WO2016182321A1 - L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법 - Google Patents

L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법 Download PDF

Info

Publication number
WO2016182321A1
WO2016182321A1 PCT/KR2016/004893 KR2016004893W WO2016182321A1 WO 2016182321 A1 WO2016182321 A1 WO 2016182321A1 KR 2016004893 W KR2016004893 W KR 2016004893W WO 2016182321 A1 WO2016182321 A1 WO 2016182321A1
Authority
WO
WIPO (PCT)
Prior art keywords
tryptophan
gene
microorganism
activity
producing
Prior art date
Application number
PCT/KR2016/004893
Other languages
English (en)
French (fr)
Inventor
이석명
이백석
김경림
이광호
이근철
홍형표
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP16792967.8A priority Critical patent/EP3296400B1/en
Priority to CN201680000670.0A priority patent/CN106604987B/zh
Priority to JP2017559098A priority patent/JP6596105B2/ja
Priority to DK16792967.8T priority patent/DK3296400T3/da
Priority to ES16792967T priority patent/ES2876949T3/es
Priority to RU2017141773A priority patent/RU2692645C2/ru
Priority to US15/573,236 priority patent/US10081822B2/en
Priority to BR112017024401-2A priority patent/BR112017024401A2/pt
Publication of WO2016182321A1 publication Critical patent/WO2016182321A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03074—Pyridoxal phosphatase (3.1.3.74)

