WO2015125985A1 - 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도 - Google Patents

식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도 Download PDF

Info

Publication number
WO2015125985A1
WO2015125985A1 PCT/KR2014/001351 KR2014001351W WO2015125985A1 WO 2015125985 A1 WO2015125985 A1 WO 2015125985A1 KR 2014001351 W KR2014001351 W KR 2014001351W WO 2015125985 A1 WO2015125985 A1 WO 2015125985A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
osnf
stress
gene
plants
Prior art date
Application number
PCT/KR2014/001351
Other languages
English (en)
French (fr)
Inventor
김주곤
장규필
김형일
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to PCT/KR2014/001351 priority Critical patent/WO2015125985A1/ko
Priority to US15/120,259 priority patent/US20170058288A1/en
Publication of WO2015125985A1 publication Critical patent/WO2015125985A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

Definitions

  • the present invention relates to an OsNF-YA7 gene for increasing drought stress resistance of plants and its use, and more particularly, to a recombinant comprising NF-YA7 (nuclear factor Y, subunit A7) protein coding gene derived from rice ( Oryza sativa ).
  • a method of increasing resistance to abiotic stress in a plant comprising the step of transforming a vector into a plant cell, wherein the plant cell is transformed with a recombinant vector comprising the NF-YA7 protein coding gene to be abiotic compared to wild type.
  • Method for producing a transgenic plant with increased resistance to stress, the transgenic plant produced by the method and its seeds and the NF-YA7 protein coding gene as an active ingredient, against abiotic stress of the plant It relates to a composition for increasing resistance.
  • Drought stress is one of the most serious factors affecting crop production worldwide. Exposure of plants to drought conditions leads to the induction of many stress-related genes, the products of which are thought to function as cellular protective agents against stress-induced damage. The expression of stress related genes is usually regulated by specific transcription factors. AP2, bZIP, zinc fingers and members of the MYB family have been shown to play a transcriptional regulator in the stress response. The rice and Arabidopsis genomes encode more than 1300 transcriptional regulators, accounting for about 6% of the total gene number. It has also been reported that about 45% of these transcription factors are of plant specific family origin.
  • Nuclear factor Y is a transcription factor complex that specifically binds to the highly conserved CCAAT sequence of the target promoter (Romier et al., 2003, J. Biol. Chem. 278: 1336-1345).
  • the NF-Y transcription complex consists of three subunits, NF-YA, NF-YB and NF-YC, each containing conserved domains required for DNA binding and protein interaction.
  • NF-YB and NF-YC initially bind to each other in the cytoplasm to form a complex of NF-YB / NF-YC dimers, and then migrate to the nucleus to interact with NF-YA to form a heterotrimer complex. Form.
  • NF-Y transcription factors are present in most higher eukaryotic cells, including mammals and plants. Interestingly, many genes encoding NF-Y transcription factors show very large differences between mammals and plants. Mammalian NF-Y transcription factors are encoded by a single gene, whereas plant NF-Y transcription factors are encoded by a gene family. It was thought that multiple copies of NF-Y in plants cause complexity of regulation through various interactions between NF-Y subunit members.
  • the NF-YA subunit has two conserved domains at the amino and carboxyl terminal region domains, which are required to interact with the NF-YB / NF-YC heterodimer and the carboxyl terminal domain. Is the domain required for DNA binding.
  • the present inventors intend to isolate two NF-YA transcription factors, NF-YA4 and NF-YA7 from rice ( Oryza sativa ), and analyze the function of drought resistance of the genes.
  • US Patent Publication No. 2009-0089899 discloses 'Method for Enhancing Drought Stress Tolerance in Plants by Active AREB1', but the content of OsNF-YA7 gene and its use for increasing the drought stress resistance of the plant of the present invention Is not described.
  • the present invention is derived from the above requirements, the present inventors are a recombinant vector comprising a rice-derived NF-YA7 protein coding gene and a rice transgenic plant overexpressing the NF-YA7 gene by transforming the plant with the recombinant vector
  • the NF-YA7 overexpressed transgenic rice plant was confirmed that the resistance to stress was increased compared to wild-type plants during drought stress treatment, thereby completing the present invention.
  • the present invention is a plant abiotic comprising the step of transforming a plant cell with a recombinant vector comprising a rice (Oyza sativa ) derived NF-YA7 (nuclear factor Y, subunit A7) protein coding gene Provides a way to increase resistance to enemy stress.
  • a method for producing a transgenic plant having increased resistance to abiotic stress compared to wild type comprising transforming plant cells with a recombinant vector comprising a rice-derived NF-YA7 protein coding gene.
  • the present invention provides a transgenic plant and its seed having increased resistance to abiotic stress compared to the wild type produced by the method.
  • the present invention provides a composition for increasing resistance to abiotic stress of plants, containing the rice-derived NF-YA7 protein coding gene as an active ingredient.
  • plants overexpressed by the rice-derived NF-YA7 protein coding gene have increased stress resistance compared to wild type under drought stress conditions. Therefore, the rice-derived NF-YA7 protein coding gene of the present invention can be usefully used in the development of transgenic plants with increased resistance to drought stress, it will be very useful industrially.
  • Figure 2 is a result of confirming the change in the expression level of OsNF-YA7 and OsNF-YA4 gene when the stress hormone abstic acid (ABA) is treated to plants for a short (a) or long-term (b).
  • ABA abstic acid
  • OsNF-YA4 and OsNF-YA7 transgenic plants (PGD1: OsNF-YA4 and PGD1: OsNF-YA7) and as a result of a comparison of the drought stress tolerance of the wild-type plants, (a) is drought stress treatment and the water re- (B) is a graph analyzing the change of Fv / Fm value according to drought stress treatment, the upper graph is the result of OsNF-YA4 transgenic plant, and the lower graph is OsNF- Results of YA7 transgenic plants.
  • the present invention provides a plant comprising a step of transforming a plant cell with a recombinant vector comprising a nuclear factor Y, subunit A7 (NF-YA7) protein coding gene derived from rice ( Oryza sativa ) It provides a method of increasing resistance to abiotic stress.
  • a plant comprising a step of transforming a plant cell with a recombinant vector comprising a nuclear factor Y, subunit A7 (NF-YA7) protein coding gene derived from rice ( Oryza sativa ) It provides a method of increasing resistance to abiotic stress.
  • NF-YA7 nuclear factor Y, subunit A7
  • NF-YA7 The range of proteins includes proteins having the amino acid sequence represented by SEQ ID NO: 2 and functional equivalents of such proteins.
  • “Functional equivalent” means at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid Is 95% or more of sequence homology, and refers to a protein that exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 2.
  • Substantially homogeneous physiological activity means activity that increases the plant's resistance to abiotic stress.
  • the present invention also provides a gene encoding the NF-YA7 protein.
  • the gene of the present invention may include a nucleotide sequence represented by SEQ ID NO: 1.
  • homologues of the above nucleotide sequences are included within the scope of the present invention.
  • the gene has a base sequence having a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1, respectively. It may include.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
  • Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.
  • the NF-YA7 Protein coding gene sequences can be inserted into recombinant expression vectors.
  • recombinant expression vector means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host.
  • An important feature of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.
  • Expression vectors comprising the NF-YA7 protein coding gene sequence and appropriate transcriptional / translational control signals can be constructed by methods well known to those of skill in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.
  • Preferred examples of recombinant vectors of the invention are Ti-plasmid vectors capable of transferring part of themselves, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens.
  • Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have.
  • a particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.
  • viral vectors such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc.
  • CaMV double stranded plant viruses
  • gemini viruses single stranded viruses
  • it may be selected from an incomplete plant viral vector.
  • the use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.
  • the expression vector will preferably comprise one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance genes include, but are not limited to.
  • the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter.
  • the term “promoter” refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Persistent promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, persistent promoters do not limit the selection possibilities.
  • terminators can be used, for example nopalin synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, but is not limited thereto.
  • NOS nopalin synthase
  • rice ⁇ -amylase RAmy1 A terminator phaseoline terminator
  • Agrobacterium tumefaciens Agrobacterium tumefaciens
  • Terminator of the octopine gene but is not limited thereto.
  • terminators such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.
  • Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol.
  • the abiotic stress may be drought, oxidation, heat, light, low temperature and salt stress, etc., preferably drought stress, but is not limited thereto.
  • It provides a method for producing a transgenic plant with increased resistance to abiotic stress compared to the wild type comprising the step of regenerating the plant from the transformed plant cells.
  • the range of the NF-YA7 protein is as described above.
  • the method of the present invention comprises transforming plant cells with a recombinant vector according to the present invention, which transformation can be mediated by, for example, Agrobacterium tumefiaciens .
  • the method also includes the step of regenerating the transgenic plant from said transformed plant cell.
  • the method for regenerating the transformed plant from the transformed plant cell may use any method known in the art.
  • Transformed plant cells should be re-differentiated into whole plants. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for many different species.
  • the abiotic stress may be drought, oxidation, heat, light, low temperature and salt stress and the like, preferably drought stress, but is not limited thereto.
  • the present invention provides a transgenic plant and its seed having increased resistance to abiotic stress compared to the wild type produced by the method.
  • the plant is monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, onions or potatoes, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower , Spinach, chard, sweet potatoes, carrots, buttercups, cabbage, cabbage, cod radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, green beans, green beans, peas, etc., dicotyledonous plants, preferably monocotyledonous plants It may be, and more preferably may be rice, but is not limited thereto.
  • the present invention also provides a composition for increasing resistance to abiotic stress in plants, comprising as an active ingredient a gene encoding a rice-derived NF-YA7 protein consisting of the amino acid sequence of SEQ ID NO: 2.
  • the composition contains a gene encoding the NF-YA7 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, it is possible to increase the plant's resistance to abiotic stress by transforming the gene in the plant.
  • OsNF-YA4 The full- length cDNAs of OsNF-YA4 (AK069854) and OsNF-YA7 (AK059903) were based on total RNA extracted from rice ('nakdong' variety), and OsNF-YA4 forward (5'-ATGGAGTCGAGGCCGGGGGG-3 '; SEQ ID NO: 3) And OsNF-YA4 reverse (5'-TCATGTTTCCTTCTGTAGGA-3 '; SEQ ID NO: 4) primer, OsNF-YA7 forward (5'-ATGAAGCCAGATGGTGAAAC-3'; SEQ ID NO: 5) and OsNF-YA7 reverse (5'-TCATACAACATCGGACGCAT-3 ' SEQ ID NO: 6) using a primer.
  • nontransformed (NT, 'nakdong') rice plants were grown in soil in a plastic house for 4 weeks.
  • Four-week-old transgenic plants were air dried for three hours for drought stress treatment.
  • the whole plant was transferred to 200 mM sodium chloride solution for salt stress for 24 hours, and the whole plant was placed in a 4 ° C. low temperature chamber for 24 hours for low temperature stress treatment.
  • untransformed plants were grown for two weeks in MS medium in the growth chamber.
  • the entire plant was transferred to a solution containing 10 or 100 ⁇ M of abscis acid for 24 hours, and for long-term abscis acid treatment, the seed of the non-transformed plant was 0, 0.5, Growth was for 2 weeks in MS medium containing 1 or 3 ⁇ M of abscisic acid.
  • RNA is extracted using the Qiagen RNeasy plant mini kit (Qiagen, USA). It was. 1 ⁇ g of total RNA was used for first strand cDNA synthesis using the Superscript II cDNA Synthesis Kit (Invitrogen, USA). In order to analyze the gene expression levels using real-time PCR equipment and Mx3000p Platinum SYBR ® Green qPCR SuperMix-UDG system (Invitrogen, USA) was performed quantitative PCR.
  • Rice ubiquitin transcript was used as a standardization index, and gene specific primers of OsNF-YA4 and OsNF-YA7 were prepared at 3 'UTR and 3' exon sites. Primers used for quantitative RT-PCR are shown in Table 1 below.
  • PGD1 OsNF-YA4 and PGD1 : OsNF-YA7 transformed plants were grown in soil with nontransformed plants for 4 weeks and then treated with drought stress by removing water from the soil. After 7 days of drought stress treatment, water was replenished and visual symptoms of drought stress of PGD1: OsNF-YA4 and PGD1 : OsNF-YA7 transgenic plants and non-transgenic plants were photographed and observed.
  • OsNF-YA4 and PGD1 OsNF-YA7 transgenic plants were grown in soil for two weeks with non-transformed plants, and then leaves were collected from each plant and allowed to acclimate for 10 minutes.
  • drought conditions were treated in a growth chamber in a time-lapse fashion, and at each indicated time, chlorophyll fluorescence emitted from the upper surface of the leaves was extracted using a pulse modulated fluorophotometer (mini-PAM, Walz, Germany).
  • mini-PAM mini-PAM, Walz, Germany
  • the Fv / Fm value was measured by sensing.
  • Fv / Fm values indicate activity of light system II.
  • Abscisic acid is a plant hormone that regulates the growth and development of plants. It is an important substance that regulates the response and adaptation of plants to abiotic stress. In abiotic stress conditions such as cold, drought, and salts, the content is increased. Treatment of abscisic acid in plants can lead to situations similar to those of stress conditions.
  • Apsis acid and OsNF-YA genes non-transformed rice plants were treated with Apsis acid and analyzed for changes in expression levels of OsNF-YA4 and OsNF-YA7 genes.
  • the OsNF-YA7 gene showed about 30% decrease in expression compared to the untreated control, whereas the OsNF-YA4 gene showed a four-fold increase in expression compared to the control.
  • FIG. 2A Long term treatment of abscisic acid also resulted in similar trends (FIG. 2B). From the above results, it was confirmed that the expression of OsNF-YA4 and OsNF-YA7 genes are differently regulated under stress conditions by treatment with abscisic acid.
  • Example 1 it was confirmed that OsNF-YA7 gene is strongly expressed under drought stress conditions.
  • drought stress was applied to the transgenic plants overexpressing OsNF-YA4 and OsNF-YA7 .
  • OsNF-YA7 overexpressing transgenic plants showed strong resistance to drought stress.
  • OsNF-YA7 overexpressed transgenic plants showed almost the same condition as the stress-free control group after 3 days of drought stress treatment, and showed symptoms of stress-induced damage after 7 days of drought stress. The degree of was weakly confirmed.
  • OsNF-YA7 overexpressed transgenic plants showed a delay in reducing the Fv / Fm value due to drought stress.
  • Three OsNF-YA7 overexpressing transgenic plants showed similar levels of Fv / Fm values of the untreated control until 2.5 hours of drought stress treatment, and showed a decrease in Fv / Fm values after 3 hours of stress treatment (FIG. 3b).
  • OsNF-YA4 overexpressing transgenic plants did not show a delayed decrease in Fv / Fm values as found in OsNF-YA7 overexpressing transgenic plants after drought stress treatment.
  • OsNF-YA4 overexpressing transgenic plants showed little or no difference with the decreasing tendency of Fv / Fm values of non-transgenic plants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 벼(Oryza sativa) 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법에 관한 것으로, 본 발명의 벼 유래 NF-YA7 단백질 코딩 유전자는 가뭄 스트레스에 대한 저항성이 증가된 형질전환 식물체의 개발에 유용하게 이용될 수 있다.

