KR20160118936A - IbHPPD gene from sweetpotato controlling environmental stress tolerance of plant and uses thereof - Google Patents

Abstract

The present invention relates to a sweet potato-derived ibHPPD gene for controlling the environmental stress tolerance of a plant body, and to uses thereof. The gene can be efficiently used for developing biofuel crops and a transformed plant body having the tolerance to environmental stress suitable for a region under unfavorable conditions.

Description

IbHPPD genes derived from sweet potatoes that regulate environmental stress tolerance of plants and their uses {IbHPPD gene from sweetpotato controlling environmental stress tolerance of plant and uses thereof}

The present invention relates to a IbHPPD gene derived from a sweet potato regulating environmental stress tolerance of a plant and its use.

Sweet potatoes ( Ipomoea batatas are cultivated in relatively unfavorable lands and cultivated in more than 100 countries around the world and are the world's seventh major crop after wheat, rice, maize, potato, barley and cassava, representing more than 135 million tons per year It is a root crop. Sweet potato leaf and petiole contain ingredients that are not found in normal grains such as vitamin B and C, tocopherol, calcium, and iron, and have a variety of polyphenols. Therefore, they have a high value as a vegetable and a rich carbohydrate in sweet potato storage roots. It becomes an energy source.

Plants respond to a variety of environmental stress conditions, including salt, dryness and pestilence, by modulating gene expression and intracellular metabolites. As the plant is exposed to various environmental stresses, in vivo oxygen is in excess and the reaction with the e-oxide anion radicals ^{_{(O 2 -, Superoxide anion radical}} ), hydrogen peroxide _{(H 2 O 2, Hydrogen peroxide} ), hydroxyl radical (OH, Hydroxyl radical ) And reactive oxygen species (ROS, reactive oxygen species). Oxidative stress caused by ROS is caused by high temperature, low temperature, dryness, high light, ultraviolet rays, and ROS-producing herbicides such as methyl viologen (MV). To cope with such oxidative stress, plants have been developed as powerful antioxidant defense systems such as antioxidant enzymes or low molecular weight antioxidants.

Among them, tocopherol is one of the hydrophobic low molecular weight antioxidants synthesized in chloroplasts. It protects plants from singlet oxygen and protects the photosynthetic and membrane lipids by blocking lipid peroxidation. In addition, tocopherol inhibits lipid peroxidation during germination of seeds, and is resistant to stresses such as excessive metal ions and low temperatures.

Meanwhile, IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) is a protein involved in the pathway of tocopherol biosynthesis. Tyrosine or chorismate, which is formed via the Shikimic acid pathway, is converted to HPP (p-hydroxyphenylpyruvate), which is oxidized by the HPPD enzyme to produce homogentisic acid (HGA , homogentisic acid). It is known that HGA acts as the most important substrate in tocopherol biosynthesis in plants and regulates HPPD gene expression.

Bacterial Staphylococcus aureus ( Pectobacterium) chrysanthemi ) is infected through wounds, and black or brown symptoms appear throughout the stalks, petioles and storage roots of the sweet potatoes, and the whole plant becomes weaker at the end of the branching, and the sweet potato storage root rotates. Is a plant disease that is becoming. However, there are no resistant varieties in sweet potatoes yet and there is no clear control method.

Korean Patent No. 1261277 discloses ' IbLEA14 gene derived from sweet potato root and its use', Korean Patent No. 0930593 discloses 'swDREB1 protein derived from sweet potato root and gene encoding it' As in the present invention, IbHPPD derived from sweet potato controlling environmental stress tolerance of plants The gene and its use have not been disclosed.

The present invention is derived by the request as described above, in the present invention by using the plant with the expression of IbHPPD gene regulation, it was confirmed that IbHPPD gene is involved in environmental stress tolerance of a plant control. In particular, it has been found that the IbHPPD gene is strongly expressed in leaves, especially under environmental stress conditions such as dry and oxidative stress as well as pathogenic infection. Thus, the present invention has been accomplished by confirming that the plant can produce plants and / or seeds whose environmental stress tolerance is regulated using the genes.