Definitions

  • the present invention relates to an Escherichia genus microorganism having L-tryptophan production ability, which is mutated to inactivate the phosphatase, and a method for producing L-tryptophan using the microorganism.
  • L-tryptophan is one of the essential amino acids has been widely used as a pharmaceutical raw material and health food material such as feed additives, infusions and the like. As such, L-tryptophan may be produced through chemical synthesis, enzyme reaction, fermentation, etc., but direct fermentation using microorganisms is currently used.
  • L-tryptophan-producing strains Development of L-tryptophan-producing strains is initially carried out by mutation screening (Korean Patent Registration No. 1987-0001813), or with the development of genetic engineering to overcome tryptophan feedback inhibition of biosynthetic pathway enzymes, or tryptophan biosynthesis enzymes.
  • the development of tryptophan-producing strains was carried out through enhanced enzyme synthesis of metabolic processes, such as enhanced expression.
  • tryptophan producing strains with high efficiency yields for industrial use there is still a need for the development of tryptophan producing strains with high efficiency yields for industrial use.
  • tryptophan synthase (EC 4.2.1.20), which participates in the final stage of the tryptophan biosynthesis by microorganisms, is known to use PLP (Pyridoxal Phosphate) as a coenzyme.
  • PLP Pyridoxal Phosphate
  • phosphohydroxythreonine aminotransferase (EC 2.6.1.52) encoded by serC uses PLP as a coenzyme.
  • PLP is an important coenzyme.
  • the present inventors have made intensive efforts to develop a method for producing L-tryptophan with high efficiency. As a result, the present inventors have tried to prevent degradation of the coenzyme PLP, maintain appropriate concentration of PLP in the cell, and increase tryptophan production ability. As a result of inactivating the protein described by the amino acid of SEQ ID NO: 1 encoded by the yigL gene, which is not yet clear, it was confirmed that tryptophan production ability was improved, thereby completing the present invention.
  • One object of the present invention is to provide an Escherichia microorganism having L-tryptophan production capacity.
  • Another object of the present invention is to provide a method for producing L-tryptophan using a microorganism having the L-tryptophan production capacity.
  • the present invention provides an Escherichia genus microorganism having L-tryptophan production ability, which is mutated to inactivate the activity of phosphatase having the amino acid sequence of SEQ ID NO: 1, thereby using L-tryptophan in a high yield efficiently and economically. It shows the effect that can be produced.
  • L-tryptophan prepared through this can be applied to various products such as human food or food additives, pharmaceuticals as well as animal feed or feed additives.
  • the genus Escherichia microorganism having L-tryptophan production capacity may be a microorganism having increased tryptophan production capacity compared to the Escherichia genus microorganism having L-tryptophan production capacity that is not changed to inactivate phosphatase activity. have.
  • L-tryptophan is one of ⁇ -amino acids and refers to an aromatic L-amino acid having an essential amino acid not synthesized in the body and having a chemical formula of C 11 H 12 N 2 O 2 .
  • methods of enhancing the expression of biosynthetic enzymes on the tryptophan production pathway or blocking the side pathways have been used.
  • phosphatase may be a protein that catalyzes a reaction for removing phosphate groups from a substrate.
  • phosphatase having the amino acid sequence of SEQ ID NO: 1 is a protein encoded by the gene yigL, and is presumed to catalyze the reaction of decomposing pyridoxal and phosphoric acid using PLP as a substrate.
  • NCBI For the protein encoded by yigL, NCBI (http://www.ncbi.nlm.nih.gov) DB is named as PLP phosphatase (pyridoxal phosphate phsphatase) (NCBI gene ID: 12930615), EcoCyc DB (http http://www.ecocyc.org) is known as phosphosugar phosphatase, so it is not known which is the main function. Recent studies have reported that yigL expression is induced by heat shock (J. Gen. Appl.
  • the enzyme is not only the amino acid sequence set forth in SEQ ID NO: 1, but also 70% or more, specifically 80% or more, more specifically 90% or more, more specifically 95% or more, more specifically Is an amino acid sequence showing at least 98%, more specifically at least 99% homology, and may include any enzyme that has substantially the same or equivalent potency as the enzyme.
  • it is an amino acid sequence having such homology and exhibiting efficacy corresponding to each enzyme, it is obvious that enzyme variants having amino acid sequences in which some sequences are deleted, modified, substituted or added are also included within the scope of the present invention.
  • the gene encoding the phosphatase described in amino acid sequence number 1 may be included without limitation so long as it is a sequence capable of encoding the enzyme, and may be represented by a yigL gene.
  • the gene encoding the enzyme is 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 98% or more with the sequence as well as the nucleotide sequence set forth in SEQ ID NO: 2
  • the base sequence may exhibit 99% or more homology, and may include any gene sequence encoding an enzyme having substantially the same or equivalent potency as the enzyme.
  • the base sequence having such homology it is obvious that the base sequence in which some sequences are deleted, modified, substituted or added is also included in the scope of the present invention.
  • homology refers to the percent identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another may be determined by known techniques. For example, homology may be sequence information between two polynucleotide molecules or two polypeptide molecules, such as score, identity, and similarity, using a computer program that aligns the sequence information and is readily available. Parameters can be determined by direct alignment (eg BLAST 2.0). In addition, homology between polynucleotides can be determined by hybridization of polynucleotides under conditions of stable double-stranding between homologous regions, followed by digestion with single-strand-specific nucleases to determine the size of the digested fragments.
  • intrinsic activity refers to the active state of an enzyme that a microorganism possesses in its natural state or before modification of the enzyme.
  • the "mutated to inactivate the activity” means that the expression of the gene encoding the enzyme is not expressed at all, and / or even if the expression is not at all compared to the native strain or strain before modification.
  • the inactivation of activity relative to the intrinsic activity means that the activity of the microorganism is reduced or not, as compared with the activity of the enzyme that the original microorganism has in its natural state or before transformation.
  • the decrease is due to mutation of the gene encoding the enzyme, such that the activity of the enzyme itself is lower than the activity of the enzyme originally possessed by the microorganism, and the inhibition of expression or translation of the gene encoding the enzyme in the cell. If the overall degree of enzymatic activity is low compared to the native strain or the strain before modification, the concept also includes a combination thereof.
  • Methods for mutating such enzymatic activity can be accomplished by the application of various methods well known in the art.
  • the method include a method of replacing a gene encoding the enzyme on a chromosome with a mutated gene such that the activity of the enzyme is reduced, including when the activity of the enzyme is removed; Deleting part or all of the gene encoding the enzyme; Replacing the expression control sequence of the gene encoding the enzyme with a sequence having weak or no activity; Introducing a mutation into an expression control sequence of a gene on a chromosome encoding said enzyme; Deleting all or part of a gene on a chromosome that encodes the enzyme; Introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to a transcript of a gene on the chromosome to inhibit translation from the mRNA to an enzyme; The method of artificially adding a sequence complementary to the SD sequence in front of the SD sequence of the gene encoding the enzyme
  • a method for deleting part or all of a gene encoding an enzyme replaces a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or marker gene in which some nucleic acid sequences are deleted through a bacterial chromosome insertion vector. This can be done by.
  • a method of deleting part or all of such genes a method of deleting genes by homologous recombination may be used.
  • part may vary depending on the type of polynucleotide, but may be specifically 1 to 300, specifically 1 to 100, and more specifically 1 to 50, but is not particularly limited thereto.
  • homologous recombination refers to genetic recombination occurring through linkage exchange at the locus of gene chains having homology with each other.
  • the method of modifying an expression control sequence is carried out by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, in the nucleic acid sequence of the expression control sequence, or by replacement with a weaker promoter. It may be carried out by a method such as.
  • the expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls the termination of transcription and translation.
  • a method of modifying a gene sequence on a chromosome may be performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or further weakening the activity so that the activity of the enzyme is further reduced. It can be carried out by replacing with a gene sequence that has been improved to have or a gene sequence that has been improved so that there is no activity.
  • a variety of E. coli having tryptophan-producing ability, which has deleted yigL, a gene encoding the phosphatase does not delete yigL. It was confirmed that the production capacity of L-tryptophan was increased compared to the parent strain, and thus, the mutated Escherichia spp. Microorganism having a mutant L-tryptophan production capacity which inactivated endogenous phosphatase activity can efficiently produce L-tryptophan. It was confirmed.
