WO2020085559A1 - 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도 - Google Patents

콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도 Download PDF

Info

Publication number
WO2020085559A1
WO2020085559A1 PCT/KR2018/013313 KR2018013313W WO2020085559A1 WO 2020085559 A1 WO2020085559 A1 WO 2020085559A1 KR 2018013313 W KR2018013313 W KR 2018013313W WO 2020085559 A1 WO2020085559 A1 WO 2020085559A1
Authority
WO
WIPO (PCT)
Prior art keywords
soybean
plant
gene
protein
mosaic virus
Prior art date
Application number
PCT/KR2018/013313
Other languages
English (en)
French (fr)
Inventor
김국형
위드야사리크리스틴
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2020085559A1 publication Critical patent/WO2020085559A1/ko
Priority to US17/218,398 priority Critical patent/US11566261B2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
    • A01H6/542—Glycine max [soybean]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03002—Acid phosphatase (3.1.3.2)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to a GmPAP2.1 gene derived from soybean that modulates disease resistance to soybean mosaic virus and its use.
  • Glycine max is a perennial dicotyledonous plant belonging to the Rosales legumes, known as the country of origin in the northeastern region of Asia, including the Korean Peninsula, and 550 genus 13,000 species are known worldwide, 36 genus 92 in Korea The species is native. Soybeans have been used as a source of protein and fat, and are now in the spotlight as industrial materials.
  • Soybean mosaic virus is a virus belonging to the genus Potyviridae (Potyviridae), which is reportedly transmitted through aphids and up to 43% of seed transmission from soybeans.
  • the virus leads to a decrease in the number of pods directly related to the production of soybeans, a decrease in the number of seeds per pod, a decrease in the size and weight of the seeds, and staining of the bean shell.
  • gene-mediated resistance is one of the defense mechanisms that prevent or reduce viral infection, and plant-resistant genes are classified as recessive and dominant.
  • Recessive resistance genes provide passive resistance that viral proliferation is poorly expressed by incompatible interactions between the virus and the host element, while dominant resistance genes ( R gene) are pathogen effectors or avirulence.
  • R gene dominant resistance genes
  • Avr encoding a resistance protein (R protein) that recognizes the element to provide active resistance.
  • the R gene usually encodes proteins with nucleotide-binding sites (NBS) and leucine-rich repeat (LRR) sites.
  • the NBS domain is composed of functional nucleotide-binding pockets capable of binding and hydrolyzing Adenosine Tri-Phosphate (ATP) and having a signaling resistance response.
  • ATP Adenosine Tri-Phosphate
  • the LRR domain consists of individual iterations of a common leucine-rich repeat motif and has been demonstrated to be related to Avr recognition.
  • This NBS-LRR protein is divided into two groups: the TIR-NBS-LRR protein contains an N-terminal domain with Toll / interleukin-1 receptor homology, and the CC-NBS-LRR protein is N-terminal coiled It features a coiled-coil motif.
  • Rsv3 was identified between the molecular markers A519F / R and M3Satt of the 14th chromosome of the soybean variety L29, and the 5 candidate genes ( Glyma.14g204500, Glyma.14g204600) containing the NBS-LRR domain in the 154 kbp region between the two markers , Glyma.14g204700, Glyma.14g205000 and Glyma.14g205300 ), in particular, it is known that Glyma.14g204700 is closely related to Rsv3 resistance.
  • Rsv4 was identified between the molecular markers Rat2 and S6a of the chromosome 2 of the soybean variety VP-5152, and the NBS-LRR type R gene was not identified, indicating that Rsv4 belongs to a novel class of resistance gene. it means.
  • Korean Patent Registration No. 1552140 discloses a soybean transgenic plant having improved resistance to soybean mosaic virus and a method for manufacturing the same through gene silencing of the HC-Pro gene
  • Korean Patent No. 0857043 Although 'Special Primer for Diagnosing Soybean Mosaic Virus' is disclosed in the issue, the GmPAP2.1 gene derived from soybean that modulates disease resistance to the soybean mosaic virus of the present invention and its use are not described.
  • the present invention was derived by the above-described needs, and the present inventors have the expression of the GmPAP2.1 ( Glycine max purple acid phosphatase 2.1) gene located on chromosome 6 of the soybean variety L29 soybean mosaic virus (SMV) After increasing the infection, it was confirmed that the plant was transformed with a recombinant vector encoding the full-length, N-terminal deletion variant, or C-terminal deletion variant of the GmPAP2.1 protein, and the disease resistance to SMV was analyzed. Transgenic plants expressing the full-length and C-terminal deletion variants of the GmPAP2.1 protein showed high resistance to SMV, while transgenic plants expressing the N-terminal deletion variants of GmPAP2.1 showed reduced resistance to SMV. It was confirmed that the GmPAP2.1 protein confers resistance to soybean plants against SMV, and in particular, by confirming that the N-terminus is an important domain associated with disease resistance to SMV, The present invention has been completed.
  • GmPAP2.1 Glycine max purple acid
  • the present invention transforms plant cells with a recombinant vector containing a gene encoding GmPAP2.1 ( Glycine max purple acid phosphatase 2.1) derived from soybean ( Glycine max ) to encode GmPAP2.1 protein. It provides a method for increasing the disease resistance of the soybean mosaic virus (soybean mosaic virus) of plants compared to non-transformants comprising the step of overexpressing the gene.
  • the present invention comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a GmPAP2.1 protein derived from soybeans; And it provides a method for producing a transgenic plant with increased disease resistance to the soybean mosaic virus of the plant compared to the non-transformant comprising the step of re-differentiating plants from the transformed plant cells.
  • the present invention provides a transgenic plant with increased disease resistance to soybean mosaic virus prepared by the above method and a transformed seed thereof.
  • the present invention provides a composition for increasing disease resistance of soybean mosaic virus of a plant comprising a gene encoding a GmPAP2.1 protein derived from soybean consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient.
  • soybean-derived GmPAP2.1 gene of the present invention can modulate disease resistance to the soybean mosaic virus, it is expected that it can be applied to increase the productivity of soybeans by developing new varieties with increased resistance to the soybean mosaic virus.
  • Figure 2 is a soybean mosaic virus (soybean mosaic virus, SMV) in G5H or G7H infected soybean plants Gm06g03101 ( GmPAP2.1 ) It is the result of analyzing the expression level of the gene (A), the target protein through sequencing of the Gm06g03101 gene (B), and the position of the Gm06g03101 gene through the chromosome analysis of the soybean variety L29 (C). hpi; Hour post infection.
  • SMV soybean mosaic virus
  • 3 is a phylogenetic analysis of the putative domain of the Gm06g03101 gene.
  • FIG. 4 shows pG5H : GFP, pG7H: GFP, pG5H: GFP- GmPAP2.1 or pG7H: GFP- GmPAP2.1 inoculated into soybean grassy leaves, respectively, to analyze the disease resistance effect of the GmPAP2.1 gene on SMV It is a result of confirming the expression level of GFP by ultraviolet (UV) (A) and a graph (B) showing the expression level of viral RNA.
  • UV ultraviolet
  • pG5H GFP
  • pG5H GFP- GmPAP2.1 (full length)
  • pG5H GFP-GmPAP2.1_N (C-terminal deletion: ⁇ 69-153aa to analyze the disease resistance effect on SMV for each domain of GmPAP2.1 )