Description

식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도
본 발명은 식물의 가뭄 스트레스 내성을 증가시키는 OsNF-YA7 유전자 및 이의 용도에 관한 것으로, 더욱 상세하게는 벼(Oryza sativa) 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법, 상기 NF-YA7 단백질 코딩 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하여 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체의 제조 방법, 상기 방법에 의해 제조된 형질전환 식물체 및 이의 종자 및 상기 NF-YA7 단백질 코딩 유전자를 유효성분으로 함유하는, 식물체의 비생물적 스트레스에 대한 내성 증가용 조성물에 관한 것이다.
가뭄 스트레스는 전세계적으로 작물 생산에 가장 심각한 영향을 미치는 요인 중 하나이다. 가뭄 조건에 식물을 노출시키면, 많은 스트레스 관련 유전자가 유도되며, 이의 산물은 스트레스에 유도된 손상에 대한 세포 보호물질로서 기능하는 것으로 생각된다. 스트레스 관련 유전자의 발현은 특이적 전사인자에 의해 대개 조절된다. AP2, bZIP, 징크 핑거 및 MYB 패밀리의 멤버가 스트레스 반응에서 전사 조절 역할을 하는 것으로 나타났다. 벼 및 애기장대 게놈은 전체 유전자 수의 약 6%를 차지하는 1300개 이상의 전사 조절자를 코딩한다. 또한, 상기 전사인자의 약 45%가 식물 특이적 패밀리 유래인 것으로 보고되었다.
Nuclear factor Y(NF-Y)는 전사인자 복합체로 목표 프로모터의 고도로 보존된 CCAAT 서열에 특이적으로 결합한다(Romier et al., 2003, J. Biol. Chem. 278:1336-1345). NF-Y 전사 복합체는 NF-YA, NF-YB 및 NF-YC의 세 개의 서브유닛으로 구성되어 있는데, 각각의 서브유닛은 DNA 결합 및 단백질 상호작용을 위해 요구되는 보존된 도메인들을 포함하고 있다. NF-YB와 NF-YC는 세포질 내에서 처음에 서로 결합하여 NF-YB/NF-YC 이합체의 복합체를 형성한 후, 핵으로 이동하여 NF-YA와 상호작용하여 이형삼합체(heterotrimer)의 복합체를 형성한다. NF-Y 전사인자는 포유류와 식물을 포함하는 대부분의 고등 진핵세포에 존재하는데, 흥미롭게도 NF-Y 전사인자를 코딩하는 다수의 유전자가 포유류와 식물 사이에 매우 큰 차이를 보인다. 포유류의 NF-Y 전사인자는 단일 유전자에 의해 코딩되는데 반해, 식물의 NF-Y 전사인자는 유전자 패밀리에 의해 코딩된다. 이는 식물에 있어서 NF-Y의 다중 카피수가 NF-Y 서브유닛 구성원들간의 다양한 상호작용을 통해서 조절의 복잡성을 야기하는 것으로 생각되었다.
NF-YA 서브유닛은 아미노 말단 및 카복실 말단 영역 도메인에 두 개의 보존된 도메인을 가지고 있는데, 아미노 말단 도메인은 NF-YB/NF-YC 이형이합체(heterodimer)와 상호작용하기 위해 필요하며, 카복실 말단 도메인은 DNA 결합을 위해 필요한 도메인이다.
이에 본 발명자들은 벼(Oryza sativa)에서 두 개의 NF-YA 전사인자, NF-YA4와 NF-YA7을 분리하고, 상기 유전자들의 가뭄 저항성에 대한 기능을 분석하고자 한다.
한편, 미국공개특허 제2009-0089899호에는 'Method for Enhancing Drought Stress Tolerance in Plants by Active AREB1'가 개시되어 있으나, 본 발명의 식물의 가뭄 스트레스 내성을 증가시키는 OsNF-YA7 유전자 및 이의 용도에 관한 내용은 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 벼 유래 NF-YA7 단백질 코딩 유전자를 포함하는 재조합 벡터 및 상기 재조합 벡터로 식물체를 형질전환하여 NF-YA7 유전자가 과발현하는 벼 형질전환 식물체를 제작하였고, 상기 NF-YA7 과발현 형질전환 벼 식물체가 가뭄 스트레스 처리 시 야생형 식물체에 비해 스트레스에 대한 내성이 증가된 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 벼(Oryza sativa) 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법을 제공한다.
또한, 본 발명은
벼 유래 NF-YA7 단백질 코딩 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계를 포함하는 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체 및 이의 종자를 제공한다.
또한, 본 발명은 상기 벼 유래 NF-YA7 단백질 코딩 유전자를 유효성분으로 함유하는, 식물체의 비생물적 스트레스에 대한 내성 증가용 조성물을 제공한다.
본 발명에 따르면, 벼 유래 NF-YA7 단백질 코딩 유전자가 과발현하는 식물체는 가뭄 스트레스 조건에서 야생형에 비해 스트레스 내성이 증가된다. 따라서, 본 발명의 벼 유래 NF-YA7 단백질 코딩 유전자는 가뭄 스트레스에 대한 저항성이 증가된 형질전환 식물체의 개발에 유용하게 이용될 수 있으므로, 산업적으로 매우 유용하게 이용될 수 있을 것이다.
도 1은 벼 식물체에 가뭄, 염 또는 저온의 스트레스 처리 시 OsNF-YA7 및 OsNF-YA4 유전자의 발현 수준 변화를 확인한 결과이다.
도 2는 스트레스 호르몬인 앱시스산(ABA)을 단기간(a) 또는 장기간(b) 식물체에 처리하였을 때의 OsNF-YA7 및 OsNF-YA4 유전자의 발현 수준 변화를 확인한 결과이다.