  • the microorganism having the L-tryptophan production capacity refers to a microorganism capable of producing L-tryptophan from a carbon source in the medium.
  • the microorganism producing L-tryptophan may be a recombinant microorganism.
  • the type is not particularly limited, but the genus Enterbacter, Escherichia, Erwinia, Serratia, Providencia ( It may be a microorganism belonging to the genus Providencia, Corynebacterium and Brevibacterium, specifically, may be a microorganism belonging to the genus Escherichia.
  • Escherichia microorganism may specifically be Escherichia coli , but microorganisms belonging to the genus Escherichia where phosphatase activity is inactivated and L-tryptophan production may be increased may be included without limitation. have.
  • Microorganism having L-tryptophan production ability by inactivation of the activity of the phosphatase in the present invention is not particularly limited as long as it is a microorganism having tryptophan production ability.
  • Microorganisms with tryptophan production capacity for example, to attenuate or inactivate the activity of genes of the competitive pathway, modulators of the directional pathway of tryptophan operon, tryptophan influx genes, tryptophan influx and degradation genes to enhance tryptophan biosynthetic pathways Or microorganisms that overexpress the activity of tryptophan operon.
  • the overexpression of tryptophan operon activity includes a known method without limitation, for example, a method of additionally inserting a polynucleotide containing an expression control site introduced by itself or externally part or all of the nucleotide sequence of the operon gene to the chromosome , A method of increasing the number of copies by introducing into a vector system, substituting other regulatory sequences for expression control regions that control the expression of genes, modifications in which all or part of the nucleotide sequence of the expression control regions are induced, It may include a method such as enhancing the operon activity by introducing a mutation, but is not limited thereto. Specifically, it may be E. coli, in which all or part of the pheA, trpR, mtr and / or tnaAB genes are deleted, and / or the tryptophan operon is overexpressed.
  • the genes and protein sequences used in the present invention can be obtained from known databases, for example from GenBank of NCBI, etc. May be, but is not limited thereto.
  • the details of the pheA, trpR, mtr and tnaAB gene, etc. can refer to the contents described in the Republic of Korea Patent Registration No. 10-0792095, Republic of Korea Patent Publication No. 10-2013-0082121, the entire specification of the patent It may be included as a reference of the present invention.
  • the method comprises the steps of culturing an Escherichia spp. Microorganism having L-tryptophan production capacity in a medium, wherein the activity of the phosphatase comprising the amino acid sequence of SEQ ID NO: 1 of the present invention is inactivated; And it provides a method for producing L- tryptophan, comprising the step of recovering L-tryptophan from the medium or the microorganism according to the culture.
  • the medium and other culture conditions used for the cultivation of the microorganism of the present invention may be any medium without particular limitation as long as it is a medium used for the cultivation of ordinary Escherichia microorganism, but specifically, the microorganism of the present invention may be a suitable carbon source, nitrogen source. It can be cultured under aerobic conditions by adjusting the temperature, pH, etc. in a conventional medium containing the number of people, inorganic compounds, amino acids and / or vitamins.
  • the carbon source includes carbohydrates such as glucose, fructose, sucrose, maltose, mannitol, sorbitol and the like; Alcohols such as sugar alcohols, glycerol, pyruvic acid, lactic acid, citric acid and the like; Amino acids such as organic acids, glutamic acid, methionine, lysine and the like.
  • natural organic nutrients such as starch hydrolyzate, molasses, blackstrap molasses, rice winters, cassava, sugarcane residue and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (ie, reducing sugars).
  • Carbohydrates, such as molasses), and other appropriate amounts of carbon sources can be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more thereof, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or their degradation products, skim soy cakes or their degradation products Can be used. These nitrogen sources may be used alone or in combination of two or more thereof, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptones, NZ-amines
  • the personnel may include a first potassium phosphate, a second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • a first potassium phosphate sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate and the like may be used, and other amino acids, vitamins and / or suitable precursors may be included. These media or precursors may be added batchwise or continuously to the culture.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid and the like can be added to the culture in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without injecting gas to maintain anaerobic and unaerobic conditions.
  • the temperature of the culture may be specifically 27 ° C to 40 ° C, more specifically 30 ° C to 37 ° C, but is not limited thereto.
  • the incubation period may continue until the desired amount of useful material is obtained, specifically, may be 10 hours to 100 hours, but is not limited thereto.
  • the recovering L-tryptophan may be carried out using a suitable method known in the art according to the method of culturing the microorganism of the present invention, for example, a batch, continuous or fed-batch culture method, to obtain the desired L-tryptophan from the culture solution. It can be recovered.
  • the recovery step may comprise a purification process.
  • the purification process may purify the recovered L-tryptophan using any suitable method known in the art.
  • Example 1 Preparation of wild type strain lacking phosphatase
  • CM-PDT chorismate mutase / prephenate dehydratase
  • pUCprmfmloxP was used as a template using primer combinations of SEQ ID NOs: 3 and 4 having a part of yigL gene and some nucleotide sequences of chloramphenicol resistance gene of pUCprmfmloxP gene, and denatured at 94 ° C for 30 seconds, 30 at 55 ° C, and 30
  • the PCR product ⁇ yigL1st of about 1.2 kb was obtained by primary polymerase chain reaction (hereinafter 'PCR') which repeated 30 cycles consisting of annealing for 1 second and stretching for 1 minute at 72 ° C.
  • PCR product ⁇ yigL1st obtained through PCR was eluted after electrophoresis on 0.8% agarose gel to be used as a template for secondary PCR.
  • Secondary PCR is based on the eluted primary PCR product as a template using a combination of SEQ ID NOs: 5 and 6 comprising 20 bp sequences of the 5 'and 3' regions of the PCR product obtained in the primary PCR.
  • SEQ ID NOs: 5 and 6 comprising 20 bp sequences of the 5 'and 3' regions of the PCR product obtained in the primary PCR.
  • the E. coli W3110 trp ⁇ 2 transformed with the pKD46 vector was prepared according to the one-step inactivation method developed by Datsenko KA et al. (Proc Natl Acad Sci USA., (2000) V97, pp6640-6645). Thereafter, 1.3 kb of fragment ⁇ yigL obtained through primary and secondary PCR were introduced and transformed. Thereafter, primary transformants having chloramphenicol resistance were selected by culturing in LB medium containing chloramphenicol.
  • the pJW168 vector (Gene, (2000) V247, pp255-264) was introduced to remove the chloramphenicol marker gene from the cells (Gene, (2000) V247 , pp255-264). From the finally obtained cells confirmed that the yigL gene was deleted by the PCR product of about 0.6 kb obtained by PCR using the primers of SEQ ID NO: 7 and 8, was named W3110 trp ⁇ 2 yigL.
  • PCL-Dtrp_att-trpEDCBA and pBAC-Dtrp_att-trpDCBA were introduced into each strain in order to compare the tryptophan production capacity of W3110 trp ⁇ 2 yigL prepared in Example 1 and the parent strain W3110 trp ⁇ 2.
  • the introduced vectors are vectors in which tryptophan operon expression is enhanced so that the regulation mechanism of the tryptophan operon regulatory site is released to overproduce tryptophan (Korean Patent Publication No. 10-2013-0082121).
  • Strains into which the vectors were introduced were cultured in tryptophan evaluation medium prepared according to the composition of Table 2 below to compare L-tryptophan production capacity.
  • Tryptophan titer medium composition Composition Concentration (per liter) Glucose 60 g K2HPO4 1 g (NH4) 2SO4 10 g NaCl 1 g MgSO4, 7H2O 1 g Sodium citrate 5 g Yeast Extract 2 g Calcium carbonate 40 g Sodium citrate 5 g Phenylalanine 0.15 g Tyrosine 0.1 g pH 6.8
  • E. coli KCCM 11166P and E. coli CA04-2803 which were incubated overnight on a LB solid medium in a 37 ° C. incubator, were inoculated with one platinum each of the 25 ml titer medium shown in Table 4 above, followed by a 37 ° C. and 200 rpm incubator. Incubated for 48 hours at and compared the sugar consumption rate and tryptophan concentration.
  • the inventors have confirmed that the tryptophan production capacity is increased in the inactivated strain lacking the yigL coding for the phosphatase based on the KCCM11166P strain, and the strain is named "CA04-2803" or "CA04-2803 (KCCM11166P_ ⁇ yigL)". It was deposited on 5 December 2014 by KCCM, an international depositary organization under the Budapest Treaty, and was given accession number KCCM11635P.
  • the strain which inactivated the phosphatase activity in the tryptophan producing Escherichia genus microorganism of the present invention increases the L-tryptophan production capacity than the strain which does not inactivate the enzyme.
  • the results of this increase in tryptophan production are inferred to be due to the inactivation of phosphatase encoded by yigL and the inactivation of the function as PLP phosphatase, which is estimated to be one of the expected functions of phosphatase encoded by the gene. This is likely due to elevated PLP concentrations in cells.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 포스파타제의 활성을 불활성화시킴으로써, L-트립토판 생산능이 향상된 에스케리키아속 미생물에 관한 것이다. 또한, 본 발명은 상기 에스케리키아속 미생물을 이용하여 L-트립토판을 제조하는 방법에 관한 것이다.

