WO2016168592A2 - Compositions for modulating c9orf72 expression - Google Patents

Compositions for modulating c9orf72 expression Download PDF

Info

Publication number
WO2016168592A2
WO2016168592A2 PCT/US2016/027747 US2016027747W WO2016168592A2 WO 2016168592 A2 WO2016168592 A2 WO 2016168592A2 US 2016027747 W US2016027747 W US 2016027747W WO 2016168592 A2 WO2016168592 A2 WO 2016168592A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
c90rf72
composition
antisense
certain embodiments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/027747
Other languages
English (en)
French (fr)
Other versions
WO2016168592A3 (en
Inventor
Frank Rigo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2017546618A priority Critical patent/JP6606557B2/ja
Priority to EP20163264.3A priority patent/EP3722424A1/en
Priority to RS20200535A priority patent/RS60230B1/sr
Priority to KR1020207010994A priority patent/KR102258516B1/ko
Priority to HK18108871.7A priority patent/HK1250255B/en
Priority to DK16780833.6T priority patent/DK3283080T3/da
Priority to KR1020177032588A priority patent/KR102104163B1/ko
Priority to ES16780833T priority patent/ES2791995T3/es
Priority to PL16780833T priority patent/PL3283080T3/pl
Priority to AU2016249002A priority patent/AU2016249002B2/en
Priority to CA2978103A priority patent/CA2978103A1/en
Priority to HRP20200843TT priority patent/HRP20200843T1/hr
Priority to SI201630693T priority patent/SI3283080T1/sl
Priority to MX2019007834A priority patent/MX385674B/es
Priority to MX2017013199A priority patent/MX366128B/es
Priority to SG11201708468YA priority patent/SG11201708468YA/en
Priority to LTEP16780833.6T priority patent/LT3283080T/lt
Priority to EP16780833.6A priority patent/EP3283080B1/en
Priority to NZ733882A priority patent/NZ733882A/en
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to CN201680016814.1A priority patent/CN107427532B/zh
Priority to BR112017016068-4A priority patent/BR112017016068A2/pt
Priority to SM20200165T priority patent/SMT202000165T1/it
Priority to MYPI2017703869A priority patent/MY181815A/en
Priority to RU2017139121A priority patent/RU2736574C2/ru
Publication of WO2016168592A2 publication Critical patent/WO2016168592A2/en
Publication of WO2016168592A3 publication Critical patent/WO2016168592A3/en
Priority to IL253557A priority patent/IL253557B/en
Priority to CONC2017/0007671A priority patent/CO2017007671A2/es
Priority to PH12017501875A priority patent/PH12017501875B1/en
Priority to SA520412450A priority patent/SA520412450B1/ar
Priority to SA520412451A priority patent/SA520412451B1/ar
Anticipated expiration legal-status Critical
Priority to SA517390168A priority patent/SA517390168B1/ar
Priority to AU2019250156A priority patent/AU2019250156B2/en
Priority to PH12019502724A priority patent/PH12019502724A1/en
Priority to CY20201100520T priority patent/CY1122981T1/el
Priority to IL277624A priority patent/IL277624A/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02Muscle relaxants, e.g. for tetanus or cramps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/22Anxiolytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • compositions and methods for modulating expression of C90RF72 mRNA and protein in cells and animals are useful to treat, prevent, ameliorate, or slow progression of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • ALS Amyotrophic lateral sclerosis
  • ALS is a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700).
  • ALS is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537).
  • ALS and frontotemporal dementia represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133).
  • the ALS-FTD causing mutation is a large hexanucleotide (GGGGCC) repeat expansion in the first intron of the C90RF72 gene (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256).
  • GGGGCC hexanucleotide repeat expansion in the first intron of the C90RF72 gene
  • C90RF72 gene is present in the majority of cases linked to this region (Renton et al., Neuron, 201 1, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Finnish patients (Laaksovirta et al, Lancet Neurol., 2010, 9, 978-985).
  • Certain embodiments provide methods, compounds, and compositions for inhibiting expression of C90RF72 mRNA and protein in cells, tissues, and animals. Certain embodiments provide methods, compounds, and compositions for reducing C90RF72 mRNA and protein levels in cells, tissues, and animals. Certain embodiments provide antisense compounds targeted to a C90RF72 nucleic acid. In certain embodiments, the antisense compounds are modified
  • the modified oligonucleotides are single-stranded.
  • C90RF72 associated Repeat Associated Non-ATG Translation (RAN translation) products are reduced.
  • the C90RF72 associated RAN translation products are poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • certain C90RF72 mRNA variants are preferentially reduced.
  • the C90RF72 mRNA variants preferentially reduced are variants processed from a pre-mRNA containing intron 1.
  • intron 1 contains a hexanucleotide repeat expansion.
  • the C90RF72 mRNA variant preferentially reduced is a C90RF72 pathogenic associated mRNA variant.
  • the C90RF72 pathogenic associated mRNA variant is NM_001256054.1 (SEQ ID NO: 1).
  • the hexanucleotide repeat expansion is associated with a C90RF72 associated disease.
  • the hexanucleotide repeat expansion is associated with a C90RF72 hexanucleotide repeat expansion associated disease.
  • the hexanucleotide repeat expansion comprises at least 30 GGGGCC repeats, more than 30 GGGGCC repeats, more than 100 GGGGCC repeats, more than 500 GGCC repeats, or more than 1000 GGGGCC repeats.
  • the hexanucleotide repeat expansion is associated with nuclear foci.
  • C90RF72 associated RAN translation products are associated with nuclear foci.
  • the C90RF72 associated RAN translation products are are poly-(glycine- proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • the compositions and methods described herein are useful for reducing C90RF72 mRNA levels, C90RF72 protein levels, C90RF72 RAN translation products, and nuclear foci.
  • the compositions and methods described herein are useful for selectively reducing C90RF72 pathogenic associated mRNA variants. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.
  • C90RF72 associated diseases are neurodegenerative diseases.
  • the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).
  • Such diseases can have one or more risk factors, causes, or outcomes in common.
  • Certain risk factors and causes for development of a neurodegenerative disease, and, in particular, ALS and FTD, include genetic predisposition and older age.
  • methods of treatment include administering a C90RF72 antisense compound to an individual in need thereof.
  • the antisense compound is a single-stranded modified oligonucleotide.
  • the single-stranded modified oligonucleotide is complementary to a C90RF72 nucleic acid.
  • element or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
  • Compounds of the invention include variations of the disclosed compounds in which one or more hydrogen, carbon, nitrogen, oxygen, or sulfur atoms is replaced with a stable isotope of the same element.
  • 2'-0-methoxyethyl refers to an O- methoxy-ethyl modification of the 2' position of a furanose ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2' -MOE nucleoside (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a MOE modified sugar moiety.
  • 2 '-substituted nucleoside means a nucleoside comprising a substituent at the 2' -position of the furanose ring other than H or OH.
  • 2 '-substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • administering refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
  • “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
  • Antisense inhibition means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.
  • Antisense mechanisms are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.
  • Base complementarity refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
  • Bicyclic sugar means a furanose ring modified by the bridging of two atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleoside
  • C90RF72 antisense transcript means transcripts produced from the non-coding strand (also antisense strand and template strand) of the C90RF72 gene.
  • the C90RF72 antisense transcript differs from the canonically transcribed "C90RF72 sense transcript", which is produced from the coding strand (also sense strand) of the C90RF72 gene.
  • a C90RF72 antisense transcript is SEQ ID NO: 18.
  • C90RF72 antisense transcript specific inhibitor refers to any agent capable of specifically inhibiting the expression of C90RF72 antisense transcript and/or its expression products at the molecular level.
  • specific means reducing or inhibiting expression of C90RF72 antisense transcript without reducing non-target transcript to an appreciable degree (e.g., a
  • C90RF72 antisense transcript specific inhibitor reduces expression of C90RF72 antisense transcript, but does not reduce expression of C90RF72 sense transcript to an appreciable degree).
  • C90RF72 specific antisense transcript inhibitors include antisense compounds, siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C90RF72 antisense transcript and/or its expression products, such as C90RF72 antisense transcript associated RAN translation products.
  • C90RF72 associated disease means any disease associated with any C90RF72 nucleic acid or expression product thereof. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD. In certain embodiments, the C90RF72 associated disease is caused by (or is associated with) a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat expansion may comprise GGGGCC, GGGGGG,
  • C90RF72 associated RAN translation products means aberrant peptide or di-peptide polymers translated through RAN translation (i.e., repeat-associated, and non-ATG-dependent translation).
  • the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).
  • C90RF72 nucleic acid means any nucleic acid encoding C90RF72.
  • a C90RF72 nucleic acid includes a DNA sequence encoding C90RF72, an RNA sequence transcribed from DNA encoding C90RF72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding C90RF72.
  • C90RF72 mRNA means an mRNA encoding a C90RF72 protein.
  • C90RF72 pathogenic associated mRNA variant means the C90RF72 mRNA variant processed from a C90RF72 pre-mRNA variant containing the hexanucleotide repeat.
  • a C90RF72 pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1 A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No.
  • the level of a C90RF72 pathogenic associated mRNA variant is measured to determine the level of a C90RF72 pre-mRNA containing the hexanucleotide repeat in a sample.
  • C90RF72 specific inhibitor refers to any agent capable of specifically inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein at the molecular level.
  • C90RF72 specific inhibitors include nucleic acids (including antisense compounds), siRNAs, aptamers, antibodies, peptides, small molecules, and other agents capable of inhibiting the expression of C90RF72 mRNA and/or C90RF72 protein.
  • C90RF72 specific inhibitors may affect other molecular processes in an animal.
  • “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4' -carbon and the 2' -carbon, wherein the bridge has the formula: 4'-CH(CH 3 )- 0-2'.
  • Consstrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-0-2' bridge.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-0-methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.
  • Co-administration means administration of two or more pharmaceutical agents to an individual.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
  • Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
  • Co-administration encompasses parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • Designing or”designed to refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent may be a liquid, e.g. saline solution.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
  • “Focus” or “foci” means a nuclear or cytoplasmic body comprising a C90RF72 transcript. In certain embodiments, a focus comprises at least one C90RF72 transcript. In certain
  • C90RF72 foci comprise transcripts comprising any of the following hexanucleotide repeats: GGGGCC, GGGGGG, GGGGGC, and/or GGGGCG.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap” and the external regions may be referred to as the "wings.”
  • “Hexanucleotide repeat expansion” means a series of six bases (for example, GGGGCC,
  • hexanucleotide repeat expansion may be located in intron 1 of a C90RF72 nucleic acid.
  • a pathogenic hexanucleotide repeat expansion includes at least 30, more than 30, more than 100, more than 500, or more than 1000 repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid and is associated with disease.
  • the repeats are consecutive.
  • the repeats are interrupted by 1 or more nucleobases.
  • a wild-type hexanucleotide repeat expansion includes 23 or fewer repeats of GGGGCC, GGGGGG, GGGGCG, or GGGGGC in a C90RF72 nucleic acid.
  • the repeats are consecutive.
  • the repeats are interrupted by 1 or more nucleobases.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid.
  • complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • Identifying an animal having a C90RF72 associated disease means identifying an animal having been diagnosed with a C90RF72 associated disease or predisposed to develop a C90RF72 associated disease. Individuals predisposed to develop a C90RF72 associated disease include those having one or more risk factors for developing a C90RF72 associated disease, including, having a personal or family history or genetic predisposition of one or more C90RF72 associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • “Inhibiting C90RF72” means reducing the level or expression of a C90RF72 mRNA and/or protein.
  • C90RF72 mRNA and/or protein levels are inhibited in the presence of an antisense compound targeting C90RF72, including an antisense oligonucleotide targeting C90RF72, as compared to expression of C90RF72 mRNA and/or protein levels in the absence of a C90RF72 antisense compound, such as an antisense oligonucleotide.
  • “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides linked together by an internucleoside linkage.
  • Locked nucleic acid or " LNA” or “LNA nucleosides” means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) a-L-Methyleneoxy (4'-CH 2 -0-2') LNA , (B) ⁇ -D-Methyleneoxy (4'-CH 2 -0-2') LNA , (C)
  • Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(Ri)(R 2 )] n -, -[C(Ri)(R 2 )] n -0-, -C(RiR 2 )-N(Ri)-0- or - C(RiR 2 )-0-N(Ri)-.
  • bridging groups encompassed with the definition of LNA are 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(Ri)-2' and 4'-CH 2 - N(Ri)-0-2'- bridges, wherein each Ri and R 2 is, independently, H, a protecting group or Ci-Ci 2 alkyl.
  • LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH 2 -0-2') bridge to form the bicyclic sugar moiety.
  • the bridge can also be a methylene (-CH 2 -) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH 2 -0-2') LNA is used.
  • ethyl eneoxy (4'- CH 2 CH 2 -0-2') LNA is used, a -L- methyleneoxy (4'-CH 2 -0-2'), an isomer of methyleneoxy (4'- CH 2 -0-2') LNA is also encompassed within the definition of LNA, as used herein.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).
  • Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase.
  • Modified sugar means substitution and/or any change from a natural sugar moiety.
  • “Monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
  • “Motif means the pattern of unmodified and modified nucleoside in an antisense compound. "Natural sugar moiety” means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
  • Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units.
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only.
  • the tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or
  • internucleoside linkage Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Off-target effect refers to an unwanted or deleterious biological effect assocaited with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
  • Oligomer means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligomer means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous
  • administration intramuscular administration, intraarterial administration, intraperitoneal
  • intracranial administration e.g., intrathecal or intracerebroventricular
  • peptide means a molecule formed by linking at least two amino acids by amide bonds.
  • peptide refers to polypeptides and proteins.
  • “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to C90RF72 is a pharmaceutical agent.
  • “Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • Portion means a defined number of contiguous ⁇ i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent or “preventing” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • prophylactically effective amount refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
  • “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • “Ribonucleotide” means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
