WO2016190780A1 - Extracellular dna as a therapeutic target in neurodegeneration - Google Patents

Extracellular dna as a therapeutic target in neurodegeneration Download PDF

Info

Publication number
WO2016190780A1
WO2016190780A1 PCT/RU2016/000284 RU2016000284W WO2016190780A1 WO 2016190780 A1 WO2016190780 A1 WO 2016190780A1 RU 2016000284 W RU2016000284 W RU 2016000284W WO 2016190780 A1 WO2016190780 A1 WO 2016190780A1
Authority
WO
WIPO (PCT)
Prior art keywords
dnase
patient
administered
pharmaceutical composition
neurodegeneration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/RU2016/000284
Other languages
English (en)
French (fr)
Inventor
Dmitry Dmitrievich Genkin
Georgy Viktorovich Tets
Viktor Veniaminovich Tets
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to RU2017145051A priority Critical patent/RU2726131C2/ru
Priority to ES16800375T priority patent/ES2799515T3/es
Priority to JP2018513264A priority patent/JP6745873B2/ja
Priority to CN201680042916.0A priority patent/CN108289932A/zh
Priority to US15/576,611 priority patent/US11701410B2/en
Priority to EP16800375.4A priority patent/EP3297657B1/en
Publication of WO2016190780A1 publication Critical patent/WO2016190780A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0085Brain, e.g. brain implants; Spinal cord
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/02Thioester hydrolases (3.1.2)
    • C12Y301/02021Dodecanoyl-[acyl-carrier-protein] hydrolase (3.1.2.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/21Endodeoxyribonucleases producing 5'-phosphomonoesters (3.1.21)
    • C12Y301/21001Deoxyribonuclease I (3.1.21.1)