  • pG5H GFP-GmPAP2.1_C (N-terminal deletion: ⁇ 1-68aa) was inoculated into the first leaves of soybean respectively, and the expression level of GFP was confirmed by ultraviolet (UV) (A) and the expression level of viral RNA was measured. It is the graph (B) shown.
  • UV ultraviolet
  • the present invention transforms plant cells with a recombinant vector containing a gene encoding a GmPAP2.1 ( Glycine max purple acid phosphatase 2.1) protein derived from soybean ( Glycine max ) to transform the GmPAP2.1 protein. It provides a method for increasing the disease resistance of the soybean mosaic virus (soybean mosaic virus, SMV) of plants compared to non-transformants comprising the step of overexpressing the gene encoding the.
  • SMV soybean mosaic virus
  • the soybean-derived GmPAP2.1 protein may be an N-terminus of the GmPAP2.1 protein or a GmPAP2.1 protein comprising the N-terminus, and preferably may consist of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3, , But is not limited to this.
  • SEQ ID NO: 2 means the entire amino acid sequence of the GmPAP2.1 protein
  • SEQ ID NO: 3 means the amino acid sequence of the N-terminal region of the GmPAP2.1 protein.
  • SEQ ID NO: 3 is an amino acid sequence comprising the 1st to 68th amino acids in the amino acid sequence of SEQ ID NO: 2.
  • GmPAP2.1 protein includes proteins having an amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 and functional equivalents of the proteins.
  • the term "functional equivalent” as a result of addition, substitution or deletion of an amino acid the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 at least 70% or more, preferably 80% or more, more preferably
  • the protein has a sequence homology of 90% or more, and more preferably 95% or more, and refers to a protein having substantially the same physiological activity as the protein represented by SEQ ID NO: 2 or SEQ ID NO: 3.
  • “Substantially homogeneous physiological activity” means an activity that increases disease resistance to SMV.
  • the present invention also includes fragments, derivatives and analogs of the GmPAP2.1 protein.
  • fragment refers to a polypeptide having substantially the same biological function or activity as the GmPAP2.1 polypeptide of the present invention.
  • Fragments, derivatives and analogs of the present invention include (i) a polypeptide in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted (the substituted amino acid residues are encoded by a genetic code) May or may not be) or (ii) a polypeptide having substituent (s) at one or more amino acid residues, or (iii) another compound (a compound capable of extending the half-life of the polypeptide, such as polyethylene glycol) and A polypeptide derived from a bound mature polypeptide, or (iv) an additional amino acid sequence (e.g., leader sequence, secretion sequence, sequence used to purify the polypeptide, proteinogen sequence or fusion protein) and It may be a polypeptide derived from the bound polypeptid
  • the gene encoding the GmPAP2.1 protein is characterized by regulating disease resistance to SMV, and the range of the gene includes all genomic DNA, cDNA and synthetic DNA encoding the GmPAP2.1 protein.
  • the gene encoding the GmPAP2.1 protein of the present invention may consist of the nucleotide sequence of SEQ ID NO: 1.
  • homologs of the nucleotide sequence are included within the scope of the present invention.
  • the gene includes a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, more preferably 90% or more, and most preferably 95% or more, respectively, to the nucleotide sequence of SEQ ID NO: 1 can do.
  • % Of sequence homology to a polynucleotide is identified by comparing two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (not including additions or deletions) to the optimal alignment of the two sequences. Comparison), or additions or deletions (ie, gaps).
  • the term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid.
  • Recombinant cells can express genes or gene segments not found in the natural form of the cells, either in sense or antisense form. Recombinant cells can also express genes found in natural cells, but these genes have been modified and reintroduced into cells by artificial means.
  • vector is used to refer to DNA fragment (s), nucleic acid molecules that are delivered into a cell. Vectors replicate DNA and can be independently reproduced in host cells.
  • carrier is often used interchangeably with “vector”.
  • Vectors of the invention can typically be constructed as vectors for expression or cloning.
  • the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts.
  • a strong promoter for example, pL ⁇ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.
  • a ribosome binding site for initiation of translation and a transcription / detox termination sequence for example, Escherichia coli is used as a host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway, and the leftward promoter of phage ⁇ (pL ⁇ promoter) can be used as a regulatory site.
  • the promoters are suitable for transformation, and may be a CaMV 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, or a histone promoter, preferably a CaMV 35S promoter. However, it is not limited thereto.
  • promoter refers to the region of the DNA upstream from the structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.
  • Plant promoter is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental status or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be made by various tissues at various stages. Thus, the constitutive promoter does not limit the possibility of selection.
  • the recombinant vector of the present invention can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology.
  • the DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis.
  • the vector may include a ribosome binding site and a transcription terminator as a translation start site.
  • a preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring part of itself, the so-called T-region, into plant cells when present in a suitable host such as Agrobacterium tumefaciens .
  • Other types of Ti-plasmid vectors are currently used to transfer hybrid DNA sequences into plant cells, or protoplasts, into which new plants can be produced that properly insert hybrid DNA into the genome of the plant. have.
  • a particularly preferred form of Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.
  • viral vectors such as those that can be derived from double-stranded plant viruses (eg, CaMV) and single-stranded viruses, gemini viruses, etc.
  • CaMV double-stranded plant viruses
  • gemini viruses single-stranded viruses
  • it can be selected from incomplete plant viral vectors.
  • the use of such vectors can be advantageous, particularly when it is difficult to properly transform plant hosts.
  • the recombinant expression vector may preferably contain one or more selectable markers.
  • the marker is a nucleic acid sequence having a property that can be selected by a chemical method, and all genes capable of distinguishing transformed cells from non-transformed cells are included.
  • the marker gene may be an antibiotic resistance gene, but is not limited thereto.
  • a conventional terminator may be used, for example, nopaline synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ) Of the Octopine gene, but is not limited thereto.
  • NOS nopaline synthase
  • rice ⁇ -amylase RAmy1 A terminator phaseoline terminator
  • Agrobacterium tumefaciens Of the Octopine gene, but is not limited thereto.
  • terminators it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.
  • yeast Saccharomyce cerevisiae
  • insect cells eg, human cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2) , 3T3, RIN and MDCK cell lines) and plant cells.
