CA2921071A1 - Plants producing seeds which remove chlorophyl during maturation under stress conditions - Google Patents

Abstract

A method for inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions. The method comprises modulating activity or expression in seeds of the plant the transcription factor ABA Insensitive 3 (ABI3) and/or chlorophyll degradation proteins Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity. Also provided are isolated nucleic acid constructs, and their stable inclusion in transgenic plants. The transgenic plants have shown desirable phenotypic characteristics when compared to control plants, in particular, the ability to produce seeds which remove chlorophyll under stress conditions, such as cold temperatures or other environmental stresses.

Description

PLANTS PRODUCING SEEDS WHICH REMOVE CHLOROPHYL DURING
MATURATION UNDER STRESS CONDITIONS
FIELD OF INVENTION
The present invention relates to plants that produce seeds with the phenotype of removing chlorophyll during maturation under stress conditions. In particular, the invention relates to modulation of the transcription factor ABI3 and its targets SGR1 or SGR2 in plants or plant seeds to maintain the ability of the plant seed to remove chlorophyll, even under a stress such as cold temperatures, drought conditions, osmotic stress and other environmental stresses.
BACKGROUND OF THE INVENTION
The success of angiosperms impinges on their ability to desiccate and protect their embryos in a dormant state until favorable conditions are perceived. In many angiosperms and oil seed plants such as Arabidopsis and canola, this desiccation process during seed maturation is intricately coupled to loss of chlorophyll from photosynthetically active embryos. During the embryo maturation phase, as the embryos begin to lose their chlorophyll, they concomitantly initiate the process of acquisition of desiccation tolerance and dormancy, thereby producing mature, brown (de-greened) and dormant seeds.
Chlorophyll is essential for light capture and is the starting point that provides the energy for photosynthesis and thus plant growth. Obviously, for this reason, retention of the green chlorophyll pigment is considered a desirable crop trait. However, the presence of chlorophyll in mature seeds can be an undesirable trait that can affect seed maturation, seed oil quality and meal quality. Occurrence of mature green seeds in oil crops such as canola and soybean due to unfavorable weather conditions during seed maturity is known to cause severe losses in revenue.
Accordingly, there is a need in the agricultural industry for plants or crops which produce seeds that can still remove chlorophyll during maturation following stressful conditions, such as cold temperatures (e.g. frost) or high heat and drought conditions that the immature seeds are exposed to (e.g. Swathing in canola) or other environmental stresses.

SUMMARY OF THE INVENTION
An object of the invention, therefore, is to provide a means to induce in a plant the ability to produce seeds that remove chlorophyll under stress conditions.
Accordingly, the present invention relates to a method of inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions, comprising modulating activity or expression in said plant or seeds of transcription factor ABA Insensitive 3 (ABI3) and/or chlorophyll degradation proteins Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity.
In certain non-limiting embodiments of the invention, the polypeptide may comprise an amino acid sequence with 60%, or 75%, or 80%, or 90%, or 95%, or even 99% identity to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.
In addition, certain non-limiting embodiments of the method may involve steps of: a) introducing into the plant a nucleic acid construct encoding at least one promoter operably linked to at least one nucleic acid that modulates expression of ABI3, SGR1 or SGR2, or the polypeptide having ABI3, SGR1 or SGR2 activity in said plant; and b) selecting for and regenerating and/or propagating the resulting transgenic plant.
In other embodiments, which are also non-limiting, the method may involve overexpressing ABI3, SGR1 or SGR2, or the polypeptide having ABI3, SGR1 or SGR2 activity, such that the expression level of the ABI3, SGR1, SGR2, or polypeptide having ABI3, SGR1 or activity is increased in the seeds of the modified plant as compared to expression levels of ABI3, SGR1, SGR2, or a polypeptide having ABI3, SGR1 or SGR2 activity in seeds of unmodified plants.
In other non-limiting embodiments, the stress conditions may include cold temperatures, drought, heat, or osmotic stress.
There is also provided herein a transgenic plant produced according to the above method. In certain embodiments, the plant may be one of the following types of crop species: canola, soybean, maize, wheat, rye, oat, triticale, rice, millet, sorghum, barley, peanut, cotton, rapeseed,

2 manihot, pepper, sunflower, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass, and forage crop plant. Cells and seeds of the transgenic plants are also provided.
In another aspect, there is also provided a nucleic acid construct for inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions. The nucleic acid construct comprises at least one promoter operably linked to at least one nucleic acid that modulates activity or expression of transcription factor ABA Insensitive 3 (ABI3) and/or chlorophyll degradation proteins Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity.
In certain non-limiting embodiments of the above nucleic acid construct, the polypeptide may comprise an amino acid sequence with 60%, or 75%, or 80%, or 90%, or 95%, or even 99%
identity to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID
NO:7.
In other non-limiting embodiments of the above nucleic acid construct, the at least one nucleic acid may comprise a polynucleotide sequence having 60%, or 75%, or 80%, or 90%, or 95%, or even 99% identity to the polynucleotide sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID
NO:6 or SEQ ID NO:8.
SEQ ID NO:1 is the amino acid sequence of ABI3, and SEQ ID NO:2 is the DNA
sequence of ABI3, in Arabidopsis thaliana. SEQ ID NO:3 is the amino acid sequence of SGR1, and SEQ ID
NO:4 is the DNA sequence of SGR1, in Arabidopsis thaliana. SEQ ID NO:5 is the amino acid sequence of SGR2, and SEQ ID NO:6 is the DNA sequence of SGR2, in Arabidopsis thaliana.
SEQ ID NO:7 is the amino acid sequence of ABI3, and SEQ ID NO:8 is the DNA
sequence of ABI3, in Brassica napus.
A DNA based molecule for carrying the described nucleic acid construct is also provided, including but not limited to plasmids and vectors. Transgenic plant cells and transgenic tissue cultures comprising the above nucleic acid construct are also provided, as are transgenic plants regenerated and comprising the aforesaid plant cell or tissue culture. The transgenic plant may, in certain embodiments, be either hemizygous or homozygous for the nucleic acid. The

3 transgenic plant may also be a monocot or a dicot. For example, yet without wishing to be limiting in any way, the plant may be one of the following plant types: fruit-bearing plants, vegetable-bearing plants, plants used in the cut flower industry, grain-producing plants, oil-producing plants, nut-producing plants, crops including sugar beet, coffee, cacao, tea, soybean, cotton, flax, tobacco, pepper, perennial grasses, conifers and evergreens.
Plant seeds produced by the described transgenic plants are also provided, whereby the seeds comprise the nucleic acid construct. The seed may also, in certain embodiments, be true breeding for producing plants with seeds that remove chlorophyll under stress conditions, as compared to a wild type variety of the seed.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other features of the invention will become more apparent from the following description in which reference is made to the following appended drawings:
Figure 1: SGR gene family in plants Figure 2: SGR1 and SGR2 are upregulated during seed maturation and are reduced in abi3-6 background. A. Seed and mature embryo phenotypes of abi3-6 and abi3-8 mutants compared to Col-0 (Scale=lmm) B. Upregulation of SGR1 and SGR2 expression in Col-0 embryos between 13 and 16 DAF. Values in brackets indicate expression relative to AtTUB4 expression C. SGR1 and SGR2 expression in abi3-6 and abi3-8 mutants relative to Col-0, normalized against AtTUB4. Values are means SE of three biological replicates. D.
Electrophoretic mobility shift assays (EMSA) of recombinant ABI3 B3 domain protein with 32P-labelled probes derived from the SGR1 and SGR2 gene promoters. Competition experiments were performed using increasing amounts (10X, 100X, 1000X) of the SGR1/SGR2 unlabelled probes. The B3-binding target sequence is shown below the autoradiographs.
Figure 3: SGR1 and SGR2 overexpression rescues abi3-6 stay-green embryo phenotype.
Phenotype of three representative lines (F, G, H) from abi3-6 / 35S::SGR1 (A) and abi3-6 /
355::SGR2 (A, B, D) (B) showing rescue of embryo degreening. The respective RT-PCR
analysis to verify SGR1 and SGR2 overexpression is shown below the figures. C.
Seed desiccation tolerance assay. Mature seeds from Col-0, abi3-6 and the abi3-6/35S::SGR

4 overexpressors (A,B,D,F,G,H) were stored for four weeks followed by stratification and germination on 0.5X MS plates to assess desiccation tolerance.
Figure 4: SGR1 and SGR2 play a redundant function in embryo de-greening Col-0, sgr 1-1, sgr2-2 and sgr1-1/sgr2-2 mutants were analyzed for, A. SGR1 and SGR2 expression at 16 DAF
through either qRT-PCR (left) or RT-PCR (right). Values indicate levels of SGR2 transcripts relative to Col-0 B. Seed de-greening from 13 DAF to 17 DAF and at maturity (desiccated) in-planta C. chlorophyll accumulation in mature seeds D. ABA sensitivity (2 [tM
and 10 [tM
ABA) following storage for four weeks. Values are means SEM of three biological replicates Figure 5: ABI3 overexpression rescues cold-induced green seeds in Arabidopsis.
A. Mature seeds from Col-0 and ABI3 overexpressing (35S::ABI3/abi3-6) plants showing cold-induced effect on de-greening. Arabidopsis plants were exposed to -5 C to -10 C (2 hours/day) for 1 to 3 days at various stages of pod development, followed by maintenance at ambient temperature (22 C). Following maturation, the seeds were harvested and observed for presence of green seeds. B. RT-qPCR analysis of ABI3 (left panel), SGR1 (middle) and SGR2 (right) expression in seeds (11-13 DAF) either left untreated or exposed to freezing as in Figure 5A and allowed to recover for either 1 day or 2 days at ambient temperature (n=4). Asterisks indicate p<0.05 compared to untreated Col-0. Values indicate abundance of respective transcripts relative to untreated Col-0.
Figure 6. Genetic Network regulating embryo degreening in Arabidopsis. Embryo de-greening is exclusively orchestrated by ABI3. ABI3 controls embryo degreening through regulating transcription of functionally redundant SGR1 (Mendel's I locus) and SGR2, which function downstream of ABI3 to mediate de-greening. This de-greening process is also partially coupled to ABA sensitivity. (Dashed arrows: Transcriptional regulation; Thin arrows:
partial or lesser control).
Figure 7: A. Protein domains of ABI3 with the locations of the published mutations (modified from Nambara et al., 2002). B. Transient expression of GFP-ABI3, GFP-ABI3-6 and GFP-ABI3-8 in suspension-cultured tobacco cells. C. EFP-browser data showing ABI3 and SGR1 expression during Arabidopsis embryo maturation stages.

5 Figure 8: Gene expression profiles of abi3-6 embryos at 13 DAF. Fold changes (log2) of expression values of abi3-6 embryos relative to expression in Col-0 with P
<0.01 are represented as blue (upregulated), red (downregulated) and white (unchanged) squares for each gene based on the pathway analysis program MapMan (http://www.gabipd.org/projects/MapMan/).
Figure 9: Vegetative phenotypes of abi3-6/35S::SGR1 and abi3-6/35S::SGR2. A.

overexpression in abi3-6 background resulted in leaf yellowing phenotypes, while SGR2 overexpression did not cause any shoot phenotypes (B).
Figure 10: Protein profiles were analyzed from mature seeds of Col-0, abi3-6 and abi3-

6/35S::SGR overexpressors A. Freshly harvested mature seeds from the transgenic lines were tested for ABA sensitivity by germinating them on 10 and 25 [tM ABA without stratification.
Radicle emergence was observed at either 24h (B) or 72h (C) following plating.
Values are means SEM of three biological replicates. Germination index was measured as the ratio of %
germination on treatment plates / % germination of abi3-6 on half strength MS
plates.
Figure 11: Protein profiles were analyzed from mature seeds of Col-0, abi3-6, sgrl-1, sgr2-2 and sgr1-1/sgr2-2.
Figure 12: Induced senescence assay indicates a seed specific de-greening phenotype in abi3-6.
Rosette phenotypes of Col-0, abi3-6, sgrl-1 and sgr2-2 homozygous T-DNA
insertional lines after 7 days of dark-induced senescence.
Figure 13: RT-qPCR analysis of RAB18 expression in seeds (11-13 DAF) that were either left untreated or exposed to freezing as in Figure 5A and allowed to recover for either 1 day or 2 days at ambient temperature (n=4). Asterisk indicates p<0.05 compared to untreated Col-0.
Figure 14: Spring frost tolerance of RD29a::BnABI3 canola plants. After treatment at -3 C for 3 hours for 2 consecutive days, wild type (WT) plants have yellow leaves showing evidence of damaged tissue and plant death. Plants overexpressing ABI3 (RD29a::BnAB/3) remain viable with minimal or no signs of tissue damage after treatment (-3 C, 3 hrs).
Figure 15: Fall frost tolerance of RD29a::BnAB/3 canola seeds. WT and ABI3 overexpressing (RD29a::BnABI3) plants were exposed to -6 C for 4 hours, followed by maintenance at ambient temperature (22 C). Following maturation, the seeds were harvested and observed for presence of green seeds. Seeds were cut in half to show the seed interior after the outer coat was taken off WT seeds have excessive chlorophyll and are shrivelled from the cold treatment. By comparison, the RD29a::BnAB/3 transgenic lines maintained their seed shape better and had increased ability to remove excess chlorophyll.
DETAILED DESCRIPTION
The present invention relates to a method for inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions. The method comprises modulating activity or expression in seeds of the plant the transcription factor ABA Insensitive 3 (ABI3) and/or chlorophyll degradation proteins Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity.
Also provided is a nucleic acid construct for inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions. The nucleic acid construct comprises at least one promoter operably linked to at least one nucleic acid that modulates activity or expression of ABI3, SGR1 or SGR2, or a polypeptide having ABI3, SGR1 or SGR2 activity. The stable inclusion of the nucleic acid construct in transgenic plants is also provided herein. The transgenic plants have shown desirable phenotypic characteristics when compared to control plants, in particular, the ability to produce seeds which remove chlorophyll under stress conditions, such as cold temperatures or other environmental stresses.
Also included herein are the transgenic plants produced by the methods of the invention, or which comprise the described nucleic acid construct, and the seed produced by the plants which produce a plant that has an altered phenotype.
All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as they would to one skilled in the art of the present invention.
Practitioners are particularly

7 directed to Sambrook et al., Molecular Cloning: A Laboratory Manual (Second Edition), Cold Spring Harbor Press, Plainview, NY, 1989, and Ausubel F M et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1993.
DEFINITIONS
"Nucleic acid molecule" refers to an oligonucleotide, polynucleotide or any fragment thereof. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein, or other materials to perform a particular activity such as transformation or form a useful composition such as a peptide nucleic acid (PNA).
"Polynucleotide" is a nucleic acid molecule comprising a plurality of polymerized nucleotides, e.g., at least about 15 consecutive polymerized nucleotides. A polynucleotide may be a nucleic acid, oligonucleotide, nucleotide, or any fragment thereof. In many instances, a polynucleotide comprises a nucleotide sequence encoding a polypeptide (or protein) or a domain or fragment thereof. Additionally, the polynucleotide may comprise a promoter, an intron, an enhancer region, a polyadenylation site, a translation initiation site, 5' or 3' untranslated regions, a reporter gene, a selectable marker, or the like. The polynucleotide can be single-stranded or double-stranded DNA or RNA. The polynucleotide optionally comprises modified bases or a modified backbone. The polynucleotide can be, e.g., genomic DNA or RNA, a transcript (such as an mRNA), a cDNA, a PCR product, a cloned DNA, a synthetic DNA or RNA, or the like. The polynucleotide can be combined with carbohydrate, lipids, protein, or other materials to perform a particular activity such as transformation or form a useful composition such as a peptide nucleic acid (PNA). The polynucleotide can comprise a sequence in either sense or antisense orientations. "Oligonucleotide" is substantially equivalent to the terms amplimer, primer, oligomer, element, target, and probe and is preferably single-stranded.
"Gene" or "gene sequence" refers to the partial or complete coding sequence of a gene, its complement, and its 5' or 3' untranslated regions. A gene is also a functional unit of inheritance, and in physical terms is a particular segment or sequence of nucleotides along a molecule of DNA (or RNA, in the case of RNA viruses) involved in producing a polypeptide chain. The latter may be subjected to subsequent processing such as chemical modification and folding to obtain a functional protein or polypeptide. A gene may be isolated, partially isolated, or be