Definitions

  • the invention relates to the use of deoxyribonuclease (DNase) enzyme for inhibiting progression and for prevention and treatment of neurodegeneration.
  • DNase deoxyribonuclease
  • Neurodegeneration is a separate clinical pathological condition with progressive loss of structure and/or function of neurons, including death of neurons.
  • Molecular pathways leading to neurodegeneration are highly disease-specific (e.g., accumulation of abnormally folded amyloid-beta and tau proteins in the brain in Alzheimer's disease patients; accumulation of alpha-synuclein in Parkinson's disease; accumulation of mutant Huntingtin in Huntington's disease; accumulation of TDP-43 and FUS protein aggregates in Amyelotropic Lateral Sclerosis (ALS); accumulation of mitochondrial DNA mutations and broken mitochondria division mechanics in aging) and result in neuronal cell death at advanced stages of disease progression.
  • Programmed cell death including apoptosis seems to play a key role in the progression of neurodegeneration at late disease stage, as demonstrated by studies on animal models and cell lines (Radi E., et al., J Alzheimers Dis. 2014; 42).
  • Neurodegeneration usually leads to progressive nervous system dysfunction and is often associated with atrophy of the affected central or peripheral structures of the nervous system. Neurodegeneration is associated with a large group of neurological conditions with heterogeneous clinical and pathological expressions affecting specific subsets of neurons in specific functional anatomic systems. The non- limiting list of disorders where neurodegeneration has a significant impact on clinical and pathological picture is presented below:
  • Torsion dystonia torsion spasm; dystonia musculorum deformans
  • NMDA receptor inhibitor memantine has been used clinically for treatment of many neurodegenerative disorders, including Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's and Huntington's diseases. Memantine also shows promise as a treatment for other diseases associated with excessive NMDA receptor activation in the central nervous system (CNS), including glaucoma, multiple sclerosis, epilepsy and neuropathic pain (J. Johnson et al., Current Opinion in Pharmacology, 2006, V6, pp. 61-67).
  • CNS central nervous system
  • Circulating extracellular (also called "cell free") nucleic acids were discovered more than 60 years ago (Anker P., Circulating DNA in plasma or serum, Clin Chim Acta. 2001; 313(1-2): 143-6). DNA levels in normal plasma samples are quite low with concentrations varying from 3.6 to 5.0 ng/ml. Normal plasma samples mainly contain DNA fragments of about 180 bp and to a much smaller extent larger fragments (e.g., fragments of 500 bp or larger). Circulating extracellular DNA has been described as therapeutic target in several diseases and conditions, including cancer, infection, diabetes, delayed-type hypersensitivity, and fertility (see, e.g., U.S. Patents Nos.
  • compositions and methods for treating neurodegeneration As specified in the Background Section, there is a great need in the art to develop new compositions and methods for treating neurodegeneration.
  • the present invention addresses this and other needs by providing compositions and methods based on DNase enzyme.
  • the invention provides a method for preventing, treating and/or inhibiting progression of neurodegeneration (e.g., primary neurodegeneration) in a patient in need thereof (e.g., a mammal such as human or an experimental animal model), comprising administering to said patient a therapeutically effective amount of a DNase enzyme.
  • a pharmaceutical composition comprising a DNase enzyme for use in preventing, treating and/or inhibiting progression of neurodegeneration (e.g., primary neurodegeneration).
  • the invention provides a use of a DNase enzyme for preventing, treating and/or inhibiting progression of neurodegeneration in a patient in need thereof.
  • the neurodegeneration is associated with an increased level of extracellular DNA (e.g., prokaryotic and/or human) in blood or cerebrospinal fluid or intestine of the patient, which level is higher than the control level (e.g., the level of extracellular DNA in blood or cerebrospinal fluid or intestine of a healthy age-matched individual or an average level of extracellular DNA in blood or cerebrospinal fluid or intestine of several healthy age-matched individuals).
  • the neurodegeneration is associated with a neurodegenerative disorder.
  • Non-limiting examples of encompassed neurodegenerative disorders include, e.g., Alzheimer's disease (e.g., late- onset Alzheimer's disease), Parkinson's disease, Amyotrophic Lateral Sclerosis (ALS), and Huntington's disease.
  • the neurodegeneration is associated with a nervous system dysfunction such as, e.g., schizophrenia or bipolar disorder.
  • the therapeutically effective amount of the DNase enzyme is sufficient to destroy said extracellular DNA (e.g., is sufficient to decrease the average molecular weight of said extracellular DNA [e.g., as measured by gel electrophoresis]) in blood or cerebrospinal fluid or intestine of the patient.
  • said DNase is a recombinant DNase. In one embodiment, said DNase is DNase I. In one embodiment, said DNase has extended half-life (e.g., is conjugated with polysialic acid or is protected from binding to actin by modification of actin binding- site; see, e.g., Gibson et al., (1992) J. Immunol. Methods, 155, 249-256).
  • extended half-life e.g., is conjugated with polysialic acid or is protected from binding to actin by modification of actin binding- site; see, e.g., Gibson et al., (1992) J. Immunol. Methods, 155, 249-256).
  • said DNase is administered by intravenous, subcutaneous or intramuscular route.
  • said DNase is DNase I and is administered in the amount of at least 0.04 mg per kg per day or 0.05 - 10000 Kunitz units per kg per day during at least one day.
  • said DNase is administered enterally (e.g., orally).
  • said DNase is DNase I and is administered in the amount of at least 0.04 mg per kg per day or 0.05 - 10000 Kunitz units per kg per day during at least one day.
  • said DNase is administered into cerebrospinal fluid.
  • said DNase is DNase I and is administered in the amount of at least 0.1 mg per day.
  • Figure 1 shows accumulation of labeled extracellular DNA in rat brain parenchyma after itsd injection into carotid artery.
  • Figure 2 shows electrophoregrams of blood extracellular DNA of a patient before administration of DNase (left column) and one month after the start of DNase treatment
  • Figures 3A-B are Tl MRI images showing atrophy and extensive gliosis of the left frontoparietal region in the brain of a patient with severe Alzheimer's disease. Images (A) and (B) depict volume loss in end-stage Alzheimer's disease with mild changes to the periventricular white matter. (A) Coronal Tl MRI of showing marked progressive cortical atrophy of the parietal regions. (B) Transverse Tl MRI showing bilateral marked atrophy.
  • the present invention is based on an unexpected discovery that extracellular DNA (both eukaryotic and prokaryotic) is present in elevated levels in blood and cerebrospinal fluid (CSF) of patients suffering from neurodegeneration (e.g., neurodegeneration associated with Alzheimer's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis, Huntington's disease, schizophrenia, and bipolar disorder) and that said extracellular DNA penetrates blood brain barrier (BBB) and exerts neuronal toxicity.
  • CSF cerebrospinal fluid
  • BBB blood brain barrier
  • DNase enzymes results in treatment/amelioration of neurodegeneration and is accompanied by the reduction of the level of circulating extracellular DNA.
  • neurodegeneration is used herein to refer to a separate clinical pathological condition with progressive loss of structure and/or function of neurons, including death of neurons.
