WO2016159560A1 - 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도 - Google Patents

식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도 Download PDF

Info

Publication number
WO2016159560A1
WO2016159560A1 PCT/KR2016/002916 KR2016002916W WO2016159560A1 WO 2016159560 A1 WO2016159560 A1 WO 2016159560A1 KR 2016002916 W KR2016002916 W KR 2016002916W WO 2016159560 A1 WO2016159560 A1 WO 2016159560A1
Authority
WO
WIPO (PCT)
Prior art keywords
ibhppd
gene
plant
environmental stress
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/002916
Other languages
English (en)
French (fr)
Inventor
곽상수
이행순
정재철
지창윤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Publication of WO2016159560A1 publication Critical patent/WO2016159560A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10Seeds
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Definitions

  • Sweet potato ( Ipomoea batatas ) can be grown on relatively poor lands and is grown in more than 100 countries around the world. It is the seventh major crop in the world after wheat, rice, corn, potatoes, barley and cassava. It is a representative root crop produced. Sweet potato leaves and petioles contain ingredients that are not found in ordinary grains such as vitamins B and C, tocopherol, calcium and iron, and have a wide range of polyphenols, making them highly valuable as vegetables and rich in carbohydrates in sweet potato storage roots. become a source of energy.
  • Tocopherol is one of the hydrophobic low molecular weight antioxidants synthesized in the chloroplast. It protects plants from singlet oxygen and protects photosystems and membrane lipids by preventing lipid peroxidation. In addition, tocopherol prevents lipid peroxidation during seed germination and is resistant to stress such as excessive metal ions and low temperatures.
  • Pectobacterium chrysanthemi is infected through the wound, and black or brown symptoms appear throughout the sweet potato stems, petioles, and storage roots. It is a plant disease that is a problem worldwide with a large loss. However, there are no resistant varieties in sweet potatoes and there is no clear control method.
  • Korean Patent No. 121277 discloses ' IbLEA14 gene derived from sweet potato root and its use'
  • Korean Patent No. 0930593 discloses 'swDREB1 protein derived from sweet potato root and gene encoding the same'
  • the present invention is derived by the request as described above, in the present invention by using the plant with the expression of IbHPPD gene regulation, it was confirmed that IbHPPD gene is involved in environmental stress tolerance of a plant control. In particular, it was confirmed that the IbHPPD gene is strongly expressed in the leaves, especially under environmental stress conditions such as pathogen infection as well as drying and oxidative stress. Accordingly, the present invention was completed by confirming that the plant can produce a plant and its seeds whose environmental stress resistance is controlled using the gene.
  • the present invention provides an amino acid sequence of SEQ ID NO: 2, IbPOPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein that regulates environmental stress resistance.
  • IbPOPD Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase
  • the present invention also provides a gene encoding the protein.
  • the present invention also provides a host cell transformed with the recombinant vector.
  • the present invention also provides a method of controlling the environmental stress resistance of a plant comprising the step of transforming the plant cell with the recombinant vector to control the expression of the IbHPPD gene.
  • the present invention provides a method for producing a transformed plant with controlled environmental stress resistance, comprising the step of transforming plant cells with the recombinant vector.
  • the present invention also provides a composition for controlling environmental stress resistance of plants containing a gene encoding IbHPPD protein derived from sweet potato as an active ingredient.
  • the present invention relates to a potato-derived to control the environmental stress tolerance of a plant IbHPPD gene and use thereof, IbHPPD gene of potato origin according to the invention is especially under environmental stress conditions, such as drying, oxidizing and pathogen infection, strong in leaf Since expression is induced, it may be usefully used to develop transgenic plants and biofuel crops that are resistant to environmental stresses suitable for conditioned adverse areas.
  • environmental stress conditions such as drying, oxidizing and pathogen infection, strong in leaf Since expression is induced, it may be usefully used to develop transgenic plants and biofuel crops that are resistant to environmental stresses suitable for conditioned adverse areas.
  • 1 is a view showing the nucleotide sequence of the sweet potato-derived IbHPPD gene according to the present invention and the amino acid sequence deduced therefrom.
  • Figure 2 is a diagram showing the domain of the deduced protein of sweet potato-derived IbHPPD gene according to the present invention.
  • IbHPPD is a sweet potato-derived gene
  • LsHPPD is a gene derived from lettuce
  • BnHPPD is a rapeseed gene
  • AtHPPD is a gene derived from Arabidopsis
  • MiHPPD is a gene derived from mango
  • ZmHPPD is a gene derived from corn.
  • FIG. 4 is a view showing a flexible relationship between the HPPD gene of the amino acid sequence and various plants (lettuce, rapeseed, Arabidopsis thaliana, mango and corn) of the deduced protein of potato-derived IbHPPD gene according to the invention.
  • IbHPPD is a sweet potato-derived gene
  • LsHPPD is a gene derived from lettuce
  • BnHPPD is a rapeseed gene
  • AtHPPD is a gene derived from Arabidopsis
  • MiHPPD is a gene derived from mango
  • ZmHPPD is a gene derived from corn.
  • Figure 5 is a graph of real-time PCR analysis of the expression pattern of the sweet potato for the IbHPPD gene according to the present invention.
  • L is the leaf
  • S is the stem
  • FR is the fibrous root
  • TR is the thick pigmented root
  • SR is the storage root.
  • Figure 6 is treated with 30% PEG (polyethylene glycol 6000) on the sweet potato leaves after the 0, 2, 4, 6 and 12 hours, IbHPPD gene expression of the graph analyzed by Realtime PCR.
  • PEG polyethylene glycol 6000
  • Figure 9 is a graph (B) showing the expression pattern and tocopherol content of IbHPPD gene in the leaves (A) of tobacco plants inoculated with Agrobacterium mediated IbHPPD gene.
  • FIG. 10 is a graph (B) showing plant photos (A) and survival rates when oxidative stress was applied to Arabidopsis non-transformants (WT) and Arabidopsis transformants overexpressing IbHPPD genes.
  • the present invention provides an Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase (IbHPPD) protein that regulates environmental stress resistance, consisting of the amino acid sequence of SEQ ID NO: 2.
  • IbHPPD 4-hydroxyphenylpyruvate dioxygenase
  • the range of IbHPPD proteins according to the present invention includes proteins having an amino acid sequence represented by SEQ ID NO: 2 isolated from sweet potatoes and functional equivalents of the proteins.
  • “Functional equivalent” means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid Is 95% or more of sequence homology, and refers to a protein that exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2.
  • substantially homogeneous physiological activity is meant an activity that enhances the plant's resistance to environmental stress.
  • the invention also includes fragments, derivatives and analogues of the IbHPPD protein.
  • fragment refers to a polypeptide that retains the same biological function or activity as the IbHPPD polypeptide of the invention.
  • Fragments, derivatives, and analogs of the present invention comprise (i) polypeptides substituted with one or more conservative or nonconservative amino acid residues (preferably conservative amino acid residues), wherein the substituted amino acid residues are encoded by a genetic code.
  • the present invention also provides a gene encoding the IbHPPD protein.
  • the gene of the present invention may be DNA or RNA encoding IbHPPD protein.
  • DNA includes cDNA, genomic DNA or artificial synthetic DNA.
  • DNA can be single stranded or double stranded.
  • DNA may be a coding strand or a noncoding strand.
  • the gene of the present invention may include the nucleotide sequence represented by SEQ ID NO: 1.
  • polynucleotide encoding a polypeptide refers to a polynucleotide encoding a polypeptide, or a polynucleotide further comprising additional coding and / or noncoding sequences.
  • the invention also relates to variants of said polynucleotides encoding polypeptides comprising the same amino acid sequence as described herein, or fragments, analogs, and derivatives thereof.
  • Polynucleotide variants may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitutional variants, deletional variants, and insertional variants.
  • allelic variants are alternatives to polynucleotides, which may include one or more substitutions, deletions, or inserted nucleotides, which do not result in a substantial functional change in the polypeptide encoded by the variant. Do not.
  • the present invention provides a poly-hybridized hybridization with a sequence having at least 50%, preferably at least 70%, more preferably at least 80% identity with a nucleotide sequence of SEQ ID NO. It relates to nucleotides.
  • the present invention particularly relates to polynucleotides that hybridize to the polynucleotides described herein under stringent conditions.
  • stringent conditions include (1) hybridization and washing under 0.2 ⁇ SSC, 0.1% SDS, lower ionic strength such as 60 ° C.
  • hybridizable polynucleotide are identical to the biological function and activity of the mature polypeptide represented by SEQ ID NO: 2.
  • the IbHPPD gene is preferably derived from sweet potatoes.
  • embodiments of the invention have high homology (eg, 60% or more, i.e. 70%, 80%, 85%, 90%, 95%, even 98% sequence identity) with the sweet potato IbHPPD gene and other It also includes other genes derived from plants. Sequencing methods and means for determining sequence identity or homology (eg BLAST) are well known in the art.
  • recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
  • Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.
  • the polynucleotide sequence encoding the IbHPPD protein can be inserted into a recombinant expression vector.
  • recombinant expression vector means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host.
  • An important feature of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.
  • Expression vectors comprising IbHPPD protein-encoding DNA sequences and appropriate transcriptional / translational control signals can be constructed by methods well known to those of skill in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.
  • Preferred examples of recombinant vectors of the present invention are Ti plasmid vectors capable of transferring part of themselves, the so-called T region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens.
