허공개공보 제10-2017-0115852호
2. 대한민국 특허등록공보 제10-1569876호
본 발명자들은 상술한 종래의 호흡기 질환 치료제의 한계점을 극복하기 위하여 새로운 치료기전을 가진 호흡기 질환 치료제를 개발하고자 예의 연구 노력하였다. 그 결과 본 발명자들은 산약, 포공영, 형개의 복합 생약 추출물(혼합추출물)이 폐 조직의 손상뿐만 아니라, 미세먼지에 의해 유도되는 염증, 산화적 스트레스 및 노화 작용을 억제하는 효능이 있음을 확인함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 유효성분으로 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물; 및 약제학적으로 허용되는 담체를 포함하는 호흡기 질환의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물을 유효성분으로 포함하는 호흡기 질환의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 (a) 유효성분으로 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물; 및 (b) 약제학적으로 허용되는 담체를 포함하는 호흡기 질환의 예방 또는 치료용 약제학적 조성물을 제공한다.
본 명세서에서 산약(Dioscoreae Rhizoma)은 마(Dioscorea batatas Decaisne) 또는 참마(Dioscorea japonica Thunberg)의 주피를 제거한 뿌리줄기(담근체)로서 그대로 또는 쪄서 말린 것이다. 이 약의 원료는 중국이 원산지이지만 한국, 일본, 대만에서도 자생하거나 재배되고 있다. 산약은 뿌리 줄기로 원주형 또는 고르지 않은 원주형이다. 보통 뿌리 줄기를 가을에 채취하여 겉껍질을 벗긴 후 그늘에서 말려 사용한다.
본 명세서에서 포공영(Taraxaci Herba)은 민들레(Taraxacum platycarpum H. Dahlstedt), 서양민들레(Taraxacum officinale Weber), 털민들레(Taraxacum mongolicum Handel-Mazzetti), 흰민들레(Taraxacum coreanum Nakai)의 전초(全草)를 가리키는 것으로, 동의보감에는 열독을 풀고 악창을 삭히며 멍울을 헤치고 식독을 풀며 체기를 없애는데 좋은 효과를 나타낸다고 기재되어 있다.
본 명세서에서 형개(Schizonepetae Spica)는 형개(Schizonepeta tenuifolia Briquet)의 꽃대(꽃 이삭, 花穗)이다. 형개는 꽃이삭으로 가늘고 긴 보리이삭 모양이고 길이 5-10 cm이며 보라색을 띤 녹갈색에서 녹갈색이다. 작은 순형화(脣形花)와 때로는 열매를 가지는 꽃받침 통이 붙어 있다. 또한 전주(全株)에 유백색의 짧은 털을 볼 수 있다. 형개(Schizonepetae Spica)는 성미는 성온 무독(無毒)하고 신미(辛味)하다고 알려져 있다.
본 발명에서 이용되는 상기 산약, 포공영, 및 형개의 추출물은 구입하거나 또는 생약으로부터 직접 추출하여 얻을 수 있다. 상기 추출은 각각의 생약을 적절한 크기로 절단 또는 분쇄한 후 수행될 수 있다.
본 발명의 조성물에서 이용되는 상기 추출물을 산약, 포공영, 및 형개의 생약으로부터 직접 추출하여 얻는 경우에는, 극성 용매 또는 비극성 용매와 같은 다양한 추출용매가 이용될 수 있다.
극성 용매로서 적합한 것은, (i) 물, (ii) C1 내지 C6의 저급 알코올(구체적으로는 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올, 노말-부탄올, 1-펜탄올, 2-부톡시에탄올 또는 에틸렌글리콜), (iii) 아세트산, (iv) DMFO(dimethyl-formamide) 및 (v) DMSO(dimethylsulfoxide)를 포함한다. 비극성 용매로서 적합한 것은, 아세톤, 아세토나이트릴, 에틸 아세테이트, 메틸 아세테이트, 플루오로알칸, 펜탄, 헥산, 2,2,4-트리메틸펜탄, 데칸, 사이클로헥산, 사이클로펜탄, 디이소부틸렌, 1-펜텐, 1-클로로부탄, 1-클로로펜탄, o-자일렌, 디이소프로필 에테르, 2-클로로프로판, 톨루엔, 1-클로로프로판, 클로로벤젠, 벤젠, 디에틸 에테르, 디에틸 설파이드, 클로로포름, 디클로로메탄, 1,2-디클로로에탄, 어닐린, 디에틸아민, 에테르, 사염화탄소 및 THF(Tetrahydrofuran)를 포함한다.
상기 추출용매의 양은 추출하고자 하는 산약, 포공영 및 형개의 양에 따라 달라질 수 있으며, 구체적으로는 산약, 포공영, 형개 또는 이들의 혼합물의 중량의 1배 내지 20배의 부피, 구체적으로는 5배 내지 15배의 부피, 보다 구체적으로는 5배 내지 12배의 부피 또는 7배 내지 12배의 부피일 수 있다. 가장 구체적으로는 산약, 포공영, 형개 또는 이들의 혼합물 중량의 10배 부피이다.
본 발명의 추출물의 추출온도는 특별히 제한되지 아니하고, 예를 들어 0℃ 내지 120℃일 수 있으며, 구체적으로는 15℃ 내지 95℃일 수 있다. 본 발명의 일 구현예에서 본 발명의 추출온도는 상온이다.
본 발명의 추출물의 추출시간은 특별히 제한되지 아니하며, 예를 들어 1시간 내지 10일 일 수 있으며, 구체적으로는 1시간 내지 72시간, 1시간 내지 48시간, 1시간 내지 36시간, 1시간 내지 24시간, 1시간 내지 12시간, 1시간 내지 10시간, 1시간 내지 6시간일 수 있다. 상기 추출시간은 보다 구체적으로는 2시간 내지 72시간, 2시간 내지 48시간, 2시간 내지 36시간, 2시간 내지 24시간, 2시간 내지 12시간, 2시간 내지 10시간, 2시간 내지 6시간, 3시간 내지 72시간, 3시간 내지 48시간, 3시간 내지 36시간, 3시간 내지 24시간, 3시간 내지 12시간, 3시간 내지 10시간, 5시간 내지 48시간, 5시간 내지 36시간, 5시간 내지 24시간, 5시간 내지 12시간, 5시간 내지 10시간, 6시간 내지 12시간, 또는 6시간 내지 10시간일 수 있으며, 가장 구체적으로는 8시간이다.
본 발명의 추출물은 공지의 천연물 추출법으로 추출될 수 있다. 예를 들어 냉침추출, 열수추출, 초음파 추출, 환류냉각 추출, 가열 추출법으로 추출할 수 있고, 구체적으로는 냉침추출법으로 추출할 수 있으며, 1회 내지 10회, 보다 구체적으로는 2회 내지 7회 반복 추출할 수 있다.
본 발명의 일 구현예에 따르면, 본 발명에서 이용되는 산약, 포공영 및 형개의 추출물은 유기용매, 물, 또는 이들의 혼합용매로 추출이 가능하다. 상기 유기용매에는 C1 내지 C6의 저급 알코올, 석유 에테르, 헥산, 벤젠, 클로로포름, 메틸렌클로라이드, 에테르, 에틸아세테이트, 및 아세톤 등이 있다.
상기 C1 내지 C6의 저급 알코올, 석유 에테르, 헥산, 벤젠, 클로로포름, 메틸렌클로라이드, 에테르, 에틸아세테이트, 및 아세톤 등 유기용매의 농도는 1 내지 100%(v/v), 구체적으로는 10 내지 100%(w/w), 20 내지 100%(w/w), 30 내지 100%(w/w), 40 내지 100%(w/w), 50 내지 100%(w/w), 60 내지 100%(w/w), 70 내지 100%(w/w), 80 내지 100%(w/w)일 수 있고, 보다 구체적으로는 10 내지 90%(w/w), 10 내지 80%(w/w), 10 내지 70%(w/w), 10 내지 60%(w/w), 10 내지 50%(w/w), 10 내지 40%(w/w), 10 내지 30%(w/w), 보다 더 구체적으로는 20 내지 80%(w/w), 20 내지 70%(w/w), 20 내지 60%(w/w), 20 내지 50%(w/w), 20 내지 40%(w/w), 20 내지 30%(w/w)일 수 있으며, 가장 구체적으로는 25%(w/w) 일 수 있으나 이에 제한되는 것은 아니다.