  • human cells eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2) , 3T3, RIN and MDCK cell lines
  • the host cell is preferably a plant cell.
  • the method for transporting the vector of the present invention into a host cell includes, when the host cell is a prokaryotic cell, a CaCl 2 method, one method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) and electroporation. It can be carried out by a method or the like.
  • the vector is injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene balm treatment. You can.
  • the present invention also comprises the steps of transforming plant cells with a recombinant vector comprising a gene encoding a GmPAP2.1 protein derived from soybeans; And it provides a method for producing a transgenic plant with increased disease resistance to the soybean mosaic virus of the plant compared to the non-transformant comprising the step of re-differentiating plants from the transformed plant cells.
  • the range of the GmPAP2.1 protein is as described above.
  • Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species including both dicotyledonous plants as well as monocotyledonous plants.
  • any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection to plant elements, particle impact methods (DNA or RNA-coated) of various plant elements, infiltration of plants or traits of mature pollen or vesicles Agrobacterium tumefaciens-mediated gene transfer by conversion may be suitably selected from infection with (incomplete) virus and the like.
  • a preferred method according to the invention comprises Agrobacterium mediated DNA delivery.
  • the method for re-differentiating a transformed plant from the transformed plant cell may use any method known in the art.
  • the transformed plant cells must be re-differentiated into whole plants. Techniques for re-differentiation of mature plants from callus or protoplast cultures are well known in the art for numerous different species.
  • the present invention also provides a transgenic plant with increased disease resistance to soybean mosaic virus prepared by the above method and a transformed seed thereof.
  • the plants used in the present invention may be plants belonging to the family Familiar (Family Fabacea), for example, soybean, mung bean, kidney bean, pea, peanut, lentil, eastern, red bean, etc. If the host plant of the soybean mosaic virus, but is not limited thereto.
  • Familiar Familiar
  • the host plant of the soybean mosaic virus but is not limited thereto.
  • the present invention also provides a composition for increasing disease resistance of soybean mosaic virus of a plant comprising a gene encoding a GmPAP2.1 protein derived from soybean consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient.
  • the composition comprises a gene encoding the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient or a recombinant vector containing the gene, and the gene is transformed into a soybean plant, thereby cultivating the soybean mosaic virus of the soybean plant. It can increase the resistance.
  • Soybean (soybean) varieties L29 (Rsv3) and Somyungkong were pre-sale at the Cultivation Environment Division of the Central Crop Department of the National Institute of Food Science and Technology, and cultured in a growth chamber set at 25 ° C and 16 hours / 8 hours.
  • the L29 variety was used as a target plant for total RNA extraction for cDNA synthesis, and Sombean was used as a target plant for transformation.
  • the seedling of the bean to be inoculated with the viral vector was selected to have the first leaves fully expanded.
  • a coding region (714 bp) of a green fluorescent protein (GFP) without a start codon and a stop codon was amplified.
  • Primer information used in the PCR is shown in Table 1 below, and PCR was performed using Ex Taq polymerase (TaKaRa, Japan) for 35 cycles.
  • PCR amplification products were digested with Mlu I and Xba I restriction enzymes, and then linked to multiple cloning sites (MCS) of viral expression vectors based on SMV-G5H (pG5H) and SMV-G7H (pG7H), and finally produced Was designated G5H: GFP.
  • MCS multiple cloning sites
  • Primer information Primer name Base sequence (5 ' ⁇ 3') (SEQ ID NO) GFP_F 5'-GC TCTAGA GTGAGCAAGGGCGAGGAGCTG-3 '(4) (Italics: restriction enzyme Xba I site) GFP_R 5'-GC ACGCGT GACTGTAAAGATACGGACTC CTTGTACAGCTCGTCCATGCCG-3 '(5) (Italic: restriction enzyme Mlu I site, underline: coding region of NIa protease recognition site)
  • the GmPAP2.1 coding region without termination codon was amplified from cDNA of soybean variety L29.
  • the amplification product was digested with restriction enzyme Mlu I and cloned into pG5H :: GFP, and the final product was named pG5H :: GFP-GmPAP2.1.
  • a mutant clone (pG5H: GFP-GmPAP2.1_N (C-terminal deletion: ⁇ 69-153aa) and pG5H: GFP-GmPAP2.1_C (N-terminal deletion: ⁇ 1-68aa)) was prepared in the same manner as described above. Did.
  • each mutant portion was amplified from plasmid DNA of pG5H :: GFP-GmPAP2.1. Primer information used in the construction of mutant clones is shown in Table 2 below. Insertion of the target gene or fragment of the target gene in the viral vector was confirmed by colony PCR and sequencing.
  • Plasmid DNA was prepared using the Plasmid Maxi kit (QIAGEN, USA), a total of 20 mixed with 10 ⁇ g of plasmid DNA clone and 20X potassium phosphate buffer pH 7.5 (final concentration 1X) in each herbaceous Lub was inoculated with mixed solution.
  • RNA per each leaf was extracted through RNAiSO plus reagent method (TaKaRa), and cDNA was synthesized using GoScript reverse transcriptase (Promega Corp., USA) and oligo (dT) primer (15 mer, Bioneer).
  • Viral RNA replication was performed by amplifying a portion of the coat proteins (CPs) of SMV-G5H. Short fragments of the soybean-derived CDPK (Calcium dependent protein kinase) gene were used as an internal control to standardize other samples, and the information of the SMV-G5H envelope protein fragment and primers for CDPK gene amplification are shown in Table 3 below. same. The experiment was repeated three times.
  • CPs coat proteins
  • Primer information Primer name Base sequence (5 ' ⁇ 3') (SEQ ID NO) SMV-G5H-CP_F 5'-AAGGCTGCAGCTCTCTCGGG-3 '(10) SMV-G5H-CP_R 5'-TCACATCCCT-TGCAGTATGCCTT-3 '(11) CDPK_F 5'-AGTAAAGAGCACCATGCCTATCCAC-3 '(12) CDPK_R 5'-ATGGTTATGTGAGCAGATGCAAGGC-3 '. (13)
  • Gm06g03101 gene of L29 varieties increased during the initial infection of G5H and G7H of SMV, especially after 8 hours of infection, the expression of Gm06g03101 gene increased about 4 times compared to uninfected plants.
  • the Gm06g03101 gene is related to resistance to SMV (FIG. 2A).
  • the nucleotide sequence of the Gm06g03101 gene it was thought to encode the superfamily metalophosphatase purple acid phosphatase-like protein (FIG. 2B).
  • the soybean variety L29 is known to have the Rsv3 gene on chromosome 14, which has strong resistance to SMV-G5H, but the Gm06g03101 gene is located between the Sat130 and BARC_024137_04780 molecular markers of chromosome 6 and is not found near the Rsv3 gene, so it is not found in Rsv3 It was found that it was not related to the gene (Fig. 2C).
  • GmPAP2.1 gene is associated with resistance to SMV
  • pG5H GFP
  • pG7H GFP
  • pG5H GFP- GmPAP2.1
  • pG7H GFP- GmPAP2.1
  • pG5H GFP
  • pG5H GFP- GmPAP2.1
  • full length pG5H
  • GFP-GmPAP2.1_N C-terminal deletion: ⁇ 69-153aa
  • pG5H GFP-GmPAP2.1_C (N-terminal deletion: ⁇ 1-68aa) was inoculated into the soybean lobes of the soybeans, and the degree of virus accumulation was observed through expression of GFP and viral RNA 14 and 21 days after the inoculation.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GmPAP2.1 유전자 및 이의 용도에 관한 것으로, 본 발명의 콩 유래 GmPAP2.1 유전자는 콩 모자이크 바이러스에 대한 병 저항성을 조절할 수 있으므로, 콩 모자이크 바이러스에 대한 저항성이 증가된 신품종을 개발하여 콩의 생산성을 증가시키는데 응용될 수 있을 것으로 기대된다.