  • Another type of Ti plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences to protoplasts from which plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome.
  • a particularly preferred form of the Ti plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.
  • viral vectors such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc.
  • it may be selected from an incomplete plant viral vector.
  • the recombinant vector may be, but is not limited to, a pKBS11 vector, a pBI101 vector, and a pCAMBIA vector.
  • the expression vector will preferably comprise one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance genes include, but are not limited to.
  • the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter.
  • the term “promoter” refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.
  • terminators can be used, for example nopalin synthase (NOS), rice ⁇ amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, etc., but is not limited thereto.
  • NOS nopalin synthase
  • rice ⁇ amylase RAmy1 A terminator Phaseoline terminator
  • Agrobacterium tumefaciens Agrobacterium tumefaciens
  • Terminator of the octopine gene etc.
  • the present invention also provides a host cell transformed with the recombinant vector of the present invention.
  • the host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell while being stable can be used in any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1. , Bacillus genus strains, such as E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas Enterobacteria such as species and strains.
  • yeast Saccharomyce cerevisiae
  • insect cells human cells
  • human cells e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS7, 293, HepG2) , 3T3, RIN and MDCK cell lines
  • the host cell is preferably a plant cell.
  • the method of carrying the vector of the present invention into a host cell includes a CaCl 2 method, one method (Hanahan, D., J. Mol. Biol., 166: 557580 (1983)) and when the host cell is a prokaryotic cell. It may be carried out by a method of drilling.
  • the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAEdextran treatment, gene bombardment, or the like. .
  • the invention also, by transforming a plant cell with a recombinant vector containing the gene encoding the IbHPPD protein of potato-derived provides a method for controlling the environmental stress tolerance of a plant comprising the step of regulating the expression of IbHPPD gene.
  • IbHPPD proteins includes proteins having the amino acid sequence represented by SEQ ID NO: 2 and functional equivalents of the proteins.
  • the “gene expression control” of the present invention refers to increasing or decreasing the expression of the IbHPPD gene in the plant.
  • a method of controlling the environmental stress resistance of the plant by transforming the plant cell with a recombinant vector comprising the gene of SEQ ID NO: 1 overexpressing the IbHPPD gene to the environmental stress resistance of the plant May be increased, but is not limited thereto.
  • the environmental stress may be dry, oxidative or pathogen infection stress, preferably pathogen infection stress, most preferably sweet potato bacterial stem root rot pathogen ( Pectobacetrium chrysanthemi ) Infection stress may be, but is not limited to.
  • the "gene overexpression” means that the gene is expressed above the level expressed in wild-type plants.
  • a method of introducing the gene into a plant there is a method of transforming a plant using an expression vector containing the gene under the control of a promoter.
  • Plant cells used for plant transformation may be any plant cells.
  • Plant cells are cultured cells, cultured tissues, culture organs or whole plants.
  • Plant tissue refers to the tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissue.
  • Plant tissue may be in planta or in organ culture, tissue culture or cell culture.
  • the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a potato-derived IbHPPD protein;
  • It provides a method for producing a transformed plant with controlled environmental stress resistance comprising the step of regenerating the plant from the transformed plant cells.
  • the IbHPPD protein may be composed of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.
  • the gene encoding the IbHPPD protein may be the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
  • the environmental stress may be dry, oxidative or pathogen infection stress, preferably pathogen infection stress, most preferably sweet potato bacterial stem root rot pathogen ( Pectobacetrium chrysanthemi ) Infection stress may be, but is not limited to.
  • the method of the present invention comprises transforming plant cells with a recombinant vector according to the present invention, which transformation can be mediated by, for example, Agrobacterium tumefiaciens.
  • the method also includes the step of regenerating the transgenic plant from said transformed plant cell.
  • the method for regenerating the transformed plant from the transformed plant cell may use any method known in the art.
  • Transformed plant cells should be re-differentiated into whole plants. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for many different species.
  • the present invention provides a transgenic plant and seed thereof having a controlled environmental stress resistance produced by the above method.
  • the plant may be a monocotyledonous plant or a dicotyledonous plant, but is not limited thereto.
  • the present invention also provides a composition for controlling environmental stress resistance of a plant containing a gene encoding the IbHPPD protein as an active ingredient.
  • composition for controlling environmental stress resistance of a plant of the present invention includes a gene encoding the IbHPPD protein of the present invention or a recombinant vector comprising the same as an active ingredient, and the plant environment is transformed by transforming the plant with the gene or the recombinant vector comprising the same. You can control your stress tolerance.
  • the IbHPPD gene may be overexpressed to increase environmental stress tolerance of the plant, but is not limited thereto.
  • Example 1 Sweet Potato IbHPPD Gene cloning, sequencing and softness analysis
  • Sweet potato ( Ipomoea batatas (L.) Lam. Cv. Yulmi) plants were grown in soil for 3 months at 25 ⁇ 3 ° C. under long-term conditions (16 hours and 8 hours cancer treatment).
  • the grown leaf tissue RNAs were isolated by RNase-free DNase-treated TRIzol method (Invitrogen).
  • the RNA was performed cDNA synthesis using the M-MLV reverse transcription system cDNA synthesis kit (Clontech) and primers were designed based on the known gene sequence (GeneBank accession no: KP306528). Sequence information of the HPPD gene was obtained from a transcript library constructed from RNA-seq analysis of sweet potato leaves and storage roots in the laboratory.
  • the total length of the IbHPPD cDNA gene was 1,323 bp, indicating that the coding region was composed of 440 amino acids (FIG. 1).
  • the IbHPPD protein has a SCOP and glyoxalase domain (Fig. 2).
  • the coding region of Ipomoea batatas IbHPPD was examined by BlastP, it showed 74% homology with LsHPPD of Lactuca sativa at the amino acid level and 73% with AtHPPD of Arabidopsis thaliana . The homology of was shown (Fig. 3).
  • Realtime PCR was performed to analyze tissue expression patterns of IbHPPD genes derived from sweet potatoes according to the present invention.
  • cDNA was synthesized by MMLV reverse transcription system cDNA synthesis kit (Clontech) using 2 ⁇ g of RNA.
  • IbHPPD gene specific primers and Accel Taq Premix kit (Genedocs) were used to investigate the expression of IbHPPD gene.
  • primers specific for IbHPPD the primers described in Table 1 were used.
  • the IbHPPD gene was most strongly expressed in the leaf and very weakly expressed in the stem. Storage roots in the root system were relatively strongly expressed compared to fibrous roots and thick pigmented roots. Therefore, the IbHPPD gene isolated from the sweet potato storage root was found to be the gene mainly expressed in the leaves under normal growth conditions.
  • IbHPPD gene responds to various stress treatments, including drying, treatment with various stress conditions, drying (30% PEG, polyethylene glycol), oxidation (400 mM hydrogen peroxide, H 2 O 2 ) and pathogens ( Pectobacterium chrysanthemi ) Afterwards, the expression changes of IbHPPD gene were analyzed using Realtime PCR.
  • IbHPPD In order to analyze the degree of reaction according to the PEG treatment of the gene, after drying the sweet potato leaf tissue according to time zones (0, 2, 4, 6 and 12 hours), RNA was analyzed by the method described in Example 2. After separation, cDNA was synthesized, respectively. IbHPPD used in Example 2 above Realtime PCR was performed with specific primers of the genes. As a result, the IbHPPD gene showed the strongest expression level in the leaf tissue after 4 hours of drying compared to the negative control (No control) (FIG. 6).
  • IbHPPD To determine whether the gene is related to the resistance to Pectobacterium chrysanthemi , the pathogens were treated by time zones (0, 3, 6 and 12 hours) and analyzed for gene expression patterns. Pathogen inoculation was carried out by culturing the pathogen on the leaves and adding 1x10 5 to 10mM MgCl 2 as an infiltration buffer The solution was suspended to a concentration of cfu / ml. As a mock, leaves treated with 10 mM MgCl 2 were used. RNA was extracted, cDNA was synthesized in the same manner as above, and realtime PCR was performed. As a result, 6 hours after treatment with pathogens, IbHPPD compared to Mock It was confirmed that the expression level of the gene is increased rapidly.
  • IbHPPD gene is responsive to various stresses. Therefore, IbHPPD gene is expected to be helpful in the development of environmentally resistant plants (including sweet potatoes) that improve growth even in drying, oxidative stress and pathogen infection.
  • Example 4 From Sweet Potato IbHPPD Analysis of alpha-tocopherol content in the leaves of tobacco plants by transient overexpression of genes
  • Alpha-tocopherol content was analyzed through transient overexpression of the Agrobacterium mediated IbHPPD gene. After inoculating Agrobacterium on the leaves of three-week-old tobacco plants, three days later, the IbHPPD gene expression was confirmed by realtime PCR analysis, and the alpha-tocopherol content was measured by HPLC analysis (FIG. 9A). As a result, not only the IbHPPD gene expression increased significantly compared with the empty vector (control) in the leaves of tobacco plants were inoculated IbHPPD gene, alpha-tocopherol was found that the content is increased to 81% (Fig. 9B). Therefore, IbHPPD gene is involved in the tocopherol biosynthesis pathway, it was confirmed that plays a role in increasing the content of tocopherol, a low-molecular antioxidant.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Physiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도에 관한 것으로서, 상기 유전자를 이용하여 조건 불리 지역에 적합한 환경 스트레스에 내성을 갖는 형질전환 식물체 및 바이오 연료 작물을 개발하는데 유용하게 활용될 수 있을 것이다.