In order to solve the above-mentioned problems, the present invention provides a method for producing a protein having an amino acid sequence of SEQ ID NO: 2, which comprises IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein.

The present invention also provides a gene encoding the protein.

The present invention also provides a recombinant vector comprising the gene.

The present invention also provides a host cell transformed with the recombinant vector.

In addition, the present invention provides a method for regulating environmental stress tolerance of a plant comprising transforming a plant cell with the recombinant vector and regulating the expression of the IbHPPD gene.

In addition, the present invention provides a method for producing a transgenic plant having a controlled environmental stress tolerance, which comprises transforming a plant cell with the recombinant vector.

In addition, the present invention provides transgenic plants and seeds thereof which are prepared by the above method and whose environmental stress tolerance is regulated.

The present invention also provides a composition for controlling environmental stress tolerance of a plant containing a gene coding for IbHPPD protein derived from sweet potato as an active ingredient.

The present invention relates to a potato-derived to control the environmental stress tolerance of a plant IbHPPD gene and use thereof, IbHPPD gene of potato origin according to the invention is especially under environmental stress conditions, such as drying, oxidizing and pathogen infection, strong in leaf As a result, it can be useful for the development of transgenic plants and biofuel crops resistant to environmental stress suitable for the conditional disadvantages.

FIG. 1 is a diagram showing the nucleotide sequence of the sweet potato-derived IbHPPD gene according to the present invention and the deduced amino acid sequence thereof.
FIG. 2 is a diagram showing the domain of the deduced protein of the sweet potato-derived IbHPPD gene according to the present invention.
Figure 3 is the amino acid sequence of HPPD and other plants (lettuce, rapeseed, Arabidopsis thaliana, mango and corn) of the deduced protein of potato-derived IbHPPD gene according to the invention And comparing the gene amino acid sequences. IbHPPD is a gene derived from sweet potato; LsHPPD is a gene derived from lettuce; BnHPPD is a gene derived from rapeseed; AtHPPD is a gene derived from Arabidopsis; MiHPPD is a gene derived from mangoes; ZmHPPD is a maize-derived gene.
Figure 4 is a view showing a flexible relationship between the HPPD gene of the amino acid sequence and various plants (lettuce, rapeseed, Arabidopsis thaliana, mango and corn) of the deduced protein of potato-derived IbHPPD gene according to the invention. IbHPPD is a gene derived from sweet potato; LsHPPD is a gene derived from lettuce; BnHPPD is a gene derived from rapeseed; AtHPPD is a gene derived from Arabidopsis; MiHPPD is a gene derived from mangoes; ZmHPPD is a maize-derived gene.
FIG. 5 is a graph showing real-time PCR analysis of expression patterns of sweet potatoes in tissues of the IbHPPD gene according to the present invention. L is a leaf, S is a stem, FR is a fibrous root, TR is a thick pigmented root, and SR is a storage root.
FIG. 6 is a graph showing real-time PCR analysis of expression patterns of IbHPPD gene at 0, 2, 4, 6 and 12 hours after 30% PEG (polyethylene glycol 6000) treatment on sweet potato leaves.
FIG. 7 is a graph showing real-time PCR analysis of the expression pattern of the IbHPPD gene at 0, 2, 4, 6 and 12 hours after treatment with 400 mM of hydrogen peroxide (H ₂ O ₂ ) on sweet potato leaves.
FIG. 8 is a graph showing real-time PCR analysis of expression patterns of IbHPPD gene at 0, 3, 6 and 12 hours after treatment of sweet potato stem rot root rot disease pathogen ( Pectobacterium chrysanthemi ).
FIG. 9 is a graph (B) showing the expression pattern of IbHPPD gene and the content of tocopherol in leaves (A) of a tobacco plant inoculated with the Agrobacterium-mediated IbHPPD gene.
FIG. 10 is a photograph (A) and a graph (B) showing the survival rate of the Arabidopsis transformants (WT) and the Arabidopsis transformants overexpressing the IbHPPD gene treated with oxidative stress.