  • Salts mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
  • Side effects means physiological responses attributable to a treatment other than desired effects.
  • side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • a "single-stranded modified oligonucleotide” means a modified
  • oligonucleotide which is not hybridized to a complementary strand.
  • Sites are defined as unique nucleobase positions within a target nucleic acid.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Stringent hybridization conditions or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
  • Subject means a human or non-human animal selected for treatment or therapy.
  • Target refers to a protein, the modulation of which is desired.
  • Target gene refers to a gene encoding a target. “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid means a nucleic acid capable of being targeted by antisense compounds.
  • Target region means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • Treat” or “treating” or “treatment” means administering a composition to effect an alteration or improvement of a disease or condition.
  • Unmodified nucleobases means the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U).
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Wild segment means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • compositions and methods for reducing total C90RF72 mRNA and protein expression are provided.
  • compositions and methods for reducing C90RF72 pathogenic associated mRNA variants are provided.
  • Certain embodiments provide methods for the treatment, prevention, amelioration, or slowing progression of diseases associated with C90RF72 in an individual in need thereof. Also contemplated are methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease associated with C90RF72.
  • C90RF72 associated diseases include neurodegenerative diseases.
  • the neurodegenerative disease may be ALS or FTD.
  • the neurodegenerative disease may be familial or sporadic.
  • Embodiment 1 A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 22-55.
  • Embodiment 2 The compound of embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%>, at least 82%>, at least 83%>, at least 84%>, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1 or SEQ ID NO: 2.
  • Embodiment 3 The compound of embodiments 1 and 2, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.
  • Embodiment 4 The compound of any of embodiments 1-3, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
  • Embodiment 5 The compound of embodiment 4, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 6 The compound of embodiments 4 and 5, wherein the modified oligonucleotide comprises at least one phosphodiester linkage.
  • Embodiment 7 The compound of embodiment 5, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 8 The compound of any of embodiments 1-7, wherein at least one nucleoside comprises a modified nucleobase.
  • Embodiment 9 The compound of embodiment 8, wherein the modified nucleobase is a 5-methylcytosine.
  • Embodiment 10 The compound of any of embodiments 1-9, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
  • Embodiment 11 The compound of embodiment 10, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar.
  • Embodiment 12 The compound of embodiments 10 or 11, wherein the at least one modified sugar is a bicyclic sugar.
  • Embodiment 13 The compound of embodiment 12, wherein the bicyclic sugar comprises a chemical bridge between the 4' and 2' positions of the sugar, wherein the chemical bridge is selected from: 4'-CH(R)-0-2' and 4'-(CH 2 ) 2 -0-2', wherein R is independently H, Ci-C 6 alkyl, and Ci-C 6 alkoxy.
  • Embodiment 14 The compound of embodiment 13, wherein the chemical bridge is 4'- CH(R)-0-2' and wherein R is methyl.
  • Embodiment 15 The compound of embodiment 13, wherein the chemical bridge is 4'- CH(R)-0-2' and wherein R is H.
  • Embodiment 16 The compound of embodiment 13, wherein the chemical bridge is 4'- CH(R)-0-2' and wherein R is -CH 2 -0-CH 3 .
  • Embodiment 17 The compound of embodiments 10 or 11, wherein the at least one modified sugar comprises a 2'-0-methoxyethyl group.
  • Embodiment 18 The compound of any of embodiments 1-10 or 12-16, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 19 The compound of embodiment 18, wherein the gapmer is any of a 3-8- 7 MOE gapmer, a 3-10-7 MOE gapmer, a 4-8-6 MOE gapmer, a 4-10-6 MOE gapmer, a 6-10-4 MOE gapmer, a 6-8-4 MOE gapmer, a 7-8-3 MOE gapmer, or a 7-10-3 MOE gapmer.
  • Embodiment 20 The compound of claim 5, wherein the modified oligonucleotide comprises internucleoside linkages in any of the following patterns: soossssssssssooooss,
  • sooosssssssssssssssooss sooooossssssssssss, soooooosssssssssssss, soooosssssssssooss, sooossssssssoooss, soossssssssoooss, soosssssssssoooss, soosssssssssoooss, soooossssssssssssssss,
  • Embodiment 19 A composition comprising the compound of any preceding embodiment or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • Embodiment 20 The composition of embodiment 19, further comprising a C90RF72 antisense transcript specific inhibitor.
  • Embodiment 21 The composition of embodiment 20, wherein the C90RF72 antisense transcript specific inhibitor is an antisense compound.
  • Embodiment 22 The composition of embodiment 21, wherein the antisense compound is a modified oligonucleotide.
  • Embodiment 23 The composition of embodiment 22, wherein the modified oligonucleotide is single-stranded.
  • Embodiment 24 The composition of embodiments 22 or 23, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C90RF72 antisense transcript.
  • Embodiment 25 The composition of embodiment 24, wherein the C90RF72 antisense transcript has the nucleobase sequence of SEQ ID NO: 18.
  • Embodiment 26 A method comprising administering to an animal the compound or composition of any preceding embodiment.
  • Embodiment 27 The method of embodiment 26, wherein the animal is a human.
  • Embodiment 28 The method of embodiments 26 and 27, wherein administering the compound prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease.
  • Embodiment 29 The method of embodiment 28, wherein the C90RF72 associated disease is caused by a hexanucleotide repeat expansion.
  • Embodiment 30 The method of embodiment 28, wherein the C90RF72 associated disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, and olivopontocerebellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • Embodiment 31 The method of embodiments 26-30, wherein the administering reduces nuclear foci.
  • Embodiment 32 The method of embodiments 26-31, wherein the administering reduces expression of C90RF72 associated RAN translation products.
  • Embodiment 33 The method of embodiment 32, wherein the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly- (glycine-arginine).
  • Embodiment 34 Use of the compound or composition of any of embodiments 1-33 for the manufacture of a medicament for treating a neurodegenerative disorder.
  • Embodiment 35 A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof:
  • Embodiment 36 A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula:
  • Embodiment 37 A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof:
  • Embodiment 38 A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula:
  • Embodiment 39 A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof:
  • Embodiment 40 A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula:
  • Embodiment 41 A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof:
  • Embodiment 42 A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula:
  • Embodiment 43 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of reducing human C90RF72 mRNA or protein expression in a mammal.
  • Embodiment 44 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of ameliorating at least one symptom of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • Embodiment 45 The compound or composition of embodiment 44, wherein the symptom of ALS is any of motor deficit, anxiety, and denervation.
  • Embodiment 46 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of delaying progression of disease.
  • Embodiment 47 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of extending survival.
  • Embodiment 48 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of reducing C90RF72 associated RAN translation products.
  • Embodiment 49 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of selectively reducing C90RF72 pathogenic associated mRNA variants.
  • Embodiment 50 The compound or composition of any of embodiments 1-25 or 35-42, wherein the compound or composition is capable of reducing nuclear foci.
  • Embodiment 51 A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof:
  • Embodiment 52 A method comprising administering to an animal the compound of embodiment 51.
  • Embodiment 53 The method of embodiment 52, wherein the animal is a human.
  • Embodiment 54 The method of embodiment 53, wherein the administering inhibits C90RF72.
  • Embodiment 55 The method of embodiment 53, wherein the administering prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease.
  • Embodiment 56 The method of embodiment 55, wherein the C90RF72 associated disease is caused by a hexanucleotide repeat expansion.
  • Embodiment 57 The method of embodiment 55, wherein the C90RF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • Embodiment 58 The method of embodiment 53, wherein the administering reduces nuclear foci.
  • Embodiment 59 The method of embodiment 53, wherein the administering reduces expression of C90RF72 associated RAN translation products.
  • Embodiment 60 The method of embodiment 59, wherein the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly- (glycine-arginine).
  • Embodiment 61 A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula:
  • Embodiment 62 A method comprising administering to an animal the composition of embodiment 60.
  • Embodiment 63 The method of embodiment 62, wherein the animal is a human.
  • Embodiment 64 The method of embodiment 63, wherein the administering inhibits C90RF72.
  • Embodiment 65 The method of embodiment 62, wherein the administering prevents, treats, ameliorates, or slows progression of a C90RF72 associated disease.
  • Embodiment 66 The method of embodiment 65, wherein the C90RF72 associated disease is caused by a hexanucleotide repeat expansion.
  • Embodiment 67 The method of embodiment 65, wherein the C90RF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD).
  • ALS amyotrophic lateral sclerosis
  • FDD frontotemporal dementia
  • CBD corticobasal degeneration syndrome
  • OPCD olivopontocerebellar degeneration
  • Embodiment 68 The method of embodiment 63, wherein the administering reduces nuclear foci.
  • Embodiment 69 The method of embodiment 63, wherein the administering reduces expression of C90RF72 associated RAN translation products.
  • Embodiment 70 The method of embodiment 69, wherein the C90RF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly- (glycine-arginine).
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense
  • oligonucleotides and siRNAs.
  • An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to a C90RF72 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits.
  • the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense
  • oligonucleotide, and the linked subunits are nucleosides.
  • antisense oligonucleotides targeted to a C90RF72 nucleic acid may be shortened or truncated.
  • a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3 ' end (3' truncation).
  • a shortened or truncated antisense compound targeted to a C90RF72 nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
  • the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
  • the additional subunit may be located at the 5' or 3' end of the antisense compound.
  • the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound.
  • the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3 ' end.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al J. Natl. Cancer Inst. 93 :463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • antisense compounds targeted to a C90RF72 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense
  • an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment.
  • Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides.
  • gapmers described herein include, but are not limited to, for example 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7- 5, 4-7-5, 5-7-4, or 4-7-4.
  • the antisense compound has a "wingmer" motif, having a wing- gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations described herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • antisense compounds targeted to a C90RF72 nucleic acid possess a 5-10-5 gapmer motif.
  • antisense compounds targeted to a C90RF72 nucleic acid possess a 5-8-5 gapmer motif.
  • an antisense compound targeted to a C90RF72 nucleic acid has a gap-narrowed motif.
  • a gap-narrowed antisense oligonucleotide targeted to a C90RF72 nucleic acid has a gap segment of 9, 8, 7, or 6 2'-deoxynucleotides positioned immediately adjacent to and between wing segments of 5, 4, 3, 2, or 1 chemically modified nucleosides.
  • the chemical modification comprises a bicyclic sugar.
  • the bicyclic sugar comprises a 4' to 2' bridge selected from among: 4'-(CH 2 ) n - 0-2' bridge, wherein n is 1 or 2; and 4'-CH 2 -0-CH 2 -2' .
  • the bicyclic sugar is comprises a 4'-CH(CH 3 )-0-2' bridge.
  • the chemical modification comprises a non-bicyclic 2'-modified sugar moiety.
  • the non-bicyclic 2'- modified sugar moiety comprises a 2'-0-methylethyl group or a 2'-0-methyl group.
  • Nucleotide sequences that encode C90RF72 include, without limitation, the following: the complement of GENBANK Accession No. NM_001256054.1 (incorporated herein as SEQ ID NO: 1), the complement of GENBANK Accession No. NT_008413.18 truncated from nucleobase 27535000 to 27565000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3' UTR, a 5' UTR, an ex on, an intron, an ex on/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for C90RF72 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3 ' target sites listed herein.
  • Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an ex on, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • C90RF72 mRNA levels are indicative of inhibition of C90RF72 expression.
  • Reductions in levels of a C90RF72 protein are also indicative of inhibition of target mRNA expression.
  • Reduction in the presence of expanded C90RF72 RNA foci are indicative of inhibition of C90RF72 expression.
  • phenotypic changes are indicative of inhibition of C90RF72 expression. For example, improved motor function and respiration may be indicative of inhibition of C90RF72 expression.
  • hybridization occurs between an antisense compound disclosed herein and a C90RF72 nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a C90RF72 nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a C90RF72 nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a C90RF72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a C90RF72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a C90RF72 nucleic acid, a target region, target segment, or specified portion thereof.
  • Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and
  • complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound may be fully complementary to a C90RF72 nucleic acid, or a target region, or a target segment or target sequence thereof.
  • each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous.
  • a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a C90RF72 nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • Modified Internucleoside Linkages may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5'
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to a C90RF72 nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are interspersed throughout the antisense compound.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • the antisense compounds targeted to a C90RF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage.
  • antisense compounds targeted to a C90RF72 nucleic acid possess internucleoside linkages in any of the following patterns: soooossssssssssooss, sooossssssssooss, soosssssssooss, and sosssssssssoooss; wherein,
  • o a phosphodiester linkage
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, Ci-Co alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA)
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, Ci-Co alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'- OCH 2 CH 2 F and 2'-0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • BNAs bicyclic nucleic acids
  • examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4*-(CH 2 )-0-2* (LNA); 4*-(CH 2 )-S-2*; 4'-(CH 2 ) 2 -0-2' (ENA); 4*-CH(CH 3 )-0-2* and 4'-CH(CH 2 OCH 3 )-0-2' (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH 3 )(CH 3 )-0-2' (and analogs thereof see PCT/US2008/068922 published as