8

9 found with an organism's genome. By way of example, a transcription factor gene encodes a transcription factor polypeptide, which may be functional or require processing to function as an initiator of transcription.
Operationally, genes may be defined by the cis-trans test, a genetic test that determines whether two mutations occur in the same gene and that may be used to determine the limits of the genetically active unit (Rieger et al. (1976) Glossary of Genetics and Cytogenetics: Classical and Molecular. 4th ed., Springer Verlag. Berlin). A gene generally includes regions preceding ("leaders"; upstream) and following ("trailers"; downstream) the coding region. A gene may also include intervening, non-coding sequences, referred to as "introns", located between individual coding segments, referred to as "exons". Most genes have an associated promoter region, a regulatory sequence 5' of the transcription initiation codon (there are some genes that do not have an identifiable promoter). The function of a gene may also be regulated by enhancers, operators, and other regulatory elements.
A "recombinant polynucleotide" is a polynucleotide that is not in its native state, e.g., the polynucleotide comprises a nucleotide sequence not found in nature, or the polynucleotide is in a context other than that in which it is naturally found, e.g., separated from nucleotide sequences with which it typically is in proximity in nature, or adjacent (or contiguous with) nucleotide sequences with which it typically is not in proximity. For example, the sequence at issue can be cloned into a vector, or otherwise recombined with one or more additional nucleic acid.
An "isolated polynucleotide" is a polynucleotide, whether naturally occurring or recombinant, that is present outside the cell in which it is typically found in nature, whether purified or not.
Optionally, an isolated polynucleotide is subject to one or more enrichment or purification procedures, e.g., cell lysis, extraction, centrifugation, precipitation, or the like.
"Fragment", with respect to a polynucleotide, refers to a clone or any part of a polynucleotide molecule that retains a usable, functional characteristic.
Useful fragments include oligonucleotides and polynucleotides that may be used in hybridization or amplification technologies or in the regulation of replication, transcription or translation. A "polynucleotide fragment" refers to any subsequence of a polynucleotide, typically at least about nine or more consecutive nucleotides of any of the sequences provided herein. Exemplary polynucleotide fragments are the first sixty consecutive nucleotides of the transcription factor polynucleotides listed in the Sequence Listing. Exemplary fragments also include fragments that comprise a region that encodes an Al, Bl, B2 or a B3 domain of a transcription factor.
Fragments may also include subsequences of polypeptides and protein molecules, or a subsequence of the polypeptide. Fragments may have uses in that they may have antigenic potential. In some cases, the fragment or domain is a subsequence of the polypeptide which performs at least one biological function of the intact polypeptide in substantially the same manner, or to a similar extent, as does the intact polypeptide. For example, a polypeptide fragment can comprise a recognizable structural motif or functional domain such as a DNA-binding site or domain that binds to a DNA promoter region, an activation domain, or a domain for protein-protein interactions, and may initiate transcription.
Fragments can vary in size from as few as 3 amino acid residues to the full length of the intact polypeptide, but are preferably at least about 30 amino acid residues in length. Exemplary polypeptide fragments are the first twenty consecutive amino acids of a mammalian protein encoded by are the first twenty consecutive amino acids of the transcription factor polypeptides listed in the Sequence Listing.
The invention also encompasses production of DNA sequences that encode transcription factors and transcription factor derivatives, or fragments thereof, entirely by synthetic chemistry. After production, the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents well known in the art. Moreover, synthetic chemistry may be used to introduce mutations into a sequence encoding transcription factors or any fragment thereof.
A "polypeptide" is an amino acid sequence comprising a plurality of consecutive polymerized amino acid residues e.g., at least about 15 consecutive polymerized amino acid residues. In many instances, a polypeptide comprises a polymerized amino acid residue sequence that is a transcription factor or a domain or portion or fragment thereof. Additionally, the polypeptide may comprise (i) a localization domain; (ii) an activation domain; (iii) a repression domain; (iv) an oligomerization domain; or (v) a DNA-binding domain, or the like. The polypeptide optionally comprises modified amino acid residues, naturally occurring amino acid residues not encoded by a codon, or non-naturally occurring amino acid residues.
"Protein" refers to an amino acid sequence, oligopeptide, peptide, polypeptide or portions thereof whether naturally occurring or synthetic. With respect to a polypeptide, "portion", as used herein refers to any part of a polypeptide used for any purpose, including the screening of a library of molecules that specifically bind to that portion or for the production of antibodies.
A "recombinant polypeptide" is a polypeptide produced by translation of a recombinant polynucleotide. A "synthetic polypeptide" is a polypeptide created by consecutive polymerization of isolated amino acid residues using methods well known in the art. An "isolated polypeptide," whether a naturally occurring or a recombinant polypeptide, is more enriched in (or out of) a cell than the polypeptide in its natural state in a wild-type cell, e.g., more than about 5% enriched relative to wild type standardized at 100%. Such an enrichment is not the result of a natural response of a wild-type plant. Alternatively, or additionally, the isolated polypeptide is separated from other cellular components with which it is typically associated, e.g., by any of the various protein purification methods herein.
"Homology" refers to sequence similarity between a reference sequence and at least a fragment of a newly sequenced clone insert or its encoded amino acid sequence.
"Identity" or "similarity" refers to sequence similarity between two polynucleotide sequences or between two polypeptide sequences, with identity being a more strict comparison. The phrases "percent identity" and "% identity" refer to the percentage of sequence similarity found in a comparison of two or more polynucleotide sequences or two or more polypeptide sequences.
"Sequence similarity" refers to the percent similarity in base pair sequence (as determined by any suitable method) between two or more polynucleotide sequences. Two or more sequences can be anywhere from 0-100% similar, or any integer value there between. Identity or similarity can be determined by comparing a position in each sequence that may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleotide base or amino acid, then the molecules are identical at that position. A degree of similarity or identity between polynucleotide sequences is a function of the number of identical similar or matching nucleotides at positions shared by the polynucleotide sequences. A degree of identity of polypeptide sequences is a function of the number of identical amino acids at positions shared by the polypeptide sequences. A degree of homology or similarity of polypeptide sequences is a function of the number of amino acids at positions shared by the polypeptide sequences.
With regard to polypeptides, the terms "substantial identity" or "substantially identical" may refer to sequences of sufficient similarity and structure to the transcription factors in the Sequence Listing to produce similar function when expressed or overexpressed in a plant; in the present invention, this function is increased tolerance to abiotic stress.
Sequences that are at least about 80% identical, to the instant polypeptide sequences, including Al, B 1, B2 and B3 domain sequences, are considered to have "substantial identity" with the latter. Sequences having lesser degrees of identity but comparable biological activity are considered to be equivalents. The structure required to maintain proper functionality is related to the tertiary structure of the polypeptide. There are discreet domains and motifs within a transcription factor that must be present within the polypeptide to confer function and specificity. These specific structures are required so that interactive sequences will be properly oriented to retain the desired activity. "Substantial identity" may thus also be used with regard to subsequences, for example, motifs, that are of sufficient structure and similarity, being at least about 80% identical to similar motifs in other related sequences so that each confers or is required for increased tolerance to abiotic stress.
"Alignment" refers to a number of nucleotide or amino acid residue sequences aligned by lengthwise comparison so that components in common (i.e., nucleotide bases or amino acid residues at corresponding positions) may be visually and readily identified.
The fraction or percentage of components in common is related to the homology or identity between the sequences. An alignment may suitably be determined by means of computer programs known in the art, such as Mac Vector (1999) (Accelrys, Inc., San Diego, CA).
A "conserved domain" or "conserved region" as used herein refers to a region in heterologous polynucleotide or polypeptide sequences where there is a relatively high degree of sequence identity between the distinct sequences. Al, Bl, B2 and B3 domains are examples of conserved domains. With respect to polynucleotides encoding presently disclosed transcription factors, a conserved domain is preferably at least 10 base pairs (bp) in length.
A "conserved domain", with respect to presently disclosed polypeptides refers to a domain within a transcription factor family that exhibits a higher degree of sequence homology, such as at least 70% sequence similarity, including conservative substitutions, greater than about 70%
identity, or at least about 79%, 81%, 86%, 87%, 89%, 91%, 95%, or 98% amino acid residue sequence identity of a polypeptide of consecutive amino acid residues. A
fragment or domain can be referred to as outside a conserved domain, outside a consensus sequence, or outside a consensus DNA-binding site that is known to exist or that exists for a particular transcription factor class, family, or subfamily. In this case, the fragment or domain will not include the exact amino acids of a consensus sequence or consensus DNA-binding site of a transcription factor class, family or sub-family, or the exact amino acids of a particular transcription factor consensus sequence or consensus DNA-binding site.
Furthermore, a particular fragment, region, or domain of a polypeptide, or a polynucleotide encoding a polypeptide, can be "outside a conserved domain" if all the amino acids of the fragment, region, or domain fall outside of a defined conserved domain(s) for a polypeptide or protein. Sequences having lesser degrees of identity but comparable biological activity are considered to be equivalents.
As one of ordinary skill in the art recognizes, conserved domains may be identified as regions or domains of identity to a specific consensus sequence (for example, Riechmann et al. (2000) Science 290: 2105-2110). Thus, by using alignment methods well known in the art, the conserved domains (i.e., Al, Bl, B2 and B3) of the ABI3, SGR1 and SGR2 plant transcription factors (Riechmann and Meyerowitz (1998) Biol. Chem. 379:633-646) may be determined.
"Complementary" refers to the natural hydrogen bonding by base pairing between purines and pyrimidines. For example, the sequence A-C-G-T (5' -> 3') forms hydrogen bonds with its complements A-C-G-T (5' -> 3') or A-C-G-U (5' -> 3'). Two single-stranded molecules may be considered partially complementary, if only some of the nucleotides bond, or "completely complementary" if all of the nucleotides bond. The degree of complementarity between nucleic acid strands affects the efficiency and strength of hybridization and amplification reactions.
"Fully complementary" refers to the case where bonding occurs between every base pair and its complement in a pair of sequences, and the two sequences have the same number of nucleotides.
The terms "highly stringent" or "highly stringent condition" refer to conditions that permit hybridization of DNA strands whose sequences are highly complementary, wherein these same conditions exclude hybridization of significantly mismatched DNAs.
Polynucleotide sequences capable of hybridizing under stringent conditions with the polynucleotides of the present invention may be, for example, variants of the disclosed polynucleotide sequences, including allelic or splice variants, or sequences that encode orthologs or paralogs of presently disclosed polypeptides. Nucleic acid hybridization methods are disclosed in detail by Kashima et al.
(1985) Nature 313:402-404; Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual.
2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. ("Sambrook");
and by Haymes et al., Nucleic Acid Hybridization: A Practical Approach. 1RL Press, Washington, D.C.
(1985), which references are incorporated herein by reference.
In general, stringency is determined by the temperature, ionic strength, and concentration of denaturing agents (e.g., formamide) used in a hybridization and washing procedure (a more detailed description of establishing and determining stringency is presented below). The degree to which two nucleic acids hybridize under various conditions of stringency is correlated with the extent of their similarity. Thus, similar nucleic acid sequences from a variety of sources, such as within a plant's genome (as in the case of paralogs) or from another plant (as in the case of orthologs) that may perform similar functions can be isolated on the basis of their ability to hybridize with known transcription factor sequences. Numerous variations are possible in the conditions and means by which nucleic acid hybridization can be performed to isolate transcription factor sequences having similarity to transcription factor sequences known in the art and are not limited to those explicitly disclosed herein. Such an approach may be used to isolate polynucleotide sequences having various degrees of similarity with disclosed transcription factor sequences, such as, for example, transcription factors having 60% or more identity with disclosed transcription factors.
Regarding the terms "paralog" and "ortholog", homologous polynucleotide sequences and homologous polypeptide sequences may be paralogs or orthologs of the claimed polynucleotide or polypeptide sequences. Orthologs and paralogs are evolutionarily-related genes that have similar sequence and similar functions. Orthologs are structurally-related genes in different species that are derived by a speciation event. Paralogs are structurally related genes within a single species that are derived by a duplication event. Sequences that are sufficiently similar to one another will be appreciated by those of skill in the art and may be based upon percentage identity of the complete sequences, percentage identity of a conserved domain or sequence within the complete sequence, percentage similarity to the complete sequence, percentage similarity to a conserved domain or sequence within the complete sequence, and/or an arrangement of contiguous nucleotides or peptides particular to a conserved domain or complete sequence. Sequences that are sufficiently similar to one another will also bind in a similar manner to the same DNA binding sites of transcriptional regulatory elements using methods well-known to those of skill in the art.
The term "equivalog" describes members of a set of homologous proteins that are conserved with respect to function since their last common ancestor. Related proteins are grouped into equivalog families, and otherwise into protein families with other hierarchically defined homology types. This definition is provided at the Institute for Genomic Research (TIGR) world wide web (www) website, " tigr.org " under the heading "Terms associated with TIGRFAMs".
The term "variant", as used herein, may refer to polynucleotides or polypeptides that differ from the presently disclosed polynucleotides or polypeptides, respectively, in sequence from each other, and as set forth below.
With regard to polynucleotide variants, differences between presently disclosed polynucleotides and polynucleotide variants are limited so that the nucleotide sequences of the former and the latter are closely similar overall and, in many regions, identical. Due to the degeneracy of the genetic code, differences between the former and latter nucleotide sequences may be silent (i.e., the amino acids encoded by the polynucleotide are the same, and the variant polynucleotide sequence encodes the same amino acid sequence as the presently disclosed polynucleotide).
Variant nucleotide sequences may encode different amino acid sequences, in which case such nucleotide differences will result in amino acid substitutions, additions, deletions, insertions, truncations or fusions with respect to the similar disclosed polynucleotide sequences. These variations may result in polynucleotide variants encoding polypeptides that share at least one functional characteristic. The degeneracy of the genetic code also dictates that many different variant polynucleotides can encode identical and/or substantially similar polypeptides in addition to those sequences illustrated in the Sequence Listing.

Also within the scope of the invention is a variant of a transcription factor nucleic acid listed in the Sequence Listing, that is, one having a sequence that differs from the one of the polynucleotide sequences in the Sequence Listing, or a complementary sequence, that encodes a functionally equivalent polypeptide (i.e., a polypeptide having some degree of equivalent or similar biological activity) but differs in sequence from the sequence in the Sequence Listing, due to degeneracy in the genetic code. Included within this definition are polymorphisms that may or may not be readily detectable using a particular oligonucleotide probe of the polynucleotide encoding polypeptide, and improper or unexpected hybridization to allelic variants, with a locus other than the normal chromosomal locus for the polynucleotide sequence encoding polypeptide.
"Allelic variant" or "polynucleotide allelic variant" refers to any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations may be "silent" or may encode polypeptides having altered amino acid sequence.
"Allelic variant"
and "polypeptide allelic variant" may also be used with respect to polypeptides, and in this case the terms refer to a polypeptide encoded by an allelic variant of a gene.
"Splice variant" or "polynucleotide splice variant" as used herein refers to alternative forms of RNA transcribed from a gene. Splice variation naturally occurs as a result of alternative sites being spliced within a single transcribed RNA molecule or between separately transcribed RNA
molecules, and may result in several different forms of mRNA transcribed from the same gene.
Thus, splice variants may encode polypeptides having different amino acid sequences, which may or may not have similar functions in the organism. "Splice variant" or "polypeptide splice variant" may also refer to a polypeptide encoded by a splice variant of a transcribed mRNA.
As used herein, "polynucleotide variants" may also refer to polynucleotide sequences that encode paralogs and orthologs of the presently disclosed polypeptide sequences.
"Polypeptide variants"
may refer to polypeptide sequences that are paralogs and orthologs of the presently disclosed polypeptide sequences.
Differences between presently disclosed polypeptides and polypeptide variants are limited so that the sequences of the former and the latter are closely similar overall and, in many regions, identical. Presently disclosed polypeptide sequences and similar polypeptide variants may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination. These differences may produce silent changes and result in a functionally equivalent transcription factor. Thus, it will be readily appreciated by those of skill in the art, that any of a variety of polynucleotide sequences is capable of encoding the transcription factors and transcription factor homolog polypeptides of the invention. A polypeptide sequence variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties.
Deliberate amino acid substitutions may thus be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues, as long as a substantial amount of the functional or biological activity of the transcription factor is retained.
For example, negatively charged amino acids may include aspartic acid and glutamic acid, positively charged amino acids may include lysine and arginine, and amino acids with uncharged polar head groups having similar hydrophilicity values may include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine;
and phenylalanine and tyrosine. More rarely, a variant may have "non-conservative" changes, for example, replacement of a glycine with a tryptophan. Similar minor variations may also include amino acid deletions or insertions, or both. Related polypeptides may comprise, for example, additions and/or deletions of one or more N-linked or 0-linked glycosylation sites, or an addition and/or a deletion of one or more cysteine residues. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing functional or biological activity may be found using computer programs well known in the art, for example, DNASTAR
software (for example, in US 5,840,544).
"Modulates" refers to a change in activity or expression level (e.g.
overexpression) of a polypeptide or nucleic acid as compared to wild type activity or expression of the same polypeptide or nucleic acid. The term "plant" includes whole plants, shoot vegetative organs/structures (for example, leaves, stems and tubers), roots, flowers and floral organs/structures (for example, bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (for example, vascular tissue, ground tissue, and the like) and cells (for example, guard cells, egg cells, and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, horsetails, psilophytes, lycophytes, bryophytes, and multicellular algae.
A "transgenic plant" refers to a plant that contains genetic material not found in a wild-type plant of the same species, variety or cultivar. The genetic material may include a transgene, an insertional mutagenesis event (such as by transposon or T-DNA insertional mutagenesis), an activation tagging sequence, a mutated sequence, a homologous recombination event or a sequence modified by chimeraplasty. Typically, the foreign genetic material has been introduced into the plant by human manipulation, but any method can be used as one of skill in the art recognizes. A transgenic plant may contain an expression vector or cassette.
The expression vector or cassette typically comprises a polypeptide-encoding sequence operably linked (i.e., under regulatory control of) to appropriate inducible or constitutive regulatory sequences that allow for the expression of polypeptide. The expression vector or cassette can be introduced into a plant by transformation or by breeding after transformation of a parent plant. A plant refers to a whole plant as well as to a plant part, such as seed, fruit, leaf, or root, plant tissue, plant cells or any other plant material, for example, a plant explant, as well as to progeny thereof, and to in vitro systems that mimic biochemical or cellular components or processes in a cell.
"Wild type" or "wild-type", as used herein, refers to a plant cell, seed, plant component, plant tissue, plant organ or whole plant that has not been genetically modified or treated in an experimental sense. Wild-type cells, seed, components, tissue, organs or whole plants may be used as controls to compare levels of expression and the extent and nature of trait modification with cells, tissue or plants of the same species in which a transcription factor expression is altered, e.g., in that it has been knocked out, overexpressed, or ectopically expressed.
A "control plant" as used herein refers to a plant cell, seed, plant component, plant tissue, plant organ or whole plant used to compare against transgenic or genetically modified plant for the purpose of identifying an enhanced phenotype in the transgenic or genetically modified plant. A
control plant may in some cases be a transgenic plant line that comprises an empty vector or marker gene, but does not contain the recombinant polynucleotide of the present invention that is expressed in the transgenic or genetically modified plant being evaluated. In general, a control plant is a plant of the same line or variety as the transgenic or genetically modified plant being tested. A suitable control plant would include a genetically unaltered or non-transgenic plant of the parental line used to generate a transgenic plant herein.
"Derivative" refers to the chemical modification of a nucleic acid molecule or amino acid sequence. Chemical modifications can include replacement of hydrogen by an alkyl, acyl, or amino group or glycosylation, pegylation, or any similar process that retains or enhances biological activity or lifespan of the molecule or sequence.
A "trait" refers to a physiological, morphological, biochemical, or physical characteristic of a plant or particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar concentrations, or by the observation of the expression level of a gene or genes, for example, by employing Northern analysis, RT-PCR, microarray gene expression assays, or reporter gene expression systems, or by agricultural observations such as abiotic stress tolerance or yield. Any technique can be used to measure the amount of, comparative level of, or difference in any selected chemical compound or macromolecule in the transgenic plants, however.
"Trait modification" refers to a detectable difference in a characteristic in a plant ectopically expressing a polynucleotide or polypeptide of the present invention relative to a plant not doing so, such as a wild-type plant. In some cases, the trait modification can be evaluated quantitatively. For example, the trait modification can entail at least about a 2% increase or decrease in an observed trait or an even greater difference, compared with a wild-type plant. It is known that there can be a natural variation in the modified trait. Therefore, the trait modification observed entails a change of the normal distribution and magnitude of the trait in the plants compared with the distribution and magnitude observed in wild-type plants.
When two or more plants have "similar morphologies", "substantially similar morphologies" or "a morphology that is substantially similar", the plants have comparable forms or appearances, including analogous features such as overall dimensions, height, width, mass, root mass, shape, glossiness, color, stem diameter, leaf size, leaf dimension, leaf density, internode distance, branching, root branching, number and form of inflorescences, and other macroscopic characteristics, and the genotypes of the plants with similar morphologies are not readily distinguishable based on morphological characteristics alone. The term "transcript profile" refers to the expression levels of a set of genes in a cell in a particular state, particularly by comparison with the expression levels of that same set of genes in a cell of the same type in a reference state.
For example, the transcript profile of a particular transcription factor in a suspension cell is the expression levels of a set of genes in a cell repressing or overexpressing that transcription factor compared with the expression levels of that same set of genes in a suspension cell that has normal levels of that transcription factor. The transcript profile can be presented as a list of those genes whose expression level is significantly different between the two treatments, and the difference ratios. Differences and similarities between expression levels may also be evaluated and calculated using statistical and clustering methods.
"Ectopic expression or altered expression" in reference to a polynucleotide indicates that the pattern of expression in, for example, a transgenic plant or plant tissue, is different from the expression pattern in a wild-type plant or a reference plant of the same species. The pattern of expression may also be compared with a reference expression pattern in a wild-type plant of the same species. For example, the polynucleotide or polypeptide is expressed in a cell or tissue type other than a cell or tissue type in which the sequence is expressed in the wild-type plant, or by expression at a time other than at the time the sequence is expressed in the wild-type plant, or by a response to different inducible agents, such as hormones or environmental signals, or at different expression levels (either higher or lower) compared with those found in a wild-type plant. The term also refers to altered expression patterns that are produced by lowering the levels of expression to below the detection level or completely abolishing expression. The resulting expression pattern can be transient or stable, constitutive or inducible. In reference to a polypeptide, the term "ectopic expression or altered expression" further may relate to altered activity levels resulting from the interactions of the polypeptides with exogenous or endogenous modulators or from interactions with factors or as a result of the chemical modification of the polypeptides.
The term "overexpression" as used herein refers to a greater expression level of a gene in a plant, plant cell or plant tissue, compared to expression in a wild-type plant, cell or tissue, at any developmental or temporal stage for the gene. Overexpression can occur when, for example, the genes encoding one or more transcription factors are under the control of a strong promoter described herein (for example, the cauliflower mosaic virus 35 S transcription initiation region) or be induced when an appropriate environmental signal is present.
Overexpression may occur throughout a plant or in specific tissues of the plant, depending on the promoter used, as described below. Overexpression may take place in plant cells normally lacking expression of polypeptides functionally equivalent or identical to the present transcription factors.
Overexpression may also occur in plant cells where endogenous expression of the present transcription factors or functionally equivalent molecules normally occurs, but such normal expression is at a lower level. Overexpression thus results in a greater than normal production, or "overproduction" of the transcription factor in the plant, cell or tissue.
The term "transcription regulating region" refers to a DNA regulatory sequence that regulates expression of one or more genes in a plant when a transcription factor having one or more specific binding domains binds to the DNA regulatory sequence. Transcription factors of the present invention possess an Al, Bl, B2 and B3 domain (i.e. ABI3), or a Staygreen superfamily (pfam:12638) domain (i.e. SGR1 and SGR2). The staygreen superfamily of proteins have been implicated in chlorophyll degradation. More information on the domains of ABI3 is found below.
A "sample" with respect to a material containing nucleic acid molecules may comprise a bodily fluid; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; genomic DNA, RNA, or cDNA in solution or bound to a substrate; a cell; a tissue; a tissue print; a forensic sample; and the like. In this context "substrate" refers to any rigid or semi-rigid support to which nucleic acid molecules or proteins are bound and includes membranes, filters, chips, slides, wafers, fibers, magnetic or nonmagnetic beads, gels, capillaries or other tubing, plates, polymers, and microparticles with a variety of surface forms including wells, trenches, pins, channels and pores. A substrate may also refer to a reactant in a chemical or biological reaction, or a substance acted upon (for example, by an enzyme).
Transcription Factors Modify Expression of Endogenous Genes A transcription factor may include, but is not limited to, any polypeptide that can activate or repress transcription of a single gene or a number of genes. As one of ordinary skill in the art recognizes, transcription factors can be identified by the presence of a region or domain of structural similarity or identity to a specific consensus sequence or the presence of a specific consensus DNA-binding site or DNA-binding site motif (for example, Riechmann et al. (2000) supra).
Generally, the transcription factors encoded by the present sequences are involved in various aspects of plant development. Accordingly, one skilled in the art would recognize that by expressing the present sequences in a plant, one may change the expression of autologous genes or induce the expression of introduced genes. By affecting the expression of similar autologous sequences in a plant that have the biological activity of the present sequences, or by introducing the present sequences into a plant, one may alter a plant's phenotype to one with improved traits related to environmental stresses, such as but not limited to cold. The sequences of the invention may also be used to transform a plant and introduce desirable traits not found in the wild-type cultivar or strain. Plants may then be selected for those that produce the most desirable degree of over- or under-expression of target genes of interest and coincident trait improvement.
The sequences of the present invention may be from any species, particularly plant species, in a naturally occurring form or from any source whether natural, synthetic, semi-synthetic or recombinant. The sequences of the invention may also include fragments of the present amino acid sequences. Where "amino acid sequence" is recited to refer to an amino acid sequence of a naturally occurring protein molecule, "amino acid sequence" and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.
In addition to methods for modifying a plant phenotype by employing one or more polynucleotides and polypeptides of the invention described herein, the polynucleotides and polypeptides of the invention have a variety of additional uses. These uses include their use in the recombinant production (i.e., expression) of proteins; as regulators of plant gene expression, as diagnostic probes for the presence of complementary or partially complementary nucleic acids (including for detection of natural coding nucleic acids); as substrates for further reactions, for example, mutation reactions, PCR reactions, or the like; as substrates for cloning for example, including digestion or ligation reactions; and for identifying exogenous or endogenous modulators of the transcription factors. In many instances, a polynucleotide comprises a nucleotide sequence encoding a polypeptide (or protein) or a domain or fragment thereof.
Additionally, the polynucleotide may comprise a promoter, an intron, an enhancer region, a polyadenylation site, a translation initiation site, 5' or 3' untranslated regions, a reporter gene, a selectable marker, or the like. The polynucleotide can be single-stranded or double-stranded DNA or RNA. The polynucleotide optionally comprises modified bases or a modified backbone.
The polynucleotide can be, for example, genomic DNA or RNA, a transcript (such as an mRNA), a cDNA, a PCR product, a cloned DNA, a synthetic DNA or RNA, or the like. The polynucleotide can comprise a sequence in either sense or antisense orientations.
Expression of genes that encode transcription factors that modify expression of endogenous genes, polynucleotides, and proteins are well known in the art. In addition, transgenic plants comprising isolated polynucleotides encoding transcription factors may also modify expression of endogenous genes, polynucleotides, and proteins. Examples include Peng et al. (1997) Genes Development 11:3194-3205, and Peng et al. (1999) Nature, 400:256-261. In addition, many others have demonstrated that an Arabidopsis transcription factor expressed in an exogenous plant species elicits the same or very similar phenotypic response (for example, Fu et al. (2001) Plant Cell 13:1791-1802; Nandi et al. (2000) Curr. Biol. 10:215-218; Coupland (1995) Nature 377:482-483; and Weigel and Nilsson (1995) Nature 377:482-500).
In another example, Mandel et al. (1992) Cell 71-133-143, and Suzuki et al.(2001) Plant J. 28:
409-418, teach that a transcription factor expressed in another plant species elicits the same or very similar phenotypic response of the endogenous sequence, as often predicted in earlier studies of Arabidopsis transcription factors in Arabidopsis (Mandel et al.
(1992) supra; Suzuki et al. (2001) supra). Other examples include Miiller et al. (2001) Plant J. 28:
169-179; Kim et al.
(2001) Plant J. 25: 247-259; Kyozuka and Shimamoto (2002) Plant Cell Physiol.
43: 130-135;
Boss and Thomas (2002) Nature, 416: 847-850; He et al. (2000) Transgenic Res.
9: 223-227; and Robson et al. (2001) Plant J. 28: 619-631.
In yet another example, Gilmour et al. (1998) Plant J. 16: 433-442, teach an Arabidopsis AP2 transcription factor, CBF1 that, when overexpressed in transgenic plants, increases plant freezing tolerance. Jaglo et al. (2001 ) Plant Physiol. 127: 910-917, further identified sequences in Brassica napus which encode CBF-like genes and that transcripts for these genes accumulated rapidly in response to low temperature. Transcripts encoding CBF-like proteins were also found to accumulate rapidly in response to low temperature in wheat, as well as in tomato. An alignment of the CBF proteins from Arabidopsis, B. napus, wheat, rye, and tomato revealed the presence of conserved consecutive amino acid residues, PKK/RPAGRxKFxETRHP and DSAWR, that bracket the AP2/EREBP DNA binding domains of the proteins and distinguish them from other members of the AP2/EREBP protein family (Jaglo et al. (2001) supra).
Transcription factors mediate cellular responses and control traits through altered expression of genes containing cis-acting nucleotide sequences that are targets of the introduced transcription factor. It is well appreciated in the art that the effect of a transcription factor on cellular responses or a cellular trait is determined by the particular genes whose expression is either directly or indirectly (for example, by a cascade of transcription factor binding events and transcriptional changes) altered by transcription factor binding. In a global analysis of transcription comparing a standard condition with one in which a transcription factor is overexpressed, the resulting transcript profile associated with transcription factor overexpression is related to the trait or cellular process controlled by that transcription factor. For example, the PAP2 gene (and other genes in the MYB family) have been shown to control anthocyanin biosynthesis through regulation of the expression of genes known to be involved in the anthocyanin biosynthetic pathway (Bruce et al. (2000) Plant Cell, 12: 65-79;
Borevitz et al.
(2000) Plant Cell 12: 2383-93). Further, global transcript profiles have been used successfully as diagnostic tools for specific cellular states (for example, cancerous vs. non-cancerous;
Bhattacharjee et al. (2001) Proc Natl. Acad. Sci., USA, 98: 13790-13795; Xu et al. (2001) Proc.
Natl. Acad. Sci., USA, 98: 15089-15094).
Consequently, it is evident to one skilled in the art that similarity of transcript profile upon overexpression of different transcription factors would indicate similarity of transcription factor function.
Polypeptides and Polynucleotides Provided herein, among other things, are transcription factors (TFs), and transcription factor homolog polypeptides, and isolated or recombinant polynucleotides encoding the polypeptides, or novel sequence variant polypeptides or polynucleotides encoding novel variants of transcription factors derived from the specific sequences provided here. These polypeptides and polynucleotides may be employed to modify a plant's characteristics.
The polynucleotides described herein can be or were ectopically expressed in overexpressor or knockout plants and the changes in the characteristic(s) or trait(s) of the plants observed.
Therefore, the polynucleotides and polypeptides can be employed to improve the characteristics of plants.
The polynucleotides described herein can be or were ectopically expressed in overexpressor plant cells and the changes in the expression levels of a number of genes, polynucleotides, and/or proteins of the plant cells observed. Therefore, the polynucleotides and polypeptides can be employed to change expression levels of a genes, polynucleotides, and/or proteins of plants.
ABI3 was initially identified by mutational analysis and found to encode a protein with high homology to the maize seed-specific transcription factor VP1 (Giraudat et al., 1992). Additional Orthologs of ABI3 have since been found in a number of species including canola, Phaseolis vulgaris, rice, Avena fatua, the resurrection plant Craterostigma plantagineum Hochst., carrot, sorghum, poplar and yellow cedar (Koornneef et al., 1984, Finkelstein et al., 1990; Bobb et al., 1995; Jones et al., 2000; Chandler and Bartels, 1997; Shiota et al., 1998, Rohde et al., 2000;
Carrari et al., 2000; Lazarova et al., 2001; Zeng et al., 2003). Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation, a regulator of the transition between embryo maturation and early seedling development, and a putative seed-specific transcriptional activator.
Mutants exhibit decreased responsiveness to ABA suggesting that ABI3 protein participates in the ABA
perception/transduction cascade. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA
(AT3G54230). By molecular characterization, VP1/ABI3 has been shown to have a modular structure with respect to both protein and promoter sequences.
Although first described as a seed-specific gene for its altered ABA
sensitivity, recently more detailed phenotypic analysis and expression studies of ABI3 indicate that ABI3 may have functions outside of modulating ABA seed sensitivity. ABI3 appears to play a role in plastid development and interacts with genes involved in light regulation (Rohde et al., 2000; Rohde et al., 2002). ABI3 expression is detected in many quiescent tissues including the receptacle of flowers, the axils of pedicels and axillary flower bracts, the abscission zone of siliques and rosette leaves, and stipules (Parcy et al., 1994; Rohde et al., 1999).
Interestingly, in the presence of exogenous ABA, plants misexpressing VP1 are insensitive to auxin-induced lateral root formation suggesting that the VP1/ABI3 transcription factor may define an interaction node between ABA and auxin signaling (Suzuki et al., 2001).
Domains in the ABI protein ABI3, VP1 and homologous proteins found in other plant species share four conserved regions:
the acidic Al domain and three basic domains (B1-B3) (Finkelstein et at., 2002; Fig. 4.1A).
While the amino-terminally located Al domain has been experimentally shown to function in transcriptional activation (McCarty et at., 1991; Hattori et at., 1994; Bobb et at., 1997), investigations into potential DNA-binding ability of the conserved VP1/ABI3 domains have been less clear. The first domain implicated in such a function was the VP1 B3 domain, which in isolation could specifically bind a RY cis-element common in many seed-specific promoters (Suzuki et at., 1997). Interestingly, larger VP1 protein variants that included flanking regions were unable to efficiently bind DNA, raising the possibility that interactions between protein domains may regulate VP1-DNA interaction in vivo (Suzuki et at., 1997).
Indirect evidence for a role of the ABI3 B3 domain in DNA-binding was demonstrated from transactivation studies which showed that the B3 domain was necessary for up-regulation of an RY-containing NA PIN

