WO2016159560A1 - Sweet potato-derived ibhppd gene for regulating plant tolerance to environmental stress, and use thereof - Google Patents

Abstract

The present invention relates to: a sweet potato-derived IbHPPD gene for regulating plant tolerance to environmental stress; and a use thereof, wherein the gene can be useful for developing a transgenic plant and a biofuel plant, which have environmental stress tolerance allowing the plants to be suitable to less-favorable regions by using the gene.

Description

IJHPD gene derived from sweet potato to regulate environmental stress tolerance of plants and its use

The present invention relates to IbHPPD gene derived from sweet potato and its use for regulating the environmental stress resistance of plants.

Sweet potato ( Ipomoea batatas ) can be grown on relatively poor lands and is grown in more than 100 countries around the world. It is the seventh major crop in the world after wheat, rice, corn, potatoes, barley and cassava. It is a representative root crop produced. Sweet potato leaves and petioles contain ingredients that are not found in ordinary grains such as vitamins B and C, tocopherol, calcium and iron, and have a wide range of polyphenols, making them highly valuable as vegetables and rich in carbohydrates in sweet potato storage roots. Become a source of energy.

Plants respond to a variety of environmental stress conditions, including salt, drying and pests, by controlling gene expression and altering cellular metabolites. As the plant is exposed to various environmental stresses, in vivo oxygen is in excess and the reaction with the e-oxide anion radicals ^{_{(O 2 -, Superoxide anion radical}} ), hydrogen peroxide _{(H 2 O 2, Hydrogen peroxide} ), hydroxyl radical (OH, Hydroxyl radical ) Into highly reactive, reactive oxygen species (ROS). The oxidative stress that cells receive from ROS is caused by high temperature, low temperature, drying, high brightness, ultraviolet light and ROS producing herbicides such as methyl viologen (MV). To cope with this oxidative stress, plants have been developed with powerful antioxidant defense systems such as antioxidant enzymes and low molecular weight antioxidants.

Tocopherol is one of the hydrophobic low molecular weight antioxidants synthesized in the chloroplast. It protects plants from singlet oxygen and protects photosystems and membrane lipids by preventing lipid peroxidation. In addition, tocopherol prevents lipid peroxidation during seed germination and is resistant to stress such as excessive metal ions and low temperatures.

On the other hand, IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) is a protein involved in the tocopherol biosynthesis pathway. Tyrosine or chorismate formed through the Shikimic acid pathway is converted to hydroxyphenylpyruvate (HPP), which is oxidized by the HPPD enzyme to produce homogenous acid (HGA). HGA is known to act as the most important substrate for tocopherol biosynthesis and to regulate HPPD gene expression in plants.

Pectobacterium chrysanthemi is infected through the wound, and black or brown symptoms appear throughout the sweet potato stems, petioles, and storage roots. It is a plant disease that is a problem worldwide with a large loss. However, there are no resistant varieties in sweet potatoes and there is no clear control method.

Korean Patent No. 121277 discloses ' IbLEA14 gene derived from sweet potato root and its use', and Korean Patent No. 0930593 discloses 'swDREB1 protein derived from sweet potato root and gene encoding the same', As in the present invention, it is not known about the sweet potato-derived IbHPPD gene and its use for regulating the environmental stress resistance of plants.

The present invention is derived by the request as described above, in the present invention by using the plant with the expression of IbHPPD gene regulation, it was confirmed that IbHPPD gene is involved in environmental stress tolerance of a plant control. In particular, it was confirmed that the IbHPPD gene is strongly expressed in the leaves, especially under environmental stress conditions such as pathogen infection as well as drying and oxidative stress. Accordingly, the present invention was completed by confirming that the plant can produce a plant and its seeds whose environmental stress resistance is controlled using the gene.

In order to solve the above problems, the present invention provides an amino acid sequence of SEQ ID NO: 2, IbPOPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein that regulates environmental stress resistance.

The present invention also provides a gene encoding the protein.

The present invention also provides a recombinant vector comprising the gene.

The present invention also provides a host cell transformed with the recombinant vector.

The present invention also provides a method of controlling the environmental stress resistance of a plant comprising the step of transforming the plant cell with the recombinant vector to control the expression of the IbHPPD gene.

In addition, the present invention provides a method for producing a transformed plant with controlled environmental stress resistance, comprising the step of transforming plant cells with the recombinant vector.