Description

식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도
본 발명은 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도에 관한 것이다.
고구마(Ipomoea batatas)는 비교적 척박한 땅에도 재배가 가능하고 전 세계 100여 개의 나라에서 재배되고 있으며, 밀, 벼, 옥수수, 감자, 보리 및 카사바에 이어 세계 7번째 주요작물로서 매년 135백만 톤 이상 생산되는 대표적인 뿌리작물이다. 고구마 잎과 잎자루는 비타민 B와 C, 토코페롤(tocopherol), 칼슘, 철 등 보통의 곡물에 없는 성분을 함유하고 있으며 다양한 폴리페놀을 가지고 있으므로, 채소로서의 이용가치가 높고 고구마 저장뿌리에 풍부한 탄수화물은 좋은 에너지 공급원이 된다.
식물은 유전자의 발현 조절 및 세포 내 대사 물질들을 변화시킴으로써 염, 건조 및 병충해를 포함한 여러 환경 스트레스 조건에 대응한다. 다양한 환경 스트레스에 식물이 노출되었을 때, 생체 내 산소가 전자와 반응하면서 초과산화물 음이온 라디칼(O2 -, Superoxide anion radical), 과산화수소(H2O2, Hydrogen peroxide), 수산화 라디칼(OH, Hydroxyl radical) 등의 반응성이 높은 독성의 활성산소종(ROS, reactive oxygen species)으로 변한다. ROS에 의해 세포가 받는 산화스트레스(oxidative stress)는 고온, 저온, 건조, 고광도, 자외선 그리고 메틸비올로젠(MV, methyl viologen)과 같은 ROS 생성 제초제 등으로 인해 발생한다. 이러한 산화스트레스에 대응하기 위하여 식물은 항산화효소나 저분자 항산화물질과 같은 강력한 항산화방어 시스템으로 발달되어 있다.
그 중 토코페롤은 엽록체에서 합성되는 소수성 저분자 항산화물질 중 하나이다. 이 물질은 일중항 산소(singlet oxygen)로부터 식물을 보호하며 지질 과산화를 막음으로써 광계와 막 지질을 보호한다. 또한, 토코페롤은 종자가 발아하는 동안 지질 과산화를 막고, 과도한 금속이온, 저온 등의 스트레스에 내성을 보인다.
한편, IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase)은 토코페롤 생합성 경로에 관여하는 단백질이다. 시킴산 경로(Shikimic acid pathway)를 거쳐 형성된 티로신(tyrosine) 또는 코리스메이트(chorismate)는 하이드록시페닐피루베이트(HPP, p-hydroxyphenylpyruvate)로 전환되고 이는 HPPD 효소에 의해 산화되어 호모겐티스산(HGA, homogentisic acid)이 되는데 HGA는 식물에서 토코페롤 생합성에서 가장 중요한 기질로서 작용하고 HPPD 유전자 발현도 조절하는 것으로 알려져 있다.
고구마 세균성 줄기뿌리썩음병 병원균(Pectobacterium chrysanthemi)은 상처를 통해 감염되며 고구마 줄기와 잎자루 및 저장뿌리 전반에 걸쳐 흑색이나 갈색 병징이 나타나며 분지가 시들다가 최후에는 식물 전체가 빈약해져 죽거나 고구마 저장뿌리가 썩어 경제적 손실이 큰 병으로 세계적으로 문제가 되고 있는 식물병이다. 그러나 아직까지 고구마에서는 저항성 품종이 없고 뚜렷한 방제방법이 없다.
한국등록특허 제1261277호에 '고구마 뿌리 유래의 IbLEA14 유전자 및 이의 용도'에 대해 개시되어 있고, 한국등록특허 제0930593호에 '고구마 뿌리 유래의 swDREB1 단백질 및 이를 코딩하는 유전자'에 대해 개시되어 있으나, 본 발명에서와 같이 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도에 관해서는 밝혀진 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명에서는 IbHPPD 유전자의 발현이 조절된 식물체를 이용하여, IbHPPD 유전자가 식물체의 환경 스트레스 내성 조절에 관여한다는 것을 확인하였다. 특히, IbHPPD 유전자가 건조 및 산화 스트레스뿐만 아니라 병원균 감염과 같은 환경 스트레스 조건하에 특히, 잎에서 강하게 발현되는 것을 확인하였다. 따라서, 상기 유전자를 이용하여 식물체의 환경 스트레스 내성이 조절된 식물체 및 이의 종자를 생산할 수 있는 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위하여, 본 발명은 서열번호 2의 아미노산 서열로 이루어진, 환경 스트레스 내성을 조절하는 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질을 제공한다.
또한, 본 발명은 상기 단백질을 코딩하는 유전자를 제공한다.
또한, 본 발명은 상기 유전자를 포함하는 재조합 벡터를 제공한다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.
또한, 본 발명은 상기 재조합 벡터로 식물세포를 형질전환시켜 IbHPPD 유전자의 발현을 조절하는 단계를 포함하는 식물체의 환경 스트레스 내성을 조절하는 방법을 제공한다.
또한, 본 발명은 상기 재조합 벡터로 식물세포를 형질전환하는 단계를 포함하는 환경 스트레스 내성이 조절된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 환경 스트레스 내성이 조절된 형질전환 식물체 및 이의 종자를 제공한다.
또한, 본 발명은 고구마 유래의 IbHPPD 단백질을 코딩하는 유전자를 유효성분으로 함유하는 식물체의 환경 스트레스 내성 조절용 조성물을 제공한다.
본 발명은 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도에 관한 것으로, 본 발명에 따른 고구마 유래의 IbHPPD 유전자는 건조, 산화 및 병원균 감염과 같은 환경 스트레스 조건하에 특히, 잎에서 강하게 발현이 유도되기 때문에, 이를 이용하면 조건 불리 지역에 적합한 환경 스트레스에 내성을 갖는 형질전환 식물체 및 바이오 연료 작물을 개발하는데 유용하게 활용될 수 있을 것이다.
도 1은 본 발명에 따른 고구마 유래 IbHPPD 유전자의 염기서열 및 이로부터 추론한 아미노산 서열을 나타낸 도면이다.
도 2는 본 발명에 따른 고구마 유래 IbHPPD 유전자의 추론된 단백질의 도메인을 나타낸 도면이다.
도 3은 본 발명에 따른 고구마 유래 IbHPPD 유전자의 추론된 단백질의 아미노산 서열 및 여러 식물(상추, 유채, 애기장대, 망고 및 옥수수)의 HPPD 유전자 아미노산 서열을 비교한 도면이다. IbHPPD는 고구마 유래의 유전자; LsHPPD는 상추 유래의 유전자; BnHPPD는 유채 유래의 유전자; AtHPPD는 애기장대 유래의 유전자; MiHPPD는 망고 유래의 유전자; ZmHPPD는 옥수수 유래의 유전자.
도 4는 본 발명에 따른 고구마 유래 IbHPPD 유전자의 추론된 단백질의 아미노산 서열 및 여러 식물(상추, 유채, 애기장대, 망고 및 옥수수)의 HPPD 유전자 사이의 유연관계를 나타낸 도면이다. IbHPPD는 고구마 유래의 유전자; LsHPPD는 상추 유래의 유전자; BnHPPD는 유채 유래의 유전자; AtHPPD는 애기장대 유래의 유전자; MiHPPD는 망고 유래의 유전자; ZmHPPD는 옥수수 유래의 유전자.
도 5는 본 발명에 따른 IbHPPD 유전자에 대한 고구마의 조직별 발현 양상을 Realtime PCR로 분석한 그래프이다. L은 잎(leaf), S는 줄기(stem), FR은 실뿌리(fibrous root), TR은 굵은 뿌리(thick pigmented root), SR은 저장 뿌리(storage root).
도 6은 고구마 잎에 30% PEG(polyethylene glycol 6000)을 처리하여 0, 2, 4, 6 및 12시간 후, IbHPPD 유전자의 발현 양상을 Realtime PCR로 분석한 그래프이다.