Description

콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도
본 발명은 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GmPAP2.1 유전자 및 이의 용도에 관한 것이다.
콩(Glycine max)은 장미목(Rosales) 콩과(Leguminosae)에 속하는 한해살이 쌍떡잎 식물로, 한반도를 포함하는 아시아 동북부 지역이 원산지로 알려져 있으며, 전 세계적으로 550속 13,000종이 알려져 있고, 우리나라에는 36속 92종이 자생하고 있다. 콩은 단백질과 지방 공급원으로 사용되어 왔으며, 현재는 공업용 소재로도 각광받고 있는 작물이다.
콩 모자이크 바이러스(soybean mosaic virus, SMV)는 포티바이러스과(Potyviridae) 포티바이러스속(Potyvirus)에 속하는 바이러스로, 진딧물을 통해 충매전염되며 콩에서 최대 43%의 종자전염이 이루어지는 것으로 보고되어 있다. 이 바이러스는 콩 생산량과 직접적으로 관련있는 꼬투리 수의 감소, 꼬투리 당 종자수의 감소, 종자의 크기 및 중량의 감소와 콩 껍질의 얼룩생성 등을 초래한다.
식물에서 유전자 매개 저항성(gene-mediated resistance)은 바이러스 감염을 예방하거나 줄이는 방어 기전 중 하나로, 식물 저항성 유전자들은 열성과 우성으로 분류된다. 열성 저항성 유전자들은 바이러스 증식이 바이러스와 숙주 요소 사이의 불화합적인(incompatible) 상호작용에 의해 제대로 발현되지 않는 수동적인 저항성을 제공하는 반면, 우성 저항 유전자(R 유전자)는 병원체 작동인자나 비병원성(avirulence, Avr) 요소를 인지하는 저항 단백질(R 단백질)을 암호화하여 능동적인 저항성을 제공한다. R 유전자는 보통 뉴클레오티드-결합 부위(nucleotide-binding site, NBS)와 류신-리치 반복(leucine-rich repeat, LRR) 부위를 가진 단백질들을 암호화한다. NBS 도메인은 ATP(Adenosine Tri-Phosphate)에 결합할 수 있고 가수분해할 수 있으며, 신호 저항 반응(signaling resistance response)을 하는 기능적인 뉴클레오티드-결합 포켓으로 구성된다. LRR 도메인은 공통되는 류신-리치 반복 모티프(motif)의 개별적인 반복으로 구성되며 Avr 인식과 관련된 것으로 증명되었다. 이 NBS-LRR 단백질은 두 개의 그룹으로 분류된다: TIR-NBS-LRR 단백질은 Toll/인터류킨-1 수용체 상동성을 가진 N-말단 도메인을 포함하며, CC-NBS-LRR 단백질은 N-말단 코일된 코일(coiled-coil) 모티프의 특징이 있다.
콩 모자이크 바이러스는 국내에 11개 계통(G1 to G7, G5H, G6H, G7H, G7a)들이 보고되어있으며, 저항성 유전자를 극복하는 계통들이 계속적으로 나타나고 있다. 현재까지 알려진 콩 모자이크 바이러스에 대한 저항성 유전자에는 Rsv1(R genes against SMV), Rsv3 및 Rsv4가 있다. Rsv1는 국내 재래종 콩인 PI 96983의 13번 염색체에서 발견된 것으로, Rsv1 유전자좌의 부근에는 3개의 NBS-LRR 서열들 3gG2, 5gG3 및 6gG9가 존재하고 있어 이들 중 하나 이상이 Rsv1 내성을 담당한다. Rsv3는 콩 품종 L29의 14번째 염색체의 분자표지 A519F/R 및 M3Satt 사이에서 동정된 것으로, 두 마커 사이의 154 kbp 영역에는 NBS-LRR 도메인을 포함하는 5개의 후보 유전자(Glyma.14g204500, Glyma.14g204600, Glyma.14g204700, Glyma.14g205000 및 Glyma.14g205300)가 존재하며, 특히 Glyma.14g204700가 Rsv3 저항성과 밀접한 관련이 있다고 알려져 있다. 또한, Rsv4는 콩 품종 VP-5152의 2번 염색체의 분자표지 Rat2 및 S6a 사이에서 동정된 것으로, NBS-LRR 타입의 R 유전자가 확인되지 않았으며, 이는 Rsv4가 신규한 클래스의 저항성 유전자에 속함을 의미한다.
한편, 한국등록특허 제1552140호에는 HC-Pro 유전자의 침묵(gene silencing)을 통한 '콩 모자이크 바이러스에 대한 내성이 증진된 콩 형질전환 식물체 및 그 제조방법'이 개시되어 있고, 한국등록특허 제0857043호에는 '콩 모자이크 바이러스 진단용 특이 프라이머'가 개시되어 있으나, 본 발명의 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GmPAP2.1 유전자 및 이의 용도에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 콩 품종 L29의 6번 염색체에 위치한 GmPAP2.1(Glycine max purple acid phosphatase 2.1) 유전자의 발현이 콩 모자이크 바이러스(soybean mosaic virus, SMV) 감염 후에 증가되는 것을 확인하였고, GmPAP2.1 단백질의 전장, N-말단 결실 변이체, 또는 C-말단 결실 변이체를 코딩하는 재조합벡터로 식물체를 형질전환시킨 후, SMV에 대한 병 저항성을 분석한 결과, GmPAP2.1 단백질의 전장 및 C-말단 결실 변이체를 발현하는 형질전환 식물체는 SMV에 높은 저항성을 보인 반면, GmPAP2.1의 N-말단 결실 변이체를 발현하는 형질전환 식물체는 SMV에 대한 저항성이 감소된 것이 확인되어, GmPAP2.1 단백질이 SMV에 대해 콩 식물체에 저항성을 부여하며 특히, N-말단이 SMV에 대한 병 저항성과 연관된 중요 도메인인 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 콩(Glycine max) 유래 GmPAP2.1(Glycine max purple acid phosphatase 2.1) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 GmPAP2.1 단백질을 코딩하는 유전자를 과발현시키는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스(soybean mosaic virus)에 대한 병 저항성을 증가시키는 방법을 제공한다.
또한, 본 발명은 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물 세포를 형질전환하는 단계; 및 상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스에 대한 병 저항성이 증가된 형질전환 식물체의 제조방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 콩 모자이크 바이러스에 대해 병 저항성이 증가된 형질전환 식물체 및 이의 형질전환된 종자를 제공한다.
또한, 본 발명은 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 유효성분으로 포함하는 식물체의 콩 모자이크 바이러스에 대한 병 저항성 증가용 조성물을 제공한다.
본 발명의 콩 유래 GmPAP2.1 유전자는 콩 모자이크 바이러스에 대한 병 저항성을 조절할 수 있으므로, 콩 모자이크 바이러스에 대한 저항성이 증가된 신품종을 개발하여 콩의 생산성을 증가시키는데 응용될 수 있을 것으로 기대된다.
도 1은 대조구(Mock; 20X 칼륨 인산염 버퍼) 및 GFP(green fluorescent protein)가 태그된 플라스미드(pG5H:GFP 또는 pG5H:GFP-GmPAP2 . 1)의 럽-접종(rub-inoculation) 과정을 나타낸 모식도이다.
도 2는 콩 모자이크 바이러스(soybean mosaic virus, SMV)인 G5H 또는 G7H에 감염된 콩 식물체에서 Gm06g03101(GmPAP2.1) 유전자의 발현 정도(A)와, Gm06g03101 유전자의 염기서열 분석을 통한 표적 단백질의 예측(B) 및 콩 품종 L29의 염색체 분석을 통한 Gm06g03101 유전자의 위치를 분석(C)한 결과이다. hpi; 감염 후 시간(hour post infection).
도 3은 Gm06g03101 유전자의 추정 도메인(putative domain)에 대한 계통수 분석(Phylogenetic analysis) 결과이다.
도 4는 GmPAP2.1 유전자의 SMV에 대한 병 저항성 효과를 분석하기 위해 pG5H:GFP, pG7H:GFP, pG5H:GFP-GmPAP2.1 또는 pG7H:GFP-GmPAP2.1를 콩의 초생엽에 각각 접종시키고 GFP의 발현 정도를 자외선(UV)로 확인한 결과(A) 및 바이러스 RNA(viral RNA)의 발현 정도를 나타낸 그래프(B)이다. dpi; 감염 후 일(day post infection.), GFP-GmPAP2.1 또는 pG7H:GFP-GmPAP2.1와 양성 대조군 pG5H:GFP 또는 pG7H:GFP 간의 통계적 비교를 위해 unpaired 2-tailed T-test를 사용(*:P<0.05, ns(not significant): P>0.05).
도 5는 GmPAP2.1의 도메인별로 SMV에 대한 병 저항성 효과를 분석하기 위해 pG5H:GFP, pG5H:GFP-GmPAP2.1(전장), pG5H:GFP-GmPAP2.1_N(C-말단 결실:Δ69-153aa) 또는 pG5H:GFP-GmPAP2.1_C(N-말단 결실:Δ1-68aa)를 콩의 초생엽에 각각 접종시키고 GFP의 발현 정도를 자외선(UV)로 확인한 결과(A) 및 바이러스 RNA의 발현 정도를 나타낸 그래프(B)이다. GFP-GmPAP2.1 또는 pG7H:GFP-GmPAP2.1와 양성 대조군 pG5H:GFP 또는 pG7H:GFP 간의 통계적 비교를 위해 unpaired 2-tailed T-test를 사용(*:P<0.05, ns: P>0.05).
본 발명의 목적을 달성하기 위하여, 본 발명은 콩(Glycine max) 유래 GmPAP2.1(Glycine max purple acid phosphatase 2.1) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 GmPAP2.1 단백질을 코딩하는 유전자를 과발현시키는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스(soybean mosaic virus, SMV)에 대한 병 저항성을 증가시키는 방법을 제공한다.