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L- ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • the bridge of a bicyclic sugar moiety is , -[C(R a )(R b )] n - , -[C(R a )(R b )] n -0-, -C(R a R b )-N(R)-0- or -C(R a R b )-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 - N(R)-0-2'- wherein each Ris, independently, H, a protecting group or Ci-Ci 2 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-(CH 2 )-0-2' bridge may be in the a-L configuration or in the ⁇ -D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids
  • bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, a-L-4'-(CH 2 )-0-2', p-D-4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'- CH 2 -0-N(R)-2', 4'-CH 2 -N(R)-0-2', 4'-CH(CH 3 )-0-2', 4'-CH 2 -S-2', 4'-CH 2 -N(R)-2', 4'-CH 2 - CH(CH 3 )-2', and 4'-(CH 2 ) 3 -2', wherein R is H, a protecting group or C1-C12 alkyl.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • R c is Ci-Ci 2 alkyl or an amino protecting group
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Ci-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q d is, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 - C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, Ci-C 6 alkoxyl, substituted Ci-C 6 alkoxyl, acyl, substituted acyl, Ci-C 6 aminoalkyl or substituted Ci-C 6 aminoalkyl;
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and q h are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA, (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0- 2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'--
  • modified tetrahydropyran nucleoside or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate.
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.
  • HNA hexitol nucleic acid
  • ANA anitol nucleic acid
  • MNA manitol nucleic acid
  • F-HNA fluoro HNA having a tetrahydropyranyl ring system as illustrated below.
  • sugar surrogates are selected having the formula:
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the
  • internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl.
  • THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is fluoro and R 2 is H; Ri is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5, 166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar surrogate having the following formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as "modifed morpholinos.”
  • Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH 2 - 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • PCT International Application WO 2007/134181 published on 11/22/07 wherein a 4'-CH 2 - 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described ⁇ see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J. Am. Chem. Soc, 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides,
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3 '-terminal group; and
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 , q7, q 8 and qg are each, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or other sugar sub stituent group .
  • 2' -modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2'- substituent groups can also be selected from: Ci-Ci 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , H 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkyl amino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al, Nucleosides Nucleotides, 1997, 16, 917-926).
  • 2'-modified or “2'-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2' -MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to a C90RF72 nucleic acid can be utilized in
  • compositions by combining the antisense compound with a suitable pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C90RF72 nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any one of
  • compositions are also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'- stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
  • C90RF72 nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commerical vendors (e.g. American Type Culture Collection, Manassus, VA; Zen- Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA).
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN
  • concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with
  • LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line.
  • Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA.
  • RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols. Analysis of inhibition of target levels or expression
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Quantitative Real-Time PCR Analysis of Target RNA Levels
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
  • Probes and primers are designed to hybridize to a C90RF72 nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRFMER EXPRESS Software (Applied Biosystems, Foster City, CA). Analysis of Protein Levels
  • Antisense inhibition of C90RF72 nucleic acids can be assessed by measuring C90RF72 protein levels. Protein levels of C90RF72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence- activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human C90RF72 are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of C90RF72 and produce phenotypic changes, such as, improved motor function and respiration.
  • motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal.
  • respiration is measured by whole body plethysmograph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).
  • a pharmaceutically acceptable diluent such as phosphate- buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).
  • Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, as well as central routes of administration such as intracerebroventricular or intrathecal. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from CNS tissue or CSF and changes in C90RF72 nucleic acid expression are measured.
  • Antisense oligonucleotides described herein may hybridize to a C90RF72 nucleic acid in any stage of RNA processing.
  • described herein are antisense oligonucleotides that are complementary to a pre-mRNA or a mature mRNA.
  • antisense oligonucleotides described herein may hybridize to any element of a C90RF72 nucleic acid.
  • antisense oligonucleotides that are complementary to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exomexon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exonl 1, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10 of a C90RF72 nucleic acid.
  • antisense oligonucleotides described herein hybridize to all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to certain variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to variants of C90RF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively hybridize to pre-mRNA variants containing the hexanucleotide repeat.
  • pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10.
  • such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
  • the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72. In certain embodiments, the antisense oligonucleotides described herein inhibit expression of all variants of C90RF72 equally. In certain embodiments, the antisense oligonucleotides described herein preferentially inhibit expression of one or more variants of
  • the antisense oligonucleotides described herein preferentially inhibit expression of variants of C90RF72 containing a hexanucleotide repeat expansion. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of pre- mRNA variants containing the hexanucleotide repeat. In certain embodiments, the antisense oligonucleotides described herein selectively inhibit expression of C90RF72 pathogenic associated mRNA variants. In certain embodiments, pre-mRNA variants of C90RF72 containing a hexanucleotide repeat expansion include SEQ ID NO: 1-3 and 6-10.
  • such hexanucleotide repeat expansion comprises at least 24 repeats of any of GGGGCC, GGGGGG, GGGGGC, or GGGGCG.
  • the hexanucleotide repeat expansion forms nuclear foci.
  • antisense oligonucleotides described herein are useful for reducing nuclear foci. Nuclear foci may be reduced in terms of percent of cells with foci as well as number of foci per cell.
  • primer probe set RTS3905 detects an mRNA variant (e.g. NM_001256054.1) processed from a pre-mRNA variant containing the hexanucleotide repeat.
  • the mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat i.e., the "C90RF72 pathogenic associated mRNA variant").
  • a pre-mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1 A to the start site of exon IB, e.g., nucleotides 1107 to 1520 of the genomic sequence (SEQ ID NO: 2, the complement of GENBANK Accession No.
  • NT_008413.18 truncated from nucleosides 27535000 to 27565000.
  • Oligonucleotides were designed in this region to selectively target the pre-mRNA variant containing the hexanucleotide repeat.
  • RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.
  • Antisense oligonucleotides described herein may hybridize to any C90RF72 variant at any state of processing within any element of the C90RF72 gene. For example, antisense
  • oligonucleotides described herein may hybridize to an exon, an intron, the 5' UTR, the 3' UTR, a repeat region, a hexanucleotide repeat expansion, a splice junction, an exomexon splice junction, an exonic splicing silencer (ESS), an exonic splicing enhancer (ESE), exon la, exon lb, exon lc, exon Id, exon le, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10.
  • ESS exonic splicing silencer
  • ESE exonic splicing enhancer
  • antisense oligonucleotides may target any of the exons characterized below in Tables 1-5 for the various C90RF72 variants described below.
  • Antisense oligonucleotides described herein may also target variants not characterized below and such variants are characterized in GENBANK.
  • antisense oligonucleotides described herein may also target elements other than exons and such elements are characterized in GENBANK.
  • provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions described herein.
  • the individual has a neurodegenerative disease.
  • the individual is at risk for developing a neurodegenerative disease, including, but not limited to, ALS or FTD.
  • the individual has been identified as having a C90RF72 associated disease.
  • methods for prophylactically reducing C90RF72 expression in an individual include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a C90RF72 nucleic acid is accompanied by monitoring of C90RF72 levels in an individual, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of an antisense compound targeted to a C90RF72 nucleic acid results in reduction of C90RF72 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • administration of an antisense compound targeted to a C90RF72 nucleic acid results in improved motor function and respiration in an animal.
  • administration of a C90RF72 antisense compound improves motor function and respiration by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to C90RF72 are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including ALS and FTD.
  • one or more pharmaceutical compositions described herein are coadministered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein.
  • one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein.
  • one or more pharmaceutical agents described herein are coadministered with one or more other pharmaceutical agents.
  • compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions described herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • compositions described herein are co-administered with another pharmaceutical agent to produce a synergistic effect.
  • one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include Riluzole (Rilutek), Lioresal (Lioresal), and Dexpramipexole.
  • pharmaceutical agents that may be co-administered with a
  • C90RF72 specific inhibitor described herein include, but are not limited to, an additional C90RF72 inhibitor.
  • pharmaceutical agents that may be co-administered with a
  • C90RF72 specific inhibitor described herein include, but are not limited to, a C90RF72 antisense transcript specific inhibitor.
  • the C90RF72 antisense transcript specific inhibitor is an antisense compound.
  • the antisense compound is a modified oligonucleotide. In certain embodiments, the modified oligonucleotide is single-stranded.
  • the co-administered pharmaceutical agent is administered prior to administration of a pharmaceutical composition described herein. In certain embodiments, the coadministered pharmaceutical agent is administered following administration of a pharmaceutical composition described herein. In certain embodiments the co-administered pharmaceutical agent is administered at the same time as a pharmaceutical composition described herein. In certain embodiments the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
  • the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone.
  • the coadministration results in effects that are additive of the effects of the compounds when administered alone.
  • the co-administration results in effects that are supra-additive of the effects of the compounds when administered alone.
  • the first compound is an antisense compound.
  • the second compound is an antisense compound.
  • compounds described herein are more tolerable than ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and/or ISIS 577083.
  • ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 were selected as comparator compounds because they exhibited high levels of dose-dependent reduction of C90RF72 mRNA in various studies described in WO2014/062691.
  • ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, and ISIS 577083 were deemed highly efficacious and potent compounds.
  • ISIS 577065, ISIS 577056, and ISIS 576816 described in WO2014/062691 are structurally similar as compounds described herein.
  • ISIS 577065 has a 16 nucleobase overlap with ISIS 801287
  • ISIS 577056 has a 16 nucleobase overlap with ISIS 806679
  • ISIS 576816 has an 18 nucleobase overlap with ISIS 802473 (18-mer)
  • ISIS 576816 has an 18 nucleobase overlap with ISIS 802459.
  • ISIS 576816 a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') GCCTTACTCTAGGACCAAGA (incorporated herein as SEQ ID NO: 21), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 576816 achieved an average FOB score of 7.00 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 576816.
  • ISIS 576974 a 5-10-5 MOE gapmer, having a sequence of (from
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine
  • each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 576974 achieved an average FOB score of 5.67 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 576974.
  • ISIS 577061 a 5-10-5 MOE gapmer, having a sequence of (from
  • TACAGGCTGCGGTTGTTTCC (incorporated herein as SEQ ID NO: 57), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 577061 achieved an average FOB score of 7.00 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 577061.
  • ISIS 577065 a 5-10-5 MOE gapmer, having a sequence of (from
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine
  • each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 577065 achieved an average FOB score of 6.00 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 577065.
  • ISIS 577083 a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') GGTAACTTCAAACTCTTGGG (incorporated herein as SEQ ID NO: 59), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 577083 achieved an average FOB score of 7.00 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 577083.
  • ISIS 577056 a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') AATCTTTATCAGGTCTTTTC (incorporated herein as SEQ ID NO: 60), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2'-0-methoxyethyl group, which was previously described in WO2014/062691, incorporated herein by reference, is a comparator compound.
  • ISIS 577056 achieved an average FOB score of 6.5 in a study of acute tolerability in mice (see Example 3 hereinbelow).
  • Certain compounds described herein achieved a lower FOB score in a similar study of acute tolerability in mice (see Example 2 hereinbelow), including ISIS 801287, ISIS 806679, ISIS 802473, and ISIS 802459. Therefore, certain compounds described herein are more tolerable than comparator compound ISIS 577056.
  • the human C90RF72 antisense oligonucleotides described herein are human therapeutics.
  • RNA expression RNA expression
  • C90RF72 pathogenic associated RNA variant expression in vitro dose response (IC50)
  • IC50 in vitro inhibition of total or pathogenic RNA and/or protein in a transgenic animal containing a human C90RF72 transgene in relevant tissues (e.g., brain and/or spinal cord)
  • Tolerability markers that may be measured include blood and serum chemistry parameters, CSF chemistry parameters, body and organ weights, general observations and/or behavioral tests, and/or biochemical markers such as GFAP and/or AIF1. Acute or long term tolerability may be measured.
  • ISIS 801287 is characterized as a 4-8-6 MOE gapmer, having a sequence of (from 5' to 3 ') GCCCCTAGCGCGCGACTC (incorporated herein as SEQ ID NO: 33), wherein each of nucleosides 1-4 and 13-18 are 2'-0-methoxyethylribose modified nucleosides, and each of nucleosides 5-12 are 2'-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, 14 to 15, and 15 to 16 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 16 to 17, and 17 to 18 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.