In order to accomplish the object of the present invention, the present invention provides a method for producing a protein having the amino acid sequence of SEQ ID NO: 2, IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein.

The range of the IbHPPD protein according to the present invention includes a protein having the amino acid sequence shown in SEQ ID NO: 2 isolated from sweet potato and a functional equivalent of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means an activity promoting tolerance of the plant to environmental stress.

The invention also includes fragments, derivatives and analogues of the IbHPPD protein. As used herein, the terms "fragment," " derivative, "and" analogue "refer to polypeptides having substantially the same biological function or activity as the IbHPPD polypeptides of the present invention. The fragments, derivatives, and analogs of the present invention may be used in conjunction with (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted (the substituted amino acid residues are encoded Or (ii) a polypeptide having substituent (s) at one or more amino acid residues, or (iii) another compound (a compound capable of extending the half-life of the polypeptide, such as polyethylene glycol) (Iv) an additional amino acid sequence (e. G., A leader sequence, a secretory sequence, a sequence used to purify the polypeptide, a proteinogen sequence or a fusion protein) and a polypeptide derived from the mature polypeptide Or a polypeptide derived from said polypeptide. Such fragments, derivatives and analogs as defined herein are well known to those skilled in the art.

The present invention also provides a gene encoding the IbHPPD protein. The gene of the present invention may be DNA or RNA encoding the IbHPPD protein. DNA includes cDNA, genomic DNA, or artificial synthetic DNA. The DNA may be single stranded or double stranded. The DNA may be a coding strand or a noncoding strand.

Preferably, the gene of the present invention may include the nucleotide sequence shown in SEQ ID NO: 1.

A polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 encodes only a mature polypeptide; Sequences encoding mature polypeptides and various additional coding sequences; Mature polypeptides (and any additional coding sequences) and sequences coding for noncoding sequences.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide encoding a polypeptide, or a polynucleotide further comprising additional coding and / or noncoding sequences.

The invention also relates to variants of said polynucleotides encoding polypeptides comprising the same amino acid sequences as described herein, or fragments, analogs, and derivatives thereof. Polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. The nucleotide mutant includes a substitution mutant, a deletion mutant, and an insertion mutant. As is known in the art, an allelic variant is an alternative to a polynucleotide, which may comprise one or more substituted, deleted or inserted nucleotides and which does not result in a substantial functional change in the polypeptide encoded by the variant Do not.

The present invention also relates to a polynucleotide which hybridizes with a nucleotide sequence of SEQ ID NO: 1 described above and a nucleotide sequence having at least 50%, preferably at least 70%, more preferably at least 80% identity with the nucleotide sequence of SEQ ID NO: 1 described above Lt; / RTI > nucleotides. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" means (1) hybridization and washing under lower ionic strength and higher temperature such as 0.2 x SSC, 0.1% SDS, 60 ° C; Or (2) in the presence of a denaturant such as 50% (v / v) formamide, 0.1% bovine serum / 0.1% Ficoll and 42 ° C; Or (3) at least 80%, preferably at least 90%, more preferably at least 95%. In addition, the biological function and activity of the polypeptide encoded by the hybridizable polynucleotide is the same as the biological function and activity of the mature polypeptide represented by SEQ ID NO: 2.

According to an embodiment of the present invention, it is to be understood that the IbHPPD gene is preferably derived from sweet potato. However, an embodiment of the present invention may be used with high homology (e.g., 60% or more, i.e., 70%, 80%, 85%, 90%, 95%, or even 98% sequence identity) with the sweet potato IbHPPD gene But also other genes derived from plants. Methods for sequencing, and means for determining sequence identity or homology (e.g., BLAST) are well known in the art.