상기 콩 유래 GmPAP2.1 단백질은 GmPAP2.1 단백질의 N-말단이거나 또는 상기 N-말단을 포함하는 GmPAP2.1 단백질일 수 있으며, 바람직하게는 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어질 수 있으나, 이에 제한되지 않는다. 서열번호 2는 GmPAP2.1 단백질의 아미노산 전체 서열을 의미하고, 서열번호 3은 GmPAP2.1 단백질의 N-말단 영역의 아미노산 서열을 의미한다. 구체적으로 상기 서열번호 3은 서열번호 2의 아미노산 서열에서 1 내지 68번째 아미노산을 포함하는 아미노산 서열이다.
본 발명에 따른 GmPAP2.1 단백질의 범위는 서열번호 2 또는 서열번호 3으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다.
본 발명에 있어서, 용어 "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2 또는 서열번호 3으로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2 또는 서열번호 3으로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 SMV에 대한 병 저항성을 증가시키는 활성을 의미한다. 본 발명은 또한 GmPAP2.1 단백질의 단편, 유도체 및 유사체(analogues)를 포함한다.
본 발명에 있어서, 용어 "단편", "유도체" 및 "유사체"는 본 발명의 GmPAP2.1 폴리펩티드와 실질적으로 같은 생물학적 기능 또는 활성을 보유하는 폴리펩티드를 말한다. 본 발명의 단편, 유도체 및 유사체는 (i) 하나 이상의 보존적(conservative) 또는 비보존적 아미노산 잔기(바람직하게는 보존적 아미노산 잔기)가 치환된 폴리펩티드(상기 치환된 아미노산 잔기는 유전암호에 의해 암호화될 수도, 되지 않을 수도 있다) 또는 (ii) 하나 이상의 아미노산 잔기에서 치환기(들)를 가지는 폴리펩티드, 또는 (iii) 또 다른 화합물(폴리펩티드의 반감기를 연장할 수 있는 화합물, 예를 들면 폴리에틸렌 글리콜)과 결합된 성숙 폴리펩티드로부터 유래된 폴리펩티드, 또는 (iv) 부가적인 아미노산 서열(예를 들면, 선도 서열, 분비 서열, 상기 폴리펩티드를 정제하는데 사용된 서열, 프로테이노젠(proteinogen) 서열 또는 융합 단백질)과 결합된 상기 폴리펩티드로부터 유래된 폴리펩티드일 수 있다. 본 발명에 정의된 상기 단편, 유도체 및 유사체는 당업자에 잘 알려져 있다.
또한, 상기 GmPAP2.1 단백질을 코딩하는 유전자는 SMV에 대한 병 저항성을 조절하는 특징이 있으며, 상기 유전자의 범위는 GmPAP2.1 단백질을 코딩하는 게놈 DNA, cDNA 및 합성 DNA를 모두 포함한다. 바람직하게는, 본 발명의 GmPAP2.1 단백질을 코딩하는 유전자는 서열번호 1의 염기서열로 이루어질 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기 서열과 각각 70% 이상, 더 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)을 포함할 수 있다.
본 명세서에서, 용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 명세서에서, 용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다.
본 발명의 벡터는 전형적으로 발현 또는 클로닝을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예를 들면, pLλ 프로모터, trp 프로모터, lac 프로모터, T7 프로모터, tac 프로모터 등), 해독의 개시를 위한 리보솜 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 숙주 세포로서 대장균(Escherichia coli)이 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위, 그리고 파아지 λ의 좌향 프로모터(pLλ 프로모터)가 조절 부위로서 이용될 수 있다.
본 발명의 재조합 벡터에서, 상기 프로모터는 형질전환에 적합한 프로모터들로서, 바람직하게는 CaMV 35S 프로모터, 액틴 프로모터, 유비퀴틴 프로모터, pEMU 프로모터, MAS 프로모터 또는 히스톤 프로모터일 수 있으며, 바람직하게는 CaMV 35S 프로모터일 수 있으나, 이에 제한되지 않는다.
본 명세서에서, 용어 "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "항시성(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 항시성 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 항시성 프로모터는 선택 가능성을 제한하지 않는다.
본 발명의 재조합 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관 내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 벡터는 번역 개시 부위로서 리보솜 결합 부위 및 전사 터미네이터를 포함할 수 있다.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 튜머파시엔스(Agrobacterium tumefaciens)와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.
재조합 발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 수 있다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 상기 마커 유전자는 항생제 내성 유전자(antibiotics resistance gene)일 수 있으나, 이에 제한되지 않는다.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 튜머파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.
본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(Saccharomyce cerevisiae), 곤충세포, 사람세포(예컨대, CHO 세포주(Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다. 숙주세포는 바람직하게는 식물세포이다.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주 세포가 원핵 세포인 경우, CaCl2 방법, 하나한 방법(Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) 및 전기천공 방법 등에 의해 실시될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법, 칼슘포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법, 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
본 발명은 또한, 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물 세포를 형질전환하는 단계; 및 상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스에 대한 병 저항성이 증가된 형질전환 식물체의 제조방법을 제공한다.
본 발명의 식물체의 콩 모자이크 바이러스에 대한 병 저항성이 증가된 형질전환 식물체의 제조방법에 있어서, 상기 GmPAP2.1 단백질의 범위는 전술한 것과 같다.
식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법, 원형질체의 전기천공법, 식물 요소로의 현미주사법, 각종 식물 요소의 (DNA 또는 RNA-코팅된) 입자 충격법, 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 튜머파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다.
또한, 상기 형질전환된 식물세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다. 형질전환된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.
본 발명은 또한, 상기 방법에 의해 제조된 콩 모자이크 바이러스에 대해 병 저항성이 증가된 형질전환 식물체 및 이의 형질전환된 종자를 제공한다.
본 발명의 일 구현 예에 있어서, 본 발명에 이용되는 식물은 콩과(Family Fabacea)에 속하는 식물들일 수 있으며, 예를 들면, 대두, 녹두, 강낭콩, 완두, 땅콩, 렌즈콩, 동부, 팥 등일 수 있으며, 콩 모자이크 바이러스의 숙주 식물이면 이에 제한되지 않는다.
본 발명은 또한, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 유효성분으로 포함하는 식물체의 콩 모자이크 바이러스에 대한 병 저항성 증가용 조성물을 제공한다.
상기 조성물은 유효성분으로 서열번호 2 또는 서열번호 3의 아미노산 서열을 코딩하는 유전자 또는 상기 유전자를 포함하는 재조합 벡터를 포함하며, 상기 유전자를 콩 식물체에 형질전환함으로써 콩 식물체의 콩 모자이크 바이러스에 대한 병 저항성을 증가시킬 수 있는 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명은 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
1. 식물 재료