  • ISIS 801287 is described by the following chemical notation: Ges mCeo mCeo mCes mCds Tds Ads Gds mCds Gds mCds Gds mCeo Geo Aeo mCes Tes mCe;
  • A an adenine
  • mC a 5 '-methyl cytosine
  • G a guanine
  • o a phosphodiester internucleoside linkage.
  • ISIS 801287 is described by the following chemical structure, or a salt thereof:
  • the sodium salt of ISIS 801287 is described by the following chemical structure:
  • ISIS 806679 is characterized as a 6-10-4 MOE gapmer, having a sequence of (from 5' to 3 ') GGTTAATCTTTATCAGGTCT (incorporated herein as SEQ ID NO: 49), wherein each of nucleosides 1-6 and 17-20 are 2'-0-methoxyethylribose modified nucleosides, and each of nucleosides 7-16 are 2'-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5' -methyl cytosine.
  • mC a 5'-methylcytosine
  • G a guanine
  • o a phosphodiester internucleoside linkage.
  • ISIS 806679 is described by the following chemical structure, or a salt thereof:
  • the sodium salt of ISIS 806679 is described by the following chemical structure:
  • ISIS 802473 is characterized as a 4-8-6 MOE gapmer, having a sequence of (from 5' to 3 ') GCCTTACTCTAGGACCAA (incorporated herein as SEQ ID NO: 47), wherein each of nucleosides 1-4 and 13-18 are 2'-0-methoxyethylribose modified nucleosides, and each of nucleosides 5-12 are 2'-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, 14 to 15, and 15 to 16 are phosphodiester linkages and the internucleoside linkages between nucleosides are 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 16 to 17, and 17 to 18 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.
  • ISIS 802473 is described by the following chemical notation: Ges mCeo mCeo Tes Tds Ads mCds Tds mCds Tds Ads Gds Geo Aeo mCeo mCes Aes Ae; wherein,
  • A an adenine
  • mC a 5 '-methyl cytosine
  • G a guanine
  • o a phosphodiester internucleoside linkage.
  • ISIS 802473 is described by the following chemical structure, or a salt thereof:
  • the sodium salt of ISIS 802473 is described by the following chemical structure:
  • ISIS 802459 is characterized as a 3-10-7 MOE gapmer, having a sequence of (from 5' to 3 ') GCCTTACTCTAGGACCAAGA (incorporated herein as SEQ ID NO: 21), wherein each of nucleosides 1-3 and 14-20 are 2'-0-methoxyethylribose modified nucleosides, and each of nucleosides 4-13 are 2'-deoxynucleosides, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 14 to 15, 15 to 16, 16 to 17, and 17 to 18 are phosphodiester linkages and the intemucleoside linkages between nucleosides are 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 18 to 19, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5' -methyl cytosine.
  • ISIS 802459 is described by the following chemical notation: Ges mCeo mCeo Tds Tds Ads mCds Tds mCds Tds Ads Gds Gds Aeo mCeo mCeo Aeo Aes Ges Ae; wherein,
  • A an adenine
  • mC a 5'-methylcytosine
  • G a guanine
  • o a phosphodiester internucleoside linkage.
  • ISIS 802459 is described by the following chemical structure, or a salt thereof:
  • the sodium salt of ISIS 802459 is described by the following chemical structure:
  • Example 1 Antisense oligonucleotides targeting human C90RF72
  • the antisense oligonucleotides in the table below were designed as MOE gapmers.
  • the central gap segment of each gapmer contains 2'-deoxynucleosides and is flanked by wing segments on both the 5' end and on the 3' end containing nucleosides that each comprise a 2'-MOE group.
  • the specific motif of each gapmer is listed in table below, represented by three numbers separated by hyphens. The numbers represent the number of nucleosides in the 5 '-wing, the gap, and the 3 '-wing, respectively. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
  • the internucleoside linkages for the gapmers are mixed phosphorothioate and phosphodiester linkages.
  • the internucleoside linkages for each gapmer are presented in the Linkage column, where ⁇ ' indicates a phosphodiester linkage and's' indicates a
  • Each antisense oligonucleotide listed in the table below is targeted to the human C90RF72 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No.
  • NT_008413.18 truncated from nucleosides 27535000 to 27565000.
  • Start site indicates the 5 '-most nucleoside to which the gapmer is targeted in the human genomic sequence.
  • Sttop site indicates the 3'-most nucleoside to which the gapmer is targeted human genomic sequence.
  • Example 2 Tolerability of antisense oligonucleotides targeting human C90RF72 in mice
  • Antisense oligonucleotides described above were tested in mice to assess tolerability of the oligonucleotides.
  • Wild type C57/B16 mice each received a single ICV dose of 700 ⁇ g of an antisense oligonucleotide listed in the table below.
  • Each treatment group consisted of 4 mice.
  • the 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to a tail pinch; (7) regular breathing.
  • each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the 700 ⁇ g ICV dose, and met all other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the 700 ⁇ g ICV dose but met all other criteria, it would receive a score of 1. The results are presented as the average score for each treatment group.
  • Oligonucleotides described in WO 2014/062691 were tested in an acute tolerability study in mice. Groups of 3 wild type C57/B16 mice were treated and analyzed as described in Example 2. The tested oligonucleotides include those listed in the table below, which are 5-10-5 MOE gapmers with a full phosphorothioate backbone and each cytosine is a 5-methylcytosine. The start and stop sites on SEQ ID NO: 2 that each oligonucleotide is targeted to are shown. The results are presented as the average score for each treatment group in the table below. These results demonstrate that ISIS 576816, ISIS 576974, ISIS 577061, ISIS 577065, ISIS 577083, and ISIS 577056 were poorly tolerated.
  • Example 4 Antisense inhibition of a human C90RF72 mRNA variant in HepG2 cells
  • Antisense oligonucleotides described above are tested for their effects on C90RF72 mRNA in vitro.
  • RNA is isolated from the cells and C90RF72 mRNA levels are measured by quantitative real-time PCR.
  • Human primer probe set RTS3905 forward primer sequence GGGTCTAGCAAGAGCAGGTG, designated herein as SEQ ID NO: 12; reverse primer sequence GTCTTGGCAACAGCTGGAGAT, designated herein as SEQ ID NO: 13; probe sequence TGATGTCGACTCTTTGCCCACCGC, designated herein as SEQ ID NO: 14 - a TAQ-man primer probe set
  • RTS3905 detects an mRNA variant (e.g.
  • NM_001256054.1 processed from a pre-mRNA variant containing the hexanucleotide repeat.
  • the mRNA variant processed from a pre-mRNA variant containing the hexanucleotide repeat is herein the "C90RF72 pathogenic associated mRNA variant.”
  • a pre- mRNA contains the hexanucleotide repeat when transcription of the pre-mRNA begins in the region from the start site of exon 1A to the start site of exon IB (generally nucleotides 1107 to 1520 of the genomic sequence: SEQ ID NO: 2, the complement of GENBANK Accession No. NT_008413.18 truncated from nucleosides 27535000 to 2756500.
  • oligonucleotides designed in this region selectively target the pre-mRNA variant containing the hexanucleotide repeat.
  • RTS3905 measures an mRNA product (i.e. the C90RF72 pathogenic associated mRNA variant) of the pre-mRNA variant containing the hexanucleotide repeat and, therefore, measures the reduction of the pre-mRNA variant containing the hexanucleotide repeat.
  • the levels of the C90RF72 pathogenic associated mRNA variant are normalized to the total RNA content of the cell, as measured by RIBOGREEN®, then the normalized mRNA variant levels are compared to those of cells that were not treated with antisense oligonucleotide.
  • Example 5 Dose-dependent antisense inhibition of a human C90RF72 mRNA variant
  • Antisense oligonucleotides described above are tested at various doses in HepG2 cells.
  • Cells are plated at a density of 20,000 cells per well and electroporated with antisense oligonucleotide.
  • RNA is isolated from the cells and C90RF72 mRNA levels are measured by quantitative real-time PCR.
  • Human C90RF72 primer probe set RTS3905 is used to measure the C90RF72 pathogenic associated mRNA variant.
  • the levels of the C90RF72 pathogenic associated mRNA variant are adjusted according to total RNA content, as measured by RIBOGREEN ® .
  • the half maximal inhibitory concentration (IC 50 ) of each oligonucleotide is calculated based on the inhibition of mRNA variant levels observed at each individual dose of antisense oligonucleotide.
  • Antisense oligonucleotides described above that are fully cross-reactive with a rhesus C90RF72 nucleic acid are tested for their effects on rhesus C90RF72 mRNA in vitro.
  • Cultured rhesus LLC-MK2 cells at a density of 20,000 cells per well are electroporated with antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA is isolated from the cells and C90RF72 mRNA levels are measured by quantitative real-time PCR.
  • Primer probe set RTS3750 forward sequence
  • TGTGACAGTTGGAATGCAGTGA designated herein as SEQ ID NO: 15; reverse sequence
  • TCGACTCTTTGCCCACCGCCA designated herein as SEQ ID NO: 17 - a TAQ-man primer probe set
  • RTS3750 targets exon 2 of the mRNA transcripts and, therefore, measures total mRNA transcripts.
  • C90RF72 mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®, then the normalized mRNA variant levels are compared to those of cells that were not treated with antisense oligonucleotide.
  • Example 7 Dose-dependent antisense inhibition of human C90RF72 mRNA in LLC-MK2
  • Antisense oligonucleotides described above are tested at various doses in LLC-MK2 cells.
  • Cells are plated at a density of 20,000 cells per well and electroporated with antisense oligonucleotide.
  • RNA is isolated from the cells and C90RF72 mRNA levels are measured by quantitative real-time PCR.
  • Primer probe set RTS3750 is used to measure total C90RF72 mRNA levels.
  • C90RF72 mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®, then the normalized mRNA variant levels are compared to those of cells that were not treated with antisense oligonucleotide.
  • Example 8 Antisense inhibition of human C90RF72 mRNA in a transgenic mouse model
  • Antisense oligonucleotides described above are tested in two BAC transgenic mouse lines, designated herein as C9B41 and C9B183, that each express a truncated human C90RF72 gene comprising exons 1-5.
  • the truncated human C90RF72 genes of the C9B41 and C9B183 mouse lines comprise 110 and 450 hexanucleotide repeats, respectively.
  • Each mouse in each treatment group receives 350 ⁇ g of an antisense oligonucleotide, then expression levels of human C90RF72 RNA are analyzed by RT-PCR. Dose responses are also performed.
  • Example 9 Antisense inhibition of C90RF72 mRNA in patient fibroblasts
  • Antisense oligonucleotides described above were tested for their effects on C90RF72 mRNA in vitro.
  • the antisense oligonucleotides listed in the table below were added to a plate before patient fibroblasts F09-152 were added at a density of 20,000 cells per well.
  • the final concentrations of the antisense oligonucleotides after the addition of the cells are listed in the table below. After 30 seconds of shaking, the cells were electroporated then transferred to a Primaria coated culture plate.
  • the levels of the C90RF72 total mRNA and C90RF72 pathogenic associated mRNA were normalized to the total RNA content of the cell, as measured by RIBOGREEN®, then the normalized mRNA levels were compared to those of cells that were not treated with antisense oligonucleotide.
  • the results are shown in the table below. An entry of "nd” means not determined. IC 50 values listed as "nd” were not determined, because the target was not inhibited sufficiently to determine an IC 50 . The results show that all of the oligonucleotides listed below inhibited the pathogenic associated C90RF72 mRNA variant.
  • Oligonucleotides that do not specifically target the repeat variant pre-mRNA inhibited both the pathogenic associated C90RF72 mRNA and total C90RF72 mRNA. Oligonucleotides that specifically target the repeat variant pre-mRNA selectively inhibited the pathogenic associated C90RF72 mRNA.
  • Example 10 Antisense inhibition of human C90RF72 mRNA in a transgenic mouse model
  • Antisense oligonucleotides described above were tested in a BAC transgenic mouse line, C9B41 (see Example 8), that expresses a human C90RF72 gene comprising the promoter region through exon 5 and 110 hexanucleotide repeats.
  • Each treatment group consisted of 2-3 mice.
  • Each mouse received a single ICVB of 350 ⁇ g of an antisense oligonucleotide listed in the tables below or PBS. Two weeks later, the mice were euthanized, and expression levels of the human pathogenic associated C90RF72 mRNA variant and/or total human C90RF72 mRNA were analyzed by RT-qPCR as described in Example 9.
  • Example 11 Dose dependent antisense inhibition of human C90RF72 mRNA in a transgenic mouse model
  • Antisense oligonucleotides described above were tested in two BAC transgenic mouse lines, C9B41 and C9B183, that each express atruncated human C90RF72 gene comprising exons 1-5.
  • the truncated human C90RF72 genes of the C9B41 and C9B183 mouse lines comprise 110 and 450 hexanucleotide repeats, respectively (see Example 8).
  • Each treatment group consisted of 2-4 mice. Each mouse received a single ICVB of 30 ⁇ g, 100 ⁇ g, 300 ⁇ g, or 700 ⁇ g of an antisense oligonucleotide as listed in the tables below or PBS.
  • mice Two weeks later, the mice were euthanized, and expression levels of the human pathogenic associated C90RF72 mRNA variant and/or total human C90RF72 mRNA were analyzed by RT-qPCR as described in Example 9.
  • the results in the tables below show the average percent normalized human C90RF72 mRNA levels relative to the normalized average for the PBS treated group. A value of 100 or greater means the antisense oligonucleotide did not reduce mRNA or increased the amount of mRNA.
  • Example 12 Tolerability of antisense oligonucleotides targeting human C90rf72in mice
  • Wild type C57/B16 mice each received a single ICV dose of 70C ⁇ g of an antisense oligonucleotide listed in the table below, as described in Example 2.
  • Each treatment group consisted of 4 mice.
  • mice were evaluated according to 7 different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing.
  • a mouse was given a subscore of 0 if it met the criteria and 1 if it did not. After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below.
  • mice were sacrificed at 8 weeks. The cortex and spinal cord were collected from each animal, and RT-PCR was performed. Expression levels of allograft inflammatory factor (AIF1) were determined as a measure of inflammation. Expression levels of glial fibrillary acidic protein (GFAP) were also determined as a measure of glial cell activation. Results were normalized to Gpadh and are presented relative to PBS control (1.0) in the table below. "N.D.” indicates there was no data because the experiment was not performed. An asterisk indicates that the corresponding result is the average of 1-3 mice. Table 15: Tolerabilty of antisense oligonucleotides targeting C90rf72 in mice
  • Example 13 Tolerability of antisense oligonucleotides targeting human C90rf72in rats
  • Sprague Dawley rats were separated into groups of 4 or 6 rats. Each rat in each group of rats was administered a single 3 mg intrathecal (IT) dose of the oligonucleotide indicated in the table below. At 3 hours and at 8 weeks following the IT dose, the movement of 7 different parts of the body was evaluated for each rat.
  • the 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head.
  • each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. Saline treated rats generally receive a score of 0. A score of at the top end of the range would be suggestive of acute toxicity. Results are presented in the table below as the average score for each treatment group.
  • Example 14 Tolerability of antisense oligonucleotides targeting human C90RF72 in non- human primates
  • oligonucleotide on days 1, 14, and 28 via intrathecal bolus injection (ImL slow bolus followed by 0.25mL flush). Each treatment group contained four monkeys. Two weeks after the final dose, animals were sacrificed and RT-PCR was performed on various CNS tissues. Expression levels of AIF1 were determined as a measure of inflammation and expression levels of GFAP were determined as a measure of glial cell activation. Results were normalized to GADPH and are presented relative to PBS control (1.0) in the table below for ISIS No. 801287, 802459, and 806679.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Neurosurgery (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychology (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2016/027747 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression Ceased WO2016168592A2 (en)