Description

L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 L-트립토판의 제조 방법
본 발명은 포스파타제의 활성이 불활성화되도록 변이된, L-트립토판 생산능을 갖는 에스케리키아속 미생물, 및 상기 미생물을 이용하여 L-트립토판을 제조하는 방법에 관한 것이다.
L-트립토판(L-tryptophan)은 필수 아미노산의 하나로 사료 첨가제, 수액제 등의 의약품 원료 및 건강식품소재 등으로 널리 사용되어 왔다. 이와 같은, L-트립토판은 화학 합성법, 효소 반응법, 발효법 등을 통해 생산될 수 있으나, 현재에는 미생물을 이용한 직접 발효법이 주로 이용되고 있다.
L-트립토판 생산 균주의 개발 방향은 초기에는 돌연변이 선별로 진행되거나(대한민국 특허 등록 제1987-0001813호), 유전공학의 발달과 함께 생합성 경로 효소들의 트립토판 피드백 저해를 극복하는 방법, 혹은 트립토판 생합성 효소의 발현 강화와 같이 대사과정의 효소 합성 강화를 통해 트립토판 생산 균주의 개발이 진행되었다. 그러나, 여전히 산업상 이용하고자 하는 고 효율의 생산량을 갖는 트립토판 생산 균주의 개발의 필요성이 요구되고 있다.
한편, 미생물에 의한 트립토판 생합성에 있어 마지막 단계의 반응에 참여하는 트립토판 신타제(tryptophan synthase, EC 4.2.1.20)는 PLP (Pyridoxal Phosphate)를 조효소로 사용하는 것으로 알려져 있다. 또한, 트립토판 신타제 반응에 기질로 사용되는 세린의 경우에도 serC에 의해 코딩되는 포스포하이드록시쓰레오닌 아미노트랜스퍼라제(phosphohydroxythreonine aminotransferase, EC 2.6.1.52)가 PLP를 조효소로 사용하고 있어, 트립토판 생합성에 있어 PLP는 중요한 조효소라고 할 수 있다.
따라서, PLP의 적절한 농도 유지는 해당 효소의 효율적 반응 및 목적 산물의 생합성 반응에 중요한 역할을 할 것으로 기대할 수 있다. 그러나, 상기 조효소는 트립토판 생산 이외에도 다양한 반응에 관여함에 따라, 적합하게 PLP를 유지시키는 방법이 아직은 없었다. 또한, PLP 를 적절하게 트립토판 생산 미생물 내에서 유지한다고 하더라도 L-트립토판의 생산능이 증가될지 여부는 불분명하다.
본 발명자들은 L-트립토판을 고효율로 생산하기 위한 방법을 개발하기 위해 예의 노력한 결과, 조효소인 PLP의 분해를 막아, 세포 내 PLP의 농도를 적절하게 유지하여, 트립토판 생산능을 증가시키고자, 그 기능이 아직 명확하지 않은 yigL 유전자에 의해 코딩되는 서열번호 1의 아미노산으로 기재된 단백질의 활성을 불활성화시킨 결과, 트립토판 생성능이 향상됨을 확인하여, 본 발명을 완성하였다.
본 발명의 하나의 목적은 L-트립토판 생산능을 갖는 에스케리키아속 미생물을 제공하는 것이다.
본 발명의 또 하나의 목적은 상기 L-트립토판 생산능을 갖는 미생물을 이용하여 L-트립토판을 제조하는 방법을 제공하는 것이다.
본 발명은 서열번호 1의 아미노산 서열을 갖는 포스파타제의 활성이 불활성화되도록 변이된, L-트립토판 생산능을 갖는 에스케리키아속 미생물을 제공하여, 이를 이용해 L-트립토판을 보다 고수율로 효율적이고 경제적으로 제조할 수 있는 효과를 나타낸다. 이를 통해 제조된 L-트립토판은 동물 사료 또는 사료 첨가제뿐만 아니라 인간의 식품 또는 식품 첨가제, 의약품 등 다양한 제품에 응용될 수 있다.
상기 목적을 달성하기 위한 본 발명의 하나의 양태로서, 서열번호 1의 아미노산 서열을 포함하는 포스파타제 (phosphatase)의 활성이 불활성화되도록 변이된, L-트립토판 생산능을 갖는 에스케리키아속(Escherichia) 미생물을 제공한다. 예를 들어, 상기 L-트립토판 생산능을 갖는 에스케리키아속 미생물은 포스파타제의 활성이 불활성화되도록 변이되지 않은 L-트립토판 생산능을 갖는 에스케리키아속 미생물에 비해 트립토판 생산능이 증가된 미생물일 수 있다.
본 발명에서 용어, "L-트립토판(L-tryptophan)"은 α-아미노산의 하나로, 체내에서 합성되지 않는 필수 아미노산이며 화학식이 C11H12N2O2인 방향족 L-아미노산을 말한다. 미생물에서 L-트립토판의 생산능을 증가시키기 위해 기존에는 트립토판 생산 경로 상의 생합성 효소의 발현을 강화시키거나 곁가지 경로를 차단시키는 방법 등이 이용되어 왔다.
본 발명에서 용어, "포스파타제 (phosphatase)"는 기질로부터 인산기를 제거하는 반응을 촉매하는 단백질일 수 있다. 본 발명에서의 "서열번호 1의 아미노산 서열을 갖는 포스파타제"는 유전자 yigL에 의해 코딩되는 단백질로서 PLP를 기질로 하여 피리독살 및 인산으로 분해하는 반응을 촉매하는 것으로 추정된다. 상기 yigL에 의해 코딩되는 단백질의 경우 NCBI(http://www.ncbi.nlm.nih.gov) DB에는 PLP 포스파타제 (pyridoxal phosphate phsphatase)로 명명되어 있고 (NCBI gene ID: 12930615), EcoCyc DB (http://www.ecocyc.org)상에는 당인산 포스파타제 (phosphosugar phosphatase)로 명명되어 있어 어느 것이 더 주요한 기능인지는 밝혀진 바가 없다. 최근 연구에 따르면 yigL의 발현이 heat shock에 의해 유도된다고 보고되기도 하였으며 (J. Gen. Appl. Microbiol., (2005) V51, pp 93-103), sRNA의 일종인 sgrS에 의해 yigL의 번역 (translation)이 활성화되어 세포 내 당인산 (phosphosugar)을 분해한다는 연구 결과도 있으나 (J. Bacteriol. (2013) V195,pp 4804-4815), 아직 명확한 기능이 밝혀진 바는 없다.
이에, 상기 효소는 서열번호 1로 기재한 아미노산 서열뿐만 아니라, 상기 서열과 70% 이상, 구체적으로는 80% 이상, 더욱 구체적으로는 90% 이상, 보다 더욱 구체적으로는 95% 이상, 더 구체적으로는 98% 이상, 더욱더 구체적으로는 99% 이상의 상동성을 나타내는 아미노산 서열로서 실질적으로 상기 효소와 동일하거나 상응하는 효능을 나타내는 효소라면 제한 없이 포함할 수 있다. 또한 이러한 상동성을 갖으며 각 효소에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 효소 변이체도 본 발명의 범위 내에 포함됨은 자명하다.
상기 아미노산 서열번호 1로 기재한 포스파타제를 코딩하는 유전자는 상기 효소를 코딩할 수 있는 서열이라면 제한 없이 포함될 수 있으며, yigL 유전자로 나타낼 수 있다. 구체적으로, 상기 효소를 코딩하는 유전자는 서열번호 2로 기재한 염기서열뿐만 아니라, 상기 서열과 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 98% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 나타내는 염기 서열로서 실질적으로 상기 효소와 동일하거나 상응하는 효능을 나타내는 효소를 코딩하는 유전자 서열이라면 제한 없이 포함할 수 있다. 또한 이러한 상동성을 갖는 염기서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기서열도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에서 용어, "상동성"은 두 개의 폴리뉴클레오티드 또는 폴리펩타이드 모이티 사이의 동일성의 퍼센트를 말한다. 하나의 모이티로부터 다른 하나의 모이티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 상동성은 서열정보를 정렬하고 용이하게 입수 가능한 컴퓨터 프로그램을 이용하여 두 개의 폴리뉴클레오티드 분자 또는 두 개의 폴리펩티드 분자 간의 서열 정보, 예로는 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)를 직접 정렬하여 결정될 수 있다(예: BLAST 2.0). 또한, 폴리뉴클레오티드 간 상동성은 상동 영역 간의 안정된 이중가닥을 이루는 조건하에서 폴리뉴클레오티드의 혼성화한 후, 단일-가닥-특이적 뉴클레아제로 분해시켜 분해된 단편의 크기를 결정함으로써 결정할 수 있다.
본 발명에서 용어, "내재적 활성"은 미생물이 천연의 상태 또는 해당 효소의 변형 전에 가지고 있는 효소의 활성 상태를 의미한다.
상기 "활성이 불활성화되도록 변이된"은 효소를 코딩하는 유전자의 발현이 천연형 균주 또는 변형전의 균주에 비하여 전혀 발현이 되지 않는 경우 및/또는 발현이 되더라도 그 활성이 없거나 감소된 것을 의미한다.
이와 같이 활성이 내재적 활성에 비해 불활성화되는 것은 본래 미생물이 천연의 상태 또는 변형 전의 상태에서 가지고 있는 효소의 활성과 비교하였을 때, 그 활성이 없거나 감소된 것을 의미한다. 상기 감소는 상기 효소를 코딩하는 유전자의 변이 등으로 효소 자체의 활성이 본래 미생물이 가지고 있는 효소의 활성에 비해 낮은 경우와, 이를 코딩하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 효소 활성 정도가 천연형 균주 또는 변형전의 균주에 비하여 낮은 경우, 이들의 조합 역시 포함하는 개념이다.