In addition, the present invention provides a transgenic plant and seed thereof having a controlled environmental stress resistance produced by the above method.

The present invention also provides a composition for controlling environmental stress resistance of plants containing a gene encoding IbHPPD protein derived from sweet potato as an active ingredient.

The present invention relates to a potato-derived to control the environmental stress tolerance of a plant IbHPPD gene and use thereof, IbHPPD gene of potato origin according to the invention is especially under environmental stress conditions, such as drying, oxidizing and pathogen infection, strong in leaf Since expression is induced, it may be usefully used to develop transgenic plants and biofuel crops that are resistant to environmental stresses suitable for conditioned adverse areas.

1 is a view showing the nucleotide sequence of the sweet potato-derived IbHPPD gene according to the present invention and the amino acid sequence deduced therefrom.

Figure 2 is a diagram showing the domain of the deduced protein of sweet potato-derived IbHPPD gene according to the present invention.

3 is a diagram comparing the amino acid sequences of the HPPD gene amino acid sequence and various plants (lettuce, rapeseed, Arabidopsis thaliana, mango and corn) of the deduced protein of potato-derived IbHPPD gene according to the invention. IbHPPD is a sweet potato-derived gene; LsHPPD is a gene derived from lettuce; BnHPPD is a rapeseed gene; AtHPPD is a gene derived from Arabidopsis; MiHPPD is a gene derived from mango; ZmHPPD is a gene derived from corn.

Figure 4 is a view showing a flexible relationship between the HPPD gene of the amino acid sequence and various plants (lettuce, rapeseed, Arabidopsis thaliana, mango and corn) of the deduced protein of potato-derived IbHPPD gene according to the invention. IbHPPD is a sweet potato-derived gene; LsHPPD is a gene derived from lettuce; BnHPPD is a rapeseed gene; AtHPPD is a gene derived from Arabidopsis; MiHPPD is a gene derived from mango; ZmHPPD is a gene derived from corn.

Figure 5 is a graph of real-time PCR analysis of the expression pattern of the sweet potato for the IbHPPD gene according to the present invention. L is the leaf, S is the stem, FR is the fibrous root, TR is the thick pigmented root, and SR is the storage root.

Figure 6 is treated with 30% PEG (polyethylene glycol 6000) on the sweet potato leaves after the 0, 2, 4, 6 and 12 hours, IbHPPD gene expression of the graph analyzed by Realtime PCR.

Figure 7 is treated with 400mM hydrogen peroxide (H ₂ O ₂ ) to the sweet potato leaves after 0, 2, 4, 6 and 12 hours, a graph analyzing the expression of the IbHPPD gene by Realtime PCR.

8 is a graph of sweet potato bacterial stem root rot pathogen ( Pectobacterium chrysanthemi ) on the sweet potato leaves after 0, 3, 6 and 12 hours, the expression of IbHPPD gene was analyzed by Realtime PCR.

Figure 9 is a graph (B) showing the expression pattern and tocopherol content of IbHPPD gene in the leaves (A) of tobacco plants inoculated with Agrobacterium mediated IbHPPD gene.

10 is a graph (B) showing plant photos (A) and survival rates when oxidative stress was applied to Arabidopsis non-transformants (WT) and Arabidopsis transformants overexpressing IbHPPD genes.

In order to achieve the object of the present invention, the present invention provides an Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase (IbHPPD) protein that regulates environmental stress resistance, consisting of the amino acid sequence of SEQ ID NO: 2.

The range of IbHPPD proteins according to the present invention includes proteins having an amino acid sequence represented by SEQ ID NO: 2 isolated from sweet potatoes and functional equivalents of the proteins. "Functional equivalent" means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid Is 95% or more of sequence homology, and refers to a protein that exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2. By "substantially homogeneous physiological activity" is meant an activity that enhances the plant's resistance to environmental stress.

The invention also includes fragments, derivatives and analogues of the IbHPPD protein. As used herein, the terms “fragment”, “derivative” and “analogue” refer to a polypeptide that retains the same biological function or activity as the IbHPPD polypeptide of the invention. Fragments, derivatives, and analogs of the present invention comprise (i) polypeptides substituted with one or more conservative or nonconservative amino acid residues (preferably conservative amino acid residues), wherein the substituted amino acid residues are encoded by a genetic code. Or (ii) a polypeptide having substituent (s) at one or more amino acid residues, or (iii) another compound (a compound capable of extending the half-life of a polypeptide, such as polyethylene glycol) A polypeptide derived from a bound mature polypeptide, or (iv) an additional amino acid sequence (eg, a leader sequence, a secretion sequence, a sequence used to purify the polypeptide, a proteinogen sequence or a fusion protein) and It may be a polypeptide derived from said polypeptide bound. Such fragments, derivatives and analogs as defined herein are well known to those skilled in the art.