또한, 본 발명의 또 다른 일 구현예에 따르면, 본 발명의 상기 산약, 포공영 및 형개의 추출물은 상술한 물, C1 내지 C6의 저급 알코올 또는 이들의 혼합용매로 추출하거나, 추출 및 (감압)농축한 후 상술한 석유 에테르, 헥산, 벤젠, 클로로포름, 메틸렌클로라이드, 에테르, 에틸아세테이트, 아세톤으로 이루어진 군으로부터 선택된 유기용매로 추가 추출 또는 분획되어 제조될 수 있다.
한편, 본 발명에서 이용되는 산약, 포공영 및 형개의 추출물의 혼합추출물은 산약, 포공영, 및 형개의 개별 추출물을 서로 혼합하여 제조할 수 있고, 또는 산약, 포공영 및 형개 생약의 혼합물에 추출용매를 처리하여 제조할 수도 있다.
본 발명에서 산약, 포공영 및 형개의 추출물은 용매에 의해 추출된 조(crude)추출물 형태를 이용할 수 있으며, 고순도로 정제하여 사용할 수도 있다.
본 명세서에서 사용되는 용어 '추출물'은 상술한 바와 같이 당업계에서 조추출물(crude extract)로 통용되는 의미를 갖지만, 광의적으로는 추출물을 추가적으로 분획(fractionation)한 분획물도 포함한다. 즉, 산약, 포공영, 형개의 추출물은 상술한 추출용매를 이용하여 얻은 것뿐만 아니라, 여기에 정제과정을 추가적으로 적용하여 얻은 것도 포함한다. 예컨대, 상기 추출물을 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 얻은 분획, 다양한 크로마토그래피 (크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등, 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 분획도 본 발명의 산약, 포공영 및 형개의 추출물에 포함되는 것이다. 본 발명에서 이용되는 산약, 포공영 및 형개 추출물은 감압 증류 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조될 수 있다.
본 발명의 구체적인 구현예에 따르면, 상기 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)는 세척 및 건조된 후 각각 일정 중량비로 혼합한 뒤 혼합물 중량(g)의 1-20 배수 부피(ml)의 추출용매에 투입한 후 15-95℃에서 1-48시간 동안 잘 교반시키며 추출한다. 다음으로 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 분말 상태의 복합 생약 추출물(혼합추출물)을 수득한다.
본 발명의 다른 구현예에 따르면, 산약, 포공영, 형개를 각각 각 중량(g)의 1-20 배수 부피(ml)의 추출용매에 투입한 후 15-95℃에서 1-48시간 동안 잘 교반시키며 추출한다. 다음으로 각각의 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 분말 상태의 생약 추출물을 수득한 뒤, 각 생약 추출물을 일정 중량비로 혼합하여 분말 상태의 복합 생약 추출물(혼합추출물)을 수득한다.
본 발명의 특정 구현예에 따르면, 상기 산약, 포공영, 형개를 1:1:1의 중량비로 혼합한 후 중량의 10 배수의 에탄올을 투입한 후 상온에서 8시간 동안 추출한다. 추출액을 50-65℃에서 감압농축한 후, 농축액을 동결 건조하여 산약, 포공영, 형개의 복합 생약 추출물을 얻는다.
본 발명에서 이용되는 상기 산약, 포공영 및 형개의 3종 혼합추출물은 각각 산약, 포공영 및 형개의 생약 추출물을 1-10:1-10:1-10, 1:1-10:1-10, 1-10:1:1-10, 1-10:1-10:1, 1:1:1-10, 1:1-10:1, 또는 1-10:1:1의 중량비로 포함하거나, 1-5:1-5:1-5, 1:1-5:1-5, 1-5:1:1-5, 1-5:1-5:1, 1:1:1-5, 1:1-5:1, 1-5:1:1의 중량비로 포함하거나, 1-4:1-4:1-4, 1:1-4:1-4, 1-4:1:1-4, 1-4:1-4:1, 1:1:1-4, 1:1-4:1, 1-4:1:1의 중량비로 포함하거나, 1-3:1-3:1-3, 1:1-3:1-3, 1-3:1:1-3, 1-3:1-3:1, 1:1:1-3, 1:1-3:1, 1-3:1:1 또는 1:1:1의 중량비로 포함할 수 있다.
본 명세서에 기재된 상기 생약 성분 간의 혼합 비율은 용매가 제거된 고형분 중량(생약 추출물의 혼합물의 경우) 또는 생약 자체의 중량 (혼합 생약의 추출물의 경우)을 기준으로 산정된 것이다.
본 명세서에 사용된 바로서, 두 수치 사이에 기재된 용어 '내지' 또는 '-'는 앞뒤에 기재된 수치를 포함하는 상기 수치 사이 구간을 의미한다.
본 발명의 조성물은 약제학적 조성물로 제조될 수 있다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 조성물은 (a) 유효성분으로 상술한 산약, 포공영 및 형개의 혼합추출물; 및 (b) 약제학적으로 허용되는 담체를 포함하는 약제학적 조성물이다.
본 명세서에서 용어 "약제학적 유효량"은 상술한 산약, 포공영 및 형개의 혼합추출물의 호흡기 잘환의 치료 효능 또는 예방 효능을 달성하는 데 충분한 양을 의미한다. 본 발명은 천연식물재료인 산약, 포공영, 및 형개로부터 추출한 추출물을 포함하는 조성물로서 과량 투여하여도 인체에 부작용이 없으므로 본 발명의 조성물에 포함된 상기 추출물들의 양적 상한은 당업자가 적절한 범위 내에서 선택하여 실시할 수 있다.
본 명세서에서 용어 "호흡기 질환"은 감기, 비염, 인두염, 후두염, 인후두염, 급성 또는 만성 폐렴, 급성 또는 만성 기관지염, 천식, 및 만성폐쇄성폐질환으로 이루어진 군으로부터 선택되는 호흡기 질환을 포함하나, 이에 제한되는 것은 아니다.
하기의 실시예에서 입증된 바와 같이, 본 발명의 산약, 포공영 및 형개 복합 생약 추출물(혼합추출물)의 투여는 폐기종 마우스 모델에서 폐조직의 손상을 현저하게 감소시키는 효과를 나타낸다.
또한, 본 발명의 복합 생약 추출물은 미세먼지에 의해 유도된 폐 상피세포주의 활성산소 생성, 세포사멸, 및 노화를 현저하게 억제하고, 텔로미어의 길이를 연장시키는 텔로머레이즈의 발현정도를 농도 의존적으로 증가시킨다.
또한 본 발명의 복합 생약 추출물은 LPS를 처리한 마우스 대식세포주의 NO 생성을 억제하여 우수한 항염증 효과를 나타낸다.
또한 본 발명의 복합 생약 추출물은 LPS를 처리한 마우스 대식세포주가 발현하는 염증인자(IL-6, IL-1β, iNOS)의 발현을 억제하여 우수한 항염증 효과를 나타낸다.
또한 본 발명의 복합 생약 추출물은 LPS를 처리한 마우스 대식세포주에서 항산화 인자인 HO-1의 발현을 증가시켜 우수한 항산화 효과를 나타내며, 다양한 비율로 생약을 포함하는 복합 생약 추출물을 처리하였을 때에도 항산화 인자인 HO-1의 발현을 증가시켜 다양한 생약 비율 범위에서도 우수한 항산화 효과를 나타낸다.
또한, 본 발명의 복합 생약 추출물은 다양한 농도의 추출용매(에탄올)로 추출하였을 때에도 염증인자(iNOS)의 발현을 억제하여 우수한 항염증 효과를 나타내고, 추출용매의 농도 및 종류를 달리하는 경우에도 항산화 인자인 HO-1의 발현을 증가시켜 우수한 항산화 효과를 나타낸다.
뿐만 아니라, 본 발명의 복합 생약 추출물은 단일 생약 추출물과 비교하여 LPS로 유도한 폐염증 마우스 모델의 폐조직에서의 염증인자(IL-6, IL-1β, TNF-α)의 발현을 현저하게 억제하여, 단일 생약 추출물에 비하여 항염증 효과에 있어서 상승적 효과(synergistic effect)를 나타낸다.