promoter derivative (Ezcurra et at., 2000). Eventually a full-length ABI3 protein was shown to be capable of binding the RY element, and its B3 domain was both necessary and sufficient for mediating this specific interaction (Monke et at., 2004). This conserved B3 activity has been shown for a variety of developmentally-important transcription factors including FUS3 (Reidt et at., 2000), LEC2 (Braybrook et at., 2006), ARF family members (Ulmasov et at., 1997; Ulmasov et at., 1999) and RAVI (Kagaya et at., 1999; Hu et al., 2004).
Other conserved domains of VP1/ABI3 have been implicated in DNA-binding. For instance, UV cross-linking experiments detected a weak, non-specific association between a VP1 B2 peptide and DNA (Hill et at., 1996). Furthermore, the ABI3 B2 domain was shown to be required for the activation of a NAPIN promoter through interaction with an ABRE (ABA-responsive element) (Ezcurra et at., 2000). However, this latter interaction was thought to be indirectly mediated by protein-protein interaction (Ezcurra et at., 2000).
Indeed, other experimental results are consistent with a role for the B2 domain in protein binding. For example, a yeast two-hybrid screen employing a B2/B3-containing ABI3 region identified four interacting partners, termed AIPs (ABI3-interacting proteins) (Kurup et at., 2000). Interestingly, four of these AIPs share homology with existing transcription factors, supporting the notion that ABI3 may function in multi-protein transcriptional complexes, potentially via B2 domain-mediated protein interaction (Kurup et at., 2000).
Providing additional support for the existence of transcriptional complexes involving ABI3, the B1 domain of ABI3 has been shown to interact with ABI5 (Nakamura et at., 2001). This interaction appears to be evolutionarily conserved since the rice homolog OsVP1 has also been shown to interact via the B1 and B2 domains with the ABI5 homolog TRAB1 in a yeast two-hybrid screen (Hobo et at., 1999). Finally, single-celled transient expression assays have shown that the B1 domain may also play a role in transcriptional activation, as its deletion greatly reduced the ABI3-mediated induction of a target reporter gene (Monke et at., 2004).
The importance of these domains in vivo has been shown by the identification of many abi3 alleles. To date, all sequenced abi3 mutations affect the coding sequence (Fig. 4.1A). Most are missense mutations within characterized domains, and many affect amino acids that are conserved across ABI3 homologs (Nambara et at., 2002). For example, the abi3-8 mutation results in a substitution of a conserved leucine by phenylalanine in the B1 domain, and the abi3-9 and abi3-10 mutations convert a conserved arginine to tryptophan and glutamine respectively.
In addition, other abi3 alleles like abi3-11 and abi3-12 contain nonsense mutations predicted to eliminate the B3 domain. In contrast, alleles like abi3-6 and abi3-7 are predicted to impair the functions of more than one domain. In general, more severe phenotypic defects are associated with defects in more than one domain.
Domains in the ABI3 promoter Functional modularity is also seen in the regulatory domains of the ABI3 promoter. Specifically, a study involving the analysis of reporter genes driven by various ABI3 promoter regions revealed the existence of at least four discrete cis-regulatory elements (Ng et at., 2004; Fig.
4.1B). Two upstream activator sequences (UAS1 and UAS2) were shown to enhance the expression of downstream reporter genes across all tissues of the embryo, with UAS2 necessary for radicle expression. Both UAS1 and UAS2 are also required for ABA-responsiveness in root tissues. The centrally-located seed-specific region (SSR) was shown to be sufficient to confer expression in the embryo.
Perhaps the most intriguing regulatory element identified was the 519 bp 5' UTR (termed NRS, negative regulatory sequence). Omission of this element from reporter constructs resulted in increased expression in embryos as well as ectopic expression in roots of seedlings. This root phenomenon required exogenously supplied ABA when a complete ABI3 promoter was employed. This observation suggests that the NRS prevents expression of ABI3 in the absence of ABA. Two different mechanisms of NRS function were proposed. One suggested that RNA-binding proteins may recognize the ABI3 5' UTR and are responsible for conferring transcriptional repression in the absence of ABA. Alternatively, the identification of multiple upstream open reading frames within the 5' UTR led to speculation of inefficient ribosome-recognition causing decreased translation and/or transcript stability (Ng et at., 2004).
Background and role of the RY cis-motif One of the best studied cis-motifs involved in seed-specific gene expression is the RY motif CATGCATG (Baumlein et al. 1992 ; Bobb et al. 1997 ; Chamberland et al. 1992 ;
Dickinson et al. 1988 ; Fujiwara & Beachy 1994; Lelievre et al. 1992). This motif is widely distributed in seed-specific gene promoters of dicots and monocots including the promoters of the V. faba legumin and USP genes ( Baumlein et al. 1991a ; Baumlein et al. 1986 ; Fiedler et al. 1993 ), as well as the regulatory region of Brass/ca napus napin genes (Ellerstrom et al.
1996 ; Stalberg et al. 1993 ). In the legumin gene promoter, the RY motif represents the central core of the 28 bp legumin box (Baumlein et al. 1986), and its deletion abolishes most of the seed-specific promoter activity and results in low-level expression in leaves (Baumlein et al. 1992).
Also in the napin promoter, the destruction of two RY motifs drastically reduces promoter activity (Ellerstrom et al. 1996 ; Stalberg et al. 1993). Together these data and the analysis of several other seed-specific promoters (see Morton et al. 1995) clearly demonstrate the importance of the RY motif for high-level expression of several seed-specific genes as well as the potential of this motif to function as a negative element repressing expression in non-seed tissues.
B3 domain transcription factors ABI3/VP1 related genes have been generally implicated in seed maturation processes. The ABSCISIC ACID INSENSITIVE (ABI3) protein and its maize ortholog VIVIPAROUS1 (VP1) regulate seed development and dormancy in response to abscisic acid (McCarty et al (1991) Cell 66: 895-905; Giraudat et al. (1992) Plant Cell 4: 1251-1261). ABI3 (G621) and VP1 play an important role in the acquisition of desiccation tolerance in late embryogenesis. This process is related to dehydration tolerance as evidenced by the protective function of late embryogenesis abundant (LEA) genes such as HVA1 (Xu et al. (1996) Plant Physiol. 110: 249-257; Sivamani et al. (2000) Plant Science 155: 1-9). Mutants for Arabidopsis ABI3 (Ooms et al.
(1993) Plant Physiol. 102: 1185-1191) and the maize ortholog VP1 (Carson et al. (1997) Plant J. 12: 1231-1240 and references therein) show severe defects in the attainment of seed desiccation tolerance.
ABI3 activity is normally restricted to the seeds. However, overexpression of ABI3 from a 35S
promoter was found to increase ABA levels, induce several ABA cold/drought-responsive genes such as RAB18 and RD29A and increased freezing tolerance in Arabidopsis (Tamminen et al.
(2001) Plant J. 25: 1-8). These data illustrate the relatedness of the processes of seed desiccation and dehydration tolerance and demonstrates that the seed-specific ABI3 transcription factor does not require additional seed-specific proteins to function in vegetative tissues. Recently, a tight coupling has been demonstrated between ABA signaling and ABI3/VP1 function;
Suzuki et al.

((2003) Plant Physiol. 132: 1664-1677) found that the global gene expression patterns caused by VP1 overexpression in Arabidopsis were very similar to patterns produced by ABA treatments.
Regulation by ABI3/VP1 is complex: the protein is a multidomain transcription factor that can apparently function as either an activator or a repressor depending on the promoter context (McCarty et al. (1991) supra; Hattori et al., (1992) Genes Dev. 6: 609-618;
Hoecker et al. (1995) Genes Dev. 9: 2459-2469; Nambara et al. (1995) Development 121: 629-636). In addition to the B3 domain, ABI3/VP1 has two other protein domains (the Bl and B2 domains) that are also highly conserved among ABI3/VP1 factors from various plant species (McCarty et al. (1991) supra). Targets of the different domains have now been identified. Both in Arabidopsis and maize, the B3 domain of ABI3/VP1 binds the RY/SPH motif (Ezcurra et al. (2000) Plant J. 24:
57-66, Carson et al. (1997) supra), whereas the N terminal Bl and B2 domains are implicated in nuclear localization and interactions with other proteins. In particular, the B2 domain is thought to act via ABA response elements (ABREs) in target promoters. VP1 has been shown to activate ABREs through a core ACGT motif (called the G-Box), but does not bind the element directly.
However, a number of bZIP transcription factors have been shown to bind ABREs in the promoters of ABA induced genes (Guiltinan et al (1990) Science 250: 267-271;
Jakoby et al.
(2002) Trends Plant Sci. 7: 106-111), and recent data suggest that VPI might induce ABREs via interactions with these bZIP proteins. Such evidence was afforded by Hobo et al., 1999) Proc.
Natl. Acad. Sci. USA 96: 15348-15353) who demonstrated interaction between the rice VPI
protein OsVPI and a rice bZIP protein, TRABl. While in Arabidopsis the B3 domain of ABI3 is essential for abscisic acid dependent activation of late embryogenesis genes (Ezcurra et al., (2000) supra), the B3 domain of VP1 is not essential for ABA regulated gene expression in maize seed (Carson et al. (1997) supra; McCarty et al. (1989) Plant Cell I:
523-532). This difference in the regulatory network between Arabidopsis and maize can be explained by differential usage of the RY/SPH versus the ABRE element in the control of seed maturation gene expression (Ezcurra et al. (2000) supra). The RY/SPH element is a key element in gene regulation during late embryogenesis in Arabidopsis (see also Reidt et al.
(2000) Plant J. 21:
401-408) while it seems to be less important for seed maturation in maize (McCarty et al. (1989) supra).

The B3 superfamily currently includes 363 members from various plant species, grouped into 16 distinct structural architectures based on their association with other conserved domain combinations (Bateman et al. 2004). For example, Arabidopsis FUSCA3 (FUS3):
the FUS3 protein can be considered as a natural truncation of the ABI3 protein (Luerssen et al. (1998) Plant J. 15: 755-764); like ABI3, FUS3 binds to the RY/SPH element, and can activate expression from target promoters even in non-seed tissues (Reidt et al. (2000) supra). AB3 domain is also present in LEAFY COTYLEDON 2 (Luerssen et al. (1998) supra;
Stone et al.
(2001) Proc. Natl. Acad. Sci. USA 98: 11806-11811). ABI3, FUS3, LEC2, and LEAFY
COTYLEDON I are known to act together to regulate many aspects of seed maturation (Parcy et al. (1997) Plant Cell 9: 1265-1277; Parcy and Giraudat (1997) Plant J. 11:
693702; Wobus and Weber (1999) Curr. Opin. Plant Biol. 2: 33-38. (LECI, is a CAAT box binding transcription factor of the HAP3 class, Lotan et al. (1998) supra). Like abi3 mutants, mutants for these other three genes also show defects in embryo specific programs and have pleiotropic phenotypes, including precocious germination and development of leaf like characters on the cotyledons.
Unlike abi3, though, these mutants have almost normal ABA sensitivity and are not directly implicated in ABA signaling (Meinke (1992) Science 258: 1647-1650; Keith et al. (1994) Plant Cell 6: 589-600; Meinke et aI. (1994) Plant Cell 6: 1049-1064). Overexpression of either LEC1 or LEC2 results in ectopic embryo formation (Lotan et al. (1998) supra; Stone et al. (2001) supra), supporting the role of this gene in the regulation of embryo development. Although the ABI3 related genes containing a B3 domain have roles related to abiotic stress tolerance during embryo maturation, it remains to be reported whether all proteins containing a B3 domain have a general role in such responses or in embryo development.
B3 DNA binding domain The B3 domain is present in several transcription factor families: RAY, ABI3/VP1, and ARF. It has been shown for all three families that the B3 domain is sufficient for DNA
binding (Table 1).
B3 domains within the ARF class are 72% identical on average. Likewise, RAV-like and ABI3/VP1-like proteins average 64% identity within their subfamilies (Walther et al., Protein Sci. 2005 September; 14(9): 2478-2483). However, the binding specificity varies significantly, these differences in the target specificity are also reflected at the protein level. Although all B3 domains share certain conserved amino acids, there is significant variation between families.