The present invention also provides a gene encoding the IbHPPD protein. The gene of the present invention may be DNA or RNA encoding IbHPPD protein. DNA includes cDNA, genomic DNA or artificial synthetic DNA. DNA can be single stranded or double stranded. DNA may be a coding strand or a noncoding strand.

Preferably, the gene of the present invention may include the nucleotide sequence represented by SEQ ID NO: 1.

Polynucleotides encoding a mature polypeptide represented by SEQ ID NO: 2 include a coding sequence encoding only a mature polypeptide; Sequences encoding mature polypeptides and various additional coding sequences; Mature polypeptides (and any additional coding sequences) and sequences encoding noncoding sequences.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide encoding a polypeptide, or a polynucleotide further comprising additional coding and / or noncoding sequences.

The invention also relates to variants of said polynucleotides encoding polypeptides comprising the same amino acid sequence as described herein, or fragments, analogs, and derivatives thereof. Polynucleotide variants may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitutional variants, deletional variants, and insertional variants. As is known in the art, allelic variants are alternatives to polynucleotides, which may include one or more substitutions, deletions, or inserted nucleotides, which do not result in a substantial functional change in the polypeptide encoded by the variant. Do not.

In addition, the present invention provides a poly-hybridized hybridization with a sequence having at least 50%, preferably at least 70%, more preferably at least 80% identity with a nucleotide sequence of SEQ ID NO. It relates to nucleotides. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" include (1) hybridization and washing under 0.2 × SSC, 0.1% SDS, lower ionic strength such as 60 ° C. and higher temperature; Or (2) hybridization in the presence of denaturing agents such as 50% (v / v) formamide, 0.1% bovine serum / 0.1% Ficoll and 42 ° C .; Or (3) hybridization that occurs between only two sequences having at least 80%, preferably at least 90%, more preferably at least 95% identity. In addition, the biological function and activity of the polypeptide encoded by the hybridizable polynucleotide are identical to the biological function and activity of the mature polypeptide represented by SEQ ID NO: 2.

In accordance with an embodiment of the invention, it should be understood that the IbHPPD gene is preferably derived from sweet potatoes. However, embodiments of the invention have high homology (eg, 60% or more, i.e. 70%, 80%, 85%, 90%, 95%, even 98% sequence identity) with the sweet potato IbHPPD gene and other It also includes other genes derived from plants. Sequencing methods and means for determining sequence identity or homology (eg BLAST) are well known in the art.

The present invention also provides a recombinant vector comprising the IbHPPD gene according to the present invention.

The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.

In the present invention, the polynucleotide sequence encoding the IbHPPD protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host. An important feature of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

Expression vectors comprising IbHPPD protein-encoding DNA sequences and appropriate transcriptional / translational control signals can be constructed by methods well known to those of skill in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.

Preferred examples of recombinant vectors of the present invention are Ti plasmid vectors capable of transferring part of themselves, the so-called T region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Another type of Ti plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences to protoplasts from which plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. . A particularly preferred form of the Ti plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host. Preferably, the recombinant vector may be, but is not limited to, a pKBS11 vector, a pBI101 vector, and a pCAMBIA vector.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance genes include, but are not limited to.

In the recombinant vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

In the recombinant vector of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, etc., but is not limited thereto. With regard to the need for terminators, such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

The present invention also provides a host cell transformed with the recombinant vector of the present invention. The host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell while being stable can be used in any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1. , Bacillus genus strains, such as E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas Enterobacteria such as species and strains.

In addition, when transforming the vector of the present invention into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS7, 293, HepG2) , 3T3, RIN and MDCK cell lines) and plant cells and the like can be used. The host cell is preferably a plant cell.

The method of carrying the vector of the present invention into a host cell includes a CaCl ₂ method, one method (Hanahan, D., J. Mol. Biol., 166: 557580 (1983)) and when the host cell is a prokaryotic cell. It may be carried out by a method of drilling. In addition, when the host cell is a eukaryotic cell, the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAEdextran treatment, gene bombardment, or the like. .