The present invention also provides a recombinant vector comprising the IbHPPD gene according to the present invention.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the polynucleotide sequence encoding the IbHPPD protein may be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors containing the IbHPPD protein-encoding DNA sequences and appropriate transcription / translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti plasmid vector capable of transferring a so-called T region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti plasmid vectors (see EP 0 116 718 B1) are currently being used to transfer hybrid DNA sequences to plant cells, or to protoplasts in which new plants capable of properly inserting hybrid DNA into the genome of a plant can be produced . A particularly preferred form of the Ti plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly. Preferably, the recombinant vector may be a pKBS11 vector, a pBI101 vector, and a pCAMBIA vector, but is not limited thereto.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant genes, but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens, And the terminator of the Octopine gene of the present invention, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The present invention also provides a host cell transformed with the recombinant vector of the present invention. Any host cell known in the art may be used as the host cell capable of continuously cloning and expressing the vector of the present invention in a stable and prokaryotic cell, for example, E. coli JM109, E. coli BL21, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus tulifene, and Salmonella typhimurium, Serratia marcesensus and various Pseudomonas species And enterobacteria and strains such as the species.

When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (for example, CHO cell line (Chinese hamster ovary), W138, BHK, COS7, 293, HepG2 , 3T3, RIN and MDCK cell lines) and plant cells. The host cell is preferably a plant cell.

The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl ₂ method, Hanahan, D., J. MoI. Biol., 166: 557580 (1983) A perforation method or the like. When the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE dextran treatment, gene bombardment or the like .

The present invention also provides a method for regulating environmental stress tolerance of a plant comprising transforming a plant cell with a recombinant vector comprising a gene encoding a IbHPPD protein derived from a sweet potato to regulate the expression of the IbHPPD gene.

The range of the IbHPPD protein according to the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein.

The "gene expression control" of the present invention refers to increasing or decreasing the expression of the IbHPPD gene in a plant.

In a method according to an embodiment of the present invention, a plant cell is transformed with a recombinant vector comprising the gene of SEQ ID NO: 1 by overexpressing the IbHPPD gene, thereby controlling the environmental stress tolerance of the plant , But is not limited thereto.

In a method according to an embodiment of the present invention, the environmental stress may be dry, oxidative or pathogenic infection stress, preferably pathogenic infection stress, most preferably Pectobacetrium chrysanthemi , Infectious stress, but is not limited thereto.

By "gene overexpression" is meant that the gene is expressed at a level that is expressed in a wild-type plant. As a method of introducing the gene into a plant, there is a method of transforming a plant using an expression vector containing the gene under the control of a promoter.

"Plant cell" used for transformation of a plant may be any plant cell. Plant cells are cultured cells, cultured tissues, cultivated or whole plants. "Plant tissue" refers to a tissue of differentiated or undifferentiated plant, including but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, protoplasts, shoots and callus tissue. The plant tissue may be in planta or may be in an organ culture, tissue culture or cell culture.

The present invention also provides a method for producing a plant, comprising transforming a plant cell with a recombinant vector comprising a gene encoding a IbHPPD protein derived from a sweet potato; And

And regenerating the plant from the transformed plant cell. The present invention also provides a method for producing a transgenic plant having regulated environmental stress tolerance.

In the method according to one embodiment of the present invention, the IbHPPD protein may be composed of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

In the production method according to one embodiment of the present invention, the gene encoding the IbHPPD protein may be the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In a method according to an embodiment of the present invention, a plant cell is transformed with a recombinant vector containing a gene encoding the IbHPPD protein by overexpressing the IbHPPD gene in a method capable of controlling environmental stress tolerance of the plant, But it is not limited thereto.

In a method according to an embodiment of the present invention, the environmental stress may be dry, oxidative or pathogenic infection stress, preferably pathogenic infection stress, most preferably Pectobacetrium chrysanthemi , Infectious stress, but is not limited thereto.

The method of the present invention comprises transforming a plant cell with a recombinant vector according to the invention, said transformation being mediated, for example, by Agrobacterium tumefaciens. In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

Transformed plant cells must be regenerated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species.

In addition, the present invention provides transgenic plants and seeds thereof which are prepared by the above method and whose environmental stress tolerance is regulated. Preferably, the plant may be a monocot plant or a twin plant but is not limited thereto.