Despite the fact that the B3 domain can bind DNA autonomously (Kagaya et al.
(1999) supra;
Suzuki et al. (1997) Plant Cell 9: 799-807), in general, B3 domain transcription factors interact with their targets via two DNA binding domains (Table 1). In case of the RAV
and ABI3 family, the second domain is located on the same protein. It has been shown for ABI3 that cooperative binding not only increases the specificity but also the affinity (Ezcurra et al. (2000) Plant J. 24: 57-66).
Recently the structure of the B3 domain has been determined and found to consist of a seven-stranded I3-sheet arranged in an open barrel and two short a-helices, one at each end of the barrel.
Interestingly one of these 3D structures was the B3 domain of At1g16640, which is quite distinct from previously characterized B3 domain proteins in terms of amino acid sequence similarity, however it adopts the same novel fold that was revealed by the RAVI B3 domain structure.
RAVI and At1g16640, despite their structural similarity, share only 26%
sequence identity.
At1g16640, in fact, shows similarly weak homology to the other two classes, sharing only approximately 22% and 20% identity with ARFs and ABI3/VP1- like proteins, respectively (Poirot et al. 2004). It suggests that this novel 3D fold is highly conserved among family members, despite relatively low sequence conservation.
Table 1: Binding sites for the different B3 domains Family Binding site Element Second domain Reference present in Protein RAV CACCTG AP2 Kagaya el al. (1999) supra ABI3 CATGCATG RY/G-box B2 Ezcurra et al. (2000) supra ARF TGTCTC AuxRE other TxF Ulmasov et al. (1997) supra SGR genes In peas, Mendel's I locus, which codes for SGR (stay green) gene was shown to be responsible for cotyledon color (yellow versus green) (Armstead et al. (2007) Science 315, 73.; Sato, Y., et al. (2007) Proc Natl Acad Sci USA 104, 14169-14174). Interestingly green pea seeds defective in SGR1 have not been reported to have any longevity problems compared to its yellow counterpart. Stay-green mutants resulting from defects in SGR belong to the type C class of non-functional stay-green mutants that proceed normally with the loss of photosynthesis and senescence process despite the presence of high levels of chlorophyll (Thomas, H. & Howarth, C. J. (2000) J Exp Bot 51 Spec No, 329-337.). In Arabidopsis, there are two SGR genes, SGR1 (At4g22920) and SGR2 (At4g11910). Loss-of-function null mutations in the SGR1 did not result in green embryos, although a stay-green vegetative leaf phenotype was reported (Ren, G., et al.
(2007) Plant Physiol 144, 1429-1441.; Aubry, S., Mani, J., & Hortensteiner, S.
(2008) Plant Mol Biol 67, 243-256.). It still remains unexplored whether the Arabidopsis SGR
orthologs participate in the seed de-greening process similar to Mendel's / locus. The SGR genes are part of a family containing 62 genes in 25 species (Figure 1).
Producing Polypeptides The polynucleotides described herein include sequences that encode transcription factors and transcription factor homolog polypeptides and sequences complementary thereto, as well as unique fragments of coding sequence, or sequences complementary thereto.
Such polynucleotides can be, for example, DNA or RNA, the latter including mRNA, cRNA, synthetic RNA, genomic DNA, cDNA synthetic DNA, oligonucleotides, etc. The polynucleotides are either double-stranded or single-stranded, and include either, or both sense (i.e. coding) sequences and antisense (i.e. non-coding, complementary) sequences. The polynucleotides include the coding sequence of a transcription factor, or transcription factor homolog polypeptide, in isolation, in combination with additional coding sequences (e.g., a purification tag, a localization signal, as a fusion-protein, as a pre-protein, or the like), in combination with non-coding sequences (for example, introns or inteins, regulatory elements such as promoters, enhancers, terminators, and the like), and or in a vector or host environment in which the polynucleotide encoding a transcription factor or transcription factor homolog polypeptide is an endogenous or exogenous gene.
A variety of methods exist for producing the polynucleotides described herein.
Procedures for identifying and isolating DNA clones are well known to those of skill in the art, and are described in, for example, Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, vol. 152 Academic Press, Inc., San Diego, CA
("Berger"); Sambrook et al. Molecular Cloning - A Laboratory Manual (2nd Ed.), Vol. 1 -3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 ("Sambrook") and Current Protocols in Molecular Biology. Ausubel et al. eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2000) ("Ausubel").
Alternatively, polynucleotides of the invention can be produced by a variety of in vitro amplification methods adapted to the present invention by appropriate selection of specific or degenerate primers. Examples of protocols sufficient to direct persons of skill through in vitro amplification methods, include polymerase chain reaction (PCR), ligase chain reaction (LCR), Q3-replicase amplification and other RNA polymerase mediated techniques (for example, NASBA), e.g., for the production of the homologous nucleic acids of the invention are found in Berger (supra), Sambrook (supra), and Ausubel (supra), as well as Mullis et al. (1987) PCR
Protocols A Guide to Methods and Applications, Innis et al. eds., Academic Press Inc., San Diego. Improved methods for cloning in vitro amplified nucleic acids are described in Wallace et al., US Pat. No. 5,426,039. Methods for amplifying large nucleic acids by PCR
are summarized in Cheng et al. (1994) Nature 369: 684-685 and the references cited therein, in which PCR
amplicons of up to 40 kb are generated. One of skill will appreciate that essentially any RNA
can be converted into a double-stranded DNA suitable for restriction digestion, PCR expansion and sequencing using reverse transcriptase and a polymerase (for example, Ausubel, Sambrook and Berger, all supra).
Alternatively, polynucleotides and oligonucleotides can be assembled from fragments produced by solid-phase synthesis methods. Typically, fragments of up to approximately 100 bases are individually synthesized and then enzymatically or chemically ligated to produce a desired sequence, e.g., a polynucleotide encoding all or part of a transcription factor. For example, chemical synthesis using the phosphoramidite method is described, e.g., by Beaucage et al.
(1981) Tetrahedron Letters 22: 1859-1869; and Matthes et al. (1984) EMBOJ. 3:
801-805.
According to such methods, oligonucleotides are synthesized, purified, annealed to their complementary strand, ligated and then optionally cloned into suitable vectors. And if so desired, the polynucleotides and polypeptides of the invention can be custom ordered from any of a number of commercial suppliers.
Homologous Sequences Sequences homologous, i.e., that share significant sequence identity or similarity, to those provided in the Sequence Listing, derived from Arabidopsis thaliana or from other plants of choice, are also provided herein. Homologous sequences can be derived from any plant including monocots and dicots and in particular agriculturally important plant species, including but not limited to, crops such as soybean, wheat, corn (maize), potato, cotton, rice, rape, oilseed rape (including canola), sunflower, alfalfa, clover, sugarcane, and turf; or fruits or fruit trees, vegetables such as banana, blackberry, blueberry, strawberry, and raspberry, cantaloupe, carrot, cauliflower, coffee, cucumber, eggplant, grapes, honeydew, lettuce, mango, melon, onion, papaya, peas, peppers, pineapple, pumpkin, spinach, squash, sweet corn, tobacco, tomato, tomatillo, watermelon, rosaceous fruits (such as apple, peach, pear, cherry and plum) and brassicas (such as broccoli, cabbage, cauliflower, Brussels sprouts, and kohlrabi). Other crops, including fruits and vegetables, whose phenotype can be changed and which comprise homologous sequences include barley; rye; millet; sorghum; currant; avocado;
citrus fruits such as oranges, lemons, grapefruit and tangerines, artichoke, cherries; nuts such as the walnut and peanut; endive; leek; roots such as arrowroot, beet, cassava, turnip, radish, yam, and sweet potato; and beans. The homologous sequences may also be derived from woody species, such as pine, poplar and eucalyptus, or mint or other labiates. In addition, homologous sequences may be derived from plants that are evolutionarily related to crop plants, but which may not have yet been used as crop plants. Examples include deadly nightshade (Atropa belladona), related to tomato; jimson weed (Datura strommium), related to peyote; and teosinte (Zea species), related to corn (maize).
Orthologs and Paralogs Homologous sequences as described above can comprise orthologous or paralogous sequences.
Several different methods are known by those of skill in the art for identifying and defining these functionally homologous sequences. General methods for defining orthologs and paralogs are described; an ortholog, paralog or homolog may be identified by one or more of the methods described below.
Within a single plant species, gene duplication may cause two copies of a particular gene, giving rise to two or more genes with similar sequence, and are known as paralogs. A
paralog is therefore a similar gene formed by duplication within the same species.
Paralogous genes may retain similar functions of the encoded proteins. In such cases, paralogs can be used interchangeably with respect to certain embodiments of the instant invention (for example, transgenic expression of a coding sequence).
An excellent example of related paralogs includes the CBF family, with three well-defined members in Arabidopsis and one ortholog in Brass/ca napus, all of which control pathways involved in both freezing and drought stress (Gilmour et al. (1998) Plant J.
16: 433-442; Jaglo et al. (1998) Plant Physiol. Ill: 910-917).
Paralogs typically cluster together or in the same clade (a group of similar genes) when a gene family phylogeny is analyzed using programs such as CLUSTAL (Thompson et al.
(1994) Nucleic Acids Res. 22: 4673-4680; Higgins et al. (1996) Methods Enzymol. 266:
383-402).
Groups of similar genes can also be identified with pair-wise BLAST analysis (Feng and Doolittle (1987) J. Mol. Evol. 25: 351-360). For example, a clade of very similar MADS domain transcription factors from Arabidopsis all share a common function in flowering time (Ratcliffe et al. (2001) Plant Physiol. 126: 122-132), and a group of very similar AP2 domain transcription factors from Arabidopsis are involved in tolerance of plants to freezing (Gilmour et al. (1998) Plant J. 16: 433-442). Analysis of groups of similar genes with similar function that fall within one clade can yield sub-sequences that are particular to the clade. These subsequences, known as consensus sequences, can not only be used to define the sequences within each clade, but define the functions of these genes; genes within a clade may contain paralogous sequences, or orthologous sequences that share the same function (for example, Mount (2001), in Bioinformatics: Sequence and Genome Analysis Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, page 543).
Speciation, the production of new species from a parental species, can also give rise to two or more genes with similar sequence and similar function. Transcription factor gene sequences are conserved across diverse eukaryotic species lines (Goodrich et al. (1993) Cell 75: 519-530; Lin et al. (1991) Nature 353: 569-571; Sadowski et al. (1988) Nature 335: 563-564). Plants are no exception to this observation; diverse plant species possess transcription factors that have similar sequences and functions. Because plants have common ancestors, many genes in any plant species will have a corresponding highly similar or orthologous gene in another plant species.
Orthologous sequences from different organisms have highly and often essentially identical functions (Lee et al. (2002) Genome Res. 12: 493-502; Remm et al. (2001) J.
Mol. Biol. 314:
1041-1052), and are often interchangeable between species without losing function. Once a phylogenic tree for a gene family of one species has been constructed using a program such as CLUSTAL (Thompson et al. (1994) Nucleic Acids Res. 22: 4673-4680; Higgins et al. (1996) supra) potential orthologous sequences can be placed into the phylogenetic tree and their relationship to genes from the species of interest can be determined.
Orthologous sequences can also be identified by a reciprocal BLAST strategy. Once an orthologous sequence has been identified, the function of the ortholog can be deduced from the identified function of the reference sequence.
The following references represent a small sampling of the many studies that demonstrate that conserved transcription factor genes from diverse species are likely to function similarly (i.e., regulate similar target sequences and control the same traits), and that transcription factors may be transformed into diverse species to confer or improve traits.
(1) Distinct Arabidopsis transcription factors, including G28 (found in US
Patent 6,664,446), G482 (found in US Patent Application 2004/0045049), G867 (found in US Patent Application 2004/0098764), and G1073 (found in US Patent 6,717,034), have been shown to confer stress tolerance or increased biomass when the sequences are overexpressed. The polypeptides sequences belong to distinct clades of transcription factor polypeptides that include members from diverse species. In each case, a significant number of clade member sequences derived from both dicots and monocots have been shown to confer increased biomass or tolerance to stress when the sequences were overexpressed (unpublished data).
(2) The Arabidopsis NPR1 gene regulates systemic acquired resistance (SAR);
over-expression of NPR1 leads to enhanced resistance in Arabidopsis. When either Arabidopsis NPR1 or the rice NPR1 ortholog was overexpressed in rice (which, as a monocot, is diverse from Arabidopsis), challenge with the rice bacterial blight pathogen Xanthomonas oryzae pv.
Oryzae, the transgenic plants displayed enhanced resistance (Chem et al. (2001) Plant J. 27: 101-113). NPR1 acts through activation of expression of transcription factor genes, such as TGA2 (Fan and Dong (2002) Plant Cell 14: 1377-1389).
(3) E2F genes are involved in transcription of plant genes for proliferating cell nuclear antigen (PCNA). Plant E2Fs share a high degree of similarity in amino acid sequence between monocots and dicots, and are even similar to the conserved domains of the animal E2Fs.
Such conservation indicates a functional similarity between plant and animal E2Fs.
E2F transcription factors that regulate meristem development act through common cis-elements, and regulate related (PCNA) genes. (Kosugi and Ohashi, (2002) Plant J. 29: 45-59).
(4) The ABI5 gene (ABA insensitive 5) encodes a basic leucine zipper factor required for ABA
response in the seed and vegetative tissues. Co-transfonnation experiments with ABI5 cDNA
constructs in rice protoplasts resulted in specific transactivation of the ABA-inducible wheat, Arabidopsis, bean, and barley promoters. These results demonstrate that sequentially similar ABI5 transcription factors are key targets of a conserved ABA signaling pathway in diverse plants. (Gampala et al. (2001) J. Biol. Chem. 277: 1689-1694).
(5) Sequences of three Arabidopsis GAMYB-like genes were obtained on the basis of sequence similarity to GAMYB genes from barley, rice, and L. temulentum. These three Arabidopsis genes were determined to encode transcription factors (AtMYB33, AtMYB65, and AtMYB101) and could substitute for a barley GAMYB and control a-amylase expression.
(Gocal et al. (2001) Plant Physiol. 127: 1682-1693).
(6) The floral control gene LEAFY from Arabidopsis can dramatically accelerate flowering in numerous dictoyledonous plants. Constitutive expression of Arabidopsis LEAFY
also caused early flowering in transgenic rice (a monocot), with a heading date that was 26-34 days earlier than that of wild-type plants. These observations indicate that floral regulatory genes from Arabidopsis are useful tools for heading date improvement in cereal crops. (He et al. (2000) Transgenic Res. 9: 223-227).
(7) Bioactive gibberellins (GAs) are essential endogenous regulators of plant growth. GA

signaling tends to be conserved across the plant kingdom. GA signaling is mediated via GAI, a nuclear member of the GRAS family of plant transcription factors. Arabidopsis GAI has been shown to function in rice to inhibit gibberellin response pathways. (Fu et al.
(2001) Plant Cell 13:
1791- 1802).
(8) The Arabidopsis gene SUPERMAN (SUP), encodes a putative transcription factor that maintains the boundary between stamens and carpels. By over-expressing Arabidopsis SUP in rice, the effect of the gene's presence on whorl boundaries was shown to be conserved. This demonstrated that SUP is a conserved regulator of floral whorl boundaries and affects cell proliferation. (Nandi et al. (2000) Curr. Biol. 10: 215-218).
(9) Maize, petunia and Arabidopsis myb transcription factors that regulate flavonoid biosynthesis are genetically similar and affect the same trait in their native species.
Therefore, sequence and function of these myb transcription factors correlate with each other in these diverse species (Borevitz et al. (2000) Plant Cell 12: 2383-2394).

(10) Wheat reduced height-1 (Rht-B1/Rht-D1) and maize dwarf-8 (d8) genes are orthologs of the Arabidopsis gibberellin insensitive (GAI) gene. Both of these genes have been used to produce dwarf grain varieties that have improved grain yield. These genes encode proteins that resemble nuclear transcription factors and contain an 5H2-like domain, indicating that phosphotyrosine may participate in gibberellin signaling. Transgenic rice plants containing a mutant GAI allele from Arabidopsis have been shown to produce reduced responses to gibberellin and are dwarfed, indicating that mutant GAI orthologs could be used to increase yield in a wide range of crop species (Peng et al. (1999) Nature 400: 256-261).
Transcription factors that are homologous to the listed sequences will typically share at least about 51% and 64% amino acid sequence identity in the Staygreen and B3 domains, respectively. More closely related transcription factors can share at least about 64% and about 75% amino acid sequence identity in the Staygreen and B3 domains, respectively, or more sequence identity with the listed sequences, or with the listed sequences but excluding or outside a known consensus sequence or consensus DNA-binding site, or with the listed sequences excluding one or all conserved domains.