도 3은 OsNF-YA4 및 OsNF-YA7 과발현 형질전환 식물체(PGD1:OsNF-YA4 및 PGD1:OsNF-YA7)와 야생형 식물체의 가뭄 스트레스 저항성을 비교한 결과로, (a)는 가뭄 스트레스 처리와 물 재공급(rewatering) 후의 식물체의 모습을 보여주는 사진이며, (b)는 가뭄 스트레스 처리에 따른 Fv/Fm 값 변화를 분석한 그래프로 위쪽 그래프는 OsNF-YA4 형질전환 식물체의 결과이며, 아래쪽 그래프는 OsNF-YA7 형질전환 식물체의 결과이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 벼(Oryza sativa) 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법을 제공한다.
본 발명에 따른 NF-YA7 단백질의 범위는 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 식물체의 비생물적 스트레스에 대한 내성을 증가시키는 활성을 의미한다.
또한, 본 발명은 상기 NF-YA7 단백질을 암호화하는 유전자를 제공한다. 본 발명의 유전자는 서열번호 1로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기 서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명에서, 상기 NF-YA7 단백질 코딩 유전자 서열은 재조합 발현 벡터 내로 삽입될 수 있다. 용어 "재조합 발현 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다. 상기 발현 벡터의 중요한 특성은 복제 원점, 프로모터, 마커 유전자 및 번역 조절 요소(translation control element)를 가지는 것이다.
NF-YA7 단백질 코딩 유전자 서열 및 적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관 내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "지속적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 지속적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 지속적 프로모터는 선택 가능성을 제한하지 않는다.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.
식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), 원형질체의 전기천공법(Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), 식물 요소로의 현미주사법(Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), 각종 식물 요소의 (DNA 또는 RNA-코팅된) 입자 충격법(Klein T.M. et al., 1987, Nature 327, 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 투머파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다. 특히 바람직한 것은 EP A 120 516호 및 미국 특허 제4,940,838호에 기재된 바와 같은 소위 이원 벡터 기술을 이용하는 것이다.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 비생물적 스트레스는 가뭄, 산화, 열, 광, 저온 및 염 스트레스 등일 수 있으며, 바람직하게는 가뭄 스트레스일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은
벼 유래 NF-YA7 단백질 코딩 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체의 제조 방법을 제공한다.
본 발명 일 구현 예에 따른 제조 방법에 있어서, 상기 NF-YA7 단백질의 범위는 전술한 바와 같다.
본 발명의 방법은 본 발명에 따른 재조합 벡터로 식물 세포를 형질전환하는 단계를 포함하는데, 상기 형질전환은 예를 들면, 아그로박테리움 튜머파시엔스(Agrobacterium tumefiaciens)에 의해 매개될 수 있다. 또한, 본 발명의 방법은 상기 형질전환된 식물 세포로부터 형질전환 식물을 재분화하는 단계를 포함한다. 형질전환 식물 세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.
형질전환된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.
본 발명의 일 구현 예에 따른 제조 방법에 있어서, 상기 비생물적 스트레스는 가뭄, 산화, 열, 광, 저온 및 염 스트레스 등일 수 있으며, 바람직하게는 가뭄 스트레스일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 상기 방법에 의해 제조된 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체 및 이의 종자를 제공한다.