Priority Applications (34)

Application Number Priority Date Filing Date Title
NZ733882A NZ733882A (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
RS20200535A RS60230B1 (sr) 2015-04-16 2016-04-15 Kompozicije za moduliranje ekspresije c9orf72
KR1020207010994A KR102258516B1 (ko) 2015-04-16 2016-04-15 C9orf72 발현을 조절하기 위한 조성물
HK18108871.7A HK1250255B (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
DK16780833.6T DK3283080T3 (da) 2015-04-16 2016-04-15 Sammensætninger til modulation af c9orf72-ekspression
KR1020177032588A KR102104163B1 (ko) 2015-04-16 2016-04-15 C9orf72 발현을 조절하기 위한 조성물
ES16780833T ES2791995T3 (es) 2015-04-16 2016-04-15 Composiciones para modular la expresión de C90RF72
PL16780833T PL3283080T3 (pl) 2015-04-16 2016-04-15 Kompozycja do modulowania ekspresji c9orf72
AU2016249002A AU2016249002B2 (en) 2015-04-16 2016-04-15 Compositions for modulating C90RF72 expression
CA2978103A CA2978103A1 (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
HRP20200843TT HRP20200843T1 (hr) 2015-04-16 2016-04-15 Sastavi za moduliranje ekspresije c9orf72
SI201630693T SI3283080T1 (sl) 2015-04-16 2016-04-15 Sestavki za moduliranje izražanja C9ORF72
MX2019007834A MX385674B (es) 2015-04-16 2016-04-15 Composiciones para modular la expresion de c9orf72.
MX2017013199A MX366128B (es) 2015-04-16 2016-04-15 Composiciones para modular la expresion de c90rf72.
SG11201708468YA SG11201708468YA (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
EP20163264.3A EP3722424A1 (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
EP16780833.6A EP3283080B1 (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
JP2017546618A JP6606557B2 (ja) 2015-04-16 2016-04-15 C9orf72発現を調節するための組成物
LTEP16780833.6T LT3283080T (lt) 2015-04-16 2016-04-15 C9orf72 ekspresijos moduliavimo kompozicijos
MYPI2017703869A MY181815A (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression
BR112017016068-4A BR112017016068A2 (pt) 2015-04-16 2016-04-15 composições para modulação de expressão de c9orf72
SM20200165T SMT202000165T1 (it) 2015-04-16 2016-04-15 Composizioni per modulare l'espressione di c9orf72
CN201680016814.1A CN107427532B (zh) 2015-04-16 2016-04-15 用于调节c9orf72表达的组合物
RU2017139121A RU2736574C2 (ru) 2015-04-16 2016-04-15 Композиции для модулирования экспрессии c9orf72
IL253557A IL253557B (en) 2015-04-16 2017-07-18 Preparations for modulation of c9orf72 expression
CONC2017/0007671A CO2017007671A2 (es) 2015-04-16 2017-07-28 Composiciones para modular la expresión de c9orf72
PH12017501875A PH12017501875B1 (en) 2015-04-16 2017-10-13 Compositions for modulating c9orf72 expression
SA520412450A SA520412450B1 (ar) 2015-04-16 2017-10-16 C9orf72 تركيبات لتعديل التعبير الوراثي عن
SA520412451A SA520412451B1 (ar) 2015-04-16 2017-10-16 .تركيبات لتعديل التعبير الوراثي عن c9orf72
SA517390168A SA517390168B1 (ar) 2015-04-16 2017-10-16 تركيبات لتعديل التعبير الوراثي عن c9orf72
AU2019250156A AU2019250156B2 (en) 2015-04-16 2019-10-16 Compositions for modulating c9orf72 expression
PH12019502724A PH12019502724A1 (en) 2015-04-16 2019-12-02 Compositions for modulating c9orf72 expression
CY20201100520T CY1122981T1 (el) 2015-04-16 2020-06-02 Συνθεσεις για διαμορφωση της εκφρασης του c9orf72
IL277624A IL277624A (en) 2015-04-16 2020-09-25 Preparations for modulation of C9ORF72 expression