  • the neurodegeneration can be primary or secondary.
  • diseases involving primary neurodegeneration include, e.g., Alzheimer's disease (AD), Mild Cognitive Impairment (MCI), Parkinson's disease (PD), Huntington's disease (HD), prion-caused diseases, frontotemporal dementia (FTD), Lewy body dementia, vascular dementias, Amyotrophic Later Sclerosis (ALS), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), multiple system atrophy (MSA), corticobasal degeneration (CBGD), Pick's disease, olivopontocerebellar atrophy (OPCA), senile dementia of the Alzheimer type, progressive supranuclear palsy (Steel-Richardson-Olszewski), corticodentatonigral degeneration, Hallervor
  • Secondary neurodegeneration is caused primarily by necrosis.
  • conditions which may result in secondary neurodegeneration, include destruction of neurons by neoplasm, edema, hemorrhage, stroke, trauma, immune attack, hypoxia, poisoning, metabolic defects, and infections.
  • extracellular DNA and “cell-free DNA” are used interchangeably to refer to extracellular DNA (of eukaryotic or prokaryotic origin) found in blood, cerebrospinal fluid (CSF) or intestine of a patient.
  • CSF cerebrospinal fluid
  • deoxyribonuclease and “DNase” are used to refer to any enzyme that catalyzes the hydrolytic cleavage of phosphodiester linkages in the DNA backbone.
  • DNase e.g., human recombinant DNase I or bovine pancreatic DNase I
  • analogues of DNase I such as, e.g., DNase X, DNase gamma, and DNAS1L2
  • DNase II phosphodiesterase I
  • lactoferrin lactoferrin
  • acetylcholinesterase e.g., acetylcholinesterase.
  • DNase I cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5'5'-phosphate-terminated polynucleotides with a free hydroxyl group on position 3', on average producing tetranucleotides.
  • DNase I acts on single-stranded DNA, double-stranded DNA, and chromatin.
  • the term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to ⁇ 20%, preferably up to ⁇ 10%, more preferably up to ⁇ 5%, and more preferably still up to ⁇ 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.
  • the terms “treat”, “treatment”, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition.
  • the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
  • the term "therapeutically effective” applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof.
  • therapeutically effective when used in connection with the use of deoxyribonuclease (DNase) to prevent, treat and/or inhibit progression of neurodegeneration or a specific disease associated with said neurodegeneration, it refers to an amount of DNase or a pharmaceutical composition containing DNase that is effective to relieve or alleviate at least one symptom associated with neurodegeneration or such disease, or to slow or reverse the progression of neurodegeneration or such disease.
  • DNase deoxyribonuclease
  • a combination of active ingredients e.g., a combination of DNase and another compound effective for preventing, treating and/or inhibiting progression of a disease associated with neurodegeneration
  • the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually.
  • compositions of the invention refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when aclniinistered to a subject (e.g., a mammal such as a human).
  • a pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
  • the terms “subject” and “patient” refer to any mammal. In a preferred embodiment, the subject/patient is human.
  • both prokaryotic and eukaryotic extracellular DNA level in blood and cerebrospinal (CSF) fluid increases with worsening of neurological status in patients with senile dementia, Parkinson's and Alzheimer's" diseases.
  • CSF cerebrospinal
  • a large part of extracellular DNA in blood and CSF is intestinal bacterial DNA (e.g., derived from gastrointestinal microbiota).
  • intestinal bacterial DNA e.g., derived from gastrointestinal microbiota.
  • Monitoring may include, e.g., one or more of the following: determination of the amount of extracellular DNA, determination of the type of extracellular DNA (prokaryotic or eukaryotic, e.g., determined based on rRNA), determination of the presence and/or amount of specific DNA fragments (e.g., CpG motifs, CpG-like motifs, hyperconservative regions of 16S, rpoD, e.g., determined using RT-PCR or metagenomic analysis).
  • determination of the amount of extracellular DNA determination of the type of extracellular DNA (prokaryotic or eukaryotic, e.g., determined based on rRNA), determination of the presence and/or amount of specific DNA fragments (e.g., CpG motifs, CpG-like motifs, hyperconservative regions of 16S, rpoD, e.g., determined using RT-PCR or metagenomic analysis).
  • BBB blood brain barrier
  • extracellular DNA from intestine, blood and CSF of patients suffering from neurodegeneration causes neuronal cell death and apoptosis.
  • DNase treatment destroying such extracellular DNA significantly improves the nervous system function in these patients.
  • the improvement assessment was performed according to widely accepted clinical diagnostic criteria of cognitive decline such as MMSE, PANSS, physical function, and/or functional tasks (see, e.g., Holmes et al., (1999) The British Journal of Psychiatry, 174(1), 45-50; Os et al., (2006) Acta Psychiatrica Scandinavica, 113(2), 91-95; O'Shea et al., (2002) Physical therapy, 82(9), 888-897; Rochester et al., (2004) 85(10), 1578- 1585).
  • the invention provides a method for preventing, treating and/or inhibiting progression of neurodegeneration in a subject in need thereof, which method comprises administering to the subject a therapeutically effective amount of a DNase enzyme (e.g., DNase I, analogues of DNase I [such as, e.g., DNase X, DNase gamma, DNAS1L2], DNase II, phosphodiesterase I, lactoferrin, or acetylcholinesterase), wherein said amount of the DNase enzyme is effective to prevent or ameliorate at least one symptom of neurodegeneration.
  • a DNase enzyme e.g., DNase I, analogues of DNase I [such as, e.g., DNase X, DNase gamma, DNAS1L2], DNase II, phosphodiesterase I, lactoferrin, or acetylcholinesterase
  • said amount of the DNase enzyme is effective to prevent or ameliorate at least one symptom of neurodegeneration
  • DNase doses useful in the methods of the invention depend on the severity and course of the neurodegeneration, previous or concurrent therapy, the patient's clinical history and response to DNase, as well as the discretion of the attending physician. Preferably, such doses range from 0.5 to 20 mg/kg/day or 500 to 20000 Kunitz units (KU)/kg/day.
  • a DNase enzyme can be performed by any suitable route.
  • useful routes of administration include intravenous, subcutaneous, intramuscular, delivery to cerebrospinal fluid (CSF), enteral (e.g., oral), rectal (e.g., by enema), and intranasal.
  • CSF cerebrospinal fluid
  • enteral e.g., oral
  • rectal e.g., by enema
  • intranasal e.g., by enema
  • DNase can be administered either alone or in combination with other treatments useful for inhibiting progression or treatment of neurodegenerative diseases or other encompassed nervous system dysfunctions (e.g., bipolar disorder, migraine, schizophrenia, epilepsy).
  • additional treatments include, e.g., histone acetyltransferase activators, cyclin-dependent protein kinase 5 inhibitors, neurotrophin mimetics, semaphorin-4D blockers, microsomal prostaglandin E synthase-1 inhibitors, levodopa, and N-methyl-d-aspartate (NMDA) receptor inhibitors (e.g., memantine).
  • NMDA N-methyl-d-aspartate
  • a DNase enzyme can be formulated in a pharmaceutical composition with a pharmaceutically acceptable carrier or excipient.
  • the formulations used in the methods of the invention may conveniently be presented in unit dosage form and may be prepared by methods known in the art.
  • the amount of active ingredients that can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated and the particular mode of administration.