이러한 효소 활성이 불활성화되도록 변이시키는 방법은, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 효소의 활성이 제거된 경우를 포함하여 상기 효소의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 효소를 코딩하는 유전자를 대체하는 방법; 효소를 코딩하는 유전자의 일부 또는 전체를 결실하는 방법; 상기 효소를 코딩하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법; 상기 효소를 코딩하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 효소를 코딩하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 효소로의 번역을 저해하는 안티센스 올리고뉴클레오티드 (예컨대, 안티센스 RNA)를 도입하는 방법; 상기 효소를 코딩하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜 (ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF (open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE (Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
구체적으로, 효소를 코딩하는 유전자의 일부 또는 전체를 결실하는 방법은, 세균 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이러한 유전자의 일부 또는 전체를 결실하는 방법의 일례로 상동 재조합에 의하여 유전자를 결실시키는 방법을 사용할 수 있다.
상기에서 "일부"란, 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 구체적으로는 1 내지 100개, 더욱 구체적으로는 1 내지 50개일 수 있으나, 특별히 이에 제한되는 것은 아니다.
상기에서 "상동 재조합(homologous recombination)"이란, 서로 상동성을 지닌 유전자 사슬의 좌위에서 연결 교환을 통해 일어나는 유전자 재조합을 의미한다.
구체적으로, 발현 조절 서열을 변형하는 방법은 상기 발현 조절 서열의 핵산 서열에 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 프로모터로 교체하는 등의 방법으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함한다.
아울러, 염색체상의 유전자 서열을 변형하는 방법은 상기 효소의 활성이 더욱 감소되도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있다.
본 발명의 구체적인 실시예에 따르면, 서열번호 1의 아미노산 서열을 갖는 포스파타제의 내재적 활성을 불활성 시키고자, 당해 포스파타제를 코딩하는 유전자인 yigL을 결실시킨, 트립토판 생산능을 갖는 다양한 대장균이 yigL을 결실시키지 않은 모균주에 비해 L-트립토판의 생산능이 증가함을 확인하여, 내재적 포스파타제의 활성을 불활성화시킨 변이된, L-트립토판 생산능을 갖는 에스케리키아속 미생물이 L-트립토판을 효율적으로 생산할 수 있음을 확인하였다.
본 발명에서 상기 L-트립토판 생산능을 갖는 미생물은 상기 배지 중의 탄소원으로부터 L-트립토판을 생산할 수 있는 미생물을 말한다. 또한, 상기 L-트립토판을 생산하는 미생물은 재조합 미생물일 수 있다. 구체적으로 L-트립토판을 생산할 수 있다면 그 종류가 특별히 제한되지 않으나, 엔테로박터(Enterbacter) 속, 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있으며, 구체적으로는 에스케리키아(Escherichia) 속에 속하는 미생물일 수 있다.
더욱 구체적으로는 에스케리키아속(Escherichia) 미생물은 구체적으로 대장균(Escherichia coli)일 수 있으나, 포스파타제 활성이 불활성화되어 L-트립토판 생산능이 증가될 수 있는 에스케리키아속에 속하는 미생물은 제한 없이 포함될 수 있다.
구체적으로 본 발명에서 상기 포스파타제의 활성의 불활성화에 의하여 L-트립토판 생산능을 갖는 에스케리키아속 미생물의 모균주는 트립토판 생산능을 가지는 미생물이라면 특별히 제한되지 않는다. 트립토판 생산능을 가지는 미생물은, 그 예로, 트립토판 생합성 경로를 강화하기 위하여, 경쟁경로의 유전자, 트립토판 오페론의 방향성 경로의 조절자, 트립토판 유입유전자, 트립토판 유입 및 분해 유전자의 활성의 약화 또는 불활성화 시키거나, 및/또는 트립토판 오페론의 활성을 과발현시킨 미생물일 수 있다. 상기 활성의 약화 또는 불활성화 방법은 상기에서 설명한 바와 같으며, 공지의 방법은 제한 없이 포함될 수 있다. 또한, 트립토판 오페론 활성의 과발현은 공지의 방법은 제한없이 포함되나, 그 예로 오페론 유전자의 염기서열 일부 또는 전부 그 자체 혹은 외부로부터 도입된 발현조절부위를 포함하는 폴리뉴클레오타이드를 추가로 염색체에 삽입하는 방법, 벡터 시스템에 도입하는 방법에 의하여 카피수를 증가시키는 방법, 유전자의 발현을 조절하는 발현조절부위를 다른 조절서열로 치환, 발현조절부위의 염기서열 전체 혹은 일부 돌연변이가 유발된 변형, 유전자 자체의 변이도입에 의한 오페론 활성 강화 등에 의한 방법 등을 포함할 수 있으나, 이에 한정되는 것은 아니다. 구체적으로는 pheA, trpR, mtr 및/또는 tnaAB 유전자의 전체 또는 일부가 결실, 및/또는 트립토판 오페론이 과발현된 대장균일 수 있다.
본 발명에서, pheA, trpR, mtr, tnaAB 유전자 및 트립토판 오페론 및 이들이 코딩하는 단백질 서열을 비롯하여, 본 발명에서 사용되는 유전자 및 단백질 서열들은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등에서 얻을 수 있으나, 이에 제한되지 않는다. 또한, pheA, trpR, mtr 및 tnaAB 유전자 등에 대한 구체적인 내용은 대한민국 특허 등록 제10-0792095호, 대한민국 특허 공개 제10-2013-0082121호에 기재되어 있는 내용을 참고할 수 있으며, 상기 특허의 명세서 전체는 본 발명의 참고자료로서 포함될 수 있다.
본 발명의 구체적인 실시예들에 비추어, 다양한 모균주에서 상기 포스파타제의 활성을 불활성화시킨 결과, 트립토판 생산능을 갖고 있는 에스케리키아속 미생물이라면 모균주의 종류에 상관없이 상기 포스파타제 활성을 불활성화시키는 경우에는 L-트립토판의 생산능이 유의적으로 향상되는 것으로 확인하였다.
본 발명의 다른 하나의 양태로서, 본 발명의 서열번호 1의 아미노산 서열을 포함하는 포스파타제의 활성이 불활성화되도록 변이된, L-트립토판 생산능을 갖는 에스케리키아속 미생물을 배지에서 배양하는 단계; 및 상기 배양에 따른 배지 또는 상기 미생물로부터 L-트립토판을 회수하는 단계를 포함하는, L-트립토판의 제조 방법을 제공한다.
본 발명의 또 다른 하나의 양태로서, 본 발명의 L-트립토판 생산능을 갖는 에스케리키아속 미생물의 L-트립토판 생산 용도를 제공한다. 또한, 또 다른 하나의 양태로서, L-트립토판을 생산하기 위한, 본 발명의 L-트립토판 생산능을 갖는 에스케리키아속 미생물의 용도를 제공한다.
본 발명의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 에스케리키아속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 구체적으로는 본 발명의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 발명에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스, 만니톨, 소르비톨 등과 같은 탄수화물; 당 알코올, 글리세롤, 피루브산, 락트산, 시트르산 등과 같은 알코올; 유기산, 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있다.
본 발명에서, 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다.
배양물의 온도는 구체적으로는 27℃ 내지 40℃, 보다 구체적으로는 30℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 10 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 L-트립토판을 회수하는 단계는 본 발명의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 L-트립토판을 회수할 수 있다.
상기 회수 단계는 정제 공정을 포함할 수 있다. 상기 정제공정은 당해 기술분야에 공지된 적합한 방법을 이용하여, 회수된 L-트립토판을 정제할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1: 포스파타제 (phosphatase)가 결손된 야생형 균주의 제작
본 실시예에서는 트립토판 생산능을 갖는 균주에서 포스파타제 활성이 불활성화된 균주를 제작하고자 하였다.
대표적인 에스케리키아속 미생물인, 대장균 야생형 균주인 W3110 균주에, 트립토판 생산능을 강화시키기 위하여, 코리슴산 뮤타제 (chorismate mutase)/ 프레펜산 탈수효소 (prephenate dehydratase, CM-PDT)를 코딩하는 pheA 유전자 (NCBI gene ID: 12934467)와 트립토판 분해효소 (Tryptophanase)를 코딩하는 tnaA유전자 (NCBI gene ID: 12933600), 트립토판 임포터 (importer)를 코딩하는 tnaB유전자(NCBI gene ID: 12933602)의 오페론 형태인 tnaAB 유전자가 결실된 W3110 trpΔ2 균주 (대한민국 특허 공개 제10-2013-0082121호)로부터, 포스파타제 (phosphotase)를 코딩하는 것으로 추정되는 yigL 유전자를 상동 재조합에 의하여 결실시켰다.