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201562148691P 2015-04-16 2015-04-16
US62/148,691 2015-04-16
US201562232941P 2015-09-25 2015-09-25
US62/232,941 2015-09-25
US201562239400P 2015-10-09 2015-10-09
US62/239,400 2015-10-09

Publications (2)

Publication Number Publication Date
WO2016168592A2 true WO2016168592A2 (en) 2016-10-20
WO2016168592A3 WO2016168592A3 (en) 2016-11-24

Family

ID=57126261

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/027747 Ceased WO2016168592A2 (en) 2015-04-16 2016-04-15 Compositions for modulating c9orf72 expression

Country Status (30)

Country Link
US (4) US9605263B2 (enExample)
EP (2) EP3722424A1 (enExample)
JP (3) JP6606557B2 (enExample)
KR (2) KR102258516B1 (enExample)
CN (2) CN113265404A (enExample)
AU (2) AU2016249002B2 (enExample)
BR (1) BR112017016068A2 (enExample)
CA (1) CA2978103A1 (enExample)
CL (4) CL2017002567A1 (enExample)
CO (1) CO2017007671A2 (enExample)
CY (1) CY1122981T1 (enExample)
DK (1) DK3283080T3 (enExample)
ES (1) ES2791995T3 (enExample)
HR (1) HRP20200843T1 (enExample)
HU (1) HUE049233T2 (enExample)
IL (2) IL253557B (enExample)
LT (1) LT3283080T (enExample)
MX (2) MX366128B (enExample)
MY (1) MY181815A (enExample)
NZ (1) NZ733882A (enExample)
PH (2) PH12017501875B1 (enExample)
PL (1) PL3283080T3 (enExample)
PT (1) PT3283080T (enExample)
RS (1) RS60230B1 (enExample)
RU (1) RU2736574C2 (enExample)
SA (3) SA517390168B1 (enExample)
SG (2) SG10202001856WA (enExample)
SI (1) SI3283080T1 (enExample)
SM (1) SMT202000165T1 (enExample)
WO (1) WO2016168592A2 (enExample)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10443052B2 (en) 2012-10-15 2019-10-15 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10577604B2 (en) 2012-10-15 2020-03-03 Ionis Pharmaceuticals, Inc. Methods for monitoring C9ORF72 expression
WO2020117772A1 (en) 2018-12-06 2020-06-11 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
JP2020534253A (ja) * 2017-08-08 2020-11-26 ウェーブ ライフ サイエンシーズ リミテッド オリゴヌクレオチド組成物及びその方法
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11629347B2 (en) 2019-05-06 2023-04-18 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3017532A1 (en) * 2016-04-13 2017-10-19 Ionis Pharmaceuticals, Inc. Methods for reducing c9orf72 expression
WO2018081728A1 (en) * 2016-10-31 2018-05-03 Emendobio Inc. Compositions for genome editing
US10905707B2 (en) 2017-11-10 2021-02-02 University Of Massachusetts Compositions and methods for the treatment of expanded repeat-associated disorders
CN113164557A (zh) * 2018-07-23 2021-07-23 因柯利尔疗法公司 治疗神经性病症的方法
WO2020027311A1 (ja) 2018-08-03 2020-02-06 国立大学法人東京医科歯科大学 Tdp-43凝集阻害剤
JP7455831B2 (ja) * 2018-11-21 2024-03-26 アイオーニス ファーマシューティカルズ, インコーポレーテッド プリオン発現を低減するための化合物及び方法
WO2020205605A2 (en) * 2019-03-29 2020-10-08 University Of Massachusetts OLIGONUCLEOTIDE-BASED MODULATION OF C9orf72
CN114585370A (zh) * 2019-10-06 2022-06-03 波涛生命科学有限公司 寡核苷酸组合物及其使用方法
WO2024036186A2 (en) * 2022-08-09 2024-02-15 The University Of Massachusetts Identification of allele-specific target sequences for c9orf72