본 발명의 일 구현 예에 있어서, 상기 식물체는 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리, 양파 등의 단자엽 식물 또는 감자, 가지, 담배, 고추, 토마토, 우엉, 쑥갓, 상추, 도라지, 시금치, 근대, 고구마, 당근, 미나리, 배추, 양배추, 갓무, 수박, 참외, 오이, 호박, 박, 딸기, 대두, 녹두, 강낭콩, 완두 등의 쌍자엽 식물일 수 있고, 바람직하게는 단자엽 식물일 수 있으며, 더욱 바람직하게는 벼일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 벼 유래 NF-YA7 단백질을 코딩하는 유전자를 유효성분으로 함유하는, 식물체의 비생물적 스트레스에 대한 내성 증가용 조성물을 제공한다. 상기 조성물은 유효성분으로 서열번호 2의 아미노산 서열로 이루어진 NF-YA7 단백질을 코딩하는 유전자를 함유하며, 상기 유전자를 식물체에 형질전환시킴으로써 식물체의 비생물적 스트레스에 대한 내성을 증가시킬 수 있는 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
플라스미드 구축 및 벼의 형질전환
OsNF-YA4 (AK069854)와 OsNF-YA7 (AK059903)의 전장 cDNA는 벼('낙동' 품종)에서 추출한 총 RNA를 주형으로 하고, OsNF-YA4 정방향(5'-ATGGAGTCGAGGCCGGGGGG-3'; 서열번호 3) 및 OsNF-YA4 역방향(5'-TCATGTTTCCTTCTGTAGGA-3'; 서열번호 4) 프라이머, OsNF-YA7 정방향(5'-ATGAAGCCAGATGGTGAAAC-3'; 서열번호 5) 및 OsNF-YA7 역방향(5'-TCATACAACATCGGACGCAT-3'; 서열번호 6) 프라이머를 이용하여 증폭하였다. 증폭된 각각의 전장 cDNA는 게이트웨이 시스템(Invitrogen, 미국)을 이용하여 PGD1 프로모터를 가지고 있는 p700 벡터로 삽입하였다. PGD1:OsNF-YA7 및 PGD1:OsNF-YA4 벡터는 아그로박테리움 매개 공동 배양 방법(Jang et al., 1999, Mol. Breeding 5:453-461)을 통해 식물체 내로 도입하였다.
스트레스 및 앱시스산(ABA) 처리
비생물적 스트레스에 대한 반응에 있어서 OsNF-YA4 및 OsNF-YA7 유전자의 발현 경향을 분석하기 위해서, 비형질전환(NT, '낙동' 품종) 벼 식물체를 비닐 하우스 내의 토양에서 4주간 키웠다. 4주령 비형질전환 식물체를 가뭄 스트레스 처리를 위해 식물체 전체를 3시간 동안 공기 건조시켰다. 또한, 염 스트레스를 위해서 식물체 전체를 200mM 염화나트륨 용액으로 옮겨 24시간 두었고, 저온 스트레스의 처리를 위해서는 식물체 전체를 4℃ 저온 챔버에 넣고 24시간 두었다. 그리고 앱시스산에 대한 OsNF-YA4 및 OsNF-YA7 유전자의 발현 경향을 분석하기 위해서, 비형질전환 식물체를 성장 챔버 내의 MS 배지에서 2주 동안 키웠다. 그 후, 앱시스산의 단기간 처리를 위해, 식물체 전체를 10 또는 100μM 농도의 앱시스산이 들어있는 용액으로 옮겨 24시간 처리하였고, 장기간의 앱시스산 처리를 위해서는 비형질전환 식물체의 종자를 0, 0.5, 1 또는 3μM의 앱시스산이 들어있는 MS 배지에서 2주 동안 성장시켰다.
실시간 정량적 역전사 중합효소연쇄반응(Real-Time Quantitative RT-PCR)
비생물적 스트레스 및 앱시스산 처리 식물체의 잎과 뿌리 조직을 떼어내어 얼린 후, 얼린 잎 및 뿌리 조직을 액체 질소를 이용하여 분쇄하고 Qiagen RNeasy plant mini kit(Qiagen, 미국)를 사용하여 총 RNA를 추출하였다. 총 RNA의 1㎍을Superscript Ⅱ cDNA 합성 키트(Invitrogen, 미국)를 사용한 첫 번째 가닥 cDNA 합성에 사용하였다. 유전자 발현 수준을 분석하기 위해서, Mx3000p 실시간 PCR 장비 및 Platinum SYBR® Green qPCR SuperMix-UDG system(Invitrogen, 미국)을 사용하여 정량적 PCR을 수행하였다. 벼의 유비퀴틴 전사체를 표준화 지표로 사용하였고, OsNF-YA4 및 OsNF-YA7의 유전자 특이 프라이머는 3' UTR과 3' 엑손 부위에서 제작하였다. 정량적 RT-PCR 수행을 위해 사용한 프라이머는 하기 표 1과 같다.
표 1
유전자명 염기서열 정보 (5'→3')
OsNF-YA4 정방향 GGATCCCTCCTGACTTACAG (서열번호 7)
역방향 GGATTCTTGCTCCAGAATTG (서열번호 8)
OsNF-YA7 정방향 GGAGAACTCGAGCCCAACAA (서열번호 9)
역방향 GCAAGCACACAATTCGATCGA (서열번호 10)
OsUbi. 정방향 ATGGAGCTGCTGCTGTTCTA (서열번호 11)
역방향 TTCTTCCATGCTGCTCTACC (서열번호 12)
가뭄 스트레스에 대한 표현형 분석
PGD1:OsNF-YA4 및 PGD1:OsNF-YA7 형질전환 식물체를 비형질전환 식물체와 함께 토양에서 4주 동안 키운 후, 토양으로부터 물을 제거하여 가뭄 스트레스를 처리하였다. 가뭄 스트레스 처리 7일 후에, 물을 재공급하고 PGD1:OsNF-YA4 및 PGD1:OsNF-YA7 형질전환 식물체 및 비형질전환 식물체의 가뭄 스트레스에 의한 시각적인 증상을 이미지를 촬영하여 관찰하였다.
펄스 진폭 변조(PAM, Pulse-Amplitude Modulation) 실험
PGD1:OsNF-YA4 및 PGD1:OsNF-YA7 형질전환 식물체 3 라인을 비형질전환 식물체와 함께 2주 동안 토양에서 키운 후, 각 식물체로부터 잎을 수집하여 10분 동안 암 순응시켰다. PAM 분석을 위해서, 성장 챔버 내에서 시간 경과 방식으로 가뭄 조건을 처리하고, 각 지시된 시간에 펄스 변조 형광광도계(mini-PAM, Walz, 독일)를 사용하여 잎의 위쪽 표면으로부터 배출되는 엽록소 형광을 감지하여 Fv/Fm 값을 측정하였다. Fv/Fm 값은 광계Ⅱ의 활성을 나타낸다.