  • the amount of active ingredients that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
  • the formulations can be prepared with a liquid carrier, or a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • compositions suitable for parenteral administration may comprise DNase in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions can also contain preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • Injectable depot forms can be made by forming microencapsule matrices of one or more active ingredients in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient's release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the active ingredients in liposomes or microemulsions which are compatible with body tissue.
  • biodegradable polymers such as polylactide-polyglycolide.
  • Depot injectable formulations are also prepared by entrapping the active ingredients in liposomes or microemulsions which are compatible with body tissue.
  • Formulations for oral administration can be in the form of capsules, cachets, pills, tablets, powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid (e.g., as a mouthwash, as a composition to be swallowed, or as an enema), or as an oil- in-water or water-in-oil liquid emulsion, and the like, each containing a predetermined amount of one or more active ingredients.
  • one or more active ingredients can be mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators,
  • pharmaceutically acceptable carriers such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and
  • compositions may also comprise buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • Suspensions in addition to one or more active ingredients, can contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • the DNase compositions of the invention may further comprise agents, which facilitate DNase delivery across the blood brain barrier (BBB).
  • useful agents include, e.g., an implantable reservoir (Omaya reservoir), polysialation of DNase, functionalized nanocarriers (e.g., nanoparticles coated with transferrin or transferrin receptor [TR] antibodies), exosomes, liposomes (e.g., liposomes coated with targeting molecules such as antibodies, Trojan Horses Liposomes [THL]), antibodies (e.g., antibodies against transferrin receptor [TR] or insulin receptor [HIR], BBB transmigrating Llama single domain antibodies (sdAb)), chimeric peptides (e.g., Angiopeps derived from proteins expressing the Kunitz domain), low-density lipoprotein receptor related proteins 1 and 2 (LRP-1 and 2), diphtheria toxin receptor (DTR), mesenchyme stem cells, receptor-associated protein, apolipoprotein
  • Example 1 Extracellular circulating DNA from blood and CSF promotes neuronal cell death
  • cerebral cortices were removed from embryonic day (E) 15-17 Sprague Dawley rat embryos.
  • Cortical explants were dissected into pieces of about 200-400 ⁇ 2 using fine needles and dissociated with the Papain Dissociation System (Worthington Biochemicals) according to the manufacturer's instructions and further kept on ice-cold minimum essential medium (Gibco).
  • Papain Dissociation System Withington Biochemicals
  • Neurons were plated on 13 mm diameter glass coverslips coated first with poly-D-lysine (10 ⁇ g ml in PBS) followed by laminin (10 ⁇ g/nll in PBS) (Gibco) and cultured at 37°C in a humidified 8% C0 2 (v/v) atmosphere for 24- ⁇ 48 hrs in Neurobasal medium with 1% (v/v) Antibiotic- Antimycotic (Gibco).
  • Extracellular DNA was extracted from plasma and CSF of a patient with a severe stage of Alzheimer's disease using QIAamp Circulating Nucleic Acid Kit according to manufacturers' instructions.
  • samples of extracellular DNA were added to cortical neuronal cultures.
  • Neuronal cell death was determined in dissociated cortical neurons cultured for 48 hours. After initial period, extracellular DNA samples (100 and 200 mkg/ml dose levels) were applied for a further 24 hours. Neuronal cell death was assessed by CytoTox-GloTM Cytotoxicity Assay (Promega). Luminescence proportional to the number of dead cells was measured using a Promega GloMax 96 luminometer and was expressed in relative luminescence units (RLU).
  • Induction of apoptosis marker caspase 3 was determined in dissociated cortical neurons cultured for 48 hours. After initial period, extracellular DNA samples (100 and 200 mkg/ml dose levels) were applied for a further 24 hours. Cells were than fixed in 4% (w/v) paraformaldehyde (PFA) and incubated for 1 hour with cleaved caspase 3 antibody (Abeam) diluted 1:500 in PBS. Cells were washed and incubated for 1 hour with goat anti-rabbit polyclonal Alexa Fluor 488 antibodies for caspase 3 (Invitrogen) in PBS prior to washing and counting.
  • PFA paraformaldehyde
  • Abeam cleaved caspase 3 antibody
  • Extracellular DNA was extracted from plasma and CSF of a patient with a severe stage of Alzheimer's disease and a healthy volunteer (age- and sex-matched) using QIAamp Circulating Nucleic Acid Kit according to manufacturers' instructions. Quantification of bacterial extracellular DNA was done using CFX96 TouchTM Real-Time PCR Detection System. We have used universal bacterial DNA PCR primers 1369F and 1492R (Bacterial 16S rRNA).
  • Extracellular DNA was extracted from plasma of a patient diagnosed with senile dementia using QIAamp Circulating Nucleic Acid Kit. Iodination of extracellular DNA was performed using Iodo-Gen reagent as described (Piatyszek A., et al., Analytical Biochemistry, 1988, V172, pp. 356-359). Specific activity of labeled extracellular DNA was approximately 30 mkCi/mkg. The preparation of labeled extracellular DNA in 1 ml of PBS solution (approx. 3.0 mkCi, 100 ng) was slowly infused (0.1 ml/mn) into carotid artery of an anesthetized female Sprague Dawley rat.
  • the rat was euthanized with chloroform, the brain was removed and fixed in formalin solution. Paraffin sections were stained with Ilford L4 emulsion. Accumulation of the labeled extracellular DNA in brain was studied using standard visual histoautoradiographic technique (Figure 1). Accumulation of injected extracellular DNA in rat brain parenchyma indicates that it penetrates blood brain barrier (BBB).
  • BBB blood brain barrier
  • Patient K. age 72, male has was diagnosed with senile dementia 4 years ago with gradual development of bradykinesia, deterioration of short-term memory and attention. Gradually the following symptoms progressed: aspontaneity, lack of initiative, emotional lability, drowsiness. For 3 years the patient has been taking levodopa. A moderate positive effect was observed. However, during the last 18 prior symptoms became more pronounced, also hypokinesia and postural disorders began to manifest.
  • the patient was administered bovine pancreatic DNase I (Samson Med, Russia) in the amount of 2500 Kunitz units/kg three times per day orally in capsules.
  • the effectiveness of the DNase treatment was assessed using the mini-mental state examination scale (MMSE) after 14 and 30 days. The results of the study are shown in Table 3.
  • Electrophoregrams (agarose gels) of blood extracellular DNA of the patient before the DNase treatment (left column) and one month after the start of the treatment (right column) are presented in Figure 2.
  • DNase has a positive effect when treating exacerbation of bipolar disorder.
  • Patient L. age 38, female. Diagnosis: schizophrenia, paranoid type, paroxysmal course of the disease, paranoid-hallucinatory syndrome. Before the DNase treatment, the patient complained about hearing voices "inside her head", she also believed that her colleagues were trying to poison her. The patient was sitting in the unnatural posture, also a pronounced tremor of the upper extremities was observed, the tremor would subside upon movement. Emotional disorders were discovered, as well as thought disorders (slow thinking, derailment, illogicality). The total score of assessment using the Positive and Negative Syndrome Scale (PANSS) amounted to 24 and 22, respectively.