위와 같은 실시예의 결과는 본 발명의 복합 생약 추출물을 포함하는 조성물이 폐렴, 기관지염, 만성폐쇄성폐질환, 천식과 같은 염증 및 노화에 따른 호흡기 질환의 예방, 개선 또는 치료에 이용될 수 있으며, 종래 호흡기 질환 치료제의 대체제로 이용될 수 있음을 나타내는 것이다.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함할 수 있다. 상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시 벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내 투여, 피하 투여, 피내 투여, 근육내 투여, 비강내 투여, 점막내 투여, 경막 내 투여, 복강내 투여, 안구내 투여 등으로 투여할 수 있으며, 구체적으로는 경구 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 구체적인 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.001-1000 ㎎/㎏이다. 상기 본 발명의 약제학적 조성물의 1일 투여량은 예컨대 0.1-1000 mg/kg, 0.1-900 mg/kg, 0.1-800 mg/kg, 0.1-700 mg/kg, 0.1-600 mg/kg, 0.1-500 mg/kg, 0.1-400 mg/kg, 0.1-300 mg/kg, 0.1-200 mg/kg, 0.1-100 mg/kg, 0.1-50 mg/kg, 0.1-30 mg/kg, 0.1-20 mg/kg, 0.1-10 mg/kg, 0.1-7 mg/kg, 0.1-5 mg/kg 일 수 있고, 1-1000 mg/kg, 1-900 mg/kg, 1-800 mg/kg, 1-700 mg/kg, 1-600 mg/kg, 1-500 mg/kg, 1-400 mg/kg, 1-300 mg/kg, 1-200 mg/kg, 1-100 mg/kg, 1-50 mg/kg, 1-30 mg/kg, 1-20 mg/kg, 1-10 mg/kg, 1-7 mg/kg, 1-5 mg/kg 일 수 있고, 보다 구체적으로는 1, 2, 3, 4, 5, 6, 7, 8, 9, 또는 10 mg/kg 일 수 있다. 또한 다른 일 구현예에 있어서, 상기 본 발명의 약제학적 조성물의 1일 투여량은 예컨대 100-900 mg/kg, 100-800 mg/kg , 100-700 mg/kg , 100-600 mg/kg, 100-500 mg/kg, 100-400 mg/kg, 100-300 mg/kg, 100-200 mg/kg 일 수 있고, 200-900 mg/kg, 200-800 mg/kg , 200-700 mg/kg , 200-600 mg/kg, 200-500 mg/kg, 200-400 mg/kg, 200-300 mg/kg 일 수 있고, 300-900 mg/kg, 300-800 mg/kg, 300-700 mg/kg , 300-600 mg/kg, 300-500 mg/kg, 300-400 mg/kg 일 수 있고, 400-900 mg/kg, 400-800 mg/kg , 400-700 mg/kg , 400-600 mg/kg, 400-500 mg/kg 일 수 있고, 보다 구체적으로는 100 mg/kg, 200 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 또는 1000 mg/kg 일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약제학적 조성물은 호흡기 질환 또는 호흡기 질환 관련 증상의 예방 및 치료의 효과를 가지는 공지의 화합물 또는 약제학적 조성물과 병행하여 투여할 수 있다.
본 발명의 다른 일 양태에 따르면, 본 발명은 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물을 유효성분으로 포함하는 호흡기 질환의 예방 또는 개선용 식품 조성물을 제공한다. 상기 식품 조성물은 건강기능 식품으로 이용하거나, 각종 식품에 첨가될 수 있다.
본 발명은 또한 상기 식품 조성물을 포함하는 건강기능 식품을 제공한다. 상기 건강기능 식품은 음료류, 육류, 초코렛, 식품류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류, 알코올 음료류, 비타민 복합제 또는 건강보조식품류일 수 있다.
상기 식품 조성물에 함유된 본 발명의 혼합추출물의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 조절될 수 있고 특별한 제한이 없다. 예컨대, 혼합추출물의 함량은 전체 식품 중량의 0.001 내지 30 중량% 또는 0.01 내지 20 중량%일 수 있고, 건강 음료 조성물의 경우 100 ml을 기준으로 0.001 내지 15 g, 0.02 내지 10 g, 또는 0.3 내지 1 g일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물을 포함하는 조성물이 식품 조성물로 제조되는 경우, 유효성분으로서 상기 추출물 뿐만 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있다. 상기 첨가 성분은 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연향미제 [타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진등)] 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 상기 추출물 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 두충 추출액, 대추 추출액, 감초 추출액 등을 추가로 포함시킬 수 있다.
본 발명의 호흡기 질환 예방 또는 개선용 식품 조성물은 상술한 "호흡기 질환의 예방 또는 치료용 약제학적 조성물"과 동일하게 유효성분으로서 산약, 포공영 및 형개의 혼합추출물을 포함하기 때문에, 양 발명 간에 공통된 사항은 본 명세서의 과도한 중복성을 피하기 위해 그 기재를 생략한다.
또한 본 발명의 또 다른 양태에 따르면, 본 발명은 상술한 본 발명의 산약, 포공영 및 형개의 혼합추출물을 유효성분으로 포함하는 약제학적 조성물을 대상체(subject)에 투여하는 단계를 포함하는 호흡기 질환의 예방 또는 치료 방법을 제공한다.
또한, 본 발명의 다른 일 양태에 따르면, 본 발명은 상술한 본 발명의 산약, 포공영 및 형개의 혼합추출물을 유효성분으로 포함하는 식품 조성물을 대상체(subject)에 투여하는 단계를 포함하는 호흡기 질환의 예방 또는 개선방법을 제공한다.
본 발명의 치료방법, 또는 개선방법의 대상 질병인 호흡기 질환은 상기 약제학적 조성물의 치료 대상 질병인 호흡기 질환과 관련하여 정의한 것과 같다.
본 명세서에서 사용된 용어, "투여" 또는 "투여하다"는 본 발명의 조성물의 치료적, 또는 개선적 유효량을 호흡기 질환을 겪는 대상체(개체)에 직접적으로 투여함으로써 대상체의 체내에서 동일한 양이 형성되도록 하는 것을 말한다.
상기 조성물의 "치료적 유효량"은 조성물을 투여하고자 하는 대상체에게 치료적 또는 예방적 효과를 제공하기에 충분한 조성물의 함량을 의미하며, 이에 "예방적 유효량"을 포함하는 의미이다. 또한, 본 명세서에서 사용된 용어, "대상체"는 인간, 마우스, 랫트, 기니아 피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 및 붉은털 원숭이 등을 포함하는 포유류이다. 가장 구체적으로는, 본 발명의 대상체는 인간이다.
본 발명의 상기 호흡기 질환의 예방, 개선 또는 치료방법은, 본 발명의 일 양태인 호흡기 질환의 예방 또는 치료용 약제학적 조성물, 또는 예방 또는 개선용 식품조성물을 투여하는 단계를 포함하는 방법이므로, 중복되는 내용에 대해서는 본 명세서의 과도한 중복성을 피하기 위하여 그 기재를 생략한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 산약, 포공영, 및 형개의 혼합추출물을 포함하는 호흡기 질환의 예방 또는 치료용 약제학적 조성물 및 호흡기 질환의 예방 또는 개선용 식품 조성물에 관한 것이다.
(b) 본 발명의 산약, 포공영 및 형개의 혼합 추출물을 포함하는 조성물은 호흡기 질환의 예방 및 증상을 개선하는 효과가 있고, 폐조직의 손상을 회복할 뿐만 아니라 미세먼지에 의해 유도되는 염증, 산화적 스트레스 및 노화 작용을 억제하는 효능이 있다. 특히 본 발명의 조성물은 텔로미어의 길이를 연장하는 텔로머레이즈의 발현을 증가시킴으로써 종래의 증상 완화제와 달리 미세먼지에 의해 유도되는 퇴행성 호흡기 질환을 근본적으로 치료할 수 있을 것으로 기대된다.