At the nucleotide level, the sequences will typically share at least about 40%
nucleotide sequence identity, preferably at least about 50%, about 60%, about 70% or about 80%
sequence identity, and more preferably about 85%, about 90%, about 95% or about 97% or more sequence identity to one or more of the listed sequences, or to a listed sequence but excluding or outside a known consensus sequence or consensus DNA-binding site, or outside one or all conserved domain.
The degeneracy of the genetic code enables major variations in the nucleotide sequence of a polynucleotide while maintaining the amino acid sequence of the encoded protein. B3 domains within the B3 transcription factor family may exhibit a higher degree of sequence homology, such as at least 77% amino acid sequence identity including conservative substitutions, and preferably at least 80% sequence identity, and more preferably at least 85%, or at least about 86%, or at least about 87%, or at least about 88%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity. Transcription factors that are homologous to the listed sequences should share at least 30%, or at least about 60%, or at least about 75%, or at least about 80%, or at least about 90%, or at least about 95%o amino acid sequence identity over the entire length of the polypeptide or the homolog.
Percent identity can be determined electronically, e.g., by using the MEGALIGN
program (DNASTAR, Inc. Madison, Wis.). The MEGALIGN program can create alignments between two or more sequences according to different methods, for example, the clustal method (for example, Higgins and Sharp (1988) Gene 73: 237-244). The clustal algorithm groups sequences into clusters by examining the distances between all pairs. The clusters are aligned pairwise and then in groups. Other alignment algorithms or programs may be used, including FASTA, BLAST, or ENTREZ, FASTA and BLAST, and which may be used to calculate percent similarity. These are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with or without default settings.
ENTREZ is available through the National Center for Biotechnology Information. In one embodiment, the percent identity of two sequences can be determined by the GCG program with a gap weight of 1, e.g., each amino acid gap is weighted as if it were a single amino acid or nucleotide mismatch between the two sequences (for example, USPN 6,262,333).
In the present application, the percentage similarity between two polypeptide sequences, e.g., sequence A and sequence B, is calculated by dividing the length of sequence A, minus the number of gap residues in sequence A, minus the number of gap residues in sequence B, into the sum of the residue matches between sequence A and sequence B, times one hundred. Gaps of low or of no similarity between the two amino acid sequences are not included in determining percentage similarity. Percent identity between polynucleotide sequences can also be counted or calculated by other methods known in the art, e.g., the Jotun Hein method (for example, Hein (1990) Methods Enzymol. 183: 626-645). Identity between sequences can also be determined by other methods known in the art, e.g., by varying hybridization conditions (U.S. Patent Application No. 2001/0010913).
Techniques for alignment are described in Methods in Enzymology, vol. 266, Computer Methods for Macromolecular Sequence Analysis (1996), ed. Doolittle, Academic Press, Inc., San Diego, Calif, USA. Preferably, an alignment program that permits gaps in the sequence is used to align the sequences. The Smith-Waterman is one type of algorithm that permits gaps in sequence alignments (Shpaer (1997) Methods Mol. Biol. 70: 173-187). Also, the GAP program using the Needleman and Wunsch alignment method can be utilized to align sequences. An alternative search strategy uses 1\,/iPSRCH software, which runs on a MASPAR
computer.
MPSRCH uses a Smith-Waterman algorithm to score sequences on a massively parallel computer. This approach improves ability to pick up distantly related matches, and is especially tolerant of small gaps and nucleotide sequence errors. Nucleic acid-encoded amino acid sequences can be used to search both protein and DNA databases.
Thus, the invention provides methods for identifying a sequence similar or paralogous or orthologous or homologous to one or more polynucleotides as noted herein, or one or more target polypeptides encoded by the polynucleotides, or otherwise noted herein and may include linking or associating a given plant phenotype or gene function with a sequence. In the methods, a sequence database is provided (locally or across an internet or intranet) and a query is made against the sequence database using the relevant sequences herein and associated plant phenotypes or gene functions.
In addition, one or more polynucleotide sequences or one or more polypeptides encoded by the polynucleotide sequences may be used to search against a BLOCKS (Bairoch et al. (1997) Nucleic Acids Res. 25: 217-221), PFAM, and other databases which contain previously identified and annotated motifs, sequences and gene functions. Methods that search for primary sequence patterns with secondary structure gap penalties (Smith et al. (1992) Protein Engineering 5: 35-51) as well as algorithms such as Basic Local Alignment Search Tool (BLAST; Altschul (1993) J. Mol. Evol. 36: 290-300; Altschul et al. (1990) J.
Mol. Biol. 215:
403-410), BLOCKS (Henikoff and Henikoff (1991) Nucleic Acids Res. 19: 6565-6572), Hidden Markov Models (HAW; Eddy (1996) Curr. Opin. Str. Biol. 6: 361-365; Sonnhammer et al.
(1997) Proteins 28: 405-420), and the like, can be used to manipulate and analyze polynucleotide and polypeptide sequences encoded by polynucleotides. These databases, algorithms and other methods are well known in the art and are described in Ausubel et al. (1997;
Short Protocols in Molecular Biology. John Wiley & Sons, New York, NY, unit 7.7) and in Meyers (1995;
Molecular Biology and Biotechnology. Wiley VCH, New York, NY, p 856-853).
A further method for identifying or confirming that specific homologous sequences control the same function is by comparison of the transcript profile(s) obtained upon overexpression or knockout of two or more related transcription factors. Since transcript profiles are diagnostic for specific cellular states, one skilled in the art will appreciate that genes that have a highly similar transcript profile (e.g., with greater than 50% regulated transcripts in common, more preferably with greater than 70% regulated transcripts in common, most preferably with greater than 90%
regulated transcripts in common) will have highly similar functions. Fowler et al. ((2002) Plant Cell 14: 1675-1679) have shown that three paralogous AP2 family genes (CBF1, CBF2 and CBF3), each of which is induced upon cold treatment, and each of which can condition improved freezing tolerance, have highly similar transcript profiles. Once a transcription factor has been shown to provide a specific function, its transcript profile becomes a diagnostic tool to determine whether putative paralogs or orthologs have the same function.
Furthermore, methods using manual alignment of sequences similar or homologous to one or more polynucleotide sequences or one or more polypeptides encoded by the polynucleotide sequences may be used to identify regions of similarity and B3 binding or staygreen domains.
Such manual methods are well known of those of skill in the art and can include, for example, comparisons of tertiary structure between a polypeptide sequence encoded by a polynucleotide that comprises a known function, with a polypeptide sequence encoded by a polynucleotide sequence which has a function not yet determined. Such examples of tertiary structure may comprise predicted a-helices, I3-sheets, amphipathic helices, leucine zipper motifs, zinc finger motifs, proline-rich regions, cysteine repeat motifs, and the like.
Orthologs and paralogs of presently disclosed transcription factors may be cloned using compositions provided by the present invention according to methods well known in the art.
cDNAs can be cloned using mRNA from a plant cell or tissue that expresses one of the present transcription factors. Appropriate mRNA sources may be identified by interrogating Northern blots with probes designed from the present transcription factor sequences, after which a library is prepared from the mRNA obtained from a positive cell or tissue.
Transcription factor-encoding cDNA is then isolated using an amplification method, for example, PCR, with primers designed from a presently disclosed transcription factor gene sequence, or by probing with a partial or complete cDNA or with one or more sets of degenerate probes based on the disclosed sequences. The cDNA library may be used to transform plant cells. Expression of the cDNAs of interest is detected using, for example, methods disclosed herein such as microarrays, Northern blots, quantitative PCR, or any other technique for monitoring changes in expression.
Genomic clones may be isolated using similar techniques to those.
Identifying Polynucleotides or Nucleic Acids by Hybridization Polynucleotides homologous to the sequences illustrated in the Sequence Listing can be identified, e.g., by hybridization to each other under stringent conditions.
Single-stranded polynucleotides hybridize when they associate based on a variety of well characterized physical-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. The stringency of a hybridization reflects the degree of sequence identity of the nucleic acids involved, such that the higher the stringency, the more similar are the two polynucleotide strands. Stringency is influenced by a variety of factors, including temperature, salt concentration and composition, organic and non-organic additives, solvents, etc., present in both the hybridization and wash solutions and incubations (and number thereof), as described in more detail in the references cited above.
Encompassed herein are polynucleotide sequences that are capable of hybridizing to the claimed polynucleotide sequences, including any of the transcription factor polynucleotides within the Sequence Listing, and fragments thereof under various conditions of stringency (for example, Wahl and Berger (1987) Methods Enzymol. 152: 399-407; and Kimmel (1987) Methods Enzymol. 152: 507-51 1). In addition to the nucleotide sequences in the Sequence Listing, full-length cDNA, orthologs, and paralogs of the present nucleotide sequences may be identified and isolated using well-known methods. The cDNA libraries, orthologs, and paralogs of the present nucleotide sequences may be screened using hybridization methods to determine their utility as hybridization target or amplification probes.
With regard to hybridization, conditions that are highly stringent, and means for achieving them, are well known in the art (for example, Sambrook et al. (1989) "Molecular Cloning: A
Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory); Berger and Kimmel, eds., (1987) "Guide to Molecular Cloning Techniques", in Methods in Enzymology: 152: 467-469; and Anderson and Young (1985) "Quantitative Filter Hybridisation", in Hames and Higgins, ed., Nucleic Acid Hybridisation, A Practical Approach. Oxford, IRL Press, 73-111 ).
Stability of DNA duplexes is affected by such factors as base composition, length, and degree of base pair mismatch. Hybridization conditions may be adjusted to allow DNAs of different sequence relatedness to hybridize. The melting temperature (Tm) is defined as the temperature when 50% of the duplex molecules have dissociated into their constituent single strands. The melting temperature of a perfectly matched duplex, where the hybridization buffer contains formamide as a denaturing agent, may be estimated by the following equations:
(I) DNA-DNA:
Tm( C)=81.5+16.6(log [Na+])+0.41(% G+C)-0.62(% formamide)-500/L
(II) DNA-RNA:
Tm( C)=79. 8+18. 5(1 og [Na+])+0.58(% G+C)+0.12(%G+C)2-0.5(% formami de) -(III) RNA-RNA:
Tm( C)=79. 8+18.5(1 og [Na+])+0.58(%G+Q+0. 12(%G+C)2-0.35(% formami de) -where L is the length of the duplex formed, [Na+] is the molar concentration of the sodium ion in the hybridization or washing solution, and % G+C is the percentage of (guanine+cytosine) bases in the hybrid. For imperfectly matched hybrids, approximately 1 C is required to reduce the melting temperature for each 1% mismatch.
Hybridization experiments are generally conducted in a buffer of pH between 6.8 to 7.4, although the rate of hybridization is nearly independent of pH at ionic strengths likely to be used in the hybridization buffer (Anderson and Young (1985) supra). In addition, one or more of the following may be used to reduce non-specific hybridization: sonicated salmon sperm DNA or another non-complementary DNA, bovine serum albumin, sodium pyrophosphate, sodium dodecylsulfate (SDS), polyvinyl-pyrrolidone, ficoll and Denhardt's solution.
Dextran sulfate and polyethylene glycol 6000 act to exclude DNA from solution, thus raising the effective probe DNA concentration and the hybridization signal within a given unit of time. In some instances, conditions of even greater stringency may be desirable or required to reduce non-specific and/or background hybridization. These conditions may be created with the use of higher temperature, lower ionic strength and higher concentration of a denaturing agent such as formamide.
Stringency conditions can be adjusted to screen for moderately similar fragments such as homologous sequences from distantly-related organisms, or to highly similar fragments such as genes that duplicate functional enzymes from closely-related organisms. The stringency can be adjusted either during the hybridization step or in the post-hybridization washes. Salt concentration, formamide concentration, hybridization temperature and probe lengths are variables that can be used to alter stringency (as described by the formula above). As a general guideline, high stringency is typically performed at Tm-5 C to Tm-20 C, moderate stringency at Tm-20 C to Tm-35 C and low stringency at Tm-35 C to Tm-50 C for duplex >150 base pairs.
Hybridization may be performed at low to moderate stringency (25-50 C below Tm), followed by post-hybridization washes at increasing stringencies.
Maximum rates of hybridization in solution are determined empirically to occur at Tm-25 C for DNA-DNA duplex and Tm-15 C for RNA-DNA duplex. Optionally, the degree of dissociation may be assessed after each wash step to determine the need for subsequent, higher stringency wash steps.
High stringency conditions may be used to select for nucleic acid sequences with high degrees of identity to the disclosed sequences. An example of stringent hybridization conditions obtained in a filter-based method such as a Southern or northern blot for hybridization of complementary nucleic acids that have more than 100 complementary residues is about 5 C to 20 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
Conditions used for hybridization may include about 0.02 M to about 0.15 M
sodium chloride, about 0.5% to about 5% casein, about 0.02%> SDS or about 0.1% N-laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at hybridization temperatures between about 50 C and about 70 C. More preferably, high stringency conditions are about 0.02 M
sodium chloride, about 0.5% casein, about 0.02% SDS, about 0.001 M sodium citrate, at a temperature of about 50 C. Nucleic acid molecules that hybridize under stringent conditions will typically hybridize to a probe based on either the entire DNA molecule or selected portions, e.g., to a unique subsequence, of the DNA.
Stringent salt concentration will ordinarily be less than about 750 mM NaC1 and 75 mM
trisodium citrate. Increasingly stringent conditions may be obtained with less than about 500 mM NaC1 and 50 mM trisodium citrate, to even greater stringency with less than about 250 mM
NaC1 and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, whereas high stringency hybridization may be obtained in the presence of at least about 35% formamide, and more preferably at least about 50%
formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30 C, more preferably of at least about 37 C, and most preferably of at least about 42 C
with formamide present. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS) and ionic strength, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed.
The washing steps that follow hybridization may also vary in stringency; the post-hybridization wash steps primarily determine hybridization specificity, with the most critical factors being temperature and the ionic strength of the final wash solution. Wash stringency can be increased by decreasing salt concentration or by increasing temperature. Stringent salt concentration for the wash steps will preferably be less than about 30 mM NaC1 and 3 mM
trisodium citrate, and most preferably less than about 15 mM NaC1 and 1.5 mM trisodium citrate.

Thus, hybridization and wash conditions that may be used to bind and remove polynucleotides with less than the desired homology to the nucleic acid sequences or their complements that encode the present transcription factors include, for example: 6X SSC at 65 C; 50% formamide, 4X SSC at 42 C; or 0.5X SSC, 0.1% SDS at 65 C; with, for example, two wash steps of 10 - 30 minutes each. Useful variations on these conditions will be readily apparent to those skilled in the art.
A person of skill in the art would not expect substantial variation among polynucleotide species encompassed within the scope of the present invention because the highly stringent conditions set forth in the above formulae yield structurally similar polynucleotides.
If desired, one may employ wash steps of even greater stringency, including about 0.2X SSC, 0.1% SDS at 65 C and washing twice, each wash step being about 30 min, or about 0.1 X SSC, 0.1% SDS at 65 C and washing twice for 30 min. The temperature for the wash solutions will ordinarily be at least about 25 C, and for greater stringency at least about 42 C. Hybridization stringency may be increased further by using the same conditions as in the hybridization steps, with the wash temperature raised about 3 C to about 5 C, and stringency may be increased even further by using the same conditions except the wash temperature is raised about 6 C to about 9 C. For identification of less closely related homologs, wash steps may be performed at a lower temperature, e.g., 50 C.
An example of a low stringency wash step employs a solution and conditions of at least 25 C in 30 mM NaC1, 3 mM trisodium citrate, and 0.1% SDS over 30 min. Greater stringency may be obtained at 42 C in 15 mM NaC1, with 1.5 mM trisodium citrate, and 0.1% SDS
over 30 min.
Even higher stringency wash conditions are obtained at 65 C -68 C in a solution of 15 mM
NaC1, 1.5 mM trisodium citrate, and 0.1% SDS. Wash procedures will generally employ at least two final wash steps. Additional variations on these conditions will be readily apparent to those skilled in the art (for example, U.S. Patent Application No. 20010010913).
Stringency conditions can be selected such that an oligonucleotide that is perfectly complementary to the coding oligonucleotide hybridizes to the coding oligonucleotide with at least about a 5-10 x higher signal to noise ratio than the ratio for hybridization of the perfectly complementary oligonucleotide to a nucleic acid encoding a transcription factor known as of the filing date of the application. It may be desirable to select conditions for a particular assay such that a higher signal to noise ratio, that is, about 15x or more, is obtained.
Accordingly, a subject nucleic acid will hybridize to a unique coding oligonucleotide with at least a 2x or greater signal to noise ratio as compared to hybridization of the coding oligonucleotide to a nucleic acid encoding known polypeptide. The particular signal will depend on the label used in the relevant assay, e.g., a fluorescent label, a colorimetric label, a radioactive label, or the like. Labeled hybridization or PCR probes for detecting related polynucleotide sequences may be produced by oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions.
Identifying Polynucleotides or Nucleic Acids with Expression Libraries In addition to hybridization methods, transcription factor homolog polypeptides can be obtained by screening an expression library using antibodies specific for one or more transcription factors.
With the provision herein of the disclosed transcription factor, and transcription factor homolog nucleic acid sequences, the encoded polypeptide(s) can be expressed and purified in a heterologous expression system (e.g., E. coil) and used to raise antibodies (monoclonal or polyclonal) specific for the polypeptide(s) in question. Antibodies can also be raised against synthetic peptides derived from the sequences of transcription factors or homologous sequences.
Methods of raising antibodies are well known in the art and are described in Harlow and Lane (1988), Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, New York. Such antibodies can then be used to screen an expression library produced from the plant from which it is desired to clone additional transcription factor homologs, using the methods described above. The selected cDNAs can be confirmed by sequencing and enzymatic activity.
Sequence Variations It will readily be appreciated by those of skill in the art, that any of a variety of polynucleotide sequences are capable of encoding the transcription factors and transcription factor homolog polypeptides of the invention. Due to the degeneracy of the genetic code, many different polynucleotides can encode identical and/or substantially similar polypeptides in addition to those sequences illustrated in the Sequence Listing. Nucleic acids having a sequence that differs from the sequences shown in the Sequence Listing, or complementary sequences, that encode functionally equivalent peptides (i.e., peptides having some degree of equivalent or similar biological activity) but differ in sequence from the sequence shown in the Sequence Listing due to degeneracy in the genetic code, are also within the scope of the invention.
Altered polynucleotide sequences encoding polypeptides include sequences with deletions, insertions, or substitutions of different nucleotides, resulting in a polynucleotide encoding a polypeptide with at least one functional characteristic of the instant polypeptides. Included within this definition are polymorphisms which may or may not be readily detectable using a particular oligonucleotide probe of the polynucleotide encoding the instant polypeptides, and improper or unexpected hybridization to allelic variants, with a locus other than the normal chromosomal locus for the polynucleotide sequence encoding the instant polypeptides.
Allelic variant refers to any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (i.e., no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence. The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
Splice variant refers to alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
Those skilled in the art would recognize that, for example, ABI3, (Arabidopsis - SEQ ID NO: 2;
canola - SEQ ID NO: 8), represents a single transcription factor; allelic variation and alternative splicing may be expected to occur. Allelic variants of SEQ ID NO: 2 or SEQ ID
NO: 8 can be cloned by probing cDNA or genomic libraries from different individual organisms according to standard procedures. Allelic variants of the DNA sequence shown in SEQ ID NO:
2 or SEQ ID
NO: 8, including those containing silent mutations and those in which mutations result in amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ ID NO: 1 or SEQ ID NO: 7. cDNAs generated from alternatively spliced mRNAs, which retain the properties of the transcription factor are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs.
Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individual organisms or tissues according to standard procedures known in the art (for example, U.S. Patent No. 6,388,064).
Thus, the invention also encompasses related nucleic acid molecules that include allelic or splice variants of SEQ ID NO: 2, 4, 6, and 8, and include sequences which are complementary to any of the above nucleotide sequences. Related nucleic acid molecules also include nucleotide sequences encoding a polypeptide comprising a substitution, modification, addition and/or deletion of one or more amino acid residues compared to the polypeptides as set forth in any of SEQ ID NO: 1, 3, 5 and 7. Such related polypeptides may comprise, for example, additions and/or deletions of one or more N-linked or 0-linked glycosylation sites, or an addition and/or a deletion of one or more cysteine residues.
For example, Table 2 illustrates, e.g., that the codons AGC, AGT, TCA, TCC, TCG, and TCT all encode the same amino acid: serine. Accordingly, at each position in the sequence where there is a codon encoding serine, any of the above trinucleotide sequences can be used without altering the encoded polypeptide.
Table 2:
Amino acid Possible Codons Alanine (Ala, A) GCA GCC GCG GCT
Cysteine (Cys, C) TGC TGT
Aspartic acid (Asp, D) GAC GAT
Glutamic acid (Glu, E) GAA GAG
Phenylalanine (Phe, F) TTC TTT
Glycine (Gly, G) GGA GGC GGG GGT
Hi sti dine (His, H) CAC CAT
Isoleucine (Ile, I) ATA ATC ATT
Lysine (Lys, K) AAA AAG