실시예 1. 비생물적 스트레스 조건에서 OsNF-YA4 및 OsNF-YA7 유전자의 발현 경향 분석
이전 연구의 마이크로어레이 결과를 통해서 가뭄 스트레스에 의해 두 개의 OsNF-YA 유전자인 OsNF-YA4 및 OsNF-YA7이 유도된다는 것을 확인하였다. 가뭄 스트레스를 포함한 비생물적 스트레스에 대한 반응으로 OsNF-YA4 및 OsNF-YA7 유전자의 발현 경향이 어떻게 변화하는지 확인하기 위해서 가뭄, 고염 및 저온 스트레스를 비형질전환 벼에 처리하였다.
그 결과, OsNF-YA7 유전자의 발현은 스트레스 무처리 대조구에 비해 가뭄 스트레스 시 4.4배, 고염 스트레스 시 2.9배 및 저온 스트레스 시 2.7배 발현양이 증가된 것을 확인하였다(도 1). 반면에, OsNF-YA4 유전자의 발현은 저온 스트레스 처리에서만 대조구에 비해 발현양이 증가되었고, 가뭄 및 고염 스트레스 처리에서는 발현양에 거의 변화가 없음을 확인하였다.
실시예 2. 앱시스산 처리에 의한 OsNF-YA4 및 OsNF-YA7 유전자의 발현 경향 분석
앱시스산(ABA, abscisic acid)은 식물의 생장 및 발달을 조절하는 식물호르몬의 하나로, 비생물적 스트레스에 대한 식물체의 반응 및 적응을 조절하는 중요한 물질이다. 추위, 가뭄, 염 등의 비생물적 스트레스 조건에서 특히 그 함량이 늘어나는데, 식물체에 앱시스산을 처리하면 스트레스 조건의 영향과 유사한 상황을 유도할 수 있다. 앱시스산과 OsNF-YA 유전자간의 상호작용을 알아보기 위해서, 비형질전환 벼 식물체에 앱시스산을 처리하고 OsNF-YA4 및 OsNF-YA7 유전자의 발현 수준 변화를 분석하였다.
그 결과, 10 및 100μM의 앱시스산을 단기간으로 처리한 경우에 OsNF-YA7 유전자는 무처리 대조구에 비해 약 30%의 발현 감소를 보인 반면, OsNF-YA4 유전자는 대조구에 비해 4배 이상의 발현 증가 경향을 보여주었다(도 2a). 앱시스산을 장기간으로 처리한 경우 역시, 비슷한 경향의 결과를 나타내었다(도 2b). 이상의 결과들을 통해 앱시스산 처리에 의한 스트레스 조건에서 OsNF-YA4 및 OsNF-YA7 유전자의 발현이 다르게 조절되고 있음을 확인하였다.
실시예 3. OsNF-YA7 유전자 과발현에 의한 가뭄 저항성 검증
전술한 실시예 1을 통해 가뭄 스트레스 조건에서 OsNF-YA7 유전자가 강하게 발현 유도되는 것을 확인하였다. 이에 OsNF-YA7 유전자의 가뭄 저항성에 대한 잠재적인 기능을 확인하기 위해, OsNF-YA4 및 OsNF-YA7 과발현 형질전환 식물체에 가뭄 스트레스를 처리하였다.
가뭄 스트레스 처리 3일 후, 비형질전환 식물체는 잎의 말림 및 시들음과 같은 가뭄 유도 손상의 약한 증상들을 보여주었다. 가뭄 스트레스 처리 시간의 증가와 함께, 비형질전환 식물체의 증상은 심각해졌으며, 가뭄 처리 7일째에 가뭄 유도에 의한 강한 손상 증상을 나타내었다. 비형질전환 식물체의 잎은 모두 말라버렸으며, 물을 재공급하여도 가뭄 스트레스 유도 손상으로부터 식물체는 회복되지 않았다(도 3a). 또한, OsNF-YA4 과발현 형질전환 식물체도 비형질전환 식물체의 결과와 유사하게 확인되었는데, OsNF-YA4 과발현 형질전환 식물체 역시 가뭄 스트레스 처리 시간이 경과할수록 가뭄 스트레스 유도 손상의 증상이 심하게 나타났으며, 물을 재공급한 후에도 손상으로부터 회복되지 않았다. 하지만, OsNF-YA7 과발현 형질전환 식물체는 가뭄 스트레스에 대한 강한 저항성을 보여주었다. OsNF-YA7 과발현 형질전환 식물체는 가뭄 스트레스 처리 3일 후에도 스트레스 무처리 대조구와 거의 동일한 상태를 나타냈으며, 가뭄 스트레스 7일 후에는 스트레스 유도 손상의 증상을 보였으나 가뭄 스트레스 처리 비형질전환 식물체에 비해 증상의 정도가 약하게 확인되었다. 더욱이 물 공급을 재개하자 가뭄 스트레스 유도 손상으로부터 회복되었다. 상기의 결과들을 통해 OsNF-YA7 유전자가 가뭄 스트레스에 대한 저항성을 증진시킬 수 있음을 알 수 있었다.
가뭄 저항성에 있어서 OsNF-YA7의 기능을 확인하기 위해서, OsNF-YA7 과발현 형질전환 식물체의 독립적인 3개 라인을 사용하여 펄스 증폭 변조(PAM, Pulse-Amplitude Modulation) 시험을 수행하였다. PAM 분석의 Fv/Fm 값은 식물에 있어서 비생물적 스트레스의 영향을 관찰하는데 사용되는데, 가뭄 스트레스 처리에 의해 비형질전환 식물체는 Fv/Fm 값의 강한 감소를 나타내었다. 비형질전환 식물체에서 스트레스 무처리 시 Fv/Fm 값은 0.8이었으나, 가뭄 스트레스 처리 1시간 이후부터 Fv/Fm 값의 감소를 보이기 시작하였고, 스트레스 처리 시간의 증가와 함께 감소세가 가속화되는 결과를 보여주었다(도 3b, NT). 반면에, 비형질전환 식물체와는 달리 OsNF-YA7 과발현 형질전환 식물체들은 가뭄 스트레스에 의한 Fv/Fm 값의 감소가 지연되는 결과를 나타내었다. 3개의 OsNF-YA7 과발현 형질전환 식물체들은 가뭄 스트레스 처리 2.5시간까지 무처리 대조구의 Fv/Fm 값과 유사한 수준을 나타내었고, 스트레스 처리 3시간 이후부터 Fv/Fm 값이 감소되는 결과를 보여주었다(도 3b).
하지만, OsNF-YA4 과발현 형질전환 식물체들은 가뭄 스트레스 처리 후에 OsNF-YA7 과발현 형질전환 식물체에서 확인된 것과 같은 Fv/Fm 값의 지연된 감소 경향을 나타내지 않았다. OsNF-YA4 과발현 형질전환 식물체는 비형질전환 식물체의 Fv/Fm 값의 감소경향과 아주 조금의 차이 또는 거의 차이나지 않는 결과를 보여주었다. 이상의 결과는 OsNF-YA7의 과발현이 가뭄에 대한 식물체의 저항성을 증진시킴을 뒷받침하였다.