도 7은 고구마 잎에 400mM의 과산화수소(H2O2)을 처리하여 0, 2, 4, 6 및 12시간 후, IbHPPD 유전자의 발현 양상을 Realtime PCR로 분석한 그래프이다.
도 8은 고구마 잎에 고구마 세균성 줄기뿌리썩음병 병원균(Pectobacterium chrysanthemi)을 처리하여 0, 3, 6 및 12시간 후, IbHPPD 유전자의 발현 양상을 Realtime PCR로 분석한 그래프이다.
도 9는 아그로박테리움 매개 IbHPPD 유전자를 접종시킨 담배 식물체의 잎(A)에서 IbHPPD 유전자의 발현 양상 및 토코페롤 함량을 나타낸 그래프(B)이다.
도 10은 애기장대 비형질전환체(WT) 및 IbHPPD 유전자를 과발현시킨 애기장대 형질전환체에 산화 스트레스를 처리하였을 때의 식물체 사진(A) 및 생존율을 나타낸 그래프(B)이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 2의 아미노산 서열로 이루어진, 환경 스트레스 내성을 조절하는 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질을 제공한다.
본 발명에 따른 IbHPPD 단백질의 범위는 고구마로부터 분리된 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 식물의 환경 스트레스에 대한 내성을 증진시키는 활성을 의미한다.
본 발명은 또한 IbHPPD 단백질의 단편, 유도체 및 유사체(analogues)를 포함한다. 본원에 사용된, 용어 "단편", "유도체" 및 "유사체"는 본 발명의 IbHPPD 폴리펩티드와 실질적으로 같은 생물학적 기능 또는 활성을 보유하는 폴리펩티드를 말한다. 본 발명의 단편, 유도체 및 유사체는 (i) 하나 이상의 보존적(conservative) 또는 비보존적 아미노산 잔기(바람직하게는 보존적 아미노산 잔기)가 치환된 폴리펩티드(상기 치환된 아미노산 잔기는 유전암호에 의해 암호화될 수도, 되지 않을 수도 있다) 또는 (ii) 하나 이상의 아미노산 잔기에서 치환기(들)를 가지는 폴리펩티드, 또는 (iii) 또 다른 화합물(폴리펩티드의 반감기를 연장할 수 있는 화합물, 예를 들면 폴리에틸렌 글리콜)과 결합된 성숙 폴리펩티드로부터 유래된 폴리펩티드, 또는 (iv) 부가적인 아미노산 서열(예를 들면, 선도 서열, 분비 서열, 상기 폴리펩티드를 정제하는데 사용된 서열, 프로테이노젠(proteinogen) 서열 또는 융합 단백질)과 결합된 상기 폴리펩티드로부터 유래된 폴리펩티드일 수 있다. 본원에 정의된 상기 단편, 유도체 및 유사체는 당업자에 잘 알려져 있다.
또한, 본 발명은 상기 IbHPPD 단백질을 코딩하는 유전자를 제공한다. 본 발명의 유전자는 IbHPPD 단백질을 코딩하는 DNA 또는 RNA 일 수 있다. DNA는 cDNA, 게놈 DNA 또는 인위적인 합성 DNA를 포함한다. DNA는 단일 가닥 또는 이중 가닥일 수 있다. DNA는 코딩(coding) 가닥 또는 넌코딩(noncoding) 가닥일 수 있다.
바람직하게는, 본 발명의 유전자는 서열번호 1로 표시되는 염기서열을 포함할 수 있다.
서열번호 2로 표시되는 성숙(mature) 폴리펩티드를 암호화하는 폴리뉴클레오티드는 오직 성숙 폴리펩티드만을 암호화하는 코딩 서열; 성숙 폴리펩티드 및 다양한 부가적인 코딩 서열을 암호화하는 서열; 성숙 폴리펩티드(및 임의의 부가적인 코딩 서열) 및 넌코딩 서열을 암호화하는 서열을 포함한다.
용어 "폴리펩티드를 암호화하는 폴리뉴클레오티드"는 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 부가적인 코딩 및/또는 넌코딩 서열을 더 포함하는 폴리뉴클레오티드를 말한다.
또한, 본 발명은 본원에 기재된 것과 동일한 아미노산 서열, 또는 이의 단편, 유사체, 및 유도체를 포함하는 폴리펩티드를 암호화하는 상기 폴리뉴클레오티드의 변이체에 관한 것이다. 폴리뉴클레오티드 변이체는 자연적으로 발생하는 대립유전자 변이체 또는 비자연적으로 발생하는 변이체일 수 있다. 상기 뉴클레오티드 변이체는 치환 변이체, 결실 변이체, 및 삽입 변이체를 포함한다. 당업계에 공지된 바와 같이, 대립유전자 변이체는 폴리뉴클레오티드의 대안(alternative)이며, 이는 하나 이상의 치환, 결실 또는 삽입된 뉴클레오티드를 포함할 수 있으며, 변이체에 의해 암호화된 폴리펩티드에서 실질적인 기능 변화를 초래하지는 않는다.
또한, 본 발명은 상기 기재된 서열번호 1의 염기서열 및 상기 기재된 서열번호 1의 염기서열과 적어도 50%, 바람직하게는 적어도 70%, 더욱 바람직하게는 적어도 80%의 동일성을 가지는 서열과 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명은 특히, 스트린전트 조건하에 본원에 기재된 폴리뉴클레오티드에 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명에서, "스트린전트 조건"은 (1) 0.2 × SSC, 0.1% SDS, 60℃와 같은 더 낮은 이온강도 및 더 높은 온도하에서의 혼성화 및 세척; 또는 (2) 50%(v/v) 포름아미드, 0.1% 소혈청/0.1% Ficoll 및 42℃ 등과 같은 변성제의 존재하에 혼성화; 또는 (3) 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 95% 이상의 동일성을 가지는 단지 2개의 서열 사이에서 발생하는 혼성화를 말한다. 게다가, 혼성화가 가능한 폴리뉴클레오티드에 의해 암호화된 폴리펩티드의 생물학적 기능 및 활성은 서열번호 2 표시되는 성숙 폴리펩티드의 생물학적 기능 및 활성과 동일하다.
본 발명의 구현예에 따라, IbHPPD 유전자는 바람직하게는 고구마 유래라는 것을 이해해야 한다. 그러나, 본 발명의 구현예는 고구마 IbHPPD 유전자와 높은 상동성(예를 들면, 60% 이상, 즉 70%, 80%, 85%, 90%, 95%, 심지어 98%의 서열 동일성)을 갖고 다른 식물로부터 유래한 다른 유전자를 또한 포함한다. 서열정렬 방법, 및 서열 동일성 또는 상동성을 결정하기 위한 수단(예를 들면, BLAST)은 당업계에 주지되어 있다.
또한, 본 발명은 본 발명에 따른 IbHPPD 유전자를 포함하는 재조합 벡터를 제공한다.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명에서, IbHPPD 단백질을 암호화하는 상기 폴리뉴클레오티드 서열은 재조합 발현 벡터 내로 삽입될 수 있다. 용어 "재조합 발현 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다. 상기 발현 벡터의 중요한 특성은 복제 원점, 프로모터, 마커 유전자 및 번역 조절 요소(translation control element)를 가지는 것이다.
IbHPPD 단백질암호화 DNA 서열 및 적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관내 재조합 DNA 기술, DNA 합성 기술 및 생체내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T영역을 식물 세포로 전이시킬 수 있는 Ti플라스미드 벡터이다. 다른 유형의 Ti플라스미드 벡터 (EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다. 바람직하게는, 상기 재조합 벡터는 pKBS11 벡터, pBI101 벡터 및 pCAMBIA 벡터일 수 있으나, 이에 제한되지는 않는다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.