Leucine (Leu, L) TTA TTG CTA CTC CTG CTT
Methionine (Met, M) ATG
Asparagine (Asn, N) AAC AAT
Proline (Pro, P) CCA CCC CCG CCT
Glutamine (Gin, Q) CAA CAG
Arginine (Arg, R) AGA AGG CGA CGC CGG CGT
Serine (Ser, S) AGC AGT TCA TCC TCG TCT
Threonine (Thr, T) ACA ACC ACG ACT
Valine (Val, V) GTA GTC GTG GTT
Tryptophan (Trp, W) TGG
Tyrosine (Tyr, Y) TAC TAT
Sequence alterations that do not change the amino acid sequence encoded by the polynucleotide are termed "silent" variations. With the exception of the codons ATG and TGG, encoding methionine and tryptophan, respectively, any of the possible codons for the same amino acid can be substituted by a variety of techniques, e.g., site-directed mutagenesis, available in the art.
Accordingly, any and all such variations of a sequence selected from the above table are a feature of the invention.
In addition to silent variations, other conservative variations that alter one, or a few amino acid residues in the encoded polypeptide, can be made without altering the function of the polypeptide, these conservative variants are, likewise, a feature of the invention. For example, substitutions, deletions and insertions introduced into the sequences provided in the Sequence Listing, are also envisioned by the invention. Such sequence modifications can be engineered into a sequence by site-directed mutagenesis (Wu (ed.) Methods Enzymol. (1993) vol. 217, Academic Press) or the other methods noted below. Amino acid substitutions are typically of single residues; insertions usually will be on the order of about from 1 to 10 amino acid residues;
and deletions will range about from 1 to 30 residues. In some embodiments, deletions or insertions are made in adjacent pairs, e.g., a deletion of two residues or insertion of two residues.
Substitutions, deletions, insertions or any combination thereof can be combined to arrive at a sequence. The mutations that are made in the polynucleotide encoding the transcription factor should not place the sequence out of reading frame and should not create complementary regions that could produce secondary mRNA structure. Preferably, the polypeptide encoded by the DNA
performs the desired function.
Conservative substitutions are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the Table 3 when it is desired to maintain the activity of the protein. Table 3 shows amino acids which can be substituted for an amino acid in a protein and which are typically regarded as conservative substitutions.
Table 3:
RiiIue Cormervitive Su.bsd.tutions - -A14 Scr Arg Lys Aim Ghi. Ills AN-i= Clu , .
G[n Ari Cs Se!
=
Gin Asp Gly Pro ______________________________________________________________________ =
Hi Asnr. (7111.3 lic Li. V1 Lehi .11c, Val Lys Arg: (i1ri Met I reu; lie Fthc Met, Lei.[;
Ser Thr, OR
¨ ______________________________________________________________________ Thr Ser; Val TriF I Tyr Trp; Phe=
Val II. Lei"
Similar substitutions are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the Table 4 when it is desired to maintain the activity of the protein. Table 4 shows amino acids which can be substituted for an amino acid in a protein and which are typically regarded as structural and functional substitutions. For example, a residue in column 1 of Table 4 may be substituted with a residue in column 2; in addition, a residue in column 2 of Table 4 may be substituted with the residue of column 1.
Table 4:
Rsidue Similar Substitutions Ala Su; Thy, Gly; Va1;, L41.1r,II
A rg Lys: His; Gly Asa Gin: His: Gly; Ser., Mr Asp Gin, Ser; Thir IQ hi An; Al$
Cy s SLY, Gly Giu Asp Pro; Aq;
Ills Ain; Cp1r1; Tyr; Ph; Arg Ile Ala; Lcu; Val; Gly; Met Ltu. Ala;. Ile; Val; Gly; tgict Lys An.; His: Gin; Gly, Pro N.le( Lett; [le; Pht . .
= Ph Mu.
ail Tyr, Trp., Val; Ala Sr Thr; 0Iy; Asp.; Val;
Ile; His Thr Ser; Val; Ala; Gly Trp. Tyr; Phe; His Tyr Tip; Phe; HiS
_ .
Val Ala; Ile; Leu; 0 ly; Thy; Ser, GILL
Substitutions that are less conservative than those in Table 4 can be selected by picking residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl;
(b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.
Further Modifying Sequences - Mutation/Forced Evolution In addition to generating silent or conservative substitutions as noted, above, the present invention optionally includes methods of modifying the sequences of the Sequence Listing. In the methods, nucleic acid or protein modification methods are used to alter the given sequences to produce new sequences and/or to chemically or enzymatically modify given sequences to change the properties of the nucleic acids or proteins.
Thus, given nucleic acid sequences can be modified, e.g., according to standard mutagenesis or artificial evolution methods to produce modified sequences. The modified sequences may be created using purified natural polynucleotides isolated from any organism or may be synthesized from purified compositions and chemicals using chemical means well known to those of skill in the art. For example, Ausubel, supra, provides additional details on mutagenesis methods.
Artificial forced evolution methods are described, for example, by Stemmer (1994) Nature 370:
389-391, Stemmer (1994) Proc. Natl. Acad. Sci. 91: 10747-10751, and US Patents 5,811,238, 5,837,500, and 6,242,568. Methods for engineering synthetic transcription factors and other polypeptides are described, for example, by Zhang et al. (2000) J. Biol. Chem.
275: 33850-33860, Liu et al. (2001) J. Biol. Chem. 276: 11323-1 1334, and Isalan et al.
(2001) Nature Biotechnol. 19: 656-660. Many other mutation and evolution methods are also available and expected to be within the skill of the practitioner.
Similarly, chemical or enzymatic alteration of expressed nucleic acids and polypeptides can be performed by standard methods. For example, sequence can be modified by addition of lipids, sugars, peptides, organic or inorganic compounds, by the inclusion of modified nucleotides or amino acids, or the like. For example, protein modification techniques are illustrated in Ausubel, supra. Further details on chemical and enzymatic modifications can be found herein. These modification methods can be used to modify any given sequence, or to modify any sequence produced by the various mutation and artificial evolution modification methods noted herein.
Accordingly, the invention provides for modification of any given nucleic acid by mutation, evolution, chemical or enzymatic modification, or other available methods, as well as for the products produced by practicing such methods, e.g., using the sequences herein as a starting substrate for the various modification approaches.
For example, optimized coding sequence containing codons preferred by a particular prokaryotic or eukaryotic host can be used e.g., to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced using a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, preferred stop codons for Saccharomyces cerevisiae and mammals are TAA and TGA, respectively. The preferred stop codon for monocotyledonous plants is TGA, whereas insects and E. coil prefer to use TAA
as the stop codon.
The polynucleotide sequences of the present invention can also be engineered in order to alter a coding sequence for a variety of reasons, including but not limited to, alterations which modify the sequence to facilitate cloning, processing and/or expression of the gene product. For example, alterations are optionally introduced using techniques which are well known in the art, e.g., site-directed mutagenesis, to insert new restriction sites, to alter glycosylation patterns, to change codon preference, to introduce splice sites, etc.
Furthermore, a fragment or domain derived from any of the polypeptides of the invention can be combined with domains derived from other transcription factors or synthetic domains to modify the biological activity of a transcription factor. For instance, a DNA-binding domain derived from a transcription factor of the invention can be combined with the activation domain of another transcription factor or with a synthetic activation domain. A
transcription activation domain assists in initiating transcription from a DNA-binding site. Examples include the transcription activation region of VP16 or GAL4 (Moore et al. (1998) Proc.
Natl. Acad. Sci. 95:
376-381; Aoyama et al. (1995) Plant Cell 7: 1773-1785), peptides derived from bacterial sequences (Ma and Ptashne (1987) Cell 51: 113-119) and synthetic peptides (Giniger and Ptashne (1987) Nature 330: 670-672).
Expression and Modification of Polypeptides Typically, polynucleotide sequences of the invention are incorporated into recombinant DNA (or RNA) molecules that direct expression of polypeptides of the invention in appropriate host cells, transgenic plants, in vitro translation systems, or the like. Due to the inherent degeneracy of the genetic code, nucleic acid sequences which encode substantially the same or a functionally equivalent amino acid sequence can be substituted for any listed sequence to provide for cloning and expressing the relevant homolog.
The transgenic plants of the present invention comprising recombinant polynucleotide sequences are generally derived from parental plants, which may themselves be non-transformed (or non-transgenic) plants. These transgenic plants may either have a transcription factor gene "knocked out" (for example, with a genomic insertion by homologous recombination, an antisense or ribozyme construct) or expressed to a normal or wild-type extent. However, overexpressing transgenic "progeny" plants will exhibit greater mRNA levels, wherein the mRNA
encodes a transcription factor, that is, a DNA-binding protein that is capable of binding to a DNA
regulatory sequence and inducing transcription, and preferably, expression of a plant trait gene.
Preferably, the mRNA expression level will be at least three-fold greater than that of the parental plant, or more preferably at least ten-fold greater mRNA levels compared to said parental plant, and most preferably at least fifty-fold greater compared to said parental plant.
Vectors, Promoters, and Expression Systems The present invention includes recombinant constructs comprising one or more of the nucleic acid sequences herein. The constructs typically comprise a vector, such as a plasmid, a cosmid, a phage, a virus (e.g., a plant virus), a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), or the like, into which a nucleic acid sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available.
General texts that describe molecular biological techniques useful herein, including the use and production of vectors, promoters and many other relevant topics, include Berger, Sambrook, supra and Ausubel, supra. Any of the identified sequences can be incorporated into a cassette or vector, e.g., for expression in plants. A number of expression vectors suitable for stable transformation of plant cells or for the establishment of transgenic plants have been described including those described in Weissbach and Weissbach (1989) Methods for Plant Molecular Biology, Academic Press, and Gelvin et al. (1990) Plant Molecular Biology Manual, Kluwer Academic Publishers. Specific examples include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed by Herrera-Estrella et al. (1983) Nature 303: 209, Bevan (1984) Nucleic Acids Res. 12: 8711-8721, Klee ( 1985) Bio/Technology 3:637-642, for dicotyledonous plants.
Alternatively, non-Ti vectors can be used to transfer the DNA into monocotyledonous plants and cells by using free DNA delivery techniques. Such methods can involve, for example, the use of liposomes, electroporation, microprojectile bombardment, silicon carbide whiskers, and viruses.
By using these methods transgenic plants such as wheat, rice (Christou (1991) Bio/Technology 9: 957-962) and corn (Gordon-Kamm (1990) Plant Cell 2: 603-618) can be produced. An immature embryo can also be a good target tissue for monocots for direct DNA
delivery techniques by using the particle gun (Weeks et al. (1993) Plant Physiol. 102:
1077-1084; Vasil (1993) Bio/Technology 10: 667-674; Wan and Lemeaux (1994) Plant Physiol. 104:
37-48, and for Agrobacterium-mediated DNA transfer (Ishida et al. (1996) Nature Biotechnol. 14: 745-750).
Typically, plant transformation vectors include one or more cloned plant coding sequence (genomic or cDNA) under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant transformation vectors typically also contain a promoter (e.g., a regulatory region controlling inducible or constitutive, environmentally-or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, an RNA processing signal (such as intron splice sites), a transcription termination site, and/or a polyadenylation signal.
A potential utility for the transcription factor polynucleotides disclosed herein is the isolation of promoter elements from these genes that can be used to program expression in plants of any genes. Each transcription factor gene disclosed herein is expressed in a unique fashion, as determined by promoter elements located upstream of the start of translation, and additionally within an intron of the transcription factor gene or downstream of the termination codon of the gene. As is well known in the art, for a significant portion of genes, the promoter sequences are located entirely in the region directly upstream of the start of translation.
In such cases, typically the promoter sequences are located within 2.0 kb of the start of translation, or within 1.5 kb of the start of translation, frequently within 1.0 kb of the start of translation, and sometimes within 0.5 kb of the start of translation.
The promoter sequences can be isolated according to methods known to one skilled in the art.
Examples of constitutive plant promoters which can be useful for expressing the TF sequence include: the cauliflower mosaic virus (CaMV) 35S promoter, which confers constitutive, high-level expression in most plant tissues (for example, Odell et al. (1985) Nature 313: 810-812); the nopaline synthase promoter (An et al. (1988) Plant Physiol. 88: 547-552); and the octopine synthase promoter (Fromm et al. (1989) Plant Cell 1 : 977-984).
The transcription factors of the invention may be operably linked with a specific promoter that causes the transcription factor to be expressed in response to environmental, tissue-specific or temporal signals. A variety of plant gene promoters that regulate gene expression in response to environmental, hormonal, chemical, developmental signals, and in a tissue-active manner can be used for expression of a TF sequence in plants. Choice of a promoter is based largely on the phenotype of interest and is determined by such factors as tissue (e.g., seed, fruit, root, pollen, vascular tissue, flower, carpel, etc.), inducibility (e.g., in response to drought, wounding, heat, cold, light, pathogens, etc.), timing, developmental stage, and the like.
Numerous known promoters have been characterized and can favorably be employed to promote expression of a polynucleotide of the invention in a transgenic plant or cell of interest. For example, tissue-specific promoters include: seed-specific promoters (such as the napin, phaseolin or DC3 promoter described in U.S. Patent No. 5,773,697), fruit-specific promoters that are active during fruit ripening (such as the drul promoter (U.S. Patent No. 5,783,393), or the 2A11 promoter (U.S. Pat.ent No. 4,943,674) and the tomato polygalacturonase promoter (Bird et al. (1988) Plant Mol. Biol. 11: 651 -662), root-specific promoters, such as those disclosed in US Patent Nos.
5,618,988, 5,837,848 and 5,905,186, pollen-active promoters such as PTA29, PTA26 and PTA13 (US Pat. No. 5,792,929), promoters active in vascular tissue (Ringli and Keller (1998) Plant Mol.
Biol. 37: 977-988), flower-specific (Kaiser et al. (1995) Plant Mol. Biol. 28:
231-243), pollen (Baerson et al. (1994) Plant Mol. Biol. 26: 1947-1959), carpels (Ohl et al.
(1990) Plant Cell 2:
837-848), pollen and ovules (Baerson et al. (1993) Plant Mol. Biol. 22: 255-267), auxin-inducible promoters (such as that described in van der Kop et al. (1999) Plant Mol. Biol. 39: 979-990 or Baumann et al., (1999) Plant Cell 11: 323-334), cytokinin-inducible promoter (Guevara-Garcia (1998) Plant Mol. Biol. 38: 743-753), promoters responsive to gibberellin (Shi et al.
(1998) Plant Mol. Biol. 38: 1053-1060, Willmott et al. (1998) Plant Molec.
Biol. 38: 817-825) and the like. Additional promoters are those that elicit expression in response to heat (Ainley et al. (1993) Plant Mol. Biol. 22: 13-23), light (e.g., the pea rbcS-3A promoter, Kuhlemeier et al.
(1989) Plant Cell 1 : 471-478, and the maize rbcS promoter, Schaffner and Sheen (1991) Plant Cell 3: 997-1012); wounding (e.g., wunl, Siebertz et al. (1989) Plant Cell 1:
961-968);
pathogens (such as the PR-1 promoter described in Buchel et al. (1999) Plant Mol. Biol. 40:
387-396, and the PDF1.2 promoter described in Manners et al. (1998) Plant Mol.
Biol. 38:
1071-1080), and chemicals such as methyl jasmonate or salicylic acid (Gatz (1997) Annu. Rev.
Plant Physiol. Plant Mol. Biol. 48: 89-108). In addition, the timing of the expression can be controlled by using promoters such as those acting at senescence (Gan and Amasino (1995) Science 270: 1986-1988); or late seed development (Odell et al. (1994) Plant Physiol. 106: 447-458).
Plant expression vectors can also include RNA processing signals that can be positioned within, upstream or downstream of the coding sequence. In addition, the expression vectors can include additional regulatory sequences from the 3 '-untranslated region of plant genes, e.g., a 3' terminator region to increase mRNA stability of the mRNA, such as the PI-II
terminator region of potato or the octopine or nopaline synthase 3' terminator regions.
Additional Expression Elements Specific initiation signals can aid in efficient translation of coding sequences. These signals can include, e.g., the ATG initiation codon and adjacent sequences. In cases where a coding sequence, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional translational control signals may be needed.
However, in cases where only coding sequence (e.g., a mature protein coding sequence) or a portion thereof is inserted, exogenous transcriptional control signals including the ATG
initiation codon can be separately provided. The initiation codon is provided in the correct reading frame to facilitate transcription. Exogenous transcriptional elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers appropriate to the cell system in use.
Expression Hosts The present invention also relates to host cells which are transduced with vectors of the invention, and the production of polypeptides of the invention (including fragments thereof) by recombinant techniques. Host cells are genetically engineered (i.e., nucleic acids are introduced, e.g., transduced, transformed or transfected) with the vectors of this invention, which may be, for example, a cloning vector or an expression vector comprising the relevant nucleic acids herein.
The vector is optionally a plasmid, a viral particle, a phage, a naked nucleic acid, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants, or amplifying the relevant gene. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art and in the references cited herein, including, Sambrook, supra and Ausubel, supra.
The host cell can be a eukaryotic cell, such as a yeast cell, or a plant cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Plant protoplasts are also suitable for some applications. For example, the DNA fragments are introduced into plant tissues, cultured plant cells or plant protoplasts by standard methods including electroporation (Fromm et al. (1985) Proc. Natl. Acad. Sci. 82: 5824-5828), infection by viral vectors such as cauliflower mosaic virus (CaMV) (Hohn et al. (1982) Molecular Biology of Plant Tumors Academic Press, New York, NY, pp. 549-560; US 4,407,956), high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface (Klein et al.
(1987) Nature 327: 70-73), use of pollen as vector (WO 85/01856), or use of Agrobacterium tumefaciens or A. rhizogenes carrying a T-DNA plasmid in which DNA fragments are cloned.
The T-DNA plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and a portion is stably integrated into the plant genome (Horsch et al. (1984) Science 233: 496-498; Fraley et al. (1983) Proc. Natl. Acad. Sci. 80: 4803-4807).
The cell can include a nucleic acid of the invention that encodes a polypeptide, wherein the cell expresses a polypeptide of the invention. The cell can also include vector sequences, or the like.
Furthermore, cells and transgenic plants that include any polypeptide or nucleic acid above or throughout this specification, e.g., produced by transduction of a vector of the invention, are an additional feature of the invention.
For long-term, high-yield production of recombinant proteins, stable expression can be used.
Host cells transformed with a nucleotide sequence encoding a polypeptide of the invention are optionally cultured under conditions suitable for the expression and recovery of the encoded protein from cell culture. The protein or fragment thereof produced by a recombinant cell may be secreted, membrane-bound, or contained intracellularly, depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides encoding mature proteins of the invention can be designed with signal sequences that direct secretion of the mature polypeptides through a prokaryotic or eukaryotic cell membrane.
Modified Amino Acid Residues Polypeptides of the invention may contain one or more modified amino acid residues. The presence of modified amino acids may be advantageous in, for example, increasing polypeptide half-life, reducing polypeptide antigenicity or toxicity, increasing polypeptide storage stability, or the like. Amino acid residue(s) are modified, for example, co-translationally or post-translationally during recombinant production or modified by synthetic or chemical means.
Non-limiting examples of a modified amino acid residue include incorporation or other use of acetylated amino acids, glycosylated amino acids, sulfated amino acids, prenylated (e.g., farnesylated, geranylgeranylated) amino acids, PEG modified (e.g., "PEGylated") amino acids, biotinylated amino acids, carboxylated amino acids, phosphorylated amino acids, etc. References adequate to guide one of skill in the modification of amino acid residues are replete throughout the literature.
The modified amino acid residues may prevent or increase affinity of the polypeptide for another molecule, including, but not limited to, polynucleotides, proteins, carbohydrates, lipids and lipid derivatives, and other organic or synthetic compounds.
Identification of Additional Protein Factors A transcription factor provided by the present invention can also be used to identify additional endogenous or exogenous molecules that can affect a phenotype or trait of interest. Such molecules include endogenous molecules that are acted upon either at a transcriptional level by a transcription factor of the invention to modify a phenotype as desired. For example, the transcription factors can be employed to identify one or more downstream genes that are subject to a regulatory effect of the transcription factor. In one approach, a transcription factor or transcription factor homolog of the invention is expressed in a host cell, e.g., a transgenic plant cell, tissue or explant, and expression products, either RNA or protein, of likely or random targets are monitored, e.g., by hybridization to a microarray of nucleic acid probes corresponding to genes expressed in a tissue or cell type of interest, by two-dimensional gel electrophoresis of protein products, or by any other method known in the art for assessing expression of gene products at the level of RNA or protein. Alternatively, a transcription factor of the invention can be used to identify promoter sequences (such as binding sites on DNA
sequences) involved in the regulation of a downstream target. After identifying a promoter sequence, interactions between the transcription factor and the promoter sequence can be modified by changing specific nucleotides in the promoter sequence or specific amino acids in the transcription factor that interact with the promoter sequence to alter a plant trait. Typically, transcription factor DNA-binding sites are identified by gel shift assays. After identifying the promoter regions, the promoter region sequences can be employed in double-stranded DNA arrays to identify molecules that affect the interactions of the transcription factors with their promoters (Bulyk et al. (1999) Nature Biotechnol. 17: 573-577).

The identified transcription factors are also useful to identify proteins that modify the activity of the transcription factor. Such modification can occur by covalent modification, such as by phosphorylation, or by protein-protein (homo- or heteropolymer) interactions.
Any method suitable for detecting protein-protein interactions can be employed. Among the methods that can be employed are co-immunoprecipitation, cross-linking and co-purification through gradients or chromatographic columns, and the two-hybrid yeast system.
The two-hybrid system detects protein interactions in vivo and is described in Chien et al.
((1991) Proc. Natl. Acad. Sci. 88: 9578-9582) and is commercially available from Clontech (Palo Alto, Calif). In such a system, plasmids are constructed that encode two hybrid proteins:
one consists of the DNA-binding domain of a transcription activator protein fused to the TF
polypeptide and the other consists of the transcription activator protein's activation domain fused to an unknown protein that is encoded by a cDNA that has been recombined into the plasmid as part of a cDNA library. The DNA-binding domain fusion plasmid and the cDNA
library are transformed into a strain of the yeast Saccharomyces cerevisiae that contains a reporter gene (e.g., lacZ) whose regulatory region contains the transcription activator's binding site. Either hybrid protein alone cannot activate transcription of the reporter gene.
Interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, which is detected by an assay for the reporter gene product.
Then, the library plasmids responsible for reporter gene expression are isolated and sequenced to identify the proteins encoded by the library plasmids. After identifying proteins that interact with the transcription factors, assays for compounds that interfere with the TF protein-protein interactions can be performed.
Subsequences Also contemplated are uses of polynucleotides, also referred to herein as oligonucleotides, typically having at least 12 bases, preferably at least 15, more preferably at least 20, 30, or 50 bases, which hybridize under stringent conditions to a polynucleotide sequence described above.
The polynucleotides may be used as probes, primers, sense and antisense agents, and the like, according to methods as noted supra.
Subsequences of the polynucleotides of the invention, including polynucleotide fragments and oligonucleotides, are useful as nucleic acid probes and primers. An oligonucleotide suitable for use as a probe or primer is typically at least about 15 nucleotides in length, and frequently at least about 30 or 40 or more nucleotides in length. A nucleic acid probe is useful in hybridization protocols, for example, to identify additional polypeptide homologs of the invention, including protocols for microarray experiments. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA
strand with DNA
polymerase. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods (Sambrook, supra, and Ausubel, supra).
In addition, one could isolate or create a recombinant polypeptide including a subsequence of at least about 15 contiguous amino acids encoded by the recombinant or isolated polynucleotides of the invention. For example, such polypeptides, or domains or fragments thereof, can be used as immunogens, e.g., to produce antibodies specific for the polypeptide sequence, or as probes for detecting a sequence of interest. A subsequence can range in size from about 15 amino acids in length up to and including the full length of the polypeptide.
To be encompassed by the present invention, an expressed polypeptide which comprises such a polypeptide subsequence performs at least one biological function of the intact polypeptide in substantially the same manner, or to a similar extent, as does the intact polypeptide. For example, a polypeptide fragment can comprise a recognizable structural motif or functional domain such as a DNA binding domain that activates transcription, e.g., by binding to a specific DNA promoter region an activation domain, or a domain for protein-protein interactions.
Production of Transgenic Plants Modification of Traits The polynucleotides of the invention are favorably employed to produce transgenic plants with various traits, or characteristics, that have been modified in a desirable manner, e.g., to improve the seed characteristics of a plant. For example, alteration of expression levels or patterns (e.g., spatial or temporal expression patterns) of one or more of the transcription factors (or transcription factor homologs) of the invention, as compared with the levels of the same protein found in a wild-type plant, can be used to modify a plant's traits. An illustrative example of trait modification, improved characteristics, by altering expression levels of a particular transcription factor is described further in the Examples and the Sequence Listing.
Arabidopsis as a model system Arabidopsis thaliana is the object of rapidly growing attention as a model for genetics and metabolism in plants. Arabidopsis has a small genome, and well-documented studies are available. It is easy to grow in large numbers and mutants defining important genetically controlled mechanisms are either available, or can readily be obtained.
Various methods to introduce and express isolated homologous genes are available (Koncz et al., eds., Methods in Arabidopsis Research (1992) World Scientific, New Jersey, NJ, in "Preface").
Because of its small size, short life cycle, obligate autogamy and high fertility, Arabidopsis is also a choice organism for the isolation of mutants and studies in morphogenetic and development pathways, and control of these pathways by transcription factors (Koncz (1992) supra, p.
72). A number of studies introducing transcription factors into A. thaliana have demonstrated the utility of this plant for understanding the mechanisms of gene regulation and trait alteration in plants (for example, Koncz (1992) supra, and U.S. Patent No. 6,417,428).
Arabidopsis genes in transgenic plants.
Expression of genes that encode transcription factors that modify expression of endogenous genes, polynucleotides, and proteins are well known in the art. In addition, transgenic plants comprising isolated polynucleotides encoding transcription factors may also modify expression of endogenous genes, polynucleotides, and proteins. Examples include Peng et al. (1997) Genes and Development 11: 3194-3205, and Peng et al. (1999) Nature 400: 256-261. In addition, many others have demonstrated that an Arabidopsis transcription factor expressed in an exogenous plant species elicits the same or very similar phenotypic response (for example, Fu et al. (2001) Plant Cell 13: 1791-1802; Nandi et al. (2000) Curr. Biol. 10: 215-218; Coupland (1995) Nature 311: 482-483; and Weigel and Nilsson (1995) Nature 377: 482-500).
Homologous genes introduced into transgenic plants.

Homologous genes that may be derived from any plant, or from any source whether natural, synthetic, semi-synthetic or recombinant, and that share significant sequence identity or similarity to those provided by the present invention, may be introduced into plants, for example, crop plants, to confer desirable or improved traits. Consequently, transgenic plants may be produced that comprise a recombinant expression vector or cassette with a promoter operably linked to one or more sequences homologous to presently disclosed sequences.
The promoter may be, for example, a plant or viral promoter.
The invention thus provides for methods for preparing transgenic plants, and for modifying plant traits. These methods include introducing into a plant a recombinant expression vector or cassette comprising a functional promoter operably linked to one or more sequences homologous to presently disclosed sequences.
Transcription factors of interest for the modification of plant traits Currently, the existence of a series of maturity groups for different latitudes represents a major barrier to the introduction of new valuable traits. Any trait (e.g.
environmental stress tolerance such as cold) has to be bred into each of the different maturity groups separately, a laborious and costly exercise. The availability of single strain, which could be grown at any latitude, would therefore greatly increase the potential for introducing new traits to crop species such as soybean and canola.
For the specific effects, traits and utilities conferred to plants, one or more transcription factor genes of the present invention may be used to increase or decrease, or improve or prove deleterious to a given trait. For example, knocking out a transcription factor gene that naturally occurs in a plant, or suppressing the gene (with, for example, antisense suppression), may cause decreased tolerance to an abiotic stress relative to non-transformed or wild-type plants. By overexpressing this gene, the plant may experience increased tolerance to the same stress. More than one transcription factor gene may be introduced into a plant, either by transforming the plant with one or more vectors comprising two or more transcription factors, or by selective breeding of plants to yield hybrid crosses that comprise more than one introduced transcription factor.