도 1은 본 발명의 복합 생약 추출물의 폐 조직 손상 억제 효과를 확인하기 위하여 PPE로 유도한 폐기종 마우스 모델의 폐 조직을 현미경으로 관찰하여 나타낸 도이다.
도 2는 본 발명의 복합 생약 추출물의 활성산소(reactive oxygen species, ROS) 생성에 대한 억제 효능을 확인하기 위하여 미세먼지에 의해 유도된 폐 상피세포주의 활성산소 생성 정도를 비교하여 나타낸 그래프이다.
도 3은 본 발명의 복합 생약 추출물의 세포 사멸 억제 효능을 확인하기 위하여 미세먼지를 처리한 폐 상피세포주의 복합 생약 추출물의 처리 농도별(100, 200, 400, 800 μg/ml) 세포생존율을 비교하여 나타낸 그래프이다.
도 4는 본 발명의 복합 생약 추출물의 항노화 효능을 확인하기 위하여 폐 상피세포주에 미세먼지를 처리한 후 β-갈락토시다제의 염색(senescence beta-galactosidase staining) 결과를 나타낸 도이다.
도 5는 본 발명의 복합 생약 추출물의 항노화 효능을 확인하기 위하여 폐 상피세포주의 복합 생약 추출물 처리 농도별(100, 200 μg/ml) 텔로머레이즈 발현 정도를 웨스턴 블롯으로 비교하여 나타낸 도이다.
도 6은 본 발명의 복합 생약 추출물의 항염증 효능을 확인하기 위하여 LPS를 처리한 마우스 대식세포주의 NO(Nitric Oxide) 생성 정도를 복합 생약 추출물의 처리 농도별(0.5, 1, 2, 4 mg/ml)로 비교하여 나타낸 그래프이다.
도 7a 내지 도 7c는 본 발명의 복합 생약 추출물의 항염증 효능을 확인하기 위하여 LPS를 처리한 마우스 대식세포주의 염증인자(IL-6, IL-1β, 및 iNOS) 발현에대한 본 발명의 복합 생약 추출물의 발현 억제 효과를 나타낸 그래프이다.
도 8은 본 발명의 복합 생약 추출물의 항산화 효능을 확인하기 위하여 LPS를 처리한 마우스 대식세포주에서 항산화 인자인 HO-1의 발현량을 복합 생약 추출물의 처리 농도별(0, 0.5, 1, 2 mg/ml)로 비교하여 나타낸 그래프이다.
도 9는 본 발명의 복합 생약 추출물의 혼합비율에 따른 항산화 효능을 확인하기 위하여 LPS를 처리한 마우스 대식세포주에서 항산화 인자인 HO-1의 발현량을 다양한 생약 비율별로 비교하여 나타낸 그래프이다.
도 10은 본 발명의 복합 생약 추출물의 추출방법(열수 추출) 및 추출 용매(에탄올)의 농도에 따른 항염증 및 항산화 효능을 확인하기 위하여 LPS를 처리한 마우스 대식세포주에서 염증인자(iNOS)의 발현량 및 항산화 인자인 HO-1의 발현량을 추출방법(열수 추출, 0%) 및 추출용매(에탄올)의 농도별(25, 50, 70, 90%)로 비교하여 나타낸 그래프이다.
도 11a 내지 도 11c는 단일 및 복합 생약 추출물의 폐 염증 억제 효능을 확인하기 위하여 LPS로 유도한 폐 염증 마우스 모델에서 단일 생약 추출물(산약, 포공영, 형개)과 복합 생약 추출물 처리에 따른 염증 인자(IL-1β, IL-6 및 TNF-α)의 발현량을 비교하여 나타낸 그래프이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.
제조예
제조예 1: 복합 생약 추출물(혼합추출물)의 제조
세척 및 건조된 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)를 실험에 사용하였다. 상기 산약, 포공영, 형개 생약을 1:1:1의 중량비로 총 60 g이 되도록 혼합한 뒤 10배의 25%(v/v) 에탄올 수용액을 가하여 상온에서 8시간 동안 잘 교반시키며 추출하였다. 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 분말 상태의 복합 생약 추출물(혼합추출물)을 수득하였다. 수율은 약 12~13%였다.
제조예 2: 생약 혼합비율별 복합 생약 추출물(혼합추출물)의 제조
세척 및 건조된 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)를 실험에 사용하였다. 상기 산약, 포공영, 형개의 생약을 표1에 기재된 중량비(w/w)로 총 30 g이 되도록 혼합한 뒤 10배의 25%(v/v) 에탄올 수용액을 가하여 상온에서 8시간 동안 잘 교반시키며 추출하였다. 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 총 7가지 종류의 복합 생약 추출물 분말을 수득하였고, 이들의 수율은 표 1과 같다.
분류 산약 포공영 형개 수율(%)
제조예 2-1 1 1 1 11.95
제조예 2-2 2 1 1 13.17
제조예 2-3 4 1 1 14.81
제조예 2-4 1 2 1 11.84
제조예 2-5 1 4 1 10.83
제조예 2-6 1 1 2 10.49
제조예 2-7 1 1 4 10.27
제조예 3: 다양한 추출 용매(에탄올) 농도별 복합 생약 추출물(혼합추출물)의 제조세척 및 건조된 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)를 실험에 사용하였다. 상기 산약, 포공영, 형개의 생약을 제조예 2-1의 중량비(w/w)로 총 30 g이 되도록 혼합한 뒤 10배의 25, 50, 70, 90% 에탄올 수용액을 가하여 상온에서 8시간 동안 잘 교반시키며 추출하였다. 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 총 4가지 종류의 복합 생약 추출물 분말을 수득하였고, 이들의 수율은 표2과 같다.
분류 에탄올 수용액의 농도(%) 수율(%) 비고
제조예 3-1 25 12.37 제조예 2-1과 동일한 제조방법
제조예 3-2 50 13.71 -
제조예 3-3 70 9.84 -
제조예 3-4 90 5.23 -
제조예 4: 열수 추출을 통한 복합 생약 추출물(혼합추출물)의 제조세척 및 건조된 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)를 실험에 사용하였다. 상기 산약, 포공영, 형개의 생약을 제조예2-1의 중량비(w/w)로 총 30 g이 되도록 혼합한 뒤 10배의 증류수를 가하여 90℃의 온도에서 3시간 동안 환류추출하였다. 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 복합 생약 추출물 분말을 수득하였고, 이의 수율은 약 13.30%이다.
비교예 1 : 단일 생약 추출물의 제조
세척 및 건조된 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba), 형개(Schizonepetae Spica)를 실험에 사용하였다. 상기 산약, 포공영, 형개의 각 생약 30g에 10배의 25%(v/v) 에탄올 수용액을 가하여 상온에서 8시간 동안 잘 교반시키며 추출하였다. 추출액을 여과하고 50-65℃에서 감압농축한 뒤, 동결건조하여 총 3가지 종류의 단일 생약 추출물 분말을 수득하였고, 이들의 수율은 표3과 같다.
분류 생약의 종류 수율(%)
비교예 1-1 산약 19.86
비교예 1-2 포공영 12.52
비교예 1-3 형개 7.84
실험예
실험예 1: PPE로 유도한 폐기종 마우스 모델에서 복합 생약 추출물의 폐조직 손상 억제 효능
제조예 1에서 준비한 본 발명의 복합 생약 추출물의 폐조직 손상 억제 효능을 확인하기 위하여 다음과 같은 실험을 수행하였다.
7주령 웅성 C57BL/6 마우스(라온바이오, 대한민국)를 일주일 이상 순화 사육한 후, (1) 정상군, (2) 폐기종 유도 및 복합 생약 추출물 투여군(실험군) (3) 폐기종 유도 및 증류수 투여군(음성대조군)으로 분류하였다. 실험군과 음성대조군의 폐기종을 유도하기 위해 돼지 췌장 엘라스타제(porcine pancreatic elastase, PPE, Millipore, USA) 1U를 마우스의 기관 내 단회 점적 투여 하였다. 정상군의 경우, PBS(phosphate buffered saline)를 마우스의 기관 내 단회 점적 투여 하였다.