본 발명은 또한, 본 발명의 재조합 벡터로 형질전환된 숙주세포를 제공한다. 본 발명의 벡터를 원핵세포에 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주세포는 당업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예컨대, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움, 세라티아 마르세슨스 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다.
또한, 본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(Saccharomyce cerevisiae), 곤충세포, 사람세포 (예컨대, CHO 세포주 (Chinese hamster ovary), W138, BHK, COS7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다. 숙주세포는 바람직하게는 식물세포이다.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주 세포가 원핵 세포인 경우, CaCl2 방법, 하나한 방법 (Hanahan, D., J. Mol. Biol., 166:557580(1983)) 및 전기천공 방법 등에 의해 실시될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법, 칼슘포스페이트 침전법, 전기천공법, 리포좀매개 형질감염법, DEAE덱스트란 처리법, 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
본 발명은 또한, 고구마 유래의 IbHPPD 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 IbHPPD 유전자의 발현을 조절하는 단계를 포함하는 식물체의 환경 스트레스 내성을 조절하는 방법을 제공한다.
본 발명에 따른 IbHPPD 단백질의 범위는 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다.
본 발명의 상기 "유전자 발현 조절"은 식물체 내의 IbHPPD 유전자의 발현을 증가시키거나 또는 감소시키는 것을 말한다.
본 발명의 일 구현 예에 따른 방법에서, 식물체의 환경 스트레스 내성을 조절할 수 있는 방법으로, 서열번호 1의 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 IbHPPD 유전자를 과발현시켜 식물체의 환경 스트레스 내성을 증가시킬 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 환경 스트레스는 건조, 산화 또는 병원균 감염 스트레스일 수 있고, 바람직하게는 병원균 감염 스트레스일 수 있으며, 가장 바람직하게는 고구마 세균성 줄기뿌리썩음병 병원균(Pectobacetrium chrysanthemi) 감염 스트레스일 수 있으나, 이에 제한되지 않는다.
상기 "유전자 과발현"이란 야생형 식물에서 발현되는 수준 이상으로 상기 유전자가 발현되도록 하는 것을 의미한다. 식물체 내로 상기 유전자를 도입하는 방법으로는 프로모터의 조절을 받는 상기 유전자가 포함된 발현 벡터를 이용하여 식물체를 형질전환하는 방법이 있다.
식물의 형질전환에 이용되는 "식물 세포"는 어떤 식물 세포도 된다. 식물 세포는 배양 세포, 배양 조직, 배양기관 또는 전체 식물이다. "식물 조직"은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 종자, 암 조직 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직배양 또는 세포 배양 상태일 수 있다.
또한, 본 발명은 고구마 유래의 IbHPPD 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 환경 스트레스 내성이 조절된 형질전환 식물체의 제조방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에서, 상기 IbHPPD 단백질은 서열번호 2의 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 제조 방법에서, IbHPPD 단백질을 코딩하는 유전자는 서열번호 1의 염기서열일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 식물체의 환경 스트레스 내성을 조절할 수 있는 방법으로, 상기 IbHPPD 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 IbHPPD 유전자를 과발현시켜 식물체의 환경 스트레스 내성을 증가시킬 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 환경 스트레스는 건조, 산화 또는 병원균 감염 스트레스일 수 있고, 바람직하게는 병원균 감염 스트레스일 수 있으며, 가장 바람직하게는 고구마 세균성 줄기뿌리썩음병 병원균(Pectobacetrium chrysanthemi) 감염 스트레스일 수 있으나, 이에 제한되지 않는다.
본 발명의 방법은 본 발명에 따른 재조합 벡터로 식물 세포를 형질전환하는 단계를 포함하는데, 상기 형질전환은 예를 들면, 아그로박테리움 튜머파시엔스(Agrobacterium tumefiaciens)에 의해 매개될 수 있다. 또한, 본 발명의 방법은 상기 형질전환된 식물 세포로부터 형질전환 식물을 재분화하는 단계를 포함한다. 형질전환 식물 세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.
형질전환된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.
또한, 본 발명은 상기 방법에 의해 제조된 환경 스트레스 내성이 조절된 형질전환 식물체 및 이의 종자를 제공한다. 바람직하게는, 상기 식물체는 단자엽 식물 또는 쌍자엽 식물일 수 있으나, 이에 제한되지 않는다.
상기 단자엽 식물은 택사과(Alismataceae), 자라풀과(Hydrocharitaceae), 지채과(Juncaginaceae), 장지채과(Scheuchzeriaceae), 가래과(Potamogetonaceae), 나자스말과(Najadaceae), 거머리말과(Zosteraceae), 백합과(Liliaceae)일 수 있고, 상기 쌍자엽 식물은 암매과(돌매화나무과, Diapensiaceae), 매화오리나무과(Clethraceae), 메꽃과(Convolvulaceae), 노루발과(Pyrolaceae), 가지과(Solanaceae), 진달래과(Ericaceae), 십자화과(겨자과, Cruciferae), 장미과(Rosaceae), 자금우과(Myrsinaceae), 앵초과(Primulaceae), 갯질경이과 (Plumbaginaceae)일 수 있으나, 이에 제한되지 않는다. 바람직하게는 상기 식물체는 십자화과, 가지과, 장미과 또는 메꽃과에 속하는 식물체일 수 있고, 가장 바람직하게는 고구마 식물체일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은, IbHPPD 단백질을 코딩하는 유전자를 유효성분으로 함유하는 식물체의 환경 스트레스 내성 조절용 조성물을 제공한다.
본 발명의 식물체의 환경 스트레스 내성 조절용 조성물은 유효 성분으로서 본 발명의 IbHPPD 단백질을 코딩하는 유전자 또는 이를 포함하는 재조합 벡터를 포함하며, 상기 유전자 또는 이를 포함하는 재조합 벡터를 식물체에 형질전환시킴으로써 식물체의 환경 스트레스 내성을 조절할 수 있는 것이다. 바람직하게는 상기 IbHPPD 유전자를 과발현시켜 식물체의 환경 스트레스 내성을 증가시킬 수 있으나, 이에 제한되지 않는다.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
실시예 1: 고구마 IbHPPD 유전자의 클로닝, 염기서열 분석 및 유연관계 분석