구체적으로, 서열번호 2의 염기 서열을 가지는 유전자 yigL의 결실을 위하여, Datsenko KA 등이 개발한 람다 레드 재조합효소 (lambda Red recombinase)를 이용한, 1-단계 불활성화 (one step inactivation) 방법을 사용하였다 (Proc Natl Acad Sci USA, (2000) V97, pp6640-6645). 유전자 내부로의 삽입을 확인하기 위한 마커로, pUC19 (New England Biolabs (USA))에 rmf 프로모터를 라이게이션시키고, pACYC184(New England Biolab)로부터 수득된 돌연변이 loxP-CmR-loxP 카세트를 라이게이션시켜 수득된 pUCprmfmloxP의 클로람페니콜 유전자를 사용하였다 (대한민국 특허 공개 제10-2009-0075549호).
먼저, yigL 유전자의 일부분과 pUCprmfmloxP 유전자의 클로람페니콜 (chloramphenicol) 내성 유전자의 일부 염기서열을 갖는 서열번호 3 및 4의 프라이머 조합을 이용하여 pUCprmfmloxP를 주형으로 하고, 94℃에서 30초간 변성, 55℃에서 30초간 어닐링, 72℃에서 1분간 신장시키는 것으로 이루어진 사이클을 30회 반복하는 1차 중합효소 연쇄반응 (이하 'PCR')에 의해 약 1.2 kb의 PCR 산물 ΔyigL1st를 수득하였다. 그 후, PCR을 통해 수득된 1.2 kb의 PCR 산물 ΔyigL1st를 0.8% 아가로스겔에서의 전기영동 후 용리하여 2차 PCR의 주형으로 사용하였다. 2차 PCR은 1차 PCR에서 수득된 PCR 산물의 5' 및 3' 영역의 20 bp의 염기서열을 포함하는 서열번호 5 및 6 프라이머 조합을 이용하여, 용리된 1차 PCR 산물을 주형으로 하여, 94℃에서 30초간 변성, 55℃에서 30초간 어닐링, 72℃에서 1분간 신장시키는 것으로 이루어진 사이클을 30회 반복하는 것에 의해 수행하여 약 1.3kb의 PCR 산물 ΔyigL을 수득하였다. 수득된 PCR 산물을 0.8% 아가로스겔에서의 전기영동후 용리하여 재조합에 사용하였다.
Datsenko KA 등이 개발한 1-단계 불활성화 방법 (Proc Natl Acad Sci USA., (2000) V97, pp6640-6645)에 따라 pKD46 벡터로 형질전환된 대장균 W3110 trpΔ2 를 컴피턴트 (competent)한 상태로 제조한 후, 1차 및 2차 PCR을 통해 수득된 1.3 kb의 단편 ΔyigL를 도입하여 형질전환시켰다. 이후, 클로람페니콜을 포함하는 LB 배지에서 배양하여 클로람페니콜 내성을 갖는 1차 형질전환체를 선별하였다.
상기에서 수득된 클로람페니콜 내성을 갖는 1차 재조합 균주로부터 pKD46을 제거한 후, pJW168 벡터 (Gene, (2000) V247, pp255-264)를 도입하여 클로람페니콜 마커 유전자를 균체로부터 제거하였다(Gene, (2000) V247,pp255-264). 최종적으로 수득된 균체로부터 서열번호 7과 8의 프라이머를 이용한 PCR을 통해 수득된 약 0.6 kb PCR 산물에 의해 yigL 유전자가 결실되었다는 것을 확인하고, W3110 trpΔ2 yigL로 명명하였다.
본 실시예에서 사용한 프라이머 서열은 하기 표 1에 나타냈다.
프라이머 서열 서열번호
yigL-Cm-R2 ttgcgtctgatttagatggcacgttactttctcccgaccatacgttatccTAgTggATCTgA TgggTACC 3
yigL-R1 cccagcggaaaccgctctacagaggtttaaatttcttATGtaccaggttgttgcgtctgatttagatggc 4
yigL-Cm-F2 ccattgtagcgaagtatcaggttgacaactgaccaaataaagaacgaTTAAggTgACACTAT AgAACgCg 5
yigL-F1 Tggtgatgataagtagcgccacaatggaaaactctttgattaacgggtatccattgtagcgaagtatcag 6
yigL conF1 AACCGCATGCATGACCGTTT 7
yigL conR1 ATATACAGGCCGACCGTTTT 8
실시예 2: 포스파타제가 불활성화된 트립토판 생산 균주의 제작
본 실시예에서는 트립토판을 생산하는 또 다른 대표적인 대장균인 KCCM11166P (대한민국 등록 특허 제10-1261147호)를 모균주로 하여 포스파타제를 코딩하는 것으로 추정되는 yigL 유전자를 상기 실시예 1에 기술한 방법과 동일하게 상동 재조합에 의하여 결실시켰다.
최종적으로 수득된 균체로부터 서열번호 7과 8의 프라이머를 이용한 PCR을 통해 수득된 약 0.6 kb PCR 산물에 의해 yigL 유전자가 결실되었다는 것을 확인하고, CA04-2803으로 명명하였다.
실시예 3: yigL 유전자가 결실된 야생형 균주의 트립토판 생성능 평가
상기 실시예 1에서 제조한 W3110 trpΔ2 yigL와 모균주인 W3110 trpΔ2의 트립토판 생성능을 비교하기 위하여 각각의 균주에 pCL-Dtrp_att-trpEDCBA와 pBAC-Dtrp_att-trpDCBA를 형질전환 방법에 의해 도입하였다. 도입된 벡터들은 트립토판 오페론 조절 부위의 조절 기작이 해제되어 트립토판을 과량 생산할 수 있도록 트립토판 오페론 발현이 강화된 벡터들이다 (대한민국 특허 공개 제10-2013-0082121호). 벡터가 도입된 균주들은 하기 표 2의 조성대로 제조된 트립토판 평가 배지에서 배양하여 L-트립토판 생산능을 비교하였다.
트립토판 평가 배지 조성
조성물 농도 (리터당)
Glucose 2 g
K2HPO4 1 g
(NH4)2SO4 12 g
NaCl 1 g
Na2HPO4·H2O 5 g
MgSO4·H2O 1 g
MnSO4·H2O 15 mg
CuSO4·H2O 3 mg
ZnSO4·H2O 30 mg
구연산나트륨 1 g
효모액기스 1 g
페닐알라닌 0.15 g
pH 6.8
37℃ 배양기(incubator)에서 LB 고체 배지 상에 밤새 배양한 균주들을 각각 상기 표 2의 25 ㎖ 평가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 48시간 동안 배양하여 트립토판 농도를 비교하였다 (표 3).
균주 트립토판 농도 (g/L)
W3110 trpΔ2 / pCL-Dtrp_att-trpEDCBA, pBAC-Dtrp_att-trpDCBA 0.5
W3110 trpΔ2 yigL / pCL-Dtrp_att-trpEDCBA, pBAC-Dtrp_att-trpDCBA 0.8
상기와 같은 결과는, 유전자 yigL에 의해 코딩되는 포스파타제의 활성이 불활성화된 균주의 트립토판 생성능이 상기 포스파타제의 활성이 불활성화되지 않은 균주에 비해 60% 증가한 것으로, yigL에 의해 코딩되는 포스파타제의 불활성화에 의해 트립토판 생성능이 향상될 수 있음을 확인하였다. 이는 yigL에 의해 코딩되는 포스파타제의 불활성에 의하여 트립토판 생합성에 중요한 조효소의 역할을 하는 PLP의 농도가 높아져 트립토판 생합성이 증가된 결과로 해석할 수 있다.
실시예 4: yigL 유전자가 결실된 균주의 트립토판 생성능 평가
상기 실시예 2에서 제조한 yigL 결손주 (CA04-2803)와 모균주인 KCCM11166P의 트립토판 역가를 측정하기 위하여 하기 표 4의 조성대로 제조된 트립토판 역가 배지에서 배양하여 L-트립토판 생산효율 향상을 확인하였다.
트립토판 역가 배지 조성
조성물 농도 (리터당)
Glucose 60 g
K2HPO4 1 g
(NH4)2SO4 10 g
NaCl 1 g
MgSO4·7H2O 1 g
구연산나트륨 5 g
효모액기스 2 g
탄산칼슘 40 g
구연산나트륨 5 g
페닐알라닌 0.15 g
타이로신 0.1 g
pH 6.8
37℃ 배양기 (incubator)에서 LB 고체 배지 상에 밤새 배양한 대장균 KCCM 11166P 및 대장균 CA04-2803을 각각 상기 표 4의 25 ㎖ 역가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 48시간 동안 배양하여 당 소모속도 및 트립토판 농도를 비교하였다.
그 결과, 하기 표 5에 기재된 바와 같이, 대조군인 KCCM11166P에 비해 유전자 yigL에 의해 코딩되는 포스파타제의 활성이 불활성화된 균주인 CA04-2803의 트립토판 농도가 약 30% 증가하는 결과를 보였다.
균주 트립토판 농도 (g/L)
KCCM11166P 7.48
CA04-2803 9.62
본 발명자들은 KCCM11166P 균주 기반, 포스파타제를 코딩하는 yigL이 결손된 불활성화된 균주에서 트립토판 생산능력이 증가됨을 확인하고, 상기 균주를 "CA04-2803" 또는 "CA04-2803(KCCM11166P_ΔyigL)"로 명명한 후 부다페스트 조약 하에 국제기탁기관인 한국미생물보존센터 (KCCM)에 2014년 12월 5일자에 기탁하여 수탁번호 KCCM11635P를 부여받았다.
상기와 같은 결과들은, 본 발명의 트립토판 생산 에스케리키아속 미생물에서 포스파타제의 활성을 불활성화시킨 균주가 상기 효소를 불활성화시키지 않은 균주보다 L-트립토판 생산능이 증가되는 것을 시사하는 것이다. 또한, 이와 같이 트립토판 생성량이 증가한 결과들은, yigL에 의해 코딩되는 포스파타제의 불활성화에 의한 것으로, 상기 유전자에 의해 코딩되는 포스파타제의 예상 기능 중 하나로 추정되는 PLP 포스파타제로서의 기능이 불활성화된 것에 의한 것으로 추론되며, 이는 세포 내 높아진 PLP 농도에 의한 가능성이 높다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2016004893-appb-I000001