The invention also, by transforming a plant cell with a recombinant vector containing the gene encoding the IbHPPD protein of potato-derived provides a method for controlling the environmental stress tolerance of a plant comprising the step of regulating the expression of IbHPPD gene.

The range of IbHPPD proteins according to the present invention includes proteins having the amino acid sequence represented by SEQ ID NO: 2 and functional equivalents of the proteins.

The "gene expression control" of the present invention refers to increasing or decreasing the expression of the IbHPPD gene in the plant.

In a method according to an embodiment of the present invention, a method of controlling the environmental stress resistance of the plant, by transforming the plant cell with a recombinant vector comprising the gene of SEQ ID NO: 1 overexpressing the IbHPPD gene to the environmental stress resistance of the plant May be increased, but is not limited thereto.

In the method according to an embodiment of the present invention, the environmental stress may be dry, oxidative or pathogen infection stress, preferably pathogen infection stress, most preferably sweet potato bacterial stem root rot pathogen ( Pectobacetrium chrysanthemi ) Infection stress may be, but is not limited to.

The "gene overexpression" means that the gene is expressed above the level expressed in wild-type plants. As a method of introducing the gene into a plant, there is a method of transforming a plant using an expression vector containing the gene under the control of a promoter.

The "plant cells" used for plant transformation may be any plant cells. Plant cells are cultured cells, cultured tissues, culture organs or whole plants. "Plant tissue" refers to the tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture or cell culture.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a potato-derived IbHPPD protein; And

It provides a method for producing a transformed plant with controlled environmental stress resistance comprising the step of regenerating the plant from the transformed plant cells.

In the method according to an embodiment of the present invention, the IbHPPD protein may be composed of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

In the preparation method according to an embodiment of the present invention, the gene encoding the IbHPPD protein may be the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In the method according to an embodiment of the present invention, a method of controlling the environmental stress resistance of the plant, transforming the plant cell with a recombinant vector containing the gene encoding the IbHPPD protein to overexpress the IbHPPD gene to the environment of the plant It may increase stress tolerance, but is not limited thereto.

In the method according to an embodiment of the present invention, the environmental stress may be dry, oxidative or pathogen infection stress, preferably pathogen infection stress, most preferably sweet potato bacterial stem root rot pathogen ( Pectobacetrium chrysanthemi ) Infection stress may be, but is not limited to.

The method of the present invention comprises transforming plant cells with a recombinant vector according to the present invention, which transformation can be mediated by, for example, Agrobacterium tumefiaciens. The method also includes the step of regenerating the transgenic plant from said transformed plant cell. The method for regenerating the transformed plant from the transformed plant cell may use any method known in the art.

Transformed plant cells should be re-differentiated into whole plants. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for many different species.

In addition, the present invention provides a transgenic plant and seed thereof having a controlled environmental stress resistance produced by the above method. Preferably, the plant may be a monocotyledonous plant or a dicotyledonous plant, but is not limited thereto.

The monocotyledonous plants are Alismataceae, Hydrocharitaceae, Juncaginaceae, Schuchzeriaceae, Pomomotontonaceae, Najadaceae, Zosteraceae, Liliaceae The dicotyledonous plants may include the Asteraceae (Asteraceae, Diapensiaceae), Asteraceae (Clethraceae), Convolvulaceae, Pyrolaceae, Solanaceae, Azalea (Ericaceae), Cruciferaceae (Cruciferae) ), Rosaceae, Myrsinaceae, Primulaceae, Plumbaginaceae, but is not limited thereto. Preferably, the plant may be a plant belonging to the cruciferaceae, eggplant, rosaceae or asteraceae, most preferably may be a sweet potato plant, but is not limited thereto.

The present invention also provides a composition for controlling environmental stress resistance of a plant containing a gene encoding the IbHPPD protein as an active ingredient.

The composition for controlling environmental stress resistance of a plant of the present invention includes a gene encoding the IbHPPD protein of the present invention or a recombinant vector comprising the same as an active ingredient, and the plant environment is transformed by transforming the plant with the gene or the recombinant vector comprising the same. You can control your stress tolerance. Preferably, the IbHPPD gene may be overexpressed to increase environmental stress tolerance of the plant, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for explaining the present invention in more detail, it is obvious to those skilled in the art that the scope of the present invention is not limited by them.