고구마(Ipomoea batatas (L.) Lam. cv. Yulmi) 식물체는 토양에서 장일조건 (16시간 명 및 8시간 암 처리)으로 25±3℃에서 3달간 생육시켰다. 생육된 잎 조직의 RNA는 RNase-free DNase을 처리한 TRIzol 방법(Invitrogen사)을 통해 분리하였다. 상기 RNA는 M-MLV 역전사 시스템 cDNA 합성키트(Clontech사)를 이용하여 cDNA 합성을 수행하였으며 프라이머는 공지된 유전자 서열(GeneBank accession no: KP306528)을 기초로 하여 디자인하였다. HPPD 유전자의 시퀀스 정보는 실험실에서 고구마 잎 및 저장뿌리를 RNA-seq 분석으로 구축한 전사체 라이브러리에서 얻었다.
IbHPPD cDNA 유전자의 전체 길이는 1,323bp로서 코딩영역(440 개의 아미노산으로 구성)으로 구성되어 있음을 보였다(도 1). 또한, 단백질 도메인 측정을 위해 SMART 프로그램(http://smart.embl-heidelberg.de/)을 이용하여 조사한 결과, IbHPPD 단백질이 SCOP와 글리옥살라아제(glyoxalase) 도메인을 가지고 있음을 확인하였다(도 2). 고구마(Ipomoea batatas) IbHPPD의 코딩영역을 블라스트(BlastP)로 조사하였을 때, 상추(Lactuca sativa)의 LsHPPD와 아미노산 수준에서 74%의 상동성을 보였으며, 애기장대(Arabidopsis thaliana)의 AtHPPD와는 73%의 상동성을 보였다(도 3). 고구마의 IbHPPD의 추정되는 단백질의 아미노산 서열과 다양한 식물 종의 HPPD 사이의 유연관계를 ClustalW 프로그램(http://plant.pdrc.re.kr/gene/align/ClustalW.html)을 이용하여 조사한 결과, 고구마 IbHPPD는 HPPD계열의 단백질임을 확인하였다(도 3 및 4).
실시예 2: 고구마 조직별 IbHPPD 유전자의 발현 분석
본 발명에 따른 고구마 유래의 IbHPPD 유전자의 조직별 발현 양상을 분석하기 위해 Realtime PCR을 수행하였다. TRIzol 방법(Invitrogen사)으로 고구마 조직(잎, 줄기, 실뿌리, 굵은 뿌리 및 저장 뿌리)으로부터 총 RNA를 추출한 후, RNA 2㎍을 사용하여 MMLV 역전사 시스템 cDNA 합성키트(Clontech사)로 cDNA를 합성하였다. IbHPPD 유전자 특이적 프라이머 및 Accel Taq Premix 키트(Genedocs사)를 사용하여 IbHPPD 유전자의 발현 양상을 조사하였다. IbHPPD에 대한 특이적인 프라이머는 표 1에 기재된 프라이머를 사용하였다. 그 결과 도 5에 개시된 바와 같이, IbHPPD 유전자는 잎(leaf)에서 가장 강하게 발현되었으며, 줄기(stem)에서는 매우 약하게 발현되는 양상을 보였다. 뿌리 시스템에서 저장 뿌리(storage root)는 실뿌리(fibrous root) 및 굵은 뿌리(thick pigmented root)에 비해 상대적으로 강하게 발현되었다. 따라서 고구마 저장뿌리에서 분리한 IbHPPD 유전자는 정상 생육조건에서 잎에서 주로 발현되는 유전자임을 알 수 있었다.
표 1 본 발명에 사용된 프라이머
프라이머 이름 정방향(5'-3') 역방향(5'-3')
IbHPPD 서열번호 프라이머 서열 서열번호 프라이머 서열
3 ATGAGGAAGAGGAGCGGAAT 4 CCAACAGGCTTGGTGAAGAT
실시예 3: 건조처리를 포함한 다양한 스트레스 처리에 의한 IbHPPD 유전자의 발현특성 분석
IbHPPD 유전자가 건조를 포함한 다양한 스트레스 처리에 대해 반응하는 정도를 분석하기 위해, 다양한 스트레스 조건인 건조(30% PEG, polyethylene glycol), 산화(400mM 과산화수소, H2O2) 및 병원균(Pectobacterium chrysanthemi) 처리를 한 후 IbHPPD 유전자의 발현 변화를 Realtime PCR을 이용하여 분석하였다.
먼저, IbHPPD 유전자의 PEG 처리에 따른 반응하는 정도를 분석하기 위해, 고구마의 잎 조직을 시간대별(0, 2, 4, 6 및 12시간)로 건조처리한 후에, 상기 실시예 2에서 수행한 방법으로 RNA를 분리한 후, cDNA를 각각 합성하였다. 상기 실시예 2에서 사용한 IbHPPD 유전자의 특이적 프라이머로 Realtime PCR을 수행하였다. 그 결과, IbHPPD 유전자는 아무것도 처리하지 않은 음성 대조군(Control)에 비해 건조처리 4시간 후 잎 조직에서 가장 강한 발현 수준을 보였다(도 6).
다음으로 과산화수소(H2O2) 처리에 의해 유도되는 산화 스트레스에 대한 반응성을 알아보기 위해, 400mM 과산화수소를 시간대별(0, 2, 4, 6 및 12시간)로 처리한 후, 상기 동일한 방법으로 RNA를 추출하고 cDNA를 합성하였으며 Realtime PCR을 수행하였다. 그 결과, 아무것도 처리하지 않은 음성 대조군(Control)에 비해 과산화수소 처리 4시간 후부터 발현이 증가하기 시작하였으며, 처리 12시간 후에 최고의 발현 수준을 보였다(도 7).
다음으로 IbHPPD 유전자가 고구마 세균성 줄기뿌리썩음병 병원균(Pectobacterium chrysanthemi)에 대한 저항성과 관련이 있는지를 확인하기 위해, 병원균을 시간대별(0, 3, 6 및 12시간)로 처리한 후 유전자 발현 양상을 분석하였다. 병원균 접종은 잎에 병원균을 배양하여 인필터레이션 버퍼인 10mM MgCl2에 약 1x105 cfu/ml의 농도가 되도록 현탁한 용액에 처리하였다. Mock으로는 10mM MgCl2을 처리한 잎을 사용하였다. 상기와 동일한 방법으로 RNA를 추출하고 cDNA를 합성하였으며 Realtime PCR을 수행하였다. 그 결과, 병원균 처리 6시간 후, Mock에 비해 IbHPPD 유전자의 발현 수준이 급격히 증가함을 확인할 수 있었다.
이러한 상기 결과들은 IbHPPD 유전자가 다양한 스트레스에 반응성을 가진다는 것을 보여준다. 따라서, IbHPPD 유전자는 건조, 산화 스트레스 및 병원균 감염에서도 생장을 좋게 하는 환경재해 내성식물체(고구마 포함)의 개발에 도움이 될 것으로 판단된다.
실시예 4: 고구마 유래의 IbHPPD 유전자의 일시적 과발현에 의한 담배 식물체의 잎에서 알파 토코페롤(α-tocopherol) 함량 분석
아그로박테리움 매개 IbHPPD 유전자의 일시적 과발현을 통하여 알파-토코페롤(α-tocopherol)의 함량을 분석하였다. 3주 된 담배 식물체의 잎에 아그로박테리움을 접종한 후, 3일이 지난 부분을 샘플링하여 Realtime PCR 분석을 통해 IbHPPD 유전자 발현 양상을 확인하였으며, HPLC 분석을 통해 알파-토코페롤 함량을 측정하였다(도 9A). 그 결과, IbHPPD 유전자를 접종시킨 담배 식물체의 잎에서 빈 벡터(control)에 비해 IbHPPD 유전자 발현이 현저히 증가할 뿐만 아니라, 알파-토코페롤 함량이 81%까지 증가함을 확인할 수 있었다(도 9B). 따라서 IbHPPD 유전자는 토코페롤 생합성 경로에 관여하는 유전자로서, 저분자 항산화물질인 토코페롤 함량을 증가시키는 역할을 하는 것을 확인할 수 있었다.
실시예 5: 고구마 유래의 IbHPPD 유전자를 과발현시킨 형질전환 애기장대 식물체의 산화 스트레스에 대한 내성 분석
IbHPPD 과발현 형질전환 식물체에서 산화 스트레스에 대한 내성을 확인하기 위해, 산화 스트레스 원인인 10μM의 메틸 비올로젠(MV, methyl viologene)이 포함된 MS 배지에 애기장대 비형질전환체 및 형질전환체를 3일간 배양한 후, 생존율(survival rate)을 확인하였다. 그 결과, 도 10에 개시된 바와 같이 메틸 비올로젠을 처리한 비형질전환체의 경우 생존율이 58.3%인 반면, IbHPPD 과발현 형질전환체의 생존율은 95.8%로서 메틸 비올로젠 처리로 인한 산화 스트레스에 대해 강한 내성을 보임을 확인할 수 있었다.