실험군에는 증류수에 녹인 복합 생약 추출물을 PPE 투여 1주 전부터, 2주간 200 mg/kg의 용량으로 1회/일 경구투여 하였다. 정상군 및 음성대조군에는 증류수만을 경구 투여하였다. 복합 생약 추출물 또는 증류수의 마지막 투여 후 마우스를 이산화탄소로 마취하여 폐조직을 적출하였다. 적출한 폐조직을 포르말린에 고정하여 H&E 염색(hematoxylin and eosin staining)을 수행하였다. 광학현미경(X100)으로 폐조직을 관찰하여 촬영한 사진을 도 1에 나타내었다.
도 1에 나타낸 바와 같이, PPE로 폐기종을 유도한 결과, 음성대조군의 폐포 확장 및 폐 조직의 손상은 정상군에 비하여 2.2배 가량 유의미하게 증가하였다. 또한 본 발명의 복합 생약 추출물을 투여한 실험군에서는 폐 조직의 손상이 폐기종 유도군(음성대조군)에 비해 억제되었다.
따라서 본 발명의 복합 생약 추출물은 폐기종 마우스 모델에서 폐 조직의 손상을 억제하는 효과를 나타냄을 확인할 수 있었다.
실험예 2. 미세먼지에 의해 유도된 폐 상피세포주의 활성산소 생성에 대한 복합 생약 추출물의 억제 효능
제조예 1에서 준비한 본 발명의 복합 생약 추출물의 활성산소 생성 억제 효능을 확인하기 위하여 다음과 같은 실험을 수행하였다.
사람의 폐 상피세포주인 NCI-H292 세포(ATCC, USA)를 10%의 우태아혈청(fetal bovine serum, FBS)을 포함하는 RPMI 배지(Corning, USA)를 이용하여 37℃, 5% CO2 배양기에서 배양하였다. 상기 세포를 웰당 1x104 세포수로 96웰-블랙 플레이트에 준비하고 24시간 동안 안정화 시켰다. 안정화 후, 세포의 상등액을 제거하고 제조예 1의 복합 생약 추출물을 100 μg/mL의 농도로 처리한 후 1시간 동안 배양하였다. 다음으로 상기 세포에 미세먼지(particulate matter 10, PM10) (NIST, USA) 200 μg/mL를 추가로 처리하였다(실험군). 정상군에는 복합 생약 추출물 및 미세먼지를 모두 처리하지 않았고, 음성대조군에는 미세먼지만 처리하였다. 3시간 후, 상기 세포에서의 활성산소의 생성량을 DCF-DA 분석법(시그마 알드리치, USA)을 사용하여 확인하였다.
도 2에 나타낸 바와 같이, 미세먼지 유도군(음성대조군)은 정상군 대비 활성산소가 약 125% 증가하였으며, 이는 복합 생약 추출물에 의해 약 61% 억제되었다. 따라서 본 발명의 복합 생약 추출물은 우수한 항산화 효과를 나타냄을 알 수 있었다.
실험예 3. 미세먼지에 의해 유도된 세포사멸에 대한 복합 생약 추출물의 억제 효능
실험예 2와 마찬가지로, NCI-H292 세포를 웰당 1x104 세포수로 96웰-플레이트에 준비하고 안정화시켰다. 24시간 후, 세포의 상등액을 제거한 후 제조예 1의 복합 생약 추출물을 각각 100, 200, 400, 800 μg/mL의 농도로 처리하였다. 1시간 후 미세먼지(PM10) 50 μg/mL을 상기 세포에 추가로 처리하였다. 정상군에는 복합 생약 추출물 및 미세먼지를 모두 처리하지 않았고, 음성대조군에는 미세먼지만 처리하였다. 24시간 후, 세포의 생존율을 WST-1 검사법(영인프런티어, 대한민국)을 통해 확인하였다.
도 3에 나타낸 바와 같이, 폐 상피세포에 미세먼지를 처리한 결과, 세포 사멸에 의해 세포 생존율이 정상군 대비 약 63.6%로 나타났다(음성대조군). 반면 100, 200, 400, 800 μg/mL 농도로 복합 생약 추출물을 처리한 실험군의 경우, 각각 67.5%, 69.9%, 77.2%, 89%의 세포 생존율을 보여 농도 의존적으로 세포사멸이 억제되었다. 따라서 본 발명의 복합 생약 추출물은 우수한 세포사멸 억제 효과를 나타냄을 알 수 있었다.
실험예 4. 미세먼지에 의해 유도된 폐 상피세포주의 세포노화에 대한 복합 생약 추출물의 항노화 효능
실험예 2와 같이, NCI-H292 세포를 웰당 1x104 세포수로 96웰-플레이트에 준비하고 안정화시켰다. 24시간 후, 세포의 상등액을 제거한 후 제조예 1의 복합 생약 추출물을 200 ㎍/㎖의 농도로 처리하였다. 1시간 후, 상기 세포에 미세먼지(PM10) 50 μg/mL을 추가로 처리하였다. 정상군에는 복합 생약 추출물 및 미세먼지를 모두 처리하지 않았고, 음성대조군에는 미세먼지만 처리하였다. 5일 후, 상기 세포를 포르말린으로 고정한 후 β-갈락토시다제 염색(senescence beta-galactosidase staining)을 통해 세포의 노화 정도를 확인하였다.
도 4에 나타낸 바와 같이, 복합 생약 추출물을 처리한 실험군에서는 미세먼지 처리에 의해 유발되는 세포 노화가 음성대조군에 비해 현저하게 감소하였다. 따라서 본 발명의 복합 생약 추출물은 우수한 항노화 효과를 나타냄을 알 수 있었다.
실험예 5. 복합 생약 추출물의 폐 상피세포주에 대한 텔로머레이즈 발현 증가 효능(항노화 효능)
NCI-H292 세포를 1x106 세포수로 100 파이(φ) 플레이트에 준비하고 안정화시켰다. 24시간 후, 상기 세포에 제조예 1의 복합 생약 추출물을 100, 200 ㎍/㎖의 농도로 처리하였다. 24시간 후에 상기 세포를 수거하여, 단백질을 추출한 후 텔로머레이즈의 촉매 소단위인 hTERT(human telomerase reverse transcriptase)의 항체(ab32020, Abcam, USA)를 사용하여 웨스턴 블롯 실험을 수행하였다.
도 5에 나타낸 바와 같이, 폐 상피세포주에 복합 생약 추출물을 100, 200 ㎍/㎖ 농도로 처리한 결과, hTERT의 발현이 미처리군(대조군)에 비해 각각 1.6배, 2.2배로 농도 의존적으로 증가하였다. 따라서 본 발명의 복합 생약 추출물은 우수한 항노화 효과를 나타냄을 알 수 있었다.
실험예 6. LPS에 의해 유도된 대식세포주의 NO(Nitric Oxide) 생성에 대한 복합 생약 추출물의 억제 효능(항염증 효능)
마우스의 대식세포주인 Raw264.7 세포(ATCC, USA)를 10%의 FBS가 포함되어 있는 RPMI 배지(Invitrogen, USA)을 이용하여, 37℃ 5% CO2 배양기에서 배양하였다. 상기 세포를 웰 당 2.5x105 세포수로 24웰-플레이트에 준비하고 안정화시켰다. 24시간 후, 세포의 상등액을 제거한 후 제조예 1의 복합 생약 추출물을 상기 세포에 0.5, 1, 2, 4 mg/mL의 농도로 처리하였다. 1시간 후 LPS 100 ng/mL을 상기 세포에 추가로 처리하였다. 24시간 후 세포의 상등액을 수거하여, NO의 생성 변화를 측정하기 위한 그리스 분석(Griess test)을 실시하였으며, NaNO2 (Sodium Nitrite)의 농도별 표준곡선을 이용하여 NO의 농도를 산출하였다(도 6).
도 6에 나타낸 바와 같이, LPS의 처리에 의해 대식세포에서 염증인자 NO의 생성이 12 μM 수준으로 증가하였다(음성대조군). LPS 처리와 함께 복합 생약 추출물을 0.5, 1, 2, 4 mg/ml 농도로 처리한 실험군에서는 NO의 농도가 각각 13.6, 9.4, 3.6, 3 μM 으로 나타나 농도의존적인 감소를 나타내었다. 따라서 본 발명의 복합 생약 추출물은 우수한 항염증 효능을 나타냄을 알 수 있었다.
실험예 7. LPS에 의해 유도된 대식세포주의 염증인자 발현에 대한 복합 생약 추출물의 억제 효능(항염증 효능)
마우스의 대식세포주인 Raw264.7 세포(ATCC, USA)를 10%의 FBS가 포함되어 있는 RPMI 배지(Invitrogen, USA)을 이용하여, 37℃ 5% CO2 배양기에서 배양하였다. 상기 세포를 웰 당 2.5x105 세포수로 24웰-플레이트에 준비하고 안정화시켰다. 24시간 후, 세포의 상등액을 제거한 후 상기 세포에 LPS (Sigma, US) 100 ng/mL과 제조예 1의 복합 생약 추출물을 0.5, 1, 2 mg/mL의 농도로 처리하였다. 24시간 후 세포의 상등액을 제거한 후, 세포로부터 TRIzol(Invitrogen, USA)을 사용하여 RNA를 분리하였다. 그 후 RT-PCR을 수행하여 얻은 cDNA를 사용하여 IL-6, IL-1β, 및 iNOS 염증 인자들에 특이적인 프라이머와 SYBR green 프로브(Takara, Japan)를 이용한 qPCR을 수행하였다. qPCR로부터 얻은 RNA의 발현 변화 값은 GAPDH mRNA를 표준 유전자로 하여 무처리군 대비 상대적인 변화량으로 표시하였다(도 7a 내지 도 7c). 시험에 사용된 마우스 유전자에 대한 프라이머 서열은 표 4에 나타내었다.