Genes, traits and utilities that affect plant characteristics Plant transcription factors can modulate gene expression, and, in turn, be modulated by the environmental experience of a plant. Significant alterations in a plant's environment invariably result in a change in the plant's transcription factor gene expression pattern. Altered transcription factor expression patterns generally result in phenotypic changes in the plant. Transcription factor gene product(s) in transgenic plants then differ(s) in amounts or proportions from that found in wild-type or non-transformed plants, and those transcription factors likely represent polypeptides that are used to alter the response to the environmental change.
By way of example, it is well accepted in the art that analytical methods based on altered expression patterns may be used to screen for phenotypic changes in a plant far more effectively than can be achieved using traditional methods.
Antisense and Co-suppression In addition to expression of the nucleic acids of the invention as gene replacement or plant phenotype modification nucleic acids, the nucleic acids are also useful for sense and anti-sense suppression of expression, e.g. to down-regulate expression of a nucleic acid of the invention, e.g. as a further mechanism for modulating plant phenotype. That is, the nucleic acids of the invention, or subsequences or anti-sense sequences thereof, can be used to block expression of naturally occurring homologous nucleic acids. A variety of sense and anti-sense technologies are known in the art, e.g. as set forth in Lichtenstein and Nellen (1997) Antisense Technology: A
Practical Approach, IRL Press at Oxford University Press, Oxford, U.K.
Antisense regulation is also described in Crowley et al. (1985) Cell 43: 633-641; Rosenberg et al.
(1985) Nature 313:
703-706; Preiss et al. (1985) Nature 313: 27-32; Melton (1985) Proc. Natl.
Acad. Sci. 82: 144-148; Izant and Weintraub (1985) Science 229: 345-352; and Kim and Wold (1985) Cell 42:
129-138. Additional methods for antisense regulation are known in the art.
Antisense regulation has been used to reduce or inhibit expression of plant genes in, for example in European Patent Publication No. 271988. Antisense RNA may be used to reduce gene expression to produce a visible or biochemical phenotypic change in a plant (Smith et al. (1988) Nature, 334: 724-726;
Smith et al. (1990) Plant Mol. Biol. 14: 369-379). In general, sense or anti-sense sequences are introduced into a cell, where they are optionally amplified, e.g. by transcription. Such sequences include both simple oligonucleotide sequences and catalytic sequences such as ribozymes.
For example, a reduction or elimination of expression (i.e., a "knock-out") of a transcription factor or transcription factor homolog polypeptide in a transgenic plant, e.g., to modify a plant trait, can be obtained by introducing an antisense construct corresponding to the polypeptide of interest as a cDNA. For antisense suppression, the transcription factor or homolog cDNA is arranged in reverse orientation (with respect to the coding sequence) relative to the promoter sequence in the expression vector. The introduced sequence need not be the full-length cDNA or gene, and need not be identical to the cDNA or gene found in the plant type to be transformed.
Typically, the antisense sequence need only be capable of hybridizing to the target gene or RNA
of interest. Thus, where the introduced sequence is of shorter length, a higher degree of homology to the endogenous transcription factor sequence will be needed for effective antisense suppression. While antisense sequences of various lengths can be used, preferably, the introduced antisense sequence in the vector will be at least 30 nucleotides in length, and improved antisense suppression will typically be observed as the length of the antisense sequence increases.
Preferably, the length of the antisense sequence in the vector will be greater than 100 nucleotides.
Transcription of an antisense construct as described results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous transcription factor gene in the plant cell.
Suppression of endogenous transcription factor gene expression can also be achieved using RNA
interference, or RNAi. RNAi is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to incite degradation of messenger RNA (mRNA) containing the same sequence as the dsRNA (Constans (2002) The Scientist 16: 36). Small interfering RNAs, or siRNAs are produced in at least two steps: an endogenous ribonuclease cleaves longer dsRNA
into shorter, 21-23 nucleotide-long RNAs. The siRNA segments then mediate the degradation of the target mRNA (Zamore (2001) Nature Struct. Biol. 8: 7 46-750). RNAi has been used for gene function determination in a manner similar to antisense oligonucleotides (Constans (2002) supra). Expression vectors that continually express siRNAs in transiently and stably transfected cells have been engineered to express small hairpin RNAs (shRNAs), which get processed in vivo into siRNAs-like molecules capable of carrying out gene-specific silencing (Brummelkamp et al. (2002) Science 296: 550-553, and Paddison et al. (2002) Genes & Dev.
16: 948-958).
Post-transcriptional gene silencing by double-stranded RNA is discussed in further detail by Hammond et al. (2001) Nature Rev Gen 2: 110-119, Fire et al. (1998) Nature 391 : 806-811 and Timmons and Fire (1998) Nature 395: 854. Vectors in which RNA encoded by a transcription factor or transcription factor homolog cDNA is over-expressed can also be used to obtain co-suppression of a corresponding endogenous gene, e.g., in the manner described in U.S. Patent No. 5,231,020 by Jorgensen. Such co-suppression (also termed sense suppression) does not require that the entire transcription factor cDNA be introduced into the plant cells, nor does it require that the introduced sequence be exactly identical to the endogenous transcription factor gene of interest. However, as with antisense suppression, the suppressive efficiency will be enhanced as specificity of hybridization is increased, e.g., as the introduced sequence is lengthened, and/or as the sequence similarity between the introduced sequence and the endogenous transcription factor gene is increased.
Vectors expressing an untranslatable form of the transcription factor mRNA, e.g., sequences comprising one or more stop codon, or nonsense mutation, can also be used to suppress expression of an endogenous transcription factor, thereby reducing or eliminating its activity and modifying one or more traits. Methods for producing such constructs are described in U.S.
Patent No. 5,583,021. Preferably, such constructs are made by introducing a premature stop codon into the transcription factor gene.
Alternatively, a plant trait can be modified by gene silencing using double-stranded RNA (Sharp (1999) Genes and Development 13: 139-141). Another method for abolishing the expression of a gene is by insertion mutagenesis using the T-DNA Agrobacterium tumefaciens.
After generating the insertion mutants, the mutants can be screened to identify those containing the insertion in a transcription factor or transcription factor homolog gene.
Plants containing a single transgene insertion event at the desired gene can be crossed to generate homozygous plants for the mutation. Such methods are well known to those of skill in the art (for example, Koncz et al.
(1992) Methods in Arabidopsis Research, World Scientific Publishing Co. Pte.
Ltd., River Edge, NJ).

Alternatively, a plant phenotype can be altered by eliminating an endogenous gene, such as a transcription factor or transcription factor homolog, e.g., by homologous recombination (Kempin et al. (1997) Nature 389: 802-803).
A plant trait can also be modified by using the Cre-lox system (for example, as described in U.S.
Patent No. 5,658,772). A plant genome can be modified to include first and second lox sites that are then contacted with a Cre recombinase. If the lox sites are in the same orientation, the intervening DNA sequence between the two sites is excised. If the lox sites are in the opposite orientation, the intervening sequence is inverted.
The polynucleotides and polypeptides of this invention can also be expressed in a plant in the absence of an expression cassette by manipulating the activity or expression level of the endogenous gene by other means, such as, for example, by ectopically expressing a gene by T-DNA activation tagging (Ichikawa et al. (1997) Nature 390 698-701; Kakimoto et al. (1996) Science 274: 982-985). This method entails transforming a plant with a gene tag containing multiple transcriptional enhancers and once the tag has inserted into the genome, expression of a flanking gene coding sequence becomes deregulated. In another example, the transcriptional machinery in a plant can be modified so as to increase transcription levels of a polynucleotide of the invention (e.g., PCT Publications WO 96/06166 and WO 98/53057 which describe the modification of the DNA-binding specificity of zinc finger proteins by changing particular amino acids in the DNA-binding motif).
The transgenic plant can also include the machinery necessary for expressing or altering the activity of a polypeptide encoded by an endogenous gene, for example, by altering the phosphorylation state of the polypeptide to maintain it in an activated state.
Transgenic plants (or plant cells, or plant explants, or plant tissues) incorporating the polynucleotides of the invention and/or expressing the polypeptides of the invention can be produced by a variety of well established techniques as described above.
Following construction of a vector, most typically an expression cassette, including a polynucleotide, e.g., encoding a transcription factor or transcription factor homolog, of the invention, standard techniques can be used to introduce the polynucleotide into a plant, a plant cell, a plant explant or a plant tissue of interest. Optionally, the plant cell, explant or tissue can be regenerated to produce a transgenic plant.
The plant can be any higher plant, including gymnosperms, monocotyledonous and dicotyledonous plants. Suitable protocols are available for Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, rapeseed, broccoli, etc.), Curcurbitaceae (melons and cucumber), Gramineae (wheat, com, rice, barley, millet, etc.), Solanaceae (potato, tomato, tobacco, peppers, etc.), and various other crops.
Examples of these protocols are described in Ammirato et al., eds., (1984) Handbook of Plant Cell Culture - Crop Species, Macmillan Publ. Co., New York, NY; Shimamoto et al. (1989) Nature 338: 274-276; Fromm et al. (1990) Bio/Technol. 8: 833-839; and Vasil et al. (1990) Bio/Technol. 8: 429-434.
Transformation and regeneration of both monocotyledonous and dicotyledonous plant cells is now routine, and the selection of the most appropriate transformation technique will be determined by the practitioner. The choice of method will vary with the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types. Suitable methods can include, but are not limited to:
electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant cells;
micro-projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium tumefaciens mediated transformation. Transformation means introducing a nucleotide sequence into a plant in a manner to cause stable or transient expression of the sequence.
Successful examples of the modification of plant characteristics by transformation with cloned sequences which serve to illustrate the current knowledge in this field of technology, and which are herein incorporated by reference, include: U.S. Patent Nos. 5,571,706;
5,677,175; 5,510,471;
5,750,386; 5,597,945; 5,589,615; 5,750,871; 5,268,526; 5,780,708; 5,538,880;
5,773,269;
5,736,369 and 5,610,042.
Following transformation, plants are preferably selected using a dominant selectable marker incorporated into the transformation vector. Typically, such a marker will confer antibiotic or herbicide resistance on the transformed plants, and selection of transformants can be accomplished by exposing the plants to appropriate concentrations of the antibiotic or herbicide.

After transformed plants are selected and grown to maturity, plants showing a modified trait are identified. The modified trait may be environmental stress tolerance. To confirm that the modified trait is due to changes in expression levels or activity of the polypeptide or polynucleotide of the invention can be determined by analyzing mRNA expression using, for example, Northern blots, RT-PCR or microarrays, or protein expression using, for example, immunoblots, Western blots or gel shift assays.
Integrated Systems - Sequence Identity Additionally, the present invention may be an integrated system, computer or computer readable medium that comprises an instruction set for determining the identity of one or more sequences in a database. In addition, the instruction set can be used to generate or identify sequences that meet any specified criteria. Furthermore, the instruction set may be used to associate or link certain functional benefits, such improved characteristics, with one or more identified sequence.
For example, the instruction set can include, e.g., a sequence comparison or other alignment program, e.g., an available program such as, for example, the Wisconsin Package Version 10.0, such as BLAST, FASTA, PILEUP, FINDPATTERNS or the like (GCG, Madison, WI).
Public sequence databases such as GenBank, EMBL, Swiss-Prot and PIR or private sequence databases such as PHYTOSEQ sequence database (Incyte Genomics, Palo Alto, CA) can be searched.
Alignment of sequences for comparison can be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2: 482-489, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85: 2444-2448, by computerized implementations of these algorithms. After alignment, sequence comparisons between two (or more) polynucleotides or polypeptides are typically performed by comparing sequences of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window can be a segment of at least about 20 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 contiguous positions. A description of the method is provided in Ausubel et al. supra.
A variety of methods for determining sequence relationships can be used, including manual alignment and computer assisted sequence alignment and analysis. This later approach is a preferred approach in the present invention, due to the increased throughput afforded by computer assisted methods. As noted above, a variety of computer programs for performing sequence alignment are available, or can be produced by one of skill.
One example algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al.
(1990) J. Mol. Biol. 215:
403-410. Software for performing BLAST analyses is publicly available, e.g., through the National Library of Medicine's National Center for Biotechnology Information (ncbi.nlm.nih; at world wide web (www) National Institutes of Health US government (gov) website). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. supra).
These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >
0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (for example, Henikoff and Henikoff (1992) Proc.
Natl. Acad. Sci. 89: 10915-10919). Unless otherwise indicated, "sequence identity" here refers to the % sequence identity generated from a tblastx using the NCBI version of the algorithm at the default settings using gapped alignments with the filter "off (for example, NII-I NLM NCBI
website at ncbi.nlm.nih; world wide web (www) National Institutes of Health US
government (gov) web site).
In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (for example, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. 90: 5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence (and, therefore, in this context, homologous) if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, or less than about 0.01, and or even less than about 0.001. An additional example of a useful sequence alignment algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. The program can align, e.g., up to 300 sequences of a maximum length of 5,000 letters.
The integrated system, or computer typically includes a user input interface allowing a user to selectively view one or more sequence records corresponding to the one or more character strings, as well as an instruction set which aligns the one or more character strings with each other or with an additional character string to identify one or more region of sequence similarity.
The system may include a link of one or more character strings with a particular phenotype or gene function. Typically, the system includes a user readable output element that displays an alignment produced by the alignment instruction set.
The methods of this invention can be implemented in a localized or distributed computing environment. In a distributed environment, the methods may be implemented on a single computer comprising multiple processors or on a multiplicity of computers. The computers can be linked, e.g. through a common bus, but more preferably the computer(s) are nodes on a network. The network can be a generalized or a dedicated local or wide-area network and, in certain preferred embodiments, the computers may be components of an intranet or an internet.
Thus, the invention provides methods for identifying a sequence similar or homologous to one or more polynucleotides as noted herein, or one or more target polypeptides encoded by the polynucleotides, or otherwise noted herein and may include linking or associating a given plant phenotype or gene function with a sequence. In the methods, a sequence database is provided (locally or across an inter or intranet) and a query is made against the sequence database using the relevant sequences herein and associated plant phenotypes or gene functions.
Any sequence herein can be entered into the database, before or after querying the database.
This provides for both expansion of the database and, if done before the querying step, for insertion of control sequences into the database. The control sequences can be detected by the query to ensure the general integrity of both the database and the query. As noted, the query can be performed using a web browser based interface. For example, the database can be a centralized public database such as those noted herein, and the querying can be done from a remote terminal or computer across an internet or intranet.
Any sequence herein can be used to identify a similar, homologous, paralogous, or orthologous sequence in another plant. This provides means for identifying endogenous sequences in other plants that may be useful to alter a trait of progeny plants, which results from crossing two plants of different strains. Sequences that encode an ortholog of a sequence herein that naturally occurs in a plant with a desired trait can be identified. The plant is then crossed with a second plant of the same species but which does not have the desired trait to produce progeny which can then be used in further crossing experiments to produce the desired trait in progeny of the second plant.
Therefore, the resulting progeny plants contain no transgenes; expression of the endogenous sequence may also be regulated by treatment with a particular chemical or other means, such as EMIR. Examples of such well-known compounds include: ethylene; cytokinins;
phenolic compounds, which stimulate the transcription of the genes needed for infection; specific monosaccharides and acidic environments which potentiate vir gene induction;
acidic polysaccharides which induce one or more chromosomal genes; and opines; other mechanisms include light or dark treatment (an example of a review of examples of such treatments is found in Winans (1992) Microbiol. Rev. 56: 12-31; Eyal et al. (1992) Plant Mol.
Biol. 19: 589-599;
Chrispeels et al. (2000) Plant Mol. Biol. 42: 279-290; and Piazza et al.
(2002) Plant Physiol.
128: 1077-1086).
Molecular Modeling Another means that may be used to confirm the utility and function of transcription factor sequences that are orthologous or paralogous to presently disclosed transcription factors is through the use of molecular modeling software. Molecular modeling is routinely used to predict polypeptide structure, and a variety of protein structure modeling programs, such as "Insight II" (Accelrys, Inc.) are commercially available for this purpose.
Modeling can thus be used to predict which residues of a polypeptide can be changed without altering function (Crameri et al. (2003) U.S. Patent No. 6, 521, 453). Thus, polypeptides that are sequentially similar can be shown to have a high likelihood of similar function by their structural similarity, which may, for example, be established by comparison of regions of superstructure. The relative tendencies of amino acids to form regions of superstructure (for example, helixes and I3-sheets) are well established. For example, O'Neil et al. ((1990) Science 250: 646-651) have discussed in detail the helix forming tendencies of amino acids. Tables of relative structure forming activity for amino acids can be used as substitution tables to predict which residues can be functionally substituted in a given region, for example, in DNA-binding domains of known transcription factors and equivalogs. Homologs that are likely to be functionally similar can then be identified.
Of particular interest is the structure of a transcription factor in the region of its conserved domains, such as the Al, B 1, B2 and B3 domain (i.e. ABI3), or a Staygreen superfamily (pfam:12638) domain (i.e. SGR1 and SGR2). Structural analyses may be performed by comparing the structure of the known transcription factor around its conserved domain with those of orthologs and paralogs. Analysis of a number of polypeptides within a transcription factor group or clade, including the functionally or sequentially similar polypeptides provided in the Sequence Listing, may also provide an understanding of structural elements required to regulate transcription within a given family.
EXAMPLES
Materials and Methods Plant materials and growth conditions: Arabidopsis thaliana ecotype Col-0 was used as the wild type in this study. abi3-6 and abi3-8 mutant lines were isolated from fast neutron- and EMS-mutagenized M2 populations of ecotype Columbia respectively (16). Single T-DNA
insertional mutants of SGR1 (At4G22920, SALK 070891, sgrl-1) and SGR2 (AT4G11910, SALK 003830, sgr2-2) were obtained from ABRC and genotyped through PCR to isolate homozygous lines. These lines were crossed and F2 generation was genotyped to isolate the sgrl-1 Isgr2-2 double mutants. Plant media and growth conditions were done as previously described (28). Siliques were staged for phenotypic analysis of whole embryos and for microarray analysis by tying colored thread around the pedicel on the day of flower opening.
Intact siliques were harvested on the indicated number of days after flowering (DAF) and seeds were observed for de-greening or excised with a needle and used for RNA
extraction and microarray analysis.
Plant transformation for Brassica napus.
B. napus transgenic lines were created as previously described using Agrobacterium-mediated transformation (33).
Surface sterilization of seeds Surface sterilization of seeds is carried out for 30 min in a laminar flow cabinet. Seeds (4 to 5 ml) are placed in sterile 50 ml plastic tubes and 35-40 ml sodium hypochlorite is added to it. The tube is closed and vigorously shaken at room temperature (22- 25 C) for 20 min. Sodium hypochlorite is discarded and the seeds are rinsed 5 times with 40-45 ml sterile water every 30s.
The seeds are decanted into a sterile Petri plate for easy handling.
Seed germination The surface-sterilized seeds (10 to 12) are transferred with forceps onto a Petri plate containing seed germination medium (Mix 0.5 strength of MS major salts (i.e., dissolve 825 mg NH4NO3, 950 mg KNO3, 185 mg Mg504.7H20, 85 mg of KH2PO4 and 21.5 mg ferric-EDTA in 1 liter of water), 0.5 ml of MS minor salt stock, 0.5 ml CaC12 stock, 0.5 ml KI stock, sucrose 10 g and phytagel 4 g liter. Adjust the pH to 5.8 before addition of phytagel). Seed germination is carried out in dark or dim light (B650 lux) at room temperature (22-25 C) for 4 d.
Agrobacterium preparation Agrobacterium is prepared on the same day as seed germination. Streak GV3101 harboring binary vector carrying BnABI3 under CaMV35S on 2-3 LB plates containing 100 pg m1-1 rifampicin and 50 pg m1-1 kanamycin. Incubate the plates for 2 d at 28 C. A
single colony of Agrobacterium from one of the plates is inoculated into 10 ml LB liquid medium containing 100 pg m1-1 rifampicin and 50 pg m1-1 kanamycin. The culture is kept for shaking (250 r.p.m) for 36 h at 28 C. OD is measured at 650 nm using a spectrophotometer. After spinning down the Agrobacterium culture down (4,300-5,500g) for 10 min at RT, the supernatant is removed and pellet is rinsed in liquid MS minimal organic medium (without antibiotics).
The pellet is resuspended in liquid MS minimal organic medium (without antibiotics) and adjusted to 0.05 OD
with MS minimal organic medium.
Agrobacterium infection and cocultivation The seedlings are pulled out from the seed germination medium and placed in an empty tray. A
scalpel blade is used to cut the cotyledons including the 2mm stalk petiole.
The cut ends of cotyledon explants (i.e, petiole only) is dipped in Agrobacterium (harboring binary vector) suspension (OD 0.05) for 30 s and the explants are placed onto a cocultivation medium (1 MS
major salts, 1 ml MS minor salts, 2.9 ml CaC12 stock, 1 ml KI stock, 1 ml vitamin stock and 20 g sucrose; pH 5.8. Add 4 g phytagel, autoclave and add filter-sterilized 100 pl AgNO3, 75 pl BAP
(stock 1, 10 mg m1-1), 20 pl NAA and 5p1 GA3) using forceps. The cotyledons are placed upright with cut end embedded in the medium (10 explants per plate) and the plate is sealed with a surgical tape. The plates with explants are incubated under dim light (B660 lux) or in the dark at 25 C for 2 d.
Shoot initiation The explants are transferred into callus induction medium (lx major salts, 1 ml minor salts, 2.9 ml CaC12 stock, 1 ml KI stock, 1 ml vitamin stock and 20 g sucrose; pH 5.8.
Add 4 g phytagel, autoclave and add filter-sterilized 100 pi AgNO3, 75 pi BAP (stock 1,10 mg m1-1), 20 pi NAA, 5 pi GA3 and 500 mg carbenicillin) using sterile forceps. The plate is sealed and incubated under dim light at 25 C for 1 week. After one week the explants are transferred to shoot initiation medium (lx major salts, 1 ml minor salts, 2.9 ml CaC12 stock,1 ml KI stock, 1 ml vitamin stock and 20 g sucrose; pH 5.8. Add 4 g phytagel, autoclave and add filter-sterilized 100 pi AgNO3, 300 pi BAP (stock 1, 10 mg m1-1), 20 pi NAA, 5 pi GA3, 500 mg carbenicillin and 25 mg kanamycin). The plates are then incubated under light (16 h ¨3300 lux at Petri dish level) at 25 C for 4 weeks.
Shoot outgrowth The explants with shoot initials are transferred to the shoot outgrowth medium (lx major salts, 1 ml minor salts, 2.9 ml CaC12 stock, 1 ml KI stock, 1 ml vitamin stock and 20 g sucrose,40 mg adenine hemisulphate and 500 mg PVP 40,000; pH 5.8. Add 4 g phytagel, autoclave and add filter-sterilized 100 pi AgNO3, 75 pi BAP (stock 2,10 mg m1-1), 20 pi NAA, 5 pi GA3 and 500 mg carbenicillin and 25 mg kanamycin). The plates are incubated under light (16 h) at 25 C for 2-4 weeks.
Transformant selection The shoots are transferred using sterile forceps, to tissue culture vessels containing transformant selection medium (lx major salts, 1 ml minor salts, 2.9 ml CaC12 stock, 1 ml KI stock, 1 ml vitamin stock, 10 g sucrose, 40 mg adenine hemisulfate and 500 mg PVP 40,000;
pH 5.8. Add 4 g phytagel, autoclave and add filter-sterilized 5 pi BAP (stock 2, 0.25 mg m1-1), carbenicillin 500 mg and kanamycin 50 mg). Care is taken to ensure that the base of the shoots is well embedded in the medium. The vessels are incubated in dim light at 25 C for 2-3 weeks.
Root initiation The green shoots are transferred to cups containing root initiation medium (0.5x major salts, 0.5 ml minor salts, 1.95 ml CaC12 stock, 0.5 ml KI stock and 10 g sucrose; pH 5.8.
Add 4 g phytagel, autoclave and add 100 pi filter-sterilized IBA stock solution) with 500 mg liter-1 carbenicillin, using sterile forceps making sure base/ends of the shoots are placed well into the medium and incubated under light for 2 weeks.
Establishment in greenhouse The rooted plants are removed from the cup with forceps and washed with lukewarm running tap water to remove traces of phytagel. Fill pots with autoclaved potting mix and water to keep the soil moist. Make a hole in the soil depending on the root length of the regenerated plant and place the plant into the soil with the root going through the hole. Compact the soil and water the plants slightly. Keep the planted pot in a ziplock bag misted with water to maintain humidity.
Keep spraying water and maintain humidity till it is ready to be transferred to greenhouse conditions. This may take about a week.
Plant transformation for complementation of the abi3-6 mutant: A. thaliana AtSGR1, At4g22920, AY850161 and AtSGR2, At4g11910, AY699948 were cloned into the pGEM-T
vector (Promega). The excised DNA fragments were cloned into the T-DNA binary vector pCAMter (2X35S::cDNA). The various constructs carrying SGR1 or SGR2 cDNAs were introduced into A. tumefaciens GV3101 by electroporation and used for floral dip transformation (29) of abi3-6 mutant plants. Harvested seeds were spread on MS medium containing kanamycin for selection of transgenic plants.
Reverse transcription¨quantitative PCR (RT-qPCR): Total RNA from seeds was prepared using RNAqueous columns with the Plant RNA isolation aid (Ambion, Austin, TX, USA) according to manufacturer's instructions. Total RNA samples were quantified using a NanoDrop Spectrophotometer (NanoDrop Technologies). RNA was additionally analyzed by gel electrophoresis to confirm integrity. RT reactions were performed using the Invitrogen SuperScript III Reverse Transcriptase following the manufacturer's directions with 2 total RNA input. qPCRs were performed using a Chromo 4 real-time PCR detector (Bio-Rad) controlled by Opticon Monitor 3 software. Standard curves were generated using five concentrations in triplicate in a dilution series, followed by the test sample run with three biological samples (each analyzed with triplicate technical replicates). qPCR
results were quantified by the Pfaffl method as described in the real-time PCR applications guide (Bio-Rad).
The Col-0 embryo samples were used as calibrators. The target genes were normalized against the reference 0-tubulin gene (TUB4) or ubiquitin 10 (UBQ10). Reference genes were chosen based on their stable expression across genotypes and treatments. Primers utilized are represented in Table 5.
Table 5. Sequences of primers Gene AGI ID Primer Seq.
size qRT-PCR
F Primer SGR1 AT4G22920 AGCAGCAGCAGCTCACTCTTCTT (SEQ ID NO: 9) R Primer SGR1 AT4G22920 CCTAGGGAGCGTTGAAGGAT(SEQ ID NO: 10) F Primer SGR2 AT4G11910 ATTAGCGGAGGCCACTTCTT (SEQ ID NO: 11) R Primer SGR2 AT4G11910 GTTGTACTCCGGGATGTTGG (SEQ ID NO: 12) F Primer TUB4 AT5G44340 AACGCTGACGAGTGTATGGTTTT (SEQ ID NO: 13) R Primer TUB4 AT5G44340 CCAAAGGTAGGATTAGCGAGCTT (SEQ ID NO: 14) F Primer UBQ10 AT4G05320 GGCCTTGTATAATCCCTGATGAATAAG (SEQ ID NO: 15) 63 R Primer UBQ10 AT4G05320 AAAGAGATAACAGGAACGGAAACATAGT (SEQ ID NO: 16) 63 F Primer ABI3 AT3G24650 GCTGCTGTGTTTTTGGAGTG (SEQ ID NO: 17) R Primer ABI3 AT3G24650 AGTCTTCTTGCCGCTGATTC (SEQ ID NO: 18) F Primer RAB18 AT5G66440 GGTCATCATGATCAGTCTGG (SEQ ID NO: 19) R Primer RAB18 AT5G66440 TCTTGTCCATCATCCCCTTC (SEQ ID NO: 20) RT-PCR
F Primer SGR1 AT4G22920 CATCCTTCAACGCTCCCTAG (SEQ ID NO: 21) R Primer SGR1 AT4G22920 CAGTCTTGTGACCATCAGGC (SEQ ID NO: 22) F Primer SGR2 AT4G11910 ACACGCAAGAATAACGCGAG (SEQ ID NO: 23) R Primer SGR2 AT4G11910 CACTCGCCCACTACTTCGTC (SEQ ID NO: 24) Transient expression using BY-2 cells: Biolistic bombardments of cultured tobacco (Nicotiana tabacum) BY-2 cells were performed essentially as described previously (30).
The full-length ABI3 cDNA (At3g24650), ABI3-6 and ABI3-8 cDNAs were cloned into pRTL2 under the control of a CaMV 35S promoter for expression as GFP-tagged proteins. These constructs were bombarded into BY-2 cells. Cells were fixed with 4% paraformaldehyde and visualized directly through fluorescent microscopy for detecting GFP.
Microarray analysis: Seeds from wild-type Col-0 and abi3-6 were excised from siliques at 13 DAF. Total RNA was extracted and triplicate microarray analysis using independent seed batches was performed. For each sample analyzed, 5 of total RNA was converted to biotin-labeled cRNA using oligo(dT) priming as described by the manufacturer (Enzo kit; Affymetrix) and hybridized to 22K ATH1 Affymetrix microarrays at the Affymetrix Genechip facility (University of Toronto). Microarray data were statistically analyzed with the flexible user friendly graphical interface ROBIN
(http ://b i oinformati c s. mpimp-golm.mpg.de/projects/own/robin) to generate log fold change of differential gene expression.
Fold changes of significantly differentially expressed genes (P < 0.01) were analyzed with the pathway analysis program MapMan (18; https://gabi.rzpd.de/projects/MapMan/) to map large datasets into diagrams and processes. A color code is used to symbolize the fold change of differential gene expression, where blue indicates higher expression, red indicates lower expression and white indicating no change in abi3-6 mutant embryos (Figure 8).
Electrophoretic mobility shift assays: Mobility shift assays were performed as described previously (31, 32). The sequences of all the oligonucleotides are shown in Figure 2D. Both strands of the oligonucleotides were synthesized and annealed. DNA probes were generated by filling in 5' overhangs with the Klenow fragment of DNA polymerase I (Promega) in the 15[a-32P]
presence of dATP and purified using MicroSpin columns (GE Healthcare). Double-stranded DNA with nonradioactive nucleotides were used as competitor DNA. For the gel shift assays either ¨200 pmol of the labeled probe or various concentrations of unlabelled probe along with the labeled probe were incubated with 50 ng of purified recombinant ABI3-binding domain in 2X reaction buffer (12 mM Hepes, 1 mM MgC12, 4 mM Tris, pH
7.9, 100 mM
KC1, 0.6 mM DTT, and 12% glycerol). The samples were incubated for 30 min at room temperature and separated by 5% non-denaturing gel (0.5X TBE) at 4 C.
Following electrophoresis the gel was dried and subjected to autoradiography.
ABA sensitivity assays: ABA was dissolved in ethanol and added to the media after sterilization. Mature seeds from Col-0, abi 3-6 and abi3-6/SGR overexpressors were harvested and tested for ABA sensitivity (germination scored as radicle emergence) without stratification.
Seeds were tested for germination on half strength Murashige and Skoog (MS) media (without sucrose supplement), in the presence of 10 [tM or 25 [tM ABA at room temperature. The double sgr1-1/sgr2-2 mutant seeds were analyzed for ABA sensitivity along with the respective single mutants and Col-0 on half strength MS media (without sucrose supplement) with 2 [tM and 10 [tM ABA. Values are means SEM of three biological replicates.