콩(대두) 품종 L29(Rsv3)과 소명콩(Somyungkong)은 국립식량과학원 중부작물부 재배환경과에서 분양받았으며, 25℃ 및 16시간/8시간 조건으로 설정된 생장 챔버에서 배양하였다. L29 품종은 cDNA 합성을 위한 총 RNA 추출 대상 식물체로 사용되었고, 소명콩은 형질전환 대상 식물체로 사용하였다. 바이러스 벡터를 접종시킬 콩의 모종은 초생엽이 완전히 팽창된 것을 선택하였다.
2. GFP가 태그된 바이러스 벡터(Viral vector)의 준비
PCR 반응을 통해 시작코돈과 종결코돈이 없는 GFP(green fluorescent protein)의 코딩 영역(714 bp)을 증폭시켰다. 상기 PCR에 사용된 프라이머 정보는 하기 표 1과 같으며, PCR은 Ex Taq polymerase(TaKaRa, 일본)를 사용하여 35 사이클을 수행하였다. PCR 증폭 산물은 MluI 및 XbaI 제한효소로 절단한 후 SMV-G5H(pG5H)와 SMV-G7H(pG7H)에 기반한 바이러스 발현 벡터의 MCS(multiple cloning site)에 연결시켰으며, 최종적으로 제작된 산물은 G5H:GFP로 명명하였다.
프라이머 정보
프라이머 명칭 염기서열(5'→3') (서열번호)
GFP_F 5'-GCTCTAGAGTGAGCAAGGGCGAGGAGCTG-3' (4)(이텔릭체: 제한효소 XbaI 부위)
GFP_R 5'-GCACGCGT GACTGTAAAGATACGGACTCCTTGTACAGCTCGTCCATGCCG-3' (5)(이텔릭체: 제한효소 MluI 부위, 밑줄: NIa 프로테아제 인식 부위의 코딩 영역)
3. GmPAP2.1 단백질을 과발현하는 바이러스 벡터 및 돌연변이체 제작
종결코돈이 없는 GmPAP2.1 코딩 영역은 콩 품종 L29의 cDNA로부터 증폭하였다. 발현 클론(expression clone)을 얻기 위해 증폭 산물을 제한효소 MluI로 절단하고 pG5H::GFP로 클로닝하였으며, 최종적으로 제작된 산물은 pG5H::GFP-GmPAP2.1로 명명하였다. 또한 상기와 같은 방법으로 돌연변이 클론(mutant clone; pG5H:GFP-GmPAP2.1_N(C-말단 결실:Δ69-153aa) 및 pG5H:GFP-GmPAP2.1_C(N-말단 결실:Δ1-68aa))를 제작하였다. 각 돌연변이 부분의 코딩 영역은 pG5H::GFP-GmPAP2.1의 플라스미드 DNA로부터 증폭하였다. 돌연변이 클론 제작에 사용된 프라이머 정보는 하기 표 2와 같다. 바이러스 벡터에서 표적 유전자 또는 표적 유전자의 단편의 삽입은 콜로니 PCR과 시퀀싱을 통해 확인하였다.
프라이머 정보
프라이머 명칭 용도 염기서열(5'→3') (서열번호)
GmPAP2.1_F GmPAP2.1 클로닝 gc acgcgtATGCATAGTCCAATGTATAATAG (6)
GmPAP2.1_R gc acgcgtCCGAAATAATGCAAGAGAT (7)
Del 1-68aa_F N-말단 결실 GmPAP2.1 클로닝 gc acgcgtGCTCCAGTTTACATAACGATTGG (8)
GmPAP2.1_R gc acgcgtCCGAAATAATGCAAGAGAT (7)
GmPAP2.1_F C-말단 결실 GmPAP2.1 클로닝 gc acgcgtATGCATAGTCCAATGTATAATAG (6)
Del 69-153_R gc acgcgtAGATTGGTCATTGATGGGGTT (9)
이텔릭체; 제한효소 부위(MluI),
굵은 글씨체; NIa 프로테아제 인식 부위의 코딩 영역.
4. 바이러스 벡터를 이용한 접종(inoculation) 및 육안 측정법(visual assessment)
공벡터(empty vector)와 바이러스 발현 클론(expression clone)의 접종은 플라스미드 DNA를 소명콩 품종(Rsv3 free)의 초생엽에 럽-접종(rub-inoculation) 방법을 통해 이루어졌다. 플라스미드 DNA는 Plasmid Maxi 키트(QIAGEN, 미국)를 이용하여 준비하였고, 각각의 초생엽에 10 ㎍의 플라스미드 DNA 클론과 20X 칼륨 인산염 버퍼(potassium phosphate buffer) pH 7.5(최종 농도 1X)가 혼합된 총 20 ㎕의 혼합액을 럽-접종하였다. 대조군(mock; 20X 포타슘 포스페이트 버퍼), 벡터 대조군(vector control; pG5H:GFP) 및 발현 클론(pG5H:GFP-GmPAP2.1, pG5H:GFP-GmPAP2.1_N 또는 pG5H:GFP-GmPAP2.1_C)이 접종된 식물체로 3번 반복 실험하였다(도 1). 감염된 식물체에서 GFP의 전신 발현(systemic expression)은 휴대용 UV 광원으로 자외선을 조사하여 확인하였고, 접종된 콩의 초생엽 세포에서 GFP에 의해 방출된 형광 신호는 형광 현미경(Axiovert, 미국)을 통해 확인하였다.
5. RNA 추출 및 qRT-PCR
각 초생엽당 총 RNA는 RNAiSO plus reagent 방법(TaKaRa)을 통해 추출하였고, cDNA는 GoScript reverse transcriptase(Promega Corp., 미국)와 oligo(dT) 프라이머(15 mer, Bioneer)를 이용하여 합성하였다. 바이러스 RNA 복제는 SMV-G5H의 외피 단백질(coat protein, CPs)의 일부분을 증폭시킴으로써 수행되었다. 콩 유래 CDPK(Calcium dependent protein kinase) 유전자의 짧은 단편은 다른 샘플들을 표준화하기 위한 내부 대조군(internal control)으로 사용되었으며, SMV-G5H의 외피 단백질 단편과 CDPK 유전자 증폭용 프라이머의 정보는 하기 표 3과 같다. 상기 실험은 3번 반복하여 수행하였다.
프라이머 정보
프라이머 명칭 염기서열(5'→3') (서열번호)
SMV-G5H-CP_F 5'-AAGGCTGCAGCTCTCTCGGG-3' (10)
SMV-G5H-CP_R 5'-TCACATCCCT-TGCAGTATGCCTT-3' (11)
CDPK_F 5'-AGTAAAGAGCACCATGCCTATCCAC-3' (12)
CDPK_R 5'-ATGGTTATGTGAGCAGATGCAAGGC-3'. (13)
상대적 정량화는 2-ΔΔCt 방법(Kenneth J. L., 2001, METHODS, 25, 402~408)을 통해 수행되었고, qRT-PCR의 결과는 Microsoft Excel 2010(Microsoft, 미국)을 이용하여 평균(mean)과 표준편차(standard deviation)를 계산하여 분석하였다.
실시예 1. 콩 품종 L29 유래의 GmPAP2.1 유전자 분석
qRT-PCR을 수행한 결과, L29 품종의 Gm06g03101 유전자의 발현이 SMV의 G5H와 G7H의 초기 감염시 증가하였고, 특히 감염 8시간 후에는 감염되지 않은 식물체에 비해 Gm06g03101 유전자의 발현이 약 4배 정도 증가한 것을 통해 Gm06g03101 유전자가 SMV에 대한 저항성과 관련이 있음을 확인하였다(도 2A). 또한, Gm06g03101 유전자의 뉴클레오티드 서열을 분석한 결과, superfamily metalophosphatase인 purple acid phosphatase 유사 단백질을 암호화할 것으로 사료되었다(도 2B).
콩 품종 L29는 SMV-G5H에 대해 강한 저항성을 보이는 14번 염색체에 Rsv3 유전자가 존재하는 것으로 알려져 있지만, Gm06g03101 유전자는 6번 염색체의 Sat130 및 BARC_024137_04780 분자표시 사이에 위치하고 있으며 Rsv3 유전자 부근에서 발견되지 않아 Rsv3 유전자와는 관련이 없음을 알 수 있었다(도 2C).
또한, Gm06g03101 유전자의 추정 도메인(putative domain)에 대한 계통수 분석(Phylogenetic analysis)을 수행한 결과, 돌콩(Glycine soja)의 purple acid phosphatase 2와 관련이 있음을 확인하였고, Gm06g03101 유전자를 GmPAP2.1로 명명하였다(도 3).
실시예 2. SMV에 대한 GmPAP2.1 유전자의 저항성 분석
GmPAP2.1 유전자가 SMV에 대한 저항성과 관련이 있는지 확인하기 위해, pG5H:GFP, pG7H:GFP, pG5H:GFP-GmPAP2.1 또는 pG7H:GFP-GmPAP2.1을 콩의 초생엽에 각각 접종하였고, 접종 7, 14 및 21일 후에 GFP 및 바이러스 RNA의 발현을 통해 바이러스 축적 정도를 관찰하였다.
그 결과, pG5H:GFP 및 pG7H:GFP을 접종한 초생엽에서 버퍼만 처리된 Mock 대조군에 비해 GFP 및 바이러스 RNA(viral RNA)의 발현이 현저하게 증가되었고, pG5H:GFP-GmPAP2.1 및 pG7H:GFP-GmPAP2.1가 접종된 초생엽에서는 대조군과 동일하게 GFP 및 바이러스 RNA가 거의 발현되지 않았음을 확인하였다(도 4). 이를 통해, GmPAP2.1 유전자의 발현이 증가하면 SMV에 대한 병 저항성이 증가하는 것을 알 수 있었다.
실시예 3. SMV에 대한 병 저항성 관련 GmPAP2.1의 도메인 분석
GmPAP2.1 도메인별로 SMV에 대한 병 저항성 효과를 분석하기 위해, pG5H:GFP, pG5H:GFP-GmPAP2.1(전장), pG5H:GFP-GmPAP2.1_N(C-말단 결실:Δ69-153aa) 또는 pG5H:GFP-GmPAP2.1_C(N-말단 결실:Δ1-68aa)을 콩의 초생엽에 각각 접종하였고, 접종 14 및 21일 후에 GFP및 바이러스 RNA의 발현을 통해 바이러스 축적 정도를 관찰하였다.
그 결과, Mock 대조군에 비해 pG5H:GFP이 접종된 초생엽에서 GFP의 발현과 바이러스 RNA의 발현이 현저하게 증가된 반면, pG5H:GFP-GmPAP2.1 또는 pG5H:GFP-GmPAP2.1_N이 접종된 초생엽에서는 대조군과 동일하게 GFP 및 바이러스 RNA가 거의 발현되지 않았다. 그러나, N-말단이 결실된 pG5H:GFP-GmPAP2.1_C가 접종된 초생엽에서는 Mock 대조군 또는 C-말단이 결실된 pG5H:GFP-GmPAP2.1_N이 접종된 초생엽에 비해 GFP의 발현과 바이러스 RNA의 발현이 현저하게 증가된 것을 확인할 수 있었다(도 5). 이를 통해, GmPAP2.1의 발현이 증가하면 SMV에 대한 병 저항성이 증가하고 특히, GmPAP2.1의 N-말단이 SMV의 저항성과 관련성이 높음을 알 수 있었다.