유전자 방향 염기서열(5' to 3') 서열번호(SEQ ID NO)
GAPDH 정방향 AGCCTCGTCCCGTAGACAA 1
역방향 AATCTCCACTTTGCCACTGC 2
IL-6 정방향 TTGGTCCTTAGCCACTCCTTC 3
역방향 TAGTCCTTCCTACCCCAATTTCC 4
IL-1β 정방향 TGTGCAAGTGTCTGAAGCAGC 5
역방향 TGGAAGCAGCCCTTCATCTT 6
iNOS 정방향 CGAAACGCTTCACTTCCAA 7
역방향 TGAGCCTATATTGCTGTGGCT 8
도 7a 내지 도 7c에 나타낸 바와 같이, LPS의 처리에 의해 Raw264.7 대식세포에서 염증 인자 IL-6, IL-1β, 및 iNOS의 생성이 유의미하게 증가하였으며(음성대조군), LPS 처리와 함께 제조예 1의 3종 복합 생약 추출물을 0.5, 1, 2 mg/ml 농도로 처리한 실험군에서는 IL-6, IL-1β, iNOS의 발현량이 모두 농도의존적으로 유의미한 감소를 나타내었다. 따라서 본 발명의 3종 복합 생약 추출물은 우수한 항염증 효능을 나타냄을 알 수 있었다.
실험예 8. LPS 처리된 대식세포주에서 복합 생약 추출물의 항산화 인자 발현 증가 효능(항산화 효능)
본 발명자들은 LPS에 의해 유도된 대식세포주에서 본 발명의 복합 생약 추출물이 항산화 인자인 HO-1 (heme oxygenase-1)의 발현에 미치는 영향을 확인하기 위하여, HO-1 유전자에 특이적인 프라이머와 SYBR green 프로브(Takara, Japan)를 이용하여 qPCR을 수행한 점을 제외하고는 실험예 7과 동일한 방법으로 실험을 수행하였다. qPCR 결과로부터 얻은 RNA의 발현 변화 값은 GAPDH mRNA를 표준 유전자로 하여 무처리군 대비 상대적인 변화량으로 표시하였다(도 8). 시험에 사용된 마우스 유전자에 대한 프라이머 서열은 표 5에 나타내었다.
유전자 방향 염기서열(5' to 3') 서열번호(SEQ ID NO)
GAPDH 정방향 AGCCTCGTCCCGTAGACAA 1
역방향 AATCTCCACTTTGCCACTGC 2
HO-1 정방향 CAGGTGATGCTGACAGAGGA 9
역방향 GAGAGTGAGGACCCACTGGA 10
도 8에 나타낸 바와 같이, LPS 처리와 함께 제조예 1의 복합 생약 추출물을 0.5, 1, 2 mg/ml 농도로 처리한 실험군에서는 HO-1의 발현량이 농도의존적으로 유의미한 증가를 나타내었다. 따라서 본 발명의 복합 생약 추출물은 우수한 항산화 효능을 나타냄을 알 수 있었다.
실험예 9. LPS 처리된 대식세포주에서 생약 비율별 복합 생약 추출물의 항산화 인자 발현 증가 효능(항산화 효능)
LPS에 의해 유도된 Raw264.7 대식세포주에서 제조예 2의 혼합비율별 복합 생약 추출물의 항산화 효능을 확인하기 위하여, HO-1 유전자에 특이적인 프라이머와 SYBR green 프로브(Takara, Japan)를 이용하여 qPCR을 수행하였다. 세부 실험 과정은 실험예 8과 동일하게 수행하였으며, 시험에 사용된 마우스 유전자에 대한 프라이머 서열은 표 5와 같았다.
도 9에 나타낸 바와 같이, LPS 처리와 함께 제조예 2의 복합 생약 추출물들을 2 mg/ml 농도로 처리한 실험군 모두에서 항산화 인자인 HO-1의 발현량이 유의미하게 증가하여 우수한 항산화 효능을 나타냄을 알 수 있었다.
실험예 10. LPS 처리된 대식세포주에서 추출 용매(에탄올) 농도별 복합 생약 추출물의 항염증 및 항산화 효능
LPS 처리된 대식세포주에서, 제조예 3의 추출 용매(에탄올) 농도별 복합 생약 추출물 및 제조예 4의 열수 복합 생약 추출물의 항염증 및 항산화 효능을 확인하기 위하여, iNOS, HO-1 유전자에 특이적인 프라이머와 SYBR green 프로브(Takara, Japan)를 이용하여 qPCR을 수행하였다. 각 추출물은 2 mg/ml의 농도로 처리하였다. 세부 실험 과정은 실험예 7 및 실험예 8과 동일하게 수행하였으며, 시험에 사용된 마우스 유전자에 대한 프라이머 서열은 표 4 및 표 5에 나타내었다.
도 10에 나타낸 바와 같이, 제조예 3에서 제조한 추출 용매(에탄올) 농도별 복합 생약 추출물은 LPS 처리에 의해 증가된 iNOS의 발현을 유의미하게 감소하여 우수한 항염증 효능을 나타냄을 알 수 있었다. 또한 제조예 3 및 제조예 4의 복합 생약 추출물들 모두 항산화 인자인 HO-1의 발현량을 유의미하게 증가시켜 우수한 항산화 효능을 나타냄을 알 수 있었다.
실험예 11. LPS로 유도한 폐 염증 마우스 모델에서 단일 생약 추출물과 복합 생약 추출물의 항염증 효능
단일 및 복합 생약 추출물의 폐 염증 억제 효능을 확인하기 위하여 다음과 같은 실험을 수행하였다. 7주령 웅성 C57BL/6 마우스(라온바이오, 대한민국)를 일주일 이상 순화 사육한 후, (1) 정상군, (2) LPS 유도 및 증류수 투여군(음성대조군), (3)~(5) LPS 유도 및 단일 생약 추출물 투여군, (6) LPS 유도 및 복합 생약 추출물 투여군으로 분류하였다.
(3)~(6)의 실험군에는 증류수에 녹인 제조예 1의 복합 생약 추출물 및 비교예 1의 3종의 단일 생약 추출물을 각 500 mg/kg의 용량으로 5일간 1회/일 경구 투여 하였으며, 정상군 및 음성대조군에는 증류수만을 경구 투여 하였다.
실험군과 음성대조군의 급성 폐 염증 반응 유도는 실험 종료 24시간 전에 50 μl의 PBS(phosphate buffered saline)에 녹인 LPS(Sigma, US) 50 μg 을 마우스 기관 내 단회 점적 투여하는 방법으로 시행하였다. 정상군의 경우, PBS(phosphate buffered saline)를 마우스의 기관 내 단회 점적 투여하였다.
생약 추출물 또는 증류수의 마지막 투여 후, 마우스를 이산화탄소로 희생시킨 후, 폐조직을 분리하여 TRIzol(Invitrogen, USA)를 이용해 RNA를 추출하였다. 그 후 RT-PCR을 수행하여 얻은 cDNA를 사용하여 염증인자인 IL-1β, IL-6 및 TNF-α에 특이적인 프라이머와 SYBR green 프로브(Takara, Japan)를 이용한 qPCR을 수행하였다. qPCR로부터 얻은 RNA의 발현 변화 값은 GAPDH mRNA를 표준 유전자로 하여 무처리군 대비 상대적인 변화량으로 표시하였다. 시험에 사용된 마우스 유전자에 대한 프라이머 서열은 표 6에 나타내었다.
유전자 방향 염기서열(5' to 3') 서열번호(SEQ ID NO)
GAPDH 정방향 AGCCTCGTCCCGTAGACAA 1
역방향 AATCTCCACTTTGCCACTGC 2
IL-6 정방향 TTGGTCCTTAGCCACTCCTTC 3
역방향 TAGTCCTTCCTACCCCAATTTCC 4
IL-1β 정방향 TGTGCAAGTGTCTGAAGCAGC 5
역방향 TGGAAGCAGCCCTTCATCTT 6
TNF-α 정방향 AAGCCTGTAGCCCACGTCGTA 11
역방향 GGCACCACTAGTTGGTTGTCTTTG 12
도 11a 내지 도 11c에 나타낸 바와 같이, LPS에 의해 폐조직 내 염증인자인 IL-1β, IL-6 및 TNF-α의 발현이 증가되었다. 3종의 단일 생약 추출물을 각각 투여한 경우 음성대조군과 유사한 정도의 염증 인자들의 발현을 보였다. 반면 복합 생약 추출물의 경우 음성대조군 대비 유의한 수준으로 염증 인자들의 발현을 감소시켜 항염증 효능에 있어서 상승적 효과(synergistic effect)를 나타내었다.