Claims (3)

  1. 서열번호 1의 아미노산 서열을 포함하는 포스파타제 (phosphatase)의 활성이 불활성화되도록 변이된, L-트립토판 생산능을 갖는 에스케리키아속(Escherichia) 미생물.
  2. 제1항에 있어서, 상기 에스케리키아속 미생물은 대장균(Escherichia coli)인 것인, L-트립토판 생산능을 갖는 에스케리키아속 미생물.
  3. (i) 제1항 또는 제2항의 에스케리키아속 미생물을 배지에서 배양하는 단계; 및
    (ii) 상기 배양에 따른 배지 또는 상기 미생물로부터 L-트립토판을 회수하는 단계를 포함하는, L-트립토판의 제조 방법.
PCT/KR2016/004893 2015-05-14 2016-05-10 L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법 WO2016182321A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP16792967.8A EP3296400B1 (en) 2015-05-14 2016-05-10 Method for producing l-tryptophan using microorganisms of genus escherichia
CN201680000670.0A CN106604987B (zh) 2015-05-14 2016-05-10 产l-色氨酸的埃希氏杆菌属的微生物和使用其生产l-色氨酸的方法
JP2017559098A JP6596105B2 (ja) 2015-05-14 2016-05-10 Ｌ−トリプトファンを産生するエシェリキア属の微生物及びそれを用いたｌ−トリプトファンの製造方法
DK16792967.8T DK3296400T3 (da) 2015-05-14 2016-05-10 Fremsgangsmåde til produktion af l-tryptofan ved hjælp af mikroorganismer af arten escherichia
ES16792967T ES2876949T3 (es) 2015-05-14 2016-05-10 Método para producir l-triptófano mediante el uso de microorganismos del género escherichia
RU2017141773A RU2692645C2 (ru) 2015-05-14 2016-05-10 Микроорганизм рода Escherichia, продуцирующий L-триптофан, и способ получения L-триптофана с его использованием
US15/573,236 US10081822B2 (en) 2015-05-14 2016-05-10 Microorganism of the genus Escherichia producing L-tryptophan and method for producing L-tryptophan using the same
BR112017024401-2A BR112017024401A2 (pt) 2015-05-14 2016-05-10 ?microrganismo do gênero escherichia que produz l-triptofano e método para produzir l-triptofano com o uso do mesmo?