Claims (7)

  1. 콩(Glycine max) 유래 GmPAP2.1(Glycine max purple acid phosphatase 2.1) 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환시켜 GmPAP2.1 단백질을 코딩하는 유전자를 과발현시키는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스(soybean mosaic virus)에 대한 병 저항성을 증가시키는 방법.
  2. 제1항에 있어서, 상기 GmPAP2.1 단백질은 GmPAP2.1 단백질의 N-말단 또는 N-말단을 포함하는 GmPAP2.1 단백질인 것을 특징으로 하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스에 대한 병 저항성을 증가시키는 방법.
  3. 제2항에 있어서, 상기 GmPAP2.1 단백질은 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 것을 특징으로 하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스에 대한 병 저항성을 증가시키는 방법.
  4. 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 포함하는 재조합 벡터로 식물 세포를 형질전환하는 단계; 및
    상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 비형질전환체에 비해 식물체의 콩 모자이크 바이러스에 대한 병 저항성이 증가된 형질전환 식물체의 제조방법.
  5. 제4항에 방법에 의해 제조된 콩 모자이크 바이러스에 대해 병 저항성이 증가된 형질전환 식물체.
  6. 제5항에 따른 식물체의 형질전환된 종자.
  7. 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 콩 유래 GmPAP2.1 단백질을 코딩하는 유전자를 유효성분으로 포함하는 식물체의 콩 모자이크 바이러스에 대한 병 저항성 증가용 조성물.
PCT/KR2018/013313 2018-10-24 2018-11-05 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도 WO2020085559A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/218,398 US11566261B2 (en) 2018-10-24 2021-03-31 GmPAP2.1 gene from Glycine max controlling plant disease resistance against soybean mosaic virus and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0127200 2018-10-24
KR1020180127200A KR101964658B1 (ko) 2018-10-24 2018-10-24 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GmPAP2.1 유전자 및 이의 용도

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/218,398 Continuation-In-Part US11566261B2 (en) 2018-10-24 2021-03-31 GmPAP2.1 gene from Glycine max controlling plant disease resistance against soybean mosaic virus and uses thereof