Claims (11)

  1. 벼(Oryza sativa) 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터를 식물세포에 형질전환시키는 단계를 포함하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법.
  2. 제1항에 있어서, 상기 NF-YA7 단백질은 서열번호 2의 아미노산 서열로 이루어진 것을 특징으로 하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법.
  3. 제1항에 있어서, 상기 비생물적 스트레스는 가뭄 스트레스인 것을 특징으로 하는 식물의 비생물적 스트레스에 대한 내성을 증가시키는 방법.
  4. 벼 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질 코딩 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및
    상기 형질전환된 식물세포로부터 식물을 재분화하는 단계를 포함하는 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체의 제조 방법.
  5. 제4항에 있어서, 상기 NF-YA7 단백질은 서열번호 2의 아미노산 서열로 이루어진 것을 특징으로 하는 방법.
  6. 제4항에 있어서, 상기 비생물적 스트레스는 가뭄 스트레스인 것을 특징으로 하는 방법.
  7. 제4항의 방법에 의해 제조된 야생형에 비해 비생물적 스트레스에 대한 내성이 증가된 형질전환 식물체.
  8. 제7항에 있어서, 상기 비생물적 스트레스는 가뭄 스트레스인 것을 특징으로 하는 형질전환 식물체.
  9. 제7항에 있어서, 상기 식물체는 단자엽 식물인 것을 특징으로 하는 형질전환 식물체.
  10. 제7항에 따른 식물체의 종자.
  11. 서열번호 2의 아미노산 서열로 이루어진 벼 유래 NF-YA7(nuclear factor Y, subunit A7) 단백질을 코딩하는 유전자를 유효성분으로 함유하는, 식물체의 비생물적 스트레스에 대한 내성 증가용 조성물.
PCT/KR2014/001351 2014-02-19 2014-02-19 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도 WO2015125985A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/KR2014/001351 WO2015125985A1 (ko) 2014-02-19 2014-02-19 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도
US15/120,259 US20170058288A1 (en) 2014-02-19 2014-02-19 Osnf-ya7 gene for increasing drought stress resistance of plant and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2014/001351 WO2015125985A1 (ko) 2014-02-19 2014-02-19 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2015125985A1 true WO2015125985A1 (ko) 2015-08-27

Family

ID=53878479

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/001351 WO2015125985A1 (ko) 2014-02-19 2014-02-19 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도

Country Status (2)