  • PANSS Positive and Negative Syndrome Scale
  • the patient began taking bovine pancreatic DNase I (Samson Med, Russia) orally in capsules in the amount of 3000 Kunitz units (KU)/kg three times per day. The results of the study are shown in Table 5.
  • DNase has a positive effect when treating schizophrenia.
  • Patient G age 77, male.
  • the patient was diagnosed with Alzheimer's disease based on clinical data and indicative MRI changes. Starting from month 14 after being diagnosed, the patient started taking Memantine. However, the clinical symptoms continued to deteriorate: memory impairments progressed, impairments of speech and coordination began to manifest, as well as disorientation. By month 20 after being diagnosed the patient had all of the above-mentioned symptoms progressing and stopped going around on his own. By the time the DNase administration began, the patient was in stupor, also urinary and fecal incontinence were observed.
  • Bovine pancreatic DNase I (Samson Med, Russia) was administered orally in capsules in the amount of 4000 Kunitz units/kg three times per 24 hours. The effectiveness was assessed using the MMSE mini-scale, 5 and 30 days after the beginning of the DNase treatment. The results of the study are shown in Table 6.
  • the human blood plasma DNA from the patient was quantified using conventional real time PCR (RT-PCR) assay for three different markers sequences: ALU (Jl), c-MYC and b-GLOB (ALU primer was GTCAGGAGATCGAGACCATCCC (SEQ ID NO: 3), c-MYC primer was AAACACAAACTTGAACAGCTAC (SEQ ID NO: 4), b-GLOB primer was GGTTGGCCAATCTACTCCCAGG (SEQ ID NO: 5) in total fraction of patient's extracellular DNA one month prior to the DNase treatment, immideately before the treatment start, and 30 days after initiation of the DNase treatment. The results are presented at Table 7.
  • DNase has a positive effect on treatment of Alzheimer's disease.
  • the positive clinical effect of DNase treatment develops alongside with reduction of the level of circulating extracellular DNA in the blood.
  • a 77-year-old Caucasian male was diagnosed with dementia secondary to late-onset Alzheimer's disease 30 months prior to his presentation at clinic, exhibiting behavioral disturbances, cognitive decline, and decreased ability to engage in activities of daily living. Approximately 14 months following the initial diagnosis, the patient began treatment with 10 mg of memantine per day (Reisberg et al., N Engl J Med. 2003; 348:1333-1341; Danysz et al., Br J Pharmacol.
  • MMSE Mini-Mental State Examination
  • FAST Functional Assessment Staging Test
  • DNase I has a positive effect on treatment of Alzheimer's disease.
  • Treatment with DNase I in the present case allowed the patient to withdraw form a terminal state and resulted in significant improvements in cognitive and behavioral function, including the ability to walk and perform everyday tasks with near independence.
  • Significant recovery was observed in all areas of cognitive and motor function, indicating the possibility of a DNase-sensitive target involved in generating the symptoms of Alzheimer's disease.
  • Cell-free DNA including bacteria-derived DNA, may be one such target (Holdenrieder et al., Clin Chem. 2005; 51:1544-1546).
  • Patient S. age 58, female, has been suffering from Parkinson's disease for 7 years. For the last 5 years she has been treated with levodopa.
  • levodopa One month before the study, there was a significant deterioration in patient's condition, namely: significant increase of tremor of the right hand, appearance of involuntary movements of hands in the form of generalized choreoathetosis, rigidity of extremities, difficulties with getting up from the bed in the morning, frequent nocturnal urination (6-7 times).
  • the patient began taking bovine pancreatic DNase I (Samson Med, Russia) orally in capsules in the amount of 1500 Kunitz units/kg three times per day. Assessment was done using unified Parkinson's disease rating scale (UPDRS), observation was performed during 6 months.
  • UPDRS unified Parkinson's disease rating scale
  • DNase administration has a positive effect on treatment of Parkinson's disease. This positive effect develops alongside with reduction of the level of circulating extracellular DNA in the blood.
  • mice with knockout of SOD1 enzyme with hyperexpression of G93A-hSODl protein, which is a generally accepted model of amyotrophic lateral sclerosis (ALS) (Gurney, New England Journal of Medicine (1994) 331: 1721-1722).
  • ALS amyotrophic lateral sclerosis
  • Two groups of animals were formed, each consisting of 10 animals (Jackson Laboratory, Bar Harbor, ME). The animals were housed in a room with 12 hour light cycle and provided with free access to water and food.
  • Polysialated DNAse was prepared as described in PCT/GB2007/002839. Briefly: 20 molar excess of oxidized 26 kDa polysialic acid (PSA) was dissolved in buffer and the pH adjusted to 6.0.
  • PSA polysialic acid
  • DNAse-PSA conjugates were purified using hydrophobic interaction chromatography (HIC) - Phenyl-sepharose matrix, starting buffer containing 2.0 M ammonium sulphate, elution in buffer without ammonium sulphate. Elution fractions are then applied to ion exchange matrix Q-sepharose Fast Flow, and eluted with buffer containing sodium chloride. Purification of conjugates was confirmed by size- exclusion-high performance liquid chromatography (SE-HPLC).
  • HIC hydrophobic interaction chromatography
  • mice from Group 1 received no treatment (the control group); mice from Group 2 received human polysialated recombinant DNase I dosed at 50 mg kg subcutaneously once a day. Survival time of the animals was used as an assessment criterion. Results are shown in Table 9.
  • Huntington's disease was chosen as an example of systemic atrophies of the central nervous system. Studies were performed on R6/2 transgenic mice expressing exon 1 of the gene that encodes glutamine, which is a generally accepted model of Huntington's disease (Miller et al., Neuroscience (2008) 153: 329-337). Three groups of animals were formed, each consisting of 10 animals (Charles River Laboratories). T he animals were housed in a room with 12 hour light cycle and provided with free access to water and food.
  • mice from Group 1 received no treatment; mice from Group 2 received human recombinant DNase I (Catalent , Madison, USA) in the amount of 25000 mg/kg (2 times per 24 hours, intramuscularly); mice from Group 3 received DNase in the amount of 25 mg/kg (once a week, into CSF, using ICV bolus injection technique). Survival time of the animals was used as an assessment criterion. Results are shown in Table 10.
  • DNase I has a positive effect on treatment of Huntington's disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Psychiatry (AREA)
  • Psychology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hospice & Palliative Care (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
PCT/RU2016/000284 2015-05-22 2016-05-11 Extracellular dna as a therapeutic target in neurodegeneration Ceased WO2016190780A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
RU2017145051A RU2726131C2 (ru) 2015-05-22 2016-05-11 Внеклеточная днк в качестве терапевтической мишени при нейродегенерации
ES16800375T ES2799515T3 (es) 2015-05-22 2016-05-11 ADN extracelular como una diana terapéutica en la neurodegeneración
JP2018513264A JP6745873B2 (ja) 2015-05-22 2016-05-11 神経変性における治療標的としての細胞外dna
CN201680042916.0A CN108289932A (zh) 2015-05-22 2016-05-11 胞外dna作为神经变性的治疗靶点
US15/576,611 US11701410B2 (en) 2015-05-22 2016-05-11 Extracellular DNA as a therapeutic target in neurodegeneration
EP16800375.4A EP3297657B1 (en) 2015-05-22 2016-05-11 Extracellular dna as a therapeutic target in neurodegeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562165255P 2015-05-22 2015-05-22
US62/165,255 2015-05-22