Example 1: Sweet Potato IbHPPD  Gene cloning, sequencing and softness analysis

Sweet potato ( Ipomoea batatas (L.) Lam. Cv. Yulmi) plants were grown in soil for 3 months at 25 ± 3 ° C. under long-term conditions (16 hours and 8 hours cancer treatment). The grown leaf tissue RNAs were isolated by RNase-free DNase-treated TRIzol method (Invitrogen). The RNA was performed cDNA synthesis using the M-MLV reverse transcription system cDNA synthesis kit (Clontech) and primers were designed based on the known gene sequence (GeneBank accession no: KP306528). Sequence information of the HPPD gene was obtained from a transcript library constructed from RNA-seq analysis of sweet potato leaves and storage roots in the laboratory.

The total length of the IbHPPD cDNA gene was 1,323 bp, indicating that the coding region was composed of 440 amino acids (FIG. 1). In addition, using a SMART program (http://smart.embl-heidelberg.de/) for protein domain measurement, it was confirmed that the IbHPPD protein has a SCOP and glyoxalase domain (Fig. 2). When the coding region of Ipomoea batatas IbHPPD was examined by BlastP, it showed 74% homology with LsHPPD of Lactuca sativa at the amino acid level and 73% with AtHPPD of Arabidopsis thaliana . The homology of was shown (Fig. 3). Using the ClustalW program (http://plant.pdrc.re.kr/gene/align/ClustalW.html), the relationship between the amino acid sequence of the putative protein of IbHPPD of sweet potato and HPPD of various plant species was investigated. Sweet potato IbHPPD was confirmed to be a protein of the HPPD family (Figs. 3 and 4).

Example 2: Sweet Potato Tissue IbHPPD  Gene expression analysis

Realtime PCR was performed to analyze tissue expression patterns of IbHPPD genes derived from sweet potatoes according to the present invention. After extracting total RNA from sweet potato tissues (leaves, stems, roots, coarse roots and storage roots) by TRIzol method (Invitrogen), cDNA was synthesized by MMLV reverse transcription system cDNA synthesis kit (Clontech) using 2 µg of RNA. . IbHPPD gene specific primers and Accel Taq Premix kit (Genedocs) were used to investigate the expression of IbHPPD gene. As primers specific for IbHPPD , the primers described in Table 1 were used. As a result, as shown in FIG. 5, the IbHPPD gene was most strongly expressed in the leaf and very weakly expressed in the stem. Storage roots in the root system were relatively strongly expressed compared to fibrous roots and thick pigmented roots. Therefore, the IbHPPD gene isolated from the sweet potato storage root was found to be the gene mainly expressed in the leaves under normal growth conditions.

Table 1 Primer used in the present invention

Primer name	Forward direction (5'-3 ')		Reverse (5'-3 ')
IbHPPD	SEQ ID NO:	Primer sequence	SEQ ID NO:	Primer sequence
	3	ATGAGGAAGAGGAGCGGAAT	4	CCAACAGGCTTGGTGAAGAT

Example 3 Various Stress Treatments Including Drying Treatments IbHPPD  Gene expression characteristics analysis

To analyze the degree to which the IbHPPD gene responds to various stress treatments, including drying, treatment with various stress conditions, drying (30% PEG, polyethylene glycol), oxidation (400 mM hydrogen peroxide, H ₂ O ₂ ) and pathogens ( Pectobacterium chrysanthemi ) Afterwards, the expression changes of IbHPPD gene were analyzed using Realtime PCR.

First, IbHPPD In order to analyze the degree of reaction according to the PEG treatment of the gene, after drying the sweet potato leaf tissue according to time zones (0, 2, 4, 6 and 12 hours), RNA was analyzed by the method described in Example 2. After separation, cDNA was synthesized, respectively. IbHPPD used in Example 2 above Realtime PCR was performed with specific primers of the genes. As a result, the IbHPPD gene showed the strongest expression level in the leaf tissue after 4 hours of drying compared to the negative control (No control) (FIG. 6).

Next, to determine the reactivity to the oxidative stress induced by hydrogen peroxide (H ₂ O ₂ ) treatment, 400mM hydrogen peroxide was treated by time zone (0, 2, 4, 6 and 12 hours), the same method RNA was extracted, cDNA was synthesized and realtime PCR was performed. As a result, expression began to increase after 4 hours of hydrogen peroxide treatment compared to the negative control (No treatment), and showed the highest expression level after 12 hours of treatment (Fig. 7).