Citations (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5698685A (en) 1985-03-15 1997-12-16 Antivirals Inc. Morpholino-subunit combinatorial library and method
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (ja) 2003-08-28 2005-03-10 Gene Design, Inc. N−0結合性架橋構造型新規人工核酸
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2010036696A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Cyclohexenyl nucleic acid analogs
WO2014062736A1 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Methods for monitoring c9orf72 expression
WO2014062691A2 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression

Family Cites Families (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
CA2126691C (en) 1991-12-24 2003-05-06 Phillip Dan Cook Gapped 2' modified oligonucleotides
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5681940A (en) * 1994-11-02 1997-10-28 Icn Pharmaceuticals Sugar modified nucleosides and oligonucleotides
WO2005121368A1 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Chimeric gapped oligomeric compositions
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
USH2191H1 (en) 2000-10-24 2007-06-05 Snp Consortium Identification and mapping of single nucleotide polymorphisms in the human genome
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
JP2006507841A (ja) 2002-11-14 2006-03-09 ダーマコン, インコーポレイテッド 機能的siRNAおよび超機能的siRNA
US7790867B2 (en) 2002-12-05 2010-09-07 Rosetta Genomics Inc. Vaccinia virus-related nucleic acids and microRNA
US20050261233A1 (en) 2004-04-21 2005-11-24 Sanjay Bhanot Modulation of glucose-6-phosphatase translocase expression
CA2566286A1 (en) 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
PT2161038E (pt) 2006-01-26 2014-03-10 Isis Pharmaceuticals Inc Composições e suas utilizações dirigidas à huntingtina
ATE514777T1 (de) 2006-05-05 2011-07-15 Isis Pharmaceuticals Inc Verbindungen und verfahren zur modulation von genexpression
ES2603379T3 (es) 2006-10-09 2017-02-27 Roche Innovation Center Copenhagen A/S Compuestos antagonistas de ARN para la modulación de PCSK9
AU2007334502B2 (en) 2006-12-14 2011-12-15 Novartis Ag Compositions and methods to treat muscular & cardiovascular disorders
DE602007005629D1 (de) 2007-06-18 2010-05-12 Commissariat Energie Atomique Reversibles siRNA-Silencing eines mutierten und endogenen Huntington-Wildtypgens und dessen Anwendung zur Behandlung von Morbus Huntington
US20090123928A1 (en) 2007-10-11 2009-05-14 The Johns Hopkins University Genomic Landscapes of Human Breast and Colorectal Cancers
BRPI0819193A2 (pt) * 2007-11-05 2017-05-23 Baltic Tech Dev Ltd uso de oligonucleotídeos com bases modificadas na hibridização de ácidos nucleicos.
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010120820A1 (en) 2009-04-13 2010-10-21 Isis Pharmaceuticals, Inc. Compositions and methods for modulation of smn2 splicing
JP2012524068A (ja) * 2009-04-15 2012-10-11 アイシス ファーマシューティカルズ, インコーポレーテッド 第xi因子による炎症反応のモジュレーション
EA201270019A1 (ru) 2009-06-15 2012-06-29 Элнилэм Фармасьютикалз, Инк. Двуцепочечная рнк, включенная в липидный состав и мишенью которой является ген pcsk9
CA2767231A1 (en) 2009-07-06 2011-01-13 Alnylam Pharmaceuticals, Inc. Cell-based bioprocessing
US8927513B2 (en) 2009-07-07 2015-01-06 Alnylam Pharmaceuticals, Inc. 5′ phosphate mimics
WO2011017521A2 (en) 2009-08-06 2011-02-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011135396A1 (en) 2010-04-30 2011-11-03 Cellectis Method for modulating double-strand break-induced homologous recombination
WO2012005898A2 (en) 2010-06-15 2012-01-12 Alnylam Pharmaceuticals, Inc. Chinese hamster ovary (cho) cell transcriptome, corresponding sirnas and uses thereof
JP5981428B2 (ja) * 2010-07-19 2016-08-31 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. 筋緊張性ジストロフィー・プロテインキナーゼ(dmpk)発現の調整
JP6126009B2 (ja) * 2010-11-17 2017-05-10 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. α−シヌクレイン発現の調節
DK2655621T3 (en) 2010-12-20 2018-08-13 Massachusetts Gen Hospital Polycomb-associated non-coding RNAS
US20140050778A1 (en) 2010-12-28 2014-02-20 University Of Rochester Nucleic acid binding compounds, methods of making, and use thereof
SMT201900060T1 (it) 2011-04-01 2019-02-28 Ionis Pharmaceuticals Inc Modulazione dell'espressione del trasduttore di segnale e dell'attivatore di trascrizione 3 (stat3)
CR20190207A (es) * 2011-04-21 2019-06-26 Ionis Pharmaceuticals Inc MODULACIÓN DE LA EXPRESIÓN DEL VIRUS DE LA HEPATITIS B (VHB) (Divisional 2013-0551)
EP3202914B2 (en) 2011-08-31 2023-06-28 The University of Manchester Method for treating a neurodegenerative disease
WO2013036833A1 (en) 2011-09-09 2013-03-14 Mayo Foundation For Medical Education And Research Detecting frontotemporal dementia and amyotrophic lateral sclerosis
BR112014009790A2 (pt) * 2011-10-25 2018-05-15 Isis Pharmaceuticals Inc composto para modulação antisense da expressão de gccr, seu uso e composição
JP2014533508A (ja) * 2011-11-17 2014-12-15 リーアニクス・インコーポレイテッドRheonix, Inc. 選択的分子分析のためのシステムおよび方法
ES2832531T3 (es) * 2011-11-30 2021-06-10 Sarepta Therapeutics Inc Oligonucleótidos para el tratamiento de enfermedades por expansión de repeticiones
CA2858576A1 (en) 2011-12-06 2013-06-13 Research Institute At Nationwide Children's Hospital Non-ionic, low osmolar contrast agents for delivery of antisense oligonucleotides and treatment of disease
AU2013253074C1 (en) * 2012-04-23 2018-06-14 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of neuromuscular disorders
CA3185392A1 (en) * 2012-05-24 2013-11-28 Ionis Pharmaceuticals, Inc. Methods and compositions for modulating apolipoprotein(a) expression
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
PT2948777T (pt) 2013-01-22 2019-09-26 Deutsches Zentrum Fuer Neurodegenerative Erkrankungen E V Proteínas de repetição por dipeptídeos como alvo terapêutico em doenças neurodegenerativas com expansão de hexanucleotídico repetido
EP3055414A4 (en) * 2013-10-11 2017-07-19 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
WO2016024205A1 (en) 2014-08-15 2016-02-18 Pfizer Inc. Oligomers targeting hexanucleotide repeat expansion in human c9orf72 gene
WO2016060919A1 (en) 2014-10-14 2016-04-21 The Board Of Regents Of The University Of Texas System Allele selective inhibition of mutant c9orf72 foci expression by duplex rnas targeting the expanded hexanucleotide repeat
WO2017079291A1 (en) 2015-11-02 2017-05-11 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating c90rf72
CA3017532A1 (en) 2016-04-13 2017-10-19 Ionis Pharmaceuticals, Inc. Methods for reducing c9orf72 expression
US10399845B2 (en) 2017-09-22 2019-09-03 Emco Wheaton Retail Corporation Testable overfill prevention valve for a liquid storage container

Patent Citations (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5698685A (en) 1985-03-15 1997-12-16 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5792847A (en) 1989-10-24 1998-08-11 Gilead Sciences, Inc. 2' Modified Oligonucleotides
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7034133B2 (en) 1997-09-12 2006-04-25 Exiqon A/S Oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (ja) 2003-08-28 2005-03-10 Gene Design, Inc. N−0結合性架橋構造型新規人工核酸
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US20070287831A1 (en) 2006-05-11 2007-12-13 Isis Pharmaceuticals, Inc 5'-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2010036696A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Cyclohexenyl nucleic acid analogs
WO2014062736A1 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Methods for monitoring c9orf72 expression
WO2014062691A2 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression

Non-Patent Citations (58)