The monocotyledonous plants may be selected from the group consisting of Alismataceae, Hydrocharitaceae, Juncaginaceae, Scheuchzeriaceae, Potamogetonaceae, Najadaceae, Zosteraceae, Liliaceae And the dicotyledonous plants can be classified into two groups according to the genus of the genus Chlamydia (Diapensiaceae), Clethraceae, Convolvulaceae, Pyrolaceae, Solanaceae, Ericaceae, Cruciferae , Rosaceae, Myrsinaceae, Primulaceae, Plumbaginaceae, and the like. Preferably, the plant may be a plant belonging to the group consisting of crucifers, branches, rosacea and mycelium, and most preferably a sweet potato plant, but is not limited thereto.

The present invention also provides a composition for controlling environmental stress tolerance of a plant containing a gene encoding an IbHPPD protein as an active ingredient.

The composition for controlling environmental stress tolerance of a plant of the present invention comprises a gene encoding the IbHPPD protein of the present invention as an active ingredient or a recombinant vector containing the gene, and transforming the gene or a recombinant vector containing the gene into a plant, Stress tolerance can be controlled. Preferably, the IbHPPD The gene may be overexpressed to increase the environmental stress tolerance of the plant, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Example  1: sweet potato IbHPPD  Gene Cloning , Nucleotide sequence analysis and flexible relationship analysis

Sweet potatoes ( Ipomoea batatas (L.) Lam. cv. Yulmi) were grown in soil at 25 ± 3 ℃ for 3 months under long-day conditions (16 h and 8 h cancer treatment). The RNA of the leaf tissues was isolated by TRIzol method (Invitrogen) treated with RNase-free DNase. The RNA was synthesized using cDNA synthesis kit of M-MLV reverse transcription system (Clontech). Primers were designed based on known gene sequence (GeneBank accession no. KP306528). Sequence information for the HPPD gene was obtained from a transcript library constructed by RNA-seq analysis of sweet potato leaves and storage roots in the laboratory.

The total length of the IbHPPD cDNA gene was 1,323 bp, which was shown to consist of the coding region (consisting of 440 amino acids) (Fig. 1). In addition, the protein domain was examined using the SMART program (http://smart.embl-heidelberg.de/), and it was confirmed that the IbHPPD protein had the SCOP and the glyoxalase domain 2). Sweet potatoes ( Ipomoea When the coding region of batatas IbHPPD was blasted, it showed 74% homology with the LsHPPD of lettuce ( Lactuca sativa ) at the amino acid level and Arabidopsis and 73% homology with AtHPPD of P. thaliana (Fig. 3). The relationship between the amino acid sequence of the predicted protein of IbHPPD in sweet potato and the HPPD of various plant species was investigated using the ClustalW program (http://plant.pdrc.re.kr/gene/align/ClustalW.html) It was confirmed that the sweet potato IbHPPD was an HPPD family of proteins (FIGS. 3 and 4).

Example  2: by sweet potato organization IbHPPD  Gene expression analysis

Real-time PCR was performed to analyze the expression pattern of IbHPPD gene derived from sweet potato according to the present invention. Total RNA was extracted from sweet potato tissues (leaves, stems, roots, roots, and storage roots) by the TRIzol method (Invitrogen), and cDNA was synthesized with MMLV reverse transcription system cDNA synthesis kit (Clontech) using 2 RNA of RNA . IbHPPD using gene-specific primers and Taq Accel Premix Kit (Genedocs four) IbHPPD The expression pattern of the gene was examined. The primers specific for IbHPPD were those listed in Table 1. As a result, as shown in Fig. 5, the IbHPPD gene was most strongly expressed on the leaf and very weakly expressed on the stem. In the root system, the storage root was relatively stronger than the fibrous root and the thick pigmented root. Therefore, IbHPPD isolated from sweet potato storage roots The genes were mainly expressed in leaves in normal growth conditions.