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020150067660A KR101704199B1 (ko) 2015-05-14 2015-05-14 L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
KR10-2015-0067660 2015-05-14

Publications (1)

Publication Number Publication Date
WO2016182321A1 true WO2016182321A1 (ko) 2016-11-17

Family

ID=57249238

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/004893 WO2016182321A1 (ko) 2015-05-14 2016-05-10 L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법

Country Status (12)

Country Link
US (1) US10081822B2 (ko)
EP (1) EP3296400B1 (ko)
JP (1) JP6596105B2 (ko)
KR (1) KR101704199B1 (ko)
CN (1) CN106604987B (ko)
BR (1) BR112017024401A2 (ko)
DK (1) DK3296400T3 (ko)
ES (1) ES2876949T3 (ko)
HU (1) HUE054774T2 (ko)
MY (1) MY175834A (ko)
RU (1) RU2692645C2 (ko)
WO (1) WO2016182321A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019182413A1 (ko) 2018-03-23 2019-09-26 씨제이제일제당 (주) L-아미노산을 포함하는 과립 및 이의 제조방법

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101991207B1 (ko) * 2018-11-29 2019-06-19 씨제이제일제당 (주) cAMP 수용 단백질 변이체 및 이를 이용한 L-아미노산 제조방법
KR101996767B1 (ko) * 2018-11-29 2019-07-04 씨제이제일제당 (주) cAMP 수용 단백질 변이체 및 이를 이용한 L-아미노산 제조방법
KR101991206B1 (ko) 2018-11-29 2019-06-19 씨제이제일제당 (주) cAMP 수용 단백질 변이체 및 이를 이용한 L-아미노산 제조방법
KR102284726B1 (ko) * 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 타우토머레이즈 pptA 변이체 및 이를 이용한 L-트립토판 생산 방법

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050059685A (ko) * 2003-12-15 2005-06-21 씨제이 주식회사 트립토판 생합성 관련 변이유전자를 함유한 대장균 변이주및 이를 이용한 트립토판 제조방법
US8435765B2 (en) * 2002-04-23 2013-05-07 Cargill, Incorporated Polypeptides and biosynthetic pathways for the production of monatin and its precursors
KR20130082121A (ko) * 2012-01-10 2013-07-18 씨제이제일제당 (주) L-트립토판 생산능이 강화된 에스케리키아속 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR870001813B1 (ko) 1985-05-20 1987-10-13 한국과학기술원 발효법에 의한 l-트립토판의 제조방법
KR970001533B1 (en) 1987-01-30 1997-02-11 American Cyanamid Co Dihydro derivatives and pseudoaglycons of ll-e33288 antibiotics and anticancer ages, preparation and purification method thereof
JPH08103283A (ja) * 1994-10-06 1996-04-23 Mitsubishi Chem Corp トリプトファンの製造法
KR100792095B1 (ko) 2006-12-29 2008-01-04 씨제이 주식회사 Ｌ-페닐알라닌 생산능을 갖는 대장균 변이주로부터유전자조작된 ｌ-트립토판 생산능을 갖는 재조합 대장균균주 및 이를 이용한 트립토판 제조방법
KR20090075549A (ko) 2008-01-04 2009-07-08 씨제이제일제당 (주) 향상된 ｌ-쓰레오닌 생산능을 갖는 대장균 및 이를 이용한ｌ-쓰레오닌의 생산 방법
KR101261147B1 (ko) * 2011-01-18 2013-05-06 씨제이제일제당 (주) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
KR101327093B1 (ko) * 2012-01-06 2013-11-07 씨제이제일제당 (주) Ｌ-아미노산을 생산할 수 있는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
RU2013118637A (ru) * 2013-04-23 2014-10-27 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") СПОСОБ ПОЛУЧЕНИЯ L-АМИНОКИСЛОТ С ИСПОЛЬЗОВАНИЕМ БАКТЕРИИ СЕМЕЙСТВА ENTEROBACTERIACEAE, В КОТОРОЙ РАЗРЕГУЛИРОВАН ГЕН yjjK
RU2013144250A (ru) * 2013-10-02 2015-04-10 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") СПОСОБ ПОЛУЧЕНИЯ L-АМИНОКИСЛОТ С ИСПОЛЬЗОВАНИЕМ БАКТЕРИИ СЕМЕЙСТВА Enterobacteriaceae, В КОТОРОЙ ОСЛАБЛЕНА ЭКСПРЕССИЯ ГЕНА, КОДИРУЮЩЕГО ФОСФАТНЫЙ ТРАНСПОРТЕР

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8435765B2 (en) * 2002-04-23 2013-05-07 Cargill, Incorporated Polypeptides and biosynthetic pathways for the production of monatin and its precursors
KR20050059685A (ko) * 2003-12-15 2005-06-21 씨제이 주식회사 트립토판 생합성 관련 변이유전자를 함유한 대장균 변이주및 이를 이용한 트립토판 제조방법
KR20130082121A (ko) * 2012-01-10 2013-07-18 씨제이제일제당 (주) L-트립토판 생산능이 강화된 에스케리키아속 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [O] 11 May 2014 (2014-05-11), "Putative Hydrolase [Escherichia coli D6-117.29", XP055329309, retrieved from NCBI Database accession no. CDP77019 *
DATABASE NCBI [O] 22 March 2015 (2015-03-22), "MULTISPECIES: Pyridoxal Phosphate Phosphatase YigL [Enterobacteriaceae", XP055329307, retrieved from NCBI Database accession no. WP_000285362.1 *
KUZNETSOVA, EKATERINA ET AL.: "Genome-wide Analysis of Substrate Specificities of the Escherichia Coli Haloacid Dehalogenase-like Phosphatase Family", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, no. 47, 24 November 2006 (2006-11-24), pages 36149 - 36161, XP055038714 *
See also references of EP3296400A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019182413A1 (ko) 2018-03-23 2019-09-26 씨제이제일제당 (주) L-아미노산을 포함하는 과립 및 이의 제조방법
US11370746B2 (en) 2018-03-23 2022-06-28 Cj Cheiljedang Corporation Granules comprising L-amino acid and method for preparing the same

Also Published As

Publication number Publication date
MY175834A (en) 2020-07-13
JP2018519799A (ja) 2018-07-26
EP3296400B1 (en) 2021-04-07
EP3296400A4 (en) 2018-10-10
CN106604987A (zh) 2017-04-26
BR112017024401A2 (pt) 2018-07-24
RU2017141773A (ru) 2019-06-17
RU2692645C2 (ru) 2019-06-25
KR101704199B1 (ko) 2017-02-08
CN106604987B (zh) 2020-08-18
DK3296400T3 (da) 2021-06-28
RU2017141773A3 (ko) 2019-06-17
ES2876949T3 (es) 2021-11-15
US10081822B2 (en) 2018-09-25
JP6596105B2 (ja) 2019-10-23
HUE054774T2 (hu) 2021-09-28
US20180087077A1 (en) 2018-03-29
EP3296400A1 (en) 2018-03-21
KR20160135026A (ko) 2016-11-24

Similar Documents

Publication Publication Date Title
KR101261147B1 (ko) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2016182322A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2016182321A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2013103268A2 (ko) Ｌ-아미노산을 생산할 수 있는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2021162189A1 (ko) L-글루탐산 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-글루탐산의 생산 방법
WO2015199406A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2017034165A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2016171392A1 (ko) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2014171747A1 (ko) L-트립토판 생산능을 갖는 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
WO2015122569A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2017065457A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2016036209A1 (ko) L-쓰레오닌 생산능이 향상된 미생물 및 이를 이용한 l-쓰레오닌 생산방법
WO2018151347A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2014208884A1 (ko) L-쓰레오닌 생산 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
KR20100038639A (ko) 변형된 ｐｕｒＣ 유전자를 가진 미생물 및 이를 이용한 이노신의 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16792967

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017559098

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15573236

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2017141773

Country of ref document: RU

Ref document number: 2016792967

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017024401

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112017024401

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20171113