Publications (1)

Publication Number Publication Date
WO2016190780A1 true WO2016190780A1 (en) 2016-12-01

Family

ID=57393467

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2016/000284 Ceased WO2016190780A1 (en) 2015-05-22 2016-05-11 Extracellular dna as a therapeutic target in neurodegeneration

Country Status (7)

Country Link
US (1) US11701410B2 (cg-RX-API-DMAC7.html)
EP (1) EP3297657B1 (cg-RX-API-DMAC7.html)
JP (1) JP6745873B2 (cg-RX-API-DMAC7.html)
CN (1) CN108289932A (cg-RX-API-DMAC7.html)
ES (1) ES2799515T3 (cg-RX-API-DMAC7.html)
RU (1) RU2726131C2 (cg-RX-API-DMAC7.html)
WO (1) WO2016190780A1 (cg-RX-API-DMAC7.html)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018197547A1 (en) * 2017-04-25 2018-11-01 Lipoxen Technologies Limited Methods of treating diseases related to net formation with parenteral administration of polysialylated dnase i
WO2019053243A1 (en) 2017-09-18 2019-03-21 Santersus Sa METHOD AND DEVICE FOR PURIFYING BLOOD OF FREE CIRCULATING DNA
WO2019212694A1 (en) * 2018-04-30 2019-11-07 Viktor Veniaminovich Tets Tetz-proteins and prion-like proteins and associated methods
WO2020006389A1 (en) * 2018-06-29 2020-01-02 Viktor Veniaminovich Tets Compositions for modulating gut microbiota
WO2021011368A1 (en) * 2019-07-12 2021-01-21 Dmitry Dmitrievich Genkin Treatment of diseases associated with protein misfolding by nervous system expression of an enzyme which has a deoxyribonuclease (dnase) activity
EP4119149A1 (en) * 2021-07-15 2023-01-18 Foundation For Research And Technology Hellas Extracellular vesicles comprising a therapeutic cargo
WO2023126672A1 (en) 2021-12-27 2023-07-06 Santersus Ag Method and device for removal of circulating cell free dna
US11701410B2 (en) 2015-05-22 2023-07-18 Cls Therapeutics Limited Extracellular DNA as a therapeutic target in neurodegeneration
US11905522B2 (en) 2018-01-16 2024-02-20 Cls Therapeutics Limited Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNase) activity
US11918610B2 (en) 2018-06-29 2024-03-05 Viktor Veniaminovich Tets Methods for diagnosis and treatment of type 1 diabetes
US12274720B2 (en) 2017-05-24 2025-04-15 Viktor Veniaminovich Tets Methods for treating and preventing diseases
US12545965B2 (en) 2018-07-03 2026-02-10 Viktor Veniaminovich Tets Method for assessing and inhibiting aging and means of determining biological age