Claims (6)

  1. (a) 유효성분으로 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물; 및 (b) 약제학적으로 허용되는 담체를 포함하는 호흡기 질환의 예방 또는 치료용 약제학적 조성물.
  2. 제 1 항에 있어서, 상기 추출물은 유기용매, 물 또는 이들의 혼합용매로 추출된 것을 특징으로 하는 약제학적 조성물.
  3. 제 2 항에 있어서, 상기 유기용매는 C1 내지 C6의 저급 알코올, 석유 에테르, 헥산, 벤젠, 클로로포름, 메틸렌클로라이드, 에테르, 에틸아세테이트, 및 아세톤으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 약제학적 조성물.
  4. 제 1 항에 있어서, 상기 호흡기 질환은 감기, 비염, 인두염, 후두염, 인후두염, 폐렴, 급성 또는 만성 기관지염, 천식, 및 만성폐쇄성폐질환으로 이루어진 군으로부터 선택되는 호흡기 질환인 것을 특징으로 하는 약제학적 조성물.
  5. 산약(Dioscoreae Rhizoma), 포공영(Taraxaci Herba) 및 형개(Schizonepetae Spica)의 혼합추출물을 유효성분으로 포함하는 호흡기 질환의 예방 또는 개선용 식품 조성물.
  6. 제 5 항의 식품 조성물을 유효성분으로 포함하는 건강기능 식품.
PCT/KR2019/003056 2018-03-16 2019-03-15 호흡기 질환의 예방 또는 치료용 생약 조성물 WO2019177424A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201980019847.5A CN112236158A (zh) 2018-03-16 2019-03-15 用于预防或治疗呼吸系统疾病的生药组合物
EP19768358.4A EP3766509A4 (en) 2018-03-16 2019-03-15 RAW RESIN COMPOSITION FOR THE PREVENTION OR TREATMENT OF RESPIRATORY DISEASES
JP2020549806A JP7255901B2 (ja) 2018-03-16 2019-03-15 呼吸器疾患の予防又は治療用生薬組成物
US16/980,917 US11541097B2 (en) 2018-03-16 2019-03-15 Crude drug composition for preventing or treating respiratory diseases
JP2022128989A JP2022163181A (ja) 2018-03-16 2022-08-12 呼吸器疾患の予防又は治療用生薬組成物
US18/148,130 US20230218704A1 (en) 2018-03-16 2022-12-29 Crude drug composition for preventing or treating respiratory diseases