The primers used in the present invention Name of the primer The forward direction (5'-3 ') The reverse direction (5'-3 ') IbHPPD SEQ ID NO: Primer sequence SEQ ID NO: Primer sequence 3 ATGAGGAAGAGGAGCGGAAT 4 CCAACAGGCTTGGTGAAGAT

Example  3: By various stress treatment including drying treatment IbHPPD  Characterization of gene expression

IbHPPD (30% PEG, polyethylene glycol), oxidized (400 mM hydrogen peroxide, H ₂ O ₂ ), and pathogens ( Pectobacterium spp. ) In order to analyze the extent to which genes respond to various stress treatments including drying. chrysanthemi ) and the expression of IbHPPD gene was analyzed by Realtime PCR.

First, IbHPPD In order to analyze the degree of reactivity of the gene with PEG treatment, the leaf tissues of sweet potato were dried at time intervals (0, 2, 4, 6 and 12 hours) After separation, cDNAs were synthesized, respectively. The IbHPPD used in Example 2 Real-time PCR was performed as a specific primer of the gene. As a result, the IbHPPD gene showed the strongest expression level in the leaf tissues after 4 hours of the dry treatment (Fig. 6), compared with the negative control (control) without any treatment.

Next, in order to examine the reactivity to oxidative stress induced by the hydrogen peroxide (H ₂ O ₂ ) treatment, 400 mM hydrogen peroxide was treated with time (0, 2, 4, 6 and 12 hours) RNA was extracted, cDNA was synthesized and real time PCR was performed. As a result, the expression began to increase from 4 hours after the hydrogen peroxide treatment compared to the negative control (control) without any treatment, and showed the highest expression level after 12 hours of treatment (Fig. 7).

Next, IbHPPD Gene is a pathogen of bacterial stem rot root of sweet potato ( Pectobacterium chrysanthemi ), the pathogen was treated with time (0, 3, 6 and 12 hours) and analyzed for gene expression pattern. Pathogen inoculation and culturing pathogens on leaves approximately 1x10 ⁵ in-fill site migration buffer of 10mM MgCl ₂ cfu / ml. < / RTI > As a mock, leaves treated with 10 mM MgCl ₂ were used. RNA was extracted by the same method as described above, cDNA was synthesized, and real-time PCR was performed. As a result, after 6 hours of pathogen treatment, IbHPPD And the expression level of the gene was rapidly increased.

These results show that the IbHPPD gene is responsive to various stresses. Therefore, the IbHPPD gene is thought to be helpful in the development of environmental tolerant plants (including sweet potatoes) which are good for growth in dry, oxidative stress and pathogenic infections.

Example  4: Sweet potato-derived IbHPPD In the leaves of tobacco plants due to transient overexpression of the gene, alpha-tocopherol (? tocopherol ) Content analysis

The content of alpha-tocopherol was analyzed through transient overexpression of the Agrobacterium-mediated IbHPPD gene. Agrobacterium was inoculated on leaves of a 3 week old tobacco plant. After 3 days, the expression of IbHPPD gene was confirmed by real-time PCR analysis and alpha-tocopherol content was measured by HPLC analysis 9A). As a result, IbHPPD The expression of IbHPPD gene was significantly increased and the alpha-tocopherol content was increased up to 81% as compared with the empty vector (Fig. 9B) in the leaves of the tobacco plants inoculated with the gene. Therefore, it was confirmed that the IbHPPD gene is involved in the pathway of tocopherol biosynthesis and plays a role in increasing the content of tocopherol, a low - molecular antioxidant.

Example  5: Sweet potato-derived IbHPPD  Resistance to oxidative stress in transgenic Arabidopsis plants overexpressing genes

In order to confirm resistance to oxidative stress in the IbHPPD overexpressed transgenic plants, Arabidopsis non-transformants and transformants were cultured for 3 days in MS medium containing 10 μM methylviologen (MV, methyl viologene) After the incubation, the survival rate was confirmed. As a result, as shown in Fig. 10, the survival rate of non-transformants treated with methylviologen was 58.3%, while the survival rate of IbHPPD- overexpressing transformants was 95.8%, which was strong against oxidative stress due to methylviologen treatment And showed resistance.