Claims (14)

  1. 서열번호 2의 아미노산 서열로 이루어진, 환경 스트레스 내성을 조절하는 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질.
  2. 제1항의 단백질을 코딩하는 유전자.
  3. 제2항의 유전자를 포함하는 재조합 벡터.
  4. 제3항의 재조합 벡터로 형질전환된 숙주세포.
  5. 고구마 유래의 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 IbHPPD 유전자의 발현을 조절하는 단계를 포함하는 식물체의 환경 스트레스 내성을 조절하는 방법.
  6. 제5항에 있어서, 상기 IbHPPD 단백질은 서열번호 2의 아미노산 서열로 이루어진 것을 특징으로 하는 식물체의 환경 스트레스 내성을 조절하는 방법.
  7. 제5항에 있어서, 상기 IbHPPD 유전자를 과발현시켜 식물체의 환경 스트레스 내성을 증가시키는 것을 특징으로 하는 식물체의 환경 스트레스 내성을 조절하는 방법.
  8. 제5항에 있어서, 상기 환경 스트레스는 건조, 산화 또는 병원균 감염 스트레스인 것을 특징으로 하는 식물체의 환경 스트레스 내성을 조절하는 방법.
  9. 제8항에 있어서, 상기 병원균은 고구마 세균성 줄기뿌리썩음병 병원균(Pectobacetrium chrysanthemi)인 것을 특징으로 하는 식물체의 환경 스트레스 내성을 조절하는 방법.
  10. 고구마 유래의 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
    상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 환경 스트레스 내성이 조절된 형질전환 식물체의 제조 방법.
  11. 제10항에 있어서, 상기 IbHPPD 유전자를 과발현시켜 식물체의 환경 스트레스 내성을 증가시키는 것을 특징으로 하는 환경 스트레스 내성이 조절된 형질전환 식물체의 제조 방법.
  12. 제10항 또는 제11항의 방법에 의해 제조된 환경 스트레스 내성이 조절된 형질전환 식물체.
  13. 제12항의 환경 스트레스 내성이 조절된 식물체의 형질전환된 종자.
  14. 고구마 유래의 IbHPPD(Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) 단백질을 코딩하는 유전자를 유효성분으로 함유하는 식물체의 환경 스트레스 내성 조절용 조성물.
PCT/KR2016/002916 2015-04-02 2016-03-23 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도 Ceased WO2016159560A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20150046747 2015-04-02
KR10-2015-0046747 2015-04-02