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180031150 2018-03-16
KR10-2018-0031150 2018-03-16
KR10-2019-0028956 2019-03-13
KR1020190028956A KR102210566B1 (ko) 2018-03-16 2019-03-13 호흡기 질환의 예방 또는 치료용 생약 조성물

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/980,917 A-371-Of-International US11541097B2 (en) 2018-03-16 2019-03-15 Crude drug composition for preventing or treating respiratory diseases
US18/148,130 Continuation US20230218704A1 (en) 2018-03-16 2022-12-29 Crude drug composition for preventing or treating respiratory diseases

Publications (1)

Publication Number Publication Date
WO2019177424A1 true WO2019177424A1 (ko) 2019-09-19

Family

ID=67908278

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/003056 WO2019177424A1 (ko) 2018-03-16 2019-03-15 호흡기 질환의 예방 또는 치료용 생약 조성물

Country Status (1)

Country Link
WO (1) WO2019177424A1 (ko)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010068273A (ko) * 2000-01-03 2001-07-23 김형민 알레르기 질환 예방 및 치료용 의약조성물 및 그 제조방법
KR20040000046A (ko) * 2002-06-19 2004-01-03 김우영 아토피성 피부염에 효과적인 건강보조식품 및 이의 제조방법
US20100028318A1 (en) * 2007-01-31 2010-02-04 Ichiro Saito Agent for relief or prevention of xerostomia
KR20100084926A (ko) * 2009-01-19 2010-07-28 주식회사 유니베라 염증, 알러지 질환 또는 성인병의 예방 또는 치료용 산약 추출물
KR20170120797A (ko) * 2016-04-22 2017-11-01 란핑 리우 만성 비염 치료용 중약
KR20180031150A (ko) 2016-09-19 2018-03-28 코디스페이스 주식회사 라디오 맵 구축 기능을 가진 핑거프린팅 방식을 이용한 측위 시스템 및 이의 라디오 맵 구축 방법
KR20190028956A (ko) 2017-09-11 2019-03-20 한화테크윈 주식회사 감시 시스템 및 그 동작 방법

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010068273A (ko) * 2000-01-03 2001-07-23 김형민 알레르기 질환 예방 및 치료용 의약조성물 및 그 제조방법
KR20040000046A (ko) * 2002-06-19 2004-01-03 김우영 아토피성 피부염에 효과적인 건강보조식품 및 이의 제조방법
US20100028318A1 (en) * 2007-01-31 2010-02-04 Ichiro Saito Agent for relief or prevention of xerostomia
KR20100084926A (ko) * 2009-01-19 2010-07-28 주식회사 유니베라 염증, 알러지 질환 또는 성인병의 예방 또는 치료용 산약 추출물
KR20170120797A (ko) * 2016-04-22 2017-11-01 란핑 리우 만성 비염 치료용 중약
KR20180031150A (ko) 2016-09-19 2018-03-28 코디스페이스 주식회사 라디오 맵 구축 기능을 가진 핑거프린팅 방식을 이용한 측위 시스템 및 이의 라디오 맵 구축 방법
KR20190028956A (ko) 2017-09-11 2019-03-20 한화테크윈 주식회사 감시 시스템 및 그 동작 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1995
See also references of EP3766509A4 *

Similar Documents

Publication Publication Date Title
WO2010104309A2 (ko) 위장질환의 예방 또는 개선용 조성물
WO2018208094A2 (en) A composition comprising a combined herb extract of salvia plebia and red ginseng as active ingredients for preventing or treating a respiratory inflammation and the use thereof
WO2012108635A2 (ko) 천궁 및 종대황의 혼합 생약 추출물을 함유하는 호흡기 질환의 예방 또는 치료용 조성물
WO2011149301A2 (en) A composition comprising the extract of physalis alkekengi var. francheti hort as an active ingredient for preventing and treating inflammatory diseases
WO2016032249A1 (ko) 모새나무 추출물 또는 이의 분획물을 유효성분으로 포함하는 신경염증 또는 퇴행성 뇌신경 질환의 예방 또는 치료용 약학적 조성물
WO2019177428A1 (ko) 호흡기 질환의 예방 또는 치료용 생약 조성물
WO2012102581A2 (ko) 천궁 및 호장근의 혼합 생약 추출물을 함유하는 호흡기 질환의 예방 또는 치료용 조성물
WO2021071269A1 (ko) 복합 생약 추출물을 포함하는 염증성 장질환의 예방 또는 치료용 조성물
WO2011139118A2 (en) A pharmaceutical composition and a health functional food composition for preventing, treating or improving a gastrointestinal dyskinetic disease
WO2019177424A1 (ko) 호흡기 질환의 예방 또는 치료용 생약 조성물
WO2012108634A2 (ko) 천궁 및 현호색의 혼합 생약 추출물을 함유하는 호흡기 질환의 예방 또는 치료용 조성물
WO2019103497A1 (ko) 천연추출물을 포함하는 소양증의 예방 또는 치료용 조성물
WO2022139529A1 (en) Composition for preventing, improving or treating gastritis or peptic ulcer comprising extract of cinnamomum cassia, fraction of said extract, isolate of said fraction or compounds isolated therefrom
WO2015105373A1 (ko) 화살나무 추출물 또는 이의 분획물을 포함하는 천식의 예방 또는 치료용 조성물
WO2016175589A2 (ko) 혼합 생약 추출물을 함유하는 호흡기 질환 예방 또는 치료용 약학적 조성물
KR20190109277A (ko) 호흡기 질환의 예방 또는 치료용 생약 조성물
WO2021045242A2 (ko) 구절초 추출물을 포함하는 월경전 증후군 증상 개선용 조성물
WO2019151547A1 (ko) 침향 추출물의 분획물을 유효성분으로 포함하는 퇴행성 신경질환의 예방, 개선 또는 치료용 조성물
WO2020222470A1 (ko) 황련 및 형개 혼합 추출물을 유효성분으로 포함하는 염증성 장질환 예방 또는 치료용 약제학적 조성물
WO2022265281A1 (ko) 증숙생강 추출물 또는 이로부터 분리된 1-데하이드로-6-진저다이온을 유효성분으로 포함하는 퇴행성 관절염 예방, 개선, 또는 치료용 조성물
WO2021150088A1 (ko) 천연소재 추출물 함유 약학적 조성물, 동물용 약학적 조성물, 식품 조성물 및 그의 제조 방법
WO2023136613A1 (ko) 식물 추출물을 유효성분으로 하는 미세먼지에 의한 호흡기 질환 예방, 개선 또는 치료용 조성물
WO2023055198A1 (ko) 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물
WO2017051984A1 (ko) 담즙산 조절제 또는 ｆｘｒ 항진제로서의 잔대 사포닌을 포함하는 잔대 추출물, 및 이를 포함하는 지방간염 및 원발성 담즙성 간경변의 예방 또는 치료용 약학적 조성물 또는 건강기능 식품용 조성물
WO2023085820A2 (ko) 근육 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19768358

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020549806

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2019768358

Country of ref document: EP