<110> Korea Research Institute of Bioscience and Biotechnology <120> IbHPPD gene from sweetpotato controlling environmental stress          resistance of plant and uses thereof <130> PN16076 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 1323 <212> DNA <213> Ipomoea batatas <400> 1 atgggcaaag agacttcctc ctccggcaac caccactcca cggcggagaa cggcggcttc 60 aagctggtag gtttcaagga tttcgttcgt gttaatccca aatccgacca cttcgccgtg 120 aaacgcttcc accacgtgga gttctggtgc ggcgacgcta ctaacactgc tcgccgcttc 180 tcctgggcgc tgggaatgcc cattgccgcg aaatccgatc tttccaccgg aaactccgct 240 cacgcgtcgt atctcctacg cgcttgcggc ggcgagcttc agttcctctt cacagctccc 300 tatgcgtcct ccatttgtaa ttccgcctcc gctgctatcc cctccttctc cgccgacgcc 360 caccgcgcct tcgctgccac acacgggctc gccgtccgcg cggtcgcgct ggtagttgag 420 gacacgcggg ccgcgttctc cgccagcgtc tcccgcggcg cgaaacccgt gtcggagccc 480 gttacactca acaaccaagt cgtactcgcc gaagttcacc tctacggcga cgtcgtgctc 540 cgattcgtta gctatctctc cgccgcctcc gccgtcacat tcctaccggg cttcgaagcc 600 atggacggaa ccgcatcctt ccaagacctc gattacggaa tccgccgcct cgaccacgcc 660 gtcggaaacg tccacgagct cgcccccgcc gtcgattacc taaaatcctt caccggcttc 720 ccgagttcg ccgaattcac cgcagaagac gtcggcaccg ccgagagcgg cctgaactca 780 gtggtgctgg ctaacaacga cgagacggtt cttctcccct tgaacgaacc ggtttacggg 840 acgaaaagga agagccaaat tcagacctat ctggagcaca acgaaggacc aggactccag 900 catttagctc ttacaagcga agatatcttc agaacactgc gagaaatgag gaagaggagc 960 ggaatcggag gtttcgagtt catgccgtcg ccgccgccga cgtactacaa gaatttaaag 1020 agcagagccg gcgatgttct gaacgatgaa caaattaagg agtgtgaaga attggggatt 1080 ttagtggata gagatgacca gggaactctg cttcaaatct tcaccaagcc tgttggagac 1140 aggccgacaa tgtttataga aataatccag agagtcgggt gcatgatgaa gaaggaagat 1200 ggacagctct atcagaaggg cgggtgtggc ggttttggca agggcaactt ctccgaactt 1260 ttcaaatcta tcgaggaata tgagaagatg cttgaagcta aacaagctac tcgtgcagcg 1320 tga 1323 <210> 2 <211> 440 <212> PRT <213> Ipomoea batatas <400> 2 Met Gly Lys Glu Thr Ser Ser Gly Asn His His Ser Thr Ala Glu   1 5 10 15 Asn Gly Gly Phe Lys Leu Val Gly Phe Lys Asp Phe Val Arg Val Asn              20 25 30 Pro Lys Ser Asp His Phe Ala Val Lys Arg Phe His His Val Glu Phe          35 40 45 Trp Cys Gly Asp Ala Thr Asn Thr Ala Arg Arg Phe Ser Trp Ala Leu      50 55 60 Gly Met Pro Ile Ala Ala Lys Ser Asp Leu Ser Thr Gly Asn Ser Ala  65 70 75 80 His Ala Ser Tyr Leu Leu Arg Ala Cys Gly Gly Glu Leu Gln Phe Leu                  85 90 95 Phe Thr Ala Pro Tyr Ala Ser Ser Ile Cys Asn Ser Ala Ser Ala Ala             100 105 110 Ile Pro Ser Phe Ser Ala Asp Ala His Arg Ala Phe Ala Ala Thr His         115 120 125 Gly Leu Ala Val Arg Ala Val Ala Leu Val Val Glu Asp Thr Arg Ala     130 135 140 Ala Phe Ser Ala Ser Val Ser Arg Gly Ala Lys Pro Val Ser Glu Pro 145 150 155 160 Val Thr Leu Asn Asn Gln Val Val Leu Ala Glu Val His Leu Tyr Gly                 165 170 175 Asp Val Val Leu Arg Phe Val Ser Tyr Leu Ser Ala Ala Ser Ala Val             180 185 190 Thr Phe Leu Pro Gly Phe Glu Ala Met Asp Gly Thr Ala Ser Phe Gln         195 200 205 Asp Leu Asp Tyr Gly Ile Arg Arg Leu Asp His Ala Val Gly Asn Val     210 215 220 His Glu Leu Ala Pro Ala Val Asp Tyr Leu Lys Ser Phe Thr Gly Phe 225 230 235 240 His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly Thr Ala Glu Ser                 245 250 255 Gly Leu Asn Ser Val Val Leu Ala Asn Asn Asp Glu Thr Val Leu Leu             260 265 270 Pro Leu Asn Glu Pro Val Tyr Gly Thr Lys Arg Lys Ser Gln Ile Gln         275 280 285 Thr Tyr Leu Glu His Asn Glu Gly Pro Gly Leu Gln His Leu Ala Leu     290 295 300 Thr Ser Glu Asp Ile Phe Arg Thr Leu Arg Glu Met Arg Lys Arg Ser 305 310 315 320 Gly Ile Gly Gly Phe Glu Phe Met Pro Ser Pro Pro Thr Tyr Tyr                 325 330 335 Lys Asn Leu Lys Ser Arg Ala Gly Asp Val Leu Asn Asp Glu Gln Ile             340 345 350 Lys Glu Cys Glu Glu Leu Gly Ile Leu Val Asp Arg Asp Asp Gln Gly         355 360 365 Thr Leu Gln Ile Phe Thr Lys Pro Val Gly Asp Arg Pro Thr Met     370 375 380 Phe Ile Glu Ile Ile Gln Arg Val Gly Cys Met Met Lys Lys Glu Asp 385 390 395 400 Gly Gln Leu Tyr Gln Lys Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn                 405 410 415 Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu Lys Met Leu Glu             420 425 430 Ala Lys Gln Ala Thr Arg Ala Ala         435 440 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 atgaggaaga ggagcggaat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 ccaacaggct tggtgaagat 20