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110129245B (zh) * 2019-07-08 2020-12-04 南京工业大学 一株敲除胞外核酸酶ExeP的谷氨酸棒杆菌及其构建方法与应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008039989A2 (en) * 2006-09-28 2008-04-03 Transave, Inc. Formulations of dnase and methods of use thereof
IL199005A (en) * 2006-11-28 2012-04-30 Dmitry Dmitrievich Genkin DNA enzyme for use in the treatment of diseases associated with increased levels of deoxyribonucleic acid in extracellular spaces
US20120252750A1 (en) * 2003-07-25 2012-10-04 University Of Massachusetts Formulations for reducing neuronal degeneration

Family Cites Families (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3224942A (en) 1962-01-15 1965-12-21 Rorer Inc William H Anti-inflammatory, anti-edema and anti-thrombi drug
US3324002A (en) 1962-09-17 1967-06-06 Armour Pharma Anti-inflammatory preparations containing proteolytic enzymes and adrenal glucocorticoids
JPS5826822A (ja) 1981-08-10 1983-02-17 Kaken Pharmaceut Co Ltd 慢性腎炎治療剤
JPS61293927A (ja) 1986-06-18 1986-12-24 Kaken Pharmaceut Co Ltd 肝臓疾患予防治療剤
US4985243A (en) 1988-01-20 1991-01-15 Ml Technology Ventures, L.P. Composition and method for protecting against diseases caused by microorganisms
EP0449968B1 (en) 1988-12-23 1999-02-24 Genentech, Inc. Process for the preparation of human dnase
US5464817A (en) 1990-04-11 1995-11-07 Brigham And Women's Hospital Method for reducing the viscosity of pathological mucoid airway contents in the respiratory tract comprising administering actin-binding compounds with or without DNASE I
DE4024530A1 (de) 1990-08-02 1992-02-06 Klinger & Co Dr Verfahren zur bekaempfung von viren
FR2666096B1 (fr) 1990-08-21 1993-12-31 Sfri Sa Nouveau procede de dosage d'acide desoxyribonucleique present en position extracellulaire dans un milieu.
WO1993003709A1 (en) 1991-08-16 1993-03-04 Vical, Inc. Composition and method for treating cystic fibrosis
US5484589A (en) 1992-04-20 1996-01-16 Rufeld, Inc. Anti-viral methods using RNAse and DNAse
NZ299257A (en) 1992-06-08 2000-08-25 Genentech Inc Treating purulent material (eg pulmonary disease) accumulation in patients using deamidated DNase
AU7212694A (en) 1993-06-24 1995-01-17 Rufeld, Inc. Inhibition of human immunodeficiency virus reproduction by deoxyribonuclease i
CH686982A5 (fr) 1993-12-16 1996-08-15 Maurice Stroun Méthode pour le diagnostic de cancers.
RU2099080C1 (ru) 1994-02-11 1997-12-20 Дмитрий Иванович Финько Способ предотвращения развития рака
ATE268605T1 (de) 1994-03-04 2004-06-15 Genentech Inc Pharmazeutische akzeptabel dnase zusammensetzung
US5830744A (en) 1995-06-06 1998-11-03 Human Genome Sciences, Inc. Gene encoding human Dnase
DE69533987T2 (de) 1994-05-20 2006-03-16 Hisamitsu Pharmaceutical Co., Inc., Tosu Protein oder polypeptid, verfahren zur seiner herstellung und entsprechende zwischenprodukte
NZ331063A (en) 1996-02-05 2000-03-27 Inc Genentech Isolated nucleotide sequences encoding for mature LS- DNase which is resistant to actin inhibition
AU2324997A (en) 1996-03-15 1997-10-01 Penn State Research Foundation, The Detection of extracellular tumor-associated nucleic acid in blood plasma or ser um using nucleic acid amplification assays
US6391607B1 (en) 1996-06-14 2002-05-21 Genentech, Inc. Human DNase I hyperactive variants
US5855920A (en) 1996-12-13 1999-01-05 Chein; Edmund Y. M. Total hormone replacement therapy
US6242426B1 (en) 1997-07-25 2001-06-05 Avigen, Inc. Induction of immune response to antigens expressed by recombinant adeno-associated virus
US6455250B1 (en) 1997-12-11 2002-09-24 The Regents Of The University Of California Endonuclease compositions and methods of use
NZ509273A (en) 1998-07-16 2003-05-30 Res Dev Foundation DNA-cleaving antitumor agents containing a benzimidazole derivative
US6465177B1 (en) 1998-10-26 2002-10-15 John Wayne Cancer Institute Detection of loss of heterozygosity in tumor and serum of melanoma patients
JP2002530436A (ja) 1998-11-25 2002-09-17 ジェネティカ インコーポレイテッド 増殖能を増強しかつ複製老化を防止する方法及び試薬
JP2000229881A (ja) 1999-02-10 2000-08-22 Morinaga Milk Ind Co Ltd 癌疾患の予後改善剤
WO2001012793A1 (en) 1999-08-17 2001-02-22 Tanuma Sei Ichi Novel deoxyribonuclease, gene encoding the same and use thereof
US6428785B1 (en) 1999-10-28 2002-08-06 Immunolytics Inc. Method and composition for treating prostate cancer
UA78486C2 (uk) 1999-12-10 2007-04-10 Хемджен Корпорейшн Композиція для перорального введення птахам та тваринам для лікування або зниження ризику інфекції травного тракту (варіанти), її застосування (варіанти) та спосіб лікування або зниження ризику інфекцій травного тракту (варіанти)
WO2001074905A1 (en) 2000-04-03 2001-10-11 Antisoma Research Limited Compounds for targeting
US6462017B1 (en) 2000-05-01 2002-10-08 Sciclone Pharmaceuticals, Inc. Method of reducing side effects of chemotherapy in cancer patients
RU2202109C1 (ru) 2001-08-03 2003-04-10 Научно-исследовательский институт неврологии РАН Способ выявления степени нарушения реологических свойств крови
RU2207876C1 (ru) 2001-11-08 2003-07-10 Ткаченко Виталий Васильевич Способ комплексно-индивидуализированного воздействия на организм при медленной вирусной инфекции и способ подготовки лабораторного животного для испытания способа такого воздействия
US7402724B2 (en) 2002-01-04 2008-07-22 Mayo Foundation For Medical Education And Research Longevity and PAPP-A
CA2516322C (en) * 2002-02-18 2013-10-15 University Of Southampton Glycosaminoglycan-dnase combination therapy
DE10221194B4 (de) 2002-05-13 2005-02-10 Fryda, Waltraud, Dr.med. Hyaluronidasehaltiges Hautpflegemittel
US20040001817A1 (en) 2002-05-14 2004-01-01 Giampapa Vincent C. Anti-aging nutritional supplement
DE60219809T2 (de) 2002-12-18 2008-01-17 Coy, Johannes F., Dr. Verbindungen und Verfahren zur Nachweiss von Karzinomen und deren Vorstufen
RU2239442C1 (ru) 2003-05-05 2004-11-10 Красноярская государственная медицинская академия Способ профилактики внутриутробных инфекций у детей
WO2005004904A1 (en) 2003-07-14 2005-01-20 Dmitry Dmitrievich Genkin Method for treating diseases associated with modifications of qualitative and/ quantitative composition of blood extracellular dna (variants)
US8710012B2 (en) 2003-07-14 2014-04-29 Cls Therapeutics Limited Method for treating oncological diseases
RU2269358C2 (ru) 2003-07-14 2006-02-10 Дмитрий Дмитриевич Генкин Способ лечения генерализованных инфекций, вызываемых бактериями, или заболеваний, вызываемых грибами и простейшими, или атеросклероза, или сахарного диабета, или заболеваний, связанных с реакцией гиперчувствительности замедленного типа, или заболеваний, обусловленных мутациями генов соматических клеток
US9248166B2 (en) 2003-07-14 2016-02-02 Cls Therapeutics Limited Method for treating oncological diseases
AU2003298972A1 (en) 2003-07-14 2005-02-04 Dmitry Dmitrievich Genkin Method for treating oncological, virulent and somatic diseases, method for controlling treatment efficiency, pharmaceutical agents and composition for carrying out said treatment
RU2269359C2 (ru) 2004-03-12 2006-02-10 Дмитрий Дмитриевич Генкин Способ профилактики развития онкологических заболеваний или инфекций, вызываемых бактериями, грибами и простейшими, или атеросклероза, или сахарного диабета, или заболеваний, связанных с реакцией гиперчувствительности замедленного типа, или заболеваний, развивающихся вследствие мутации генов соматических клеток (варианты)
WO2006130034A1 (fr) 2005-04-25 2006-12-07 Dmitry Dmitrievich Genkin Procede pour prolonger la duree de vie d'animaux ou de l'humain
US8388951B2 (en) 2003-07-14 2013-03-05 Cls Therapeutics Limited Method for treating systemic DNA mutation disease
US8431123B2 (en) * 2003-07-14 2013-04-30 Cls Therapeutics Limited Method for treating systemic bacterial, fungal and protozoan infection
RU2269356C2 (ru) 2003-07-14 2006-02-10 Дмитрий Дмитриевич Генкин Способ лечения онкологических заболеваний
RU2239404C1 (ru) 2003-09-17 2004-11-10 Бессонов Дмитрий Михайлович Способ профилактики старения организма человека
RU2267329C2 (ru) 2004-03-12 2006-01-10 Дмитрий Дмитриевич Генкин Способ лечения заболеваний, сопровождающихся изменениями качественного и/или количественного состава внеклеточной днк крови (варианты)
RU2269357C2 (ru) 2004-03-12 2006-02-10 Дмитрий Дмитриевич Генкин Способ замедления наступления болезненных состояний, связанных с увеличением возраста человека
US9592277B2 (en) 2004-04-14 2017-03-14 Avirid, Inc. Compositions with modified nucleases targeted to viral nucleic acids and methods of use for prevention and treatment of viral diseases
ES2665422T3 (es) * 2005-03-03 2018-04-25 Immunomedics Inc. Anticuerpos L243 humanizados
JP3989936B2 (ja) 2005-04-07 2007-10-10 進 須永 抗腫瘍剤及び新規dnアーゼ
EP2484768A3 (en) 2005-07-18 2012-11-21 Protalix Ltd. Mucosal or enteral administration of biologically active macromolecules
RU2308968C2 (ru) 2005-07-19 2007-10-27 Дмитрий Дмитриевич Генкин Способ лечения заболеваний человека, сопровождающихся повышенным содержанием дезоксирибонуклеиновой кислоты во внеклеточных пространствах тканей, и лекарственный препарат для его реализации
EP2416156B1 (en) 2006-10-18 2015-12-30 Periness Ltd. Method for determining a male fertility status
GB0922006D0 (en) 2009-12-17 2010-02-03 Genome Res Ltd Diagnostic
CA2814962A1 (en) * 2010-12-02 2012-06-07 Immunomedics, Inc. In vivo copper-free click chemistry for delivery of therapeutic and/or diagnostic agents
US20130243794A1 (en) 2010-12-03 2013-09-19 Beth Israel Deaconess Medical Center, Inc. Methods for predicting and treating infection-induced illnesses and predicting the severity of infection-induced illnesses
US9603907B2 (en) 2012-02-01 2017-03-28 Protalix Ltd. Dry powder formulations of dNase I
MX367100B (es) 2012-02-17 2019-08-05 The Children´S Hospital Of Philadelphia Composiciones del vector aav y metodos para su transferencia genetica a celulas, organos y tejidos.
KR102082735B1 (ko) 2012-08-03 2020-02-28 훼링 비.브이. 암컷 불임에 대한 치료학적 타겟 및 진단 마커로서의 세포-유리 dna
CN106232618A (zh) 2013-10-11 2016-12-14 马萨诸塞眼科耳科诊所 预测祖先病毒序列的方法及其用途
AU2015234242B2 (en) 2014-03-21 2020-09-24 Children's Medical Research Institute Stable gene transfer to proliferating cells
EP4344741A3 (en) 2014-11-21 2024-08-28 The University of North Carolina at Chapel Hill Aav vectors targeted to the central nervous system
ES2799515T3 (es) 2015-05-22 2020-12-18 Dmitry Dmitrievich Genkin ADN extracelular como una diana terapéutica en la neurodegeneración
SG11201802408RA (en) 2015-11-05 2018-05-30 Bamboo Therapeutics Inc Modified friedreich ataxia genes and vectors for gene therapy
EP3420077A4 (en) 2016-02-25 2019-12-25 Agenovir Corporation VIRAL AND ONCOVIRAL NUCLEASE TREATMENT