Publications (1)

Publication Number Publication Date
WO2016159560A1 true WO2016159560A1 (ko) 2016-10-06

Family

ID=57004481

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/002916 Ceased WO2016159560A1 (ko) 2015-04-02 2016-03-23 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101824698B1 (ko)
WO (1) WO2016159560A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119391719A (zh) * 2024-12-10 2025-02-07 青岛农业大学 甘薯IbNFYA3基因及其在提高植物抗逆性中的应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200030284A (ko) 2018-09-12 2020-03-20 인제대학교 산학협력단 고구마 스트레스 조절 관련 유전자인 IbMT3 유전자 및 이의 용도

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040045051A1 (en) * 2002-08-05 2004-03-04 Norris Susan R. Tocopherol biosynthesis related genes and uses thereof
US20050289664A1 (en) * 2004-01-26 2005-12-29 Monsanto Technology, L.L.C. Genes encoding 4-Hydroxyphenylpyruvate dioxygenase (HPPD) enzymes for plant metabolic engineering
KR20090043754A (ko) * 2007-10-30 2009-05-07 한국생명공학연구원 고구마 뿌리 유래의 IbTIP1 유전자 및 그의 프로모터
KR20110104425A (ko) * 2010-03-16 2011-09-22 한국생명공학연구원 고구마 뿌리 유래의 IbLEA14 유전자 및 이의 용도
KR20140028280A (ko) * 2012-08-28 2014-03-10 한국생명공학연구원 LCY-β 유전자를 이용한 환경 스트레스에 대한 내성이 증진된 형질전환 식물체의 제조방법 및 그에 따른 식물체

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040045051A1 (en) * 2002-08-05 2004-03-04 Norris Susan R. Tocopherol biosynthesis related genes and uses thereof
US20050289664A1 (en) * 2004-01-26 2005-12-29 Monsanto Technology, L.L.C. Genes encoding 4-Hydroxyphenylpyruvate dioxygenase (HPPD) enzymes for plant metabolic engineering
KR20090043754A (ko) * 2007-10-30 2009-05-07 한국생명공학연구원 고구마 뿌리 유래의 IbTIP1 유전자 및 그의 프로모터
KR20110104425A (ko) * 2010-03-16 2011-09-22 한국생명공학연구원 고구마 뿌리 유래의 IbLEA14 유전자 및 이의 용도
KR20140028280A (ko) * 2012-08-28 2014-03-10 한국생명공학연구원 LCY-β 유전자를 이용한 환경 스트레스에 대한 내성이 증진된 형질전환 식물체의 제조방법 및 그에 따른 식물체

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119391719A (zh) * 2024-12-10 2025-02-07 青岛农业大学 甘薯IbNFYA3基因及其在提高植物抗逆性中的应用

Also Published As

Publication number Publication date
KR101824698B1 (ko) 2018-02-02
KR20160118936A (ko) 2016-10-12

Similar Documents

Publication Publication Date Title
DK2201121T3 (en) METHODS OF MANAGING PLANT SEED AND ORGANIZATION
KR101465692B1 (ko) AtbHLH113 유전자를 이용한 안토시아닌 생합성이 조절된 형질전환 식물체의 제조방법 및 그에 따른 식물체
WO2020085559A1 (ko) 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GmPAP2.1 유전자 및 이의 용도
WO2011090272A2 (ko) 식물의 외형(초형)을 변화시키고 수확량을 증가시키는 OsMPT 유전자 및 이의 용도
CN110592134B (zh) 一种sdg40基因或其编码蛋白的应用
WO2015125985A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 OsNF-YA7 유전자 및 이의 용도
WO2016159560A1 (ko) 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 IbHPPD 유전자 및 이의 용도
WO2014061932A1 (ko) 애기장대 유래의 reca1 유전자를 이용한 병원균에 대한 면역능력이 증진된 형질전환 식물체의 제조방법 및 그에 따른 식물체
KR101852530B1 (ko) 식물의 엽설 및 종자 발달을 조절하는 벼 유래의 OsiEZ1 유전자 및 이의 용도
KR102090157B1 (ko) 식물체의 초장, 종자 크기 및 출수기를 조절하는 야생벼 유래 apx9 유전자 및 이의 용도
KR102805494B1 (ko) 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 ATPsyn-α 유전자 및 이의 용도
KR20210069839A (ko) 식물체의 개화기 조절 efg1 유전자 및 이의 용도
KR101651940B1 (ko) 벼의 출수기와 생장을 조절하는 dhd1 유전자 및 이의 용도
Xun et al. Identification and functional characterization of R3 MYB transcription factor genes in soybean
KR102609708B1 (ko) 식물체의 재분화 효율을 조절하는 애기장대 유래 esr2 유전자 및 이의 용도
KR102528935B1 (ko) 식물체의 재분화 효율을 조절하는 애기장대 유래 arp6 유전자 및 이의 용도
KR101664206B1 (ko) 식물의 환경 스트레스 내성을 증가시키는 벼 유래의 OsWOX13 유전자 및 이의 용도
KR101957736B1 (ko) 식물의 고온 스트레스 내성을 증가시키는 벼 유래 OsOPT10 유전자 및 이의 용도
KR102025255B1 (ko) 배추 유래의 gs 유전자의 수확량 및 환경 스트레스 조절자로서의 용도
KR20220086037A (ko) 식물체의 재분화 효율을 조절하는 애기장대 유래 hda6 유전자 및 이의 용도
KR20220029188A (ko) 고온 스트레스 조건에서 식물체의 종자 발달 및 화분 생존율을 조절하는 애기장대 유래 sta1 유전자 및 이의 용도
KR101717474B1 (ko) At1g70000을 포함하는 식물체의 안토시아닌 합성 증가 유도용 조성물 및 그의 이용
KR20150106528A (ko) 식물의 비생물학적 스트레스 내성을 증가시키는 고추 유래의 msrb2 유전자 및 이의 용도
WO2018164293A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 Roc10 유전자 및 이의 용도
KR102173875B1 (ko) 식물의 제초제 저항성 증진용 조성물 및 이를 이용한 식물의 제초제 저항성을 증진시키는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16773341

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16773341

Country of ref document: EP

Kind code of ref document: A1