Claims (14)

Comprising IbHPPD ( Ipomoea batatas &lt; RTI ID = 0.0 &gt; 4-hydroxyphenylpyruvate dioxygenase) protein. A gene encoding the protein of claim 1. A recombinant vector comprising the gene of claim 2. A host cell transformed with the recombinant vector of claim 3. The sweet potato-derived IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase (hereinafter referred to as &quot; 4-hydroxyphenylpyruvate dioxygenase &quot;) protein, and regulating the expression of the IbHPPD gene by transforming the plant cell with a recombinant vector. 6. The method according to claim 5, wherein the IbHPPD protein comprises the amino acid sequence of SEQ ID NO: 2. The method according to claim 5, wherein the IbHPPD gene is over-expressed to increase the environmental stress tolerance of the plant. 6. The method of claim 5, wherein the environmental stress is dry, oxidative or pathogenic infection stress. 9. The method of claim 8, wherein said pathogen is selected from the group consisting of Pectobacetrium chrysanthemi ). &lt; / RTI &gt; The sweet potato-derived IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase (hereinafter referred to as &quot; 4-hydroxyphenylpyruvate dioxygenase &quot;)protein; And
And regenerating the plant from the transformed plant cell. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt; [Claim 11] The method according to claim 10, wherein the IbHPPD gene is overexpressed to increase the environmental stress tolerance of the plant. 11. A transgenic plant having an environmental stress tolerance regulated by the method of claims 10 or 11. The transformed seed of a plant according to claim 12, wherein the environmental stress tolerance is controlled. The sweet potato-derived IbHPPD ( Ipomoea batatas 4-hydroxyphenylpyruvate dioxygenase) protein as an active ingredient.

Images