* Cited by examiner, † Cited by third party
Title
"GENBANK", Database accession no. NW -001101662.1
ALBAEK ET AL., J. ORG. CHEM., vol. 71, 2006, pages 7731 - 7740
ALTMANN ET AL., BIOCHEM. SOC. TRANS., vol. 24, 1996, pages 630 - 637
ALTMANN ET AL., CHIMIA, vol. 50, 1996, pages 168 - 176
ALTMANN ET AL., NUCLEOSIDES NUCLEOTIDES, vol. 16, 1997, pages 917 - 926
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 410
BAKER ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 11944 - 12000
BOXER ET AL., J. NEUROL. NEUROSURG. PSYCHIATRY, vol. 82, 2011, pages 196 - 203
BRAASCH ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 4503 - 4510
BRAASCH ET AL., CHEM. BIOL., vol. 8, 2001, pages 1 - 7
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
CHIO ET AL., NEUROLOGY, vol. 70, 2008, pages 533 - 537
DEJESUS-HEMANDEZ ET AL., NEURON, vol. 72, 2011, pages 245 - 256
ELAYADI ET AL., CURR. OPINION INVENS. DRUGS, vol. 2, 2001, pages 558 - 561
FRIEDEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 21, 2003, pages 6365 - 6372
FRIER ET AL., NUCLEIC ACIDS RESEARCH, vol. 25, no. 22, 1997, pages 4429 - 4443
GAUTSCHI ET AL., J. NATL. CANCER INST., vol. 93, March 2001 (2001-03-01), pages 463 - 471
GU ET AL., OLIGONUCLEOTIDES, vol. 13, no. 6, 2003, pages 479 - 489
GU ET AL., TETRAHEDRON, vol. 60, no. 9, 2004, pages 2111 - 2123
GU, NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 24, no. 5-7, 2005, pages 993 - 998
HIRTZ ET AL., NEUROLOGY, vol. 68, 2007, pages 326 - 337
HORVATH ET AL., TETRAHEDRON LETTERS, vol. 48, 2007, pages 3621 - 3623
JOHNSON ET AL., NEURON, vol. 68, 2010, pages 857 - 864
JONES, L.J. ET AL., ANALYTICAL BIOCHEMISTRY, vol. 265, 1998, pages 368 - 374
KOSHKIN ET AL., TETRAHEDRON, vol. 54, 1998, pages 3607 - 3630
KUMAR ET AL., BIOORG. MED. CHEM. LETT., vol. 8, 1998, pages 2219 - 2222
KWIATKOWSKI ET AL., SCIENCE, vol. 323, 2009, pages 1205 - 1208
LAAKSOVIRTA ET AL., LANCET NEUROL., vol. 9, 2010, pages 978 - 985
LEUMANN, BIOORG. MED. CHEM., vol. 10, 2002, pages 841 - 854
LEUMANN, CHRISTIAN, J. BIOORG. & MED. CHEM., vol. 10, 2002, pages 841 - 854
LILLOHODGES, J. CLIN. NEUROSCI., vol. 16, 2009, pages 1131 - 1135
MAHERDOLNICK, NUC. ACID. RES., vol. 16, 1988, pages 3341 - 3358
MARTIN, HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MARUYAMA ET AL., NATURE, vol. 465, 2010, pages 223 - 226
MORITA ET AL., NEUROLOGY, vol. 66, 2006, pages 839 - 844
NAUWELAERTS ET AL., J. AM. CHEM. SOC., vol. 129, no. 30, 2007, pages 9340 - 9348
NAUWELAERTS ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 8, 2005, pages 2452 - 2463
NEUMANN ET AL., SCIENCE, vol. 314, 2006, pages 130 - 133
ORUM ET AL., CURR. OPINION MOL. THER., vol. 3, 2001, pages 239 - 243
PEARSON ET AL., J. NEROL., vol. 258, 2011, pages 647 - 655
ROBEYNS ET AL., ACTA CRYSTALLOGRAPHICA, SECTION F: STRUCTURAL BIOLOGY AND CRYSTALLIZATION COMMUNICATIONS, vol. F61, no. 6, 2005, pages 585 - 586
ROBEYNS ET AL., J. AM. CHEM. SOC., vol. 130, no. 6, 2008, pages 1979 - 1984
ROSEN ET AL., NATURE, vol. 362, 1993, pages 59 - 62
ROWLANDSHNEIDER, N. ENGL. J. MED., vol. 344, 2001, pages 1688 - 1700
SINGH ET AL., CHEM. COMMUN., vol. 4, 1998, pages 455 - 456
SINGH ET AL., J. ORG. CHEM., vol. 63, 1998, pages 10035 - 10039
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 489
SREEDHARAN ET AL., SCIENCE, vol. 319, 2008, pages 1668 - 1672
VANCE ET AL., BRAIN, vol. 129, 2006, pages 868 - 876
VANCE ET AL., BRAIN, vol. 129, 2009, pages 868 - 876
VERBEURE ET AL., NUCLEIC ACIDS RESEARCH, vol. 29, no. 24, 2001, pages 4941 - 4947
WAHLESTEDT ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 97, 2000, pages 5633 - 5638
WANG ET AL., J. AM. CHEM., vol. 122, 2000, pages 8595 - 8602
WANG ET AL., J. ORG. CHEM., vol. 66, 2001, pages 8478 - 82
WANG ET AL., J. ORG. CHEM., vol. 68, 2003, pages 4499 - 4505
WANG ET AL., NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 20, no. 4-7, 2001, pages 785 - 788
WOOLF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7305 - 7309
ZHANGMADDEN, GENOME RES., vol. 1997, no. 7, pages 649 656

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10577604B2 (en) 2012-10-15 2020-03-03 Ionis Pharmaceuticals, Inc. Methods for monitoring C9ORF72 expression
US10443052B2 (en) 2012-10-15 2019-10-15 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US11339393B2 (en) 2013-10-11 2022-05-24 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
US11739325B2 (en) 2017-08-08 2023-08-29 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
JP2020534253A (ja) * 2017-08-08 2020-11-26 ウェーブ ライフ サイエンシーズ リミテッド オリゴヌクレオチド組成物及びその方法
EP3664816A4 (en) * 2017-08-08 2021-05-19 Wave Life Sciences Ltd. OLIGONUCLEOTIDE COMPOSITIONS AND RELATED PROCESSES
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11447775B2 (en) 2018-01-12 2022-09-20 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US12180478B2 (en) 2018-01-12 2024-12-31 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
WO2020117772A1 (en) 2018-12-06 2020-06-11 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
US11629347B2 (en) 2019-05-06 2023-04-18 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods
US12378554B2 (en) 2019-05-06 2025-08-05 University Of Massachusetts Anti-C9ORF72 oligonucleotides and related methods

Also Published As

Publication number Publication date
CO2017007671A2 (es) 2018-01-31
MX385674B (es) 2025-03-18
CL2020002019A1 (es) 2020-12-11
MX366128B (es) 2019-06-28
CL2018003582A1 (es) 2019-04-05
LT3283080T (lt) 2020-05-25
SG10202001856WA (en) 2020-04-29
MX2019007834A (es) 2019-09-06
SG11201708468YA (en) 2017-11-29
BR112017016068A2 (pt) 2018-04-03
SA520412450B1 (ar) 2022-01-24
JP6606557B2 (ja) 2019-11-13
CN107427532B (zh) 2021-06-04
PH12019502724A1 (en) 2021-03-15
PL3283080T3 (pl) 2020-07-27
KR20170136597A (ko) 2017-12-11
RS60230B1 (sr) 2020-06-30
CY1122981T1 (el) 2021-10-29
IL253557B (en) 2020-11-30
RU2017139121A (ru) 2019-05-16
JP6924242B2 (ja) 2021-08-25
PH12017501875B1 (en) 2020-02-19
ES2791995T3 (es) 2020-11-06
NZ733882A (en) 2020-04-24
WO2016168592A3 (en) 2016-11-24
PT3283080T (pt) 2020-06-08
SI3283080T1 (sl) 2020-06-30
PH12017501875A1 (en) 2018-02-26
US20160304871A1 (en) 2016-10-20
AU2016249002B2 (en) 2019-07-18
RU2736574C2 (ru) 2020-11-18
SA520412451B1 (ar) 2021-02-22
US10815483B2 (en) 2020-10-27
JP2018512127A (ja) 2018-05-17
SMT202000165T1 (it) 2020-05-08
JP2020022483A (ja) 2020-02-13
HK1250255A1 (en) 2018-12-07
AU2019250156B2 (en) 2021-11-25
IL277624A (en) 2020-11-30
MY181815A (en) 2021-01-08
EP3283080A4 (en) 2018-12-19
US10138482B2 (en) 2018-11-27
DK3283080T3 (da) 2020-04-06
CL2020002018A1 (es) 2020-12-11
CL2017002567A1 (es) 2018-06-01
KR20200043513A (ko) 2020-04-27
AU2016249002A1 (en) 2017-08-10
SA517390168B1 (ar) 2020-08-26
HUE049233T2 (hu) 2020-09-28
MX2017013199A (es) 2018-02-09
AU2019250156A1 (en) 2019-10-31
CN113265404A (zh) 2021-08-17
US9605263B2 (en) 2017-03-28
KR102104163B1 (ko) 2020-04-23
EP3283080B1 (en) 2020-03-18
JP2021184720A (ja) 2021-12-09
IL253557A0 (en) 2017-09-28
US20190264204A1 (en) 2019-08-29
CA2978103A1 (en) 2016-10-20
EP3283080A2 (en) 2018-02-21
US20170349897A1 (en) 2017-12-07
US20210230589A1 (en) 2021-07-29
EP3722424A1 (en) 2020-10-14
KR102258516B1 (ko) 2021-05-31
RU2017139121A3 (enExample) 2019-06-10
CN107427532A (zh) 2017-12-01
HRP20200843T1 (hr) 2020-08-21

Similar Documents

Publication Publication Date Title
US10815483B2 (en) Compositions for modulating C9ORF72 expression
AU2013331434B2 (en) Compositions for modulating C90RF72 expression
AU2014331652B2 (en) Compositions for modulating C9ORF72 expression
EP2906696B2 (en) Methods for modulating c9orf72 expression
EP3058068B1 (en) Compositions for modulating expression of c9orf72 antisense transcript
WO2016112132A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
WO2016167780A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
AU2015240761A1 (en) Compositions for modulating SOD-1 expression
CA2926341A1 (en) Methods for modulating expression of c9orf72 antisense transcript
WO2016141145A1 (en) Methods for modulating mecp2 expression
HK40039446A (en) Compositions for modulating c9orf72 expression
HK40088775A (en) Compositions for modulating sod-1 expression
HK1250255B (en) Compositions for modulating c9orf72 expression

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 253557

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 122021001645

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2017/0007671

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017016068

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2016249002

Country of ref document: AU

Date of ref document: 20160415

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2978103

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017546618

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/013199

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 11201708468Y

Country of ref document: SG

Ref document number: 12017501875

Country of ref document: PH

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20177032588

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017139121

Country of ref document: RU

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16780833

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112017016068

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170727

WWE Wipo information: entry into national phase

Ref document number: 517390168

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 517390168

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 517390168

Country of ref document: SA

Ref document number: 520412451

Country of ref document: SA