Next IbHPPD To determine whether the gene is related to the resistance to Pectobacterium chrysanthemi , the pathogens were treated by time zones (0, 3, 6 and 12 hours) and analyzed for gene expression patterns. Pathogen inoculation was carried out by culturing the pathogen on the leaves and adding 1x10 ⁵ to 10mM MgCl ₂ as an infiltration buffer The solution was suspended to a concentration of cfu / ml. As a mock, leaves treated with 10 mM MgCl ₂ were used. RNA was extracted, cDNA was synthesized in the same manner as above, and realtime PCR was performed. As a result, 6 hours after treatment with pathogens, IbHPPD compared to Mock It was confirmed that the expression level of the gene is increased rapidly.

These results show that the IbHPPD gene is responsive to various stresses. Therefore, IbHPPD gene is expected to be helpful in the development of environmentally resistant plants (including sweet potatoes) that improve growth even in drying, oxidative stress and pathogen infection.

Example 4 From Sweet Potato IbHPPD Analysis of alpha-tocopherol content in the leaves of tobacco plants by transient overexpression of genes

Alpha-tocopherol content was analyzed through transient overexpression of the Agrobacterium mediated IbHPPD gene. After inoculating Agrobacterium on the leaves of three-week-old tobacco plants, three days later, the IbHPPD gene expression was confirmed by realtime PCR analysis, and the alpha-tocopherol content was measured by HPLC analysis (FIG. 9A). As a result, not only the IbHPPD gene expression increased significantly compared with the empty vector (control) in the leaves of tobacco plants were inoculated IbHPPD gene, alpha-tocopherol was found that the content is increased to 81% (Fig. 9B). Therefore, IbHPPD gene is involved in the tocopherol biosynthesis pathway, it was confirmed that plays a role in increasing the content of tocopherol, a low-molecular antioxidant.

Example 5: Sweet Potato-derived IbHPPD  Analysis of Resistance to Oxidative Stress in Transgenic Arabidopsis Plants Overexpressed Genes

To confirm resistance to oxidative stress in IbHPPD overexpressing plants, 3 days of Arabidopsis non-transformants and transformants were added to MS medium containing 10 μM of methyl viologene (MV), the cause of oxidative stress. After incubation, the survival rate was confirmed. As a result, as shown in FIG. 10, the survival rate of the non-transformant treated with methyl viologen was 58.3%, whereas the survival rate of the IbHPPD overexpressing transformant was 95.8%, which was strong against oxidative stress due to methyl viologen treatment. It was confirmed that the resistance.

Claims (14)

1. Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase (IbHPPD) protein that regulates environmental stress resistance, consisting of the amino acid sequence of SEQ ID NO: 2.
2. Gene encoding the protein of claim 1.
3. Recombinant vector comprising the gene of claim 2.
4. A host cell transformed with the recombinant vector of claim 3.
5. Methods by transforming a plant cell with a recombinant vector comprising a gene encoding a potato-derived IbHPPD (Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase ) protein for controlling the environmental stress tolerance of a plant comprising the step of regulating the expression of IbHPPD gene.
6. The method of claim 5, wherein the IbHPPD protein consists of the amino acid sequence of SEQ ID NO: 2. 6.
7. The method of claim 5, wherein the plant overexpresses the IbHPPD gene to increase the environmental stress resistance of the plant.
8. The method of claim 5, wherein the environmental stress is drying, oxidizing or pathogen infection stress.
9. The method of claim 8, wherein the pathogen is a sweet potato bacterial stem root rot disease pathogen ( Pectobacetrium chrysanthemi ).
10. Transforming plant cells with a recombinant vector comprising a gene encoding a potato-derived IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein; And

    A method for producing a transformed plant in which environmental stress resistance is controlled, comprising the step of regenerating the plant from the transformed plant cells.
11. The method of manufacturing a transgenic plant with controlled environmental stress resistance according to claim 10, wherein the IbHPPD gene is overexpressed to increase the environmental stress resistance of the plant.
12. A transgenic plant with controlled environmental stress tolerance prepared by the method of claim 10.
13. A transformed seed of a plant in which the environmental stress resistance of claim 12 is controlled.
14. Composition for controlling environmental stress resistance of plants containing a gene encoding IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein derived from sweet potatoes as an active ingredient.

Images