Publications (1)

Publication Number Publication Date
WO2020085559A1 true WO2020085559A1 (ko) 2020-04-30

Family

ID=66167088

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/013313 WO2020085559A1 (ko) 2018-10-24 2018-11-05 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도

Country Status (3)

Country Link
US (1) US11566261B2 (ko)
KR (1) KR101964658B1 (ko)
WO (1) WO2020085559A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114645029A (zh) * 2022-03-11 2022-06-21 上海交通大学 分离人工合成的MpgS蛋白质多肽和MpgP蛋白质多肽及其应用

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117247964B (zh) * 2023-09-04 2024-05-28 南京农业大学 一个能够调控大豆花叶病毒抗性的E3泛素连接酶基因GmPUB20的应用
CN117384941B (zh) * 2023-10-18 2024-04-05 河北省农林科学院粮油作物研究所 一种提高大豆抗病毒性能的基因及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040084186A (ko) * 2003-03-27 2004-10-06 재단법인서울대학교산학협력재단 식물의 뿌리 발달 조절 유전자 및 이를 이용한 식물의뿌리 발달 촉진방법
US20100159065A1 (en) * 2008-12-18 2010-06-24 Boon Leong Lim Method for speeding up plant growth and improving yield by introducing phosphatases in transgenic plant

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0320500B1 (en) 1983-01-13 2004-11-17 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Non-oncogenic ti plasmid vector system and recombinant DNA molecules for the introduction of expressible genes into plant cell genomes
NL8300698A (nl) 1983-02-24 1984-09-17 Univ Leiden Werkwijze voor het inbouwen van vreemd dna in het genoom van tweezaadlobbige planten; agrobacterium tumefaciens bacterien en werkwijze voor het produceren daarvan; planten en plantecellen met gewijzigde genetische eigenschappen; werkwijze voor het bereiden van chemische en/of farmaceutische produkten.
KR100857043B1 (ko) 2006-02-03 2008-09-11 한국생명공학연구원 콩모자이크바이러스 진단용 특이 프라이머
KR101552140B1 (ko) 2013-10-25 2015-09-10 동아대학교 산학협력단 콩 모자이크 바이러스에 대한 내성이 증진된 콩 형질전환 식물체 및 그 제조방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040084186A (ko) * 2003-03-27 2004-10-06 재단법인서울대학교산학협력재단 식물의 뿌리 발달 조절 유전자 및 이를 이용한 식물의뿌리 발달 촉진방법
US20100159065A1 (en) * 2008-12-18 2010-06-24 Boon Leong Lim Method for speeding up plant growth and improving yield by introducing phosphatases in transgenic plant

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE NUCLEOTIDE 25 November 2015 (2015-11-25), ANONYMOUS: "Glycine max purple acid phosphatase 2 (LOC100789918), mRNA", XP055710920, retrieved from NCBI Database accession no. XM_003527817 *
HAYES, A. J.: "Molecular marker mapping of RSV4, a gene conferring resistance to all known strains of soybean mosaic virus", CROP SCIENCE, vol. 40, no. 5, 10 September 2000 (2000-09-10), pages 1434 - 1437 *
LIU, J. Z.: "The current status of the soybean-soybean mosaic virus (SMV) pathosystem", FRONTIERS IN MICROBIOLOGY, vol. 7, no. 1906, 30 November 2016 (2016-11-30), pages 1 - 9, XP055710921 *
SEO, J. K.: "Protein phosphatase 2C induced by abscisic acid positively regulates Rsv3-mediated extreme resistance", GPS, 1 July 2015 (2015-07-01), pages PD-09 PD - 09 *
SEO, J. K.: "Type 2C protein phosphatase is a key regulator of antiviral extreme resistance limiting virus spread", SCIENTIFIC REPORTS, vol. 5905, 31 July 2014 (2014-07-31), pages 1 - 8, XP055710919 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114645029A (zh) * 2022-03-11 2022-06-21 上海交通大学 分离人工合成的MpgS蛋白质多肽和MpgP蛋白质多肽及其应用

Also Published As

Publication number Publication date
US20210222191A1 (en) 2021-07-22
US11566261B2 (en) 2023-01-31
KR101964658B1 (ko) 2019-04-02

Similar Documents

Publication Publication Date Title
WO2020085559A1 (ko) 콩 모자이크 바이러스에 대한 병 저항성을 조절하는 콩 유래의 GｍPAP2.1 유전자 및 이의 용도
US20170305974A1 (en) Agent for controlling porcine reproductive and respiratory syndrome
CN114231539B (zh) 柳枝稷SBP-box类转录因子PvSPL6的应用及其重组载体
CN110592134B (zh) 一种sdg40基因或其编码蛋白的应用
Schröder et al. HSP90 homologue from Madagascar periwinkle (Catharanthus roseus): cDNA sequence, regulation of protein expression and location in the endoplasmic reticulum
CN100374569C (zh) 一种磷酸甘露糖异构酶基因及其编码蛋白与应用
CN107858369B (zh) 一种提高植物对抗有害昆虫能力的基因及其应用
CN117343156A (zh) 苦荞来源的bHLH类转录因子、其编码基因及其应用
WO2015152471A1 (ko) 식물의 가뭄 스트레스에 대한 내성을 증가시키는 벼 유래 mir399f 전구체 dna 및 이의 용도
WO2015125985A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도
WO2022019560A1 (ko) N-당질화 돌연변이 벼, 이의 제조방법 및 이를 이용한 단백질 생산용 벼의 제조방법
KR20090071350A (ko) 고감염성 고추모틀바이러스 핵산분자 및 이로부터 유래된 식물 바이러스 벡터
KR101099614B1 (ko) 식물형질전환용 운반체, 식물형질전환체, 식물형질전환 방법 및 이를 이용한 유전자형의 판별방법
KR101536894B1 (ko) 벼 유래 OsMDB1 유전자를 이용한 초장이 조절된 형질전환 식물체의 제조방법 및 그에 따른 식물체
NZ243694A (en) TRANSGENIC PLANTS WITH ALTERED VACUOLAR pH RESULTING IN FLOWER PIGMENT
WO2013154233A1 (ko) Ｓｙｃｍｖ 유래의 재조합 바이러스 벡터 및 이의 용도
WO2016159560A1 (ko) 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 ＩｂＨＰＰＤ 유전자 및 이의 용도
KR101724370B1 (ko) Trsv 재조합 벡터 및 이의 용도
EP1169463B1 (en) Method for conveying bnyvv resistance to sugar beet plants
WO2024096643A1 (ko) N-당질화 돌연변이 벼를 이용한 단일클론항체 생산용 벼의 제조방법 및 이에 의해 제조된 단일클론항체
KR101754804B1 (ko) 식물 병 저항성을 증가시키는 BrCP3 유전자 및 이의 용도
KR102478475B1 (ko) 식물체의 병 저항성을 조절하는 LOC_Os08g26230 유전자 변이체 및 이의 용도
KR101717474B1 (ko) At1g70000을 포함하는 식물체의 안토시아닌 합성 증가 유도용 조성물 및 그의 이용
KR100628023B1 (ko) 콕시듐 원충의 포자소체의 재조합 표면항원 단백질 및이를 포함하는 콕시듐병 백신
WO2023003176A1 (ko) 토마토 유래 식물면역조절인자 srfr1 유전자 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18937783

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18937783

Country of ref document: EP

Kind code of ref document: A1