Country Link
US (1) US20170058288A1 (ko)
WO (1) WO2015125985A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101898257B1 (ko) 2016-11-01 2018-09-17 대한민국 환경 스트레스 특이적 감자 유래 pStNF-YA7 프로모터 및 이의 용도

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106916826B (zh) * 2017-04-13 2019-10-18 中国科学院华南植物园 水稻基因OsNF-YC4及其应用
US11674148B2 (en) * 2021-08-03 2023-06-13 Seoul National University R&Db Foundation OSNF-YA5 gene from Oryza sativa for increasing nitrogen availability of plant and uses thereof
CN114940994B (zh) * 2022-04-29 2023-07-07 宁波大学 一类水稻转录因子OsNF-YA在水稻抗病毒中的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030097366A (ko) * 2002-06-20 2003-12-31 주식회사 그린진 바이오텍 비생물성 스트레스에 대한 단자엽 식물의 내성을증가시키는 방법
JP2011229521A (ja) * 2010-04-09 2011-11-17 Osaka Univ ヤトロファ由来のｎｆ−ｙｂをコードするポリヌクレオチド及びその利用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110131679A2 (en) * 2000-04-19 2011-06-02 Thomas La Rosa Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030097366A (ko) * 2002-06-20 2003-12-31 주식회사 그린진 바이오텍 비생물성 스트레스에 대한 단자엽 식물의 내성을증가시키는 방법
JP2011229521A (ja) * 2010-04-09 2011-11-17 Osaka Univ ヤトロファ由来のｎｆ−ｙｂをコードするポリヌクレオチド及びその利用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank [O] 16 February 2008 (2008-02-16), XP055222255, retrieved from ncbi Database accession no. BAD03416.1 *
KIM, HYEONG IL: "Functional Characterization of Stress Inducible Transcription Factors OsHAP2A and OsHAP2D in Rice", MASTER'S THESIS: GRADUATE SCHOOL OF MYONGJI UNIVERSITY, DIVISION OF ENVIRONMENTAL ENG. AND BIOTECHNOLOGY & INSTITUTE FOR INDUSTRIAL TECHNOLOGY, February 2013 (2013-02-01), pages 1 - 40 *
LEYVA-GONZALEZ, MARCO ANTONIO ET AL.: "Functional and transcriptome analysis reveals an acclimatization strategy for abiotic stress tolerance mediated by Arabidopsis NF-YA family members", PLOS ONE, vol. 7, no. 10, 31 October 2012 (2012-10-31), pages 1 - 18, XP002711317, ISSN: 1932-6203 *
SIEFERS, NICHOLAS ET AL.: "Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors suggest potential for extensive combinatorial complexity", PLANT PHYSIOLOGY, vol. 149, no. 2, February 2009 (2009-02-01), pages 625 - 641, XP055222252, ISSN: 0032-0889 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101898257B1 (ko) 2016-11-01 2018-09-17 대한민국 환경 스트레스 특이적 감자 유래 pStNF-YA7 프로모터 및 이의 용도

Also Published As

Publication number Publication date
US20170058288A1 (en) 2017-03-02

Similar Documents

Publication Publication Date Title
EP1546336B1 (en) Polynucleotides and polypeptides in plants
CA2516645C (en) Abiotic stress responsive plant transcription factor polynucleotides and polypeptides and use thereof for generating transgenic plants
US8912394B2 (en) Transcriptional regulation of plant disease tolerance
KR100833473B1 (ko) 개화시기에 관여하는 조절 유전자 ｓｖｐ
US7186563B2 (en) Methods and compositions for regulating plant stress tolerance
EP1928226A2 (en) Stress tolerance in plants
JP2009515522A (ja) Ｄｏｆ（ｄｎａｂｉｎｄｉｎｇｗｉｔｈｏｎｅｆｉｎｇｅｒ）配列および使用方法
WO2015125985A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도
US20180155736A1 (en) Manipulating plant sensitivity to light
Min et al. Maize ZmRAV1 contributes to salt and osmotic stress tolerance in transgenic Arabidopsis
EP2152734A1 (en) Yield enhancement in plants by modulation of maize mads box transcription factor zmm28
US7714187B2 (en) Phytate polynucleotides and methods of use
WO2015152471A1 (ko) 식물의 가뭄 스트레스에 대한 내성을 증가시키는 벼 유래 mir399f 전구체 dna 및 이의 용도
KR101465692B1 (ko) AtbHLH113 유전자를 이용한 안토시아닌 생합성이 조절된 형질전환 식물체의 제조방법 및 그에 따른 식물체
WO2009000789A1 (en) Yield enhancement in plants by modulation of maize myb-ada2 gene
EP3166964A1 (en) Means and methods to increase plant yield
CA2921071A1 (en) Plants producing seeds which remove chlorophyl during maturation under stress conditions
WO2013022149A1 (ko) 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체
KR101746106B1 (ko) 식물체의 뿌리 생장 및 발달을 조절하는 osa-miR444a.4 유전자 및 이의 용도
KR101376522B1 (ko) 내염성을 증가시키는 벼 유래의 ＯｓＭＬＤ 유전자 및 이의 용도
US20130031669A1 (en) Plant transcriptional regulators of abiotic stress ii
Moon et al. Identification of a drought responsive gene encoding a nuclear protein involved in drought and freezing stress tolerance in Arabidopsis
WO2016159560A1 (ko) 식물체의 환경 스트레스 내성을 조절하는 고구마 유래의 ＩｂＨＰＰＤ 유전자 및 이의 용도
WO2016175351A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 ＯｓＩＡＡ6 유전자 및 이의 용도
KR101402602B1 (ko) 벼 유래 OsCYP18-2 유전자를 이용한 환경 스트레스에 대한 내성이 증진된 형질전환 식물체의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14882983

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15120259

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 14882983

Country of ref document: EP

Kind code of ref document: A1