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120252750A1 (en) * 2003-07-25 2012-10-04 University Of Massachusetts Formulations for reducing neuronal degeneration
WO2008039989A2 (en) * 2006-09-28 2008-04-03 Transave, Inc. Formulations of dnase and methods of use thereof
IL199005A (en) * 2006-11-28 2012-04-30 Dmitry Dmitrievich Genkin DNA enzyme for use in the treatment of diseases associated with increased levels of deoxyribonucleic acid in extracellular spaces

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GLEBOVA KV. ET AL.: "Properties of extracellular DNA from the cerebrospinal fluid and blood plasma during Parkinson's disease.", BULL EXP BIOL MED., vol. 156, no. 6, April 2014 (2014-04-01), pages 826 - 828, XP055334318 *
KADIOGLU E. ET AL.: "Detection of oxidative DNA damage in lymphocytes of patients with Alzheimer's disease.", BIOMARKERS, vol. 9, no. 2, March 2004 (2004-03-01), pages 203 - 209, XP055416369 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11701410B2 (en) 2015-05-22 2023-07-18 Cls Therapeutics Limited Extracellular DNA as a therapeutic target in neurodegeneration
WO2018197547A1 (en) * 2017-04-25 2018-11-01 Lipoxen Technologies Limited Methods of treating diseases related to net formation with parenteral administration of polysialylated dnase i
US12274720B2 (en) 2017-05-24 2025-04-15 Viktor Veniaminovich Tets Methods for treating and preventing diseases
EP4011413A1 (en) 2017-09-18 2022-06-15 Santersus AG Method and device for purification of blood from circulating cell free dna
EP3978923A1 (en) 2017-09-18 2022-04-06 Santersus AG Method and device for purification of blood from circulating cell free dna
WO2019053243A1 (en) 2017-09-18 2019-03-21 Santersus Sa METHOD AND DEVICE FOR PURIFYING BLOOD OF FREE CIRCULATING DNA
US11905522B2 (en) 2018-01-16 2024-02-20 Cls Therapeutics Limited Treatment of diseases by liver expression of an enzyme which has a deoxyribonuclease (DNase) activity
US12535491B2 (en) 2018-04-30 2026-01-27 Viktor Veniaminovich Tets Vaccine comprising protein-targeted (PT) extracellular DNA isolated from bacterial matrix
WO2019212694A1 (en) * 2018-04-30 2019-11-07 Viktor Veniaminovich Tets Tetz-proteins and prion-like proteins and associated methods
WO2020006389A1 (en) * 2018-06-29 2020-01-02 Viktor Veniaminovich Tets Compositions for modulating gut microbiota
US12480150B2 (en) 2018-06-29 2025-11-25 Viktor Veniaminovich Tets and Georgy Viktorovich TETS Compositions for modulating gut microbiota
US11918610B2 (en) 2018-06-29 2024-03-05 Viktor Veniaminovich Tets Methods for diagnosis and treatment of type 1 diabetes
US12545965B2 (en) 2018-07-03 2026-02-10 Viktor Veniaminovich Tets Method for assessing and inhibiting aging and means of determining biological age
WO2021011368A1 (en) * 2019-07-12 2021-01-21 Dmitry Dmitrievich Genkin Treatment of diseases associated with protein misfolding by nervous system expression of an enzyme which has a deoxyribonuclease (dnase) activity
EP4119149A1 (en) * 2021-07-15 2023-01-18 Foundation For Research And Technology Hellas Extracellular vesicles comprising a therapeutic cargo
WO2023126672A1 (en) 2021-12-27 2023-07-06 Santersus Ag Method and device for removal of circulating cell free dna

Also Published As

Publication number Publication date
RU2017145051A3 (cg-RX-API-DMAC7.html) 2019-06-24
US20180360925A1 (en) 2018-12-20
EP3297657A4 (en) 2018-11-14
ES2799515T3 (es) 2020-12-18
JP2018520208A (ja) 2018-07-26
US11701410B2 (en) 2023-07-18
RU2017145051A (ru) 2019-06-24
EP3297657A1 (en) 2018-03-28
RU2726131C2 (ru) 2020-07-09
CN108289932A (zh) 2018-07-17
JP6745873B2 (ja) 2020-08-26
EP3297657B1 (en) 2020-03-25

Similar Documents

Publication Publication Date Title
US11701410B2 (en) Extracellular DNA as a therapeutic target in neurodegeneration
CN113164508B (zh) 与神经保护剂组合的sarm1抑制剂
US20260034156A1 (en) Inhibitors of sarm1 in combination with nad+ or a nad+ precursor
US12338238B2 (en) Inhibitors of SARM1
US12595481B2 (en) Methods and compositions for neuroprotection
US10729749B2 (en) Neurodegenerative disorders
US20130316961A1 (en) Treatment of mecp-2 associated disorders
AU2014302313A1 (en) Rett syndrome and treatments therefore
Gentile et al. Laquinimod ameliorates excitotoxic damage by regulating glutamate re-uptake
US11447775B2 (en) Antisense oligonucleotides targeting alpha-synuclein and uses thereof
KR20160147709A (ko) 4-메틸피라졸을 사용하여 인간 대상을 치료하기 위한 유전자형 특이적 방법
EP3119388B1 (en) Carboxy-cyclopropyl undecanol compounds for treatment of liver disease and other medical disorders
JP4619666B2 (ja) 医薬組成物
CN100525764C (zh) 吡唑并吡啶在制备治疗认知缺陷的药物中的应用
WO2003097024A1 (en) Methods for the prevention and/or the treatment of neurological disorders
RU2840475C2 (ru) Альфа-1-антитрипсин (ААТ) в лечении и (или) профилактике неврологических нарушений
CA3159374C (en) Methods and compositions for neuroprotection
CA2968933C (en) Peptides for use in neurodegenerative disorders
US20080280983A1 (en) Methods of treating rett syndrome
Millichap Betamethasone Treatment Of Ataxia-Telangiectasia
HK1085645B (en) Use of etazolate for the treatment of degenerative ocular pathologies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16800375

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018513264

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016800375

Country of ref document: EP

Ref document number: 2017145051

Country of ref document: RU