Seed protein analysis: Seed protein was extracted by grinding mature seeds in an ice-cold mortar with 20 11.1 me seed of extraction buffer (100 mM Tris-HCI, pH 8.0, 0.5% SDS, 10%
glycerol and 2% fl-mercaptoethanol). Extracts were boiled for 3 min and centrifuged. Equal amount of proteins were resolved by SDS-PAGE using a 10% gel. Proteins were visualized by Coomassie blue staining.
Cold-induced de-greening assays with Arabidopsis: Flowers from Arabidopsis plants (Col-0 and 35S::ABI3labi3-6) were tagged on the day of flower opening to indicate the day of fertilization/flowering. At various days after flowering (11, 12, 13 DAF), these plants were subjected to freezing (-5 C to -10 C) for 2 hours for 1, 2 or 3 days and returned to normal growth conditions. The plants were also subjected to a day of acclimatization at 4 C
before and after the treatment. Following treatment, plants were allowed to recover for one or two days before seeds were collected for either RNA extraction or allowed to mature and observed for defects in de-greening.
Cold-induced de-greening assays with Canola:
Spring frost tolerance: Canola plants (WT and RD29A::ABI3) were treated at -3 C for 3 hours for 2 consecutive days. The plants were also subjected to a day of acclimatization at 4 C before and after the treatment. Plants were observed and photographed.
Fall Frost Tolerance - Flowers from canola plants (WT and RD29A::ABI3) were tagged on the day of flower opening to indicate the day of fertilization/flowering. At various days after flowering (21-28 DAF), these plants were subjected to freezing (-6 C) for 4 hours and returned to normal growth conditions. The plants were also subjected to a day of acclimatization at 4 C
before and after the treatment. Following maturation, the seeds were harvested and observed for presence of green seeds. Seeds were cut in half to show the seed interior after the outer coat was taken off.
Results abi3-6 is an embryo stay-green mutant: Although multiple ABI3 alleles have been identified with various degrees of ABA insensitivity, not all of these alleles display the green seed phenotype exhibited by the severe alleles of ABB. To precisely examine the various stages of de-greening during embryo maturation phase, we tagged flowers from Col-0, abi3-8 (weak abi3 allele) and abi3-6 right after fertilization, followed by harvesting and comparison of the embryos at various stages post-fertilization indicated by days after flowering/fertilization (DAF). Both Col-0 and abi3-8 displayed complete embryo de-greening at 16 DAF, while abi3-6 embryos still remained green, confirming previously documented stay-green embryo phenotype observed only with the severe alleles of ABI3 (Figure 2A).
abi3-6 was originally isolated from a fast neutron screen on inhibiting concentration of ABA (8).
Sequencing of the ABI3 transcripts from abi3-6 revealed a premature stop codon caused by the deletion, leading to abrupt stoppage of the open reading frame after amino acid 231(Figure 7A).
Thus ABI3-6 codes for a truncated, short protein with only the intact Al domain and without the Bl, B2 and B3 domains (Figure 7A). The severe abi3-6 phenotype could result from lack of the DNA binding B3 domain due to the truncation and the inability of ABI3-6 to localize to the nucleus as observed from transient expression in tobacco cells (15; Figure 7B). This is in contrast to the weaker, leaky phenotype and nuclear localization displayed by point mutations in ABI3 (16; Figure 7 A, B) Transcriptional landscape of abi3-6 embryos reveal repression of Mendel's I
locus: In Arabidopsis, ABI3 is highly expressed in the embryo throughout the maturation phase (17;
Figure 7C). We hypothesized that if lack of ABI3 function results in the embryo stay-green phenotype, then the expression of downstream ABI3 targets will be affected and the factors responsible for embryo-degreening should represent a subset of the targets regulated by ABA.
To examine this, we performed microarray analyses to identify the transcriptome profile of embryos in their late maturation phase (13 DAF) when embryos begin to enter the de-greening phase (13 DAF to 16 DAF) and when ABI3 expression is maximal (Figure 7C).
Microarray was performed with RNA extracted from embryos harvested from siliques at 13 DAF.
From the microarray analyses (http://bioinformatics.mpimp-golm.mpg.de/projects/own/robin, 18), we identified several groups of genes that were expressed at least two-fold higher or lower in abi3-6 mutant than in Col-0 (Figure 8). Seed storage proteins and late embryogenesis abundant proteins were repressed while genes related to light reactions and tetrapyrrole synthesis, which are involved in photosystem organization and chlorophyll biosynthesis, were induced in abi3-6 (Supplemental Table 1). Interestingly, Mendelian stay-green locus AtNYEIISGRI
was expressed at three-fold lower level compared to Col-0 (log2 fold change -1.54) (Table 6).
Table 6. Genes with altered expression (log2) in abi3-6 embryos relative to expression in Col-0 embryos at 13 DAF
AGI ID Gene description Log 2 ratio Plant development-related At4934520 FAE1 (FATTY ACID ELONGATION-I) very long chain fatty acids content of seed oil -5.91 At5g51210 OLEOSIN3 involved in seed lipid accumulation.
-3.25 At4g 27170 25 seed storage protein 4 -3.87 At4g 27160 25 seed storage protein 3 -2.31 At4g27140 25 seed storage protein 1 -1.76 At3g 15670 Late embryogenesis abundant protein, putative / LEA
protein -4.25 At1g32560 Late embryogenesis abundant group 1 / LEA group 1 -3.25 At4g 21020 Late embryogenesis abundant domain-containing protein / LEA -1.31 Light reaction-related At2g40100 LHCB4.3 (LIGHT HARVESTING COMPLEX P5I1) 2.31 At1g45474 LHCA5 (Photosystem I light harvesting complex gene 5) 1.15 At3950820 P5B02 (PHOTOSYSTEM II SUBUNIT 0-2); oxygen evolving 1.86 At4g21280 PS130 oxygen evolving complex of photosystemIl 1.94 At2946820 TMP14 Encodes the P subunit of Photosystem 1 2.34 Atlg 76450 Oxygen-evolving complex-related, chloroplast precursor 1.80 At1g76100 Plastacyanin minor isofornn, chloroplast precursor 2.69 Tetrapyrrole synthesis-related At49 18480 CHLII (CHLORINA 42) Encodes the CHLI subunit of magnesium chelatase 2.69 At3g59400 GUN4 (Genomes uncoupled 4) enhances the activity of Mg-chelatase 1.88 At1g44446 CH1 (CHLORINA 1) chlorophyll a oxygenase 1.62 At3g51820 ATG4/CHLG/04 (CHLOROPHYLL SYNTHASE) chlorophyll synthase activity 1.44 At3g14110 FLU (FLUORESCENT IN BLUE LIGHT) involved in chlorophyll biosynthesis 1.21 Senescence-related At4g02380 SAG21 (SENESCENCE-ASSOCIATED GENE 21) Encodes AtLEA5 6.89 At1g17020 SRG1 (SENESCENCE-RELATED GENE 1) oxidoreductase 2.95 At1g21460 Nodulin MtN3 family protein similar to senescence-associated protein-like 2.05 At1g79970 Similar to senescence-associated protein-related 1.72 At2g44670 Senescence-associated protein-related 1.58 At1g74940 Senescence-associated protein-related 1.35 At5g47060 Senescence-associated protein-related 1.23 At4g22920 Similar to the tomato senescence-inducible chloroplast stay-green protein 1 -1.54 SGR1 and SGR2 are upregulated in abi3-6 during embryo maturation: Defects in SGR1 lead to stay-green leaf phenotypes in Arabidopsis and rice, and a stay-green cotyledon phenotype in peas (10). Currently, there is no evidence to suggest that SGR1 is also responsible for embryo de-greening in Arabidopsis and other related species. In public microarray databases, AtSGR1 (the only SGR family member represented in the microarray database) expression in maturing seeds mirrored ABI3 expression and was up-regulated following increase in ABI3 expression (Figure 7C). Real time quantitative RT-PCR was performed to validate the microarray results and to investigate the changes in expression patterns of both SGR1 and SGR2 during seed maturation. During seed maturation in Col-0, expression of both SGR1 and SGR2 are highly upregulated between 13 and 16 DAF, with SGR1 and SGR2 displaying a 10 and 35 fold increase respectively (Figure 2B). On 13 DAF, when compared to Col-0, both SGR1 and 2 are downregulated in abi3-6 background (Figure 2C). In abi3-6 seeds, SGR1 levels are 2.4 folds and 6 folds lower than Col-0 at 13 and 16DAF, while SGR2 levels are lower by 5 folds and 17 folds at 13 and 16DAF respectively (Figure 2C). While these results validated the microarray findings, they also indicated a lack of up-regulation of SGR family members in the absence of functional ABI3.
B3 DNA binding domain of ABI3 interacts with the RY cis-motif of SGR1 and SGR2 promoter sequences: To determine if the down-regulation of AtSGR1/2 in the abi3-6 embryo is a direct consequence of lack of ABI3-mediated transcriptional activation of SGR1/2, we analyzed the promoter sequences of both SGR1 and SGR2 genes. Both promoters possessed the canonical B3 domain binding RY motif CATGCA with variable flanking nucleotides.
Electrophoretic mobility shift assays (EMSA) were performed using purified recombinant ABI3 B3 domain with labeled RY sequence motif (27nt) of SGR1 and SGR2. Co-incubation of ABI3 B3 domain and labeled RY sequences resulted in retardation of the protein-nucleotide complex indicating binding of ABI3 B3 domain with RY sequences of SGR1 and SGR2 (Figure 2D). The binding specificity was further verified through addition of unlabeled RY
sequences (10, 100 and 1000X) in the reaction that resulted in reduction to complete elimination of signal from the autoradiograph (Figure 2D).
Ectopic expression of either SGR1 or SGR2 rescues abi3-6 degreening defect: If reduced levels of SGR1/2 transcripts were responsible for the observed stay-green embryo phenotype of abi3-6 mutant, then misexpression of SGR in abi3-6 background would restore the embryo de-greening process. To test this hypothesis, we ectopically expressed SGR1 and SGR2 under the control of cauliflower mosaic virus (CaMV) 35S promoter in abi3-6 background.
When Ti transgenic lines were examined, both overexpressions (abi3-6/35S::SGR1, abi3-6/35S::SGR2) resulted in restoration of embryo degreening (Figure 3A, B), although overexpression of SGR1 caused pleiotropic shoot phenotypes with typical yellowing of leaves (Figure 9A), as previously reported (13). In contrast, SGR2 misexpression conferred embryo specific degreening phenotype in abi3-6 seeds without any shoot yellowing phenotype (Figure 3B, 9B). This indicates a seed specific role for SGR2 during embryo degreening.
SGR-mediated de-greening is partially coupled to ABA insensitivity but not desiccation tolerance: Three independent abi3-6/35S::SGR1, abi3-6/35S::SGR2 overexpressors were further examined to test if any of the pleiotropic phenotypes associated with abi3-6 lesion are altered following overexpression of SGR1 or SGR2. When mature brown seeds from these abi3-6/35S::SGR overexpressors were collected and stored for four weeks, they were completely incapable of germination even after prolonged stratification (Figure 3C), mimicking abi3-6 phenotype. This indicates that the lack of desiccation tolerance in abi3-6 occurs independent of the de-greening process. When protein levels in these seeds were examined, the various seed storage protein levels in abi3-6/35S::SGR overexpressors resembled the abi3-6 profile revealing that the accumulation of the storage proteins was still defective in these brown seeds (Figure 10A).
To assess if de-greening defect of abi3-6 was associated with the observed extreme ABA
sensitivity, the brown, viable, pre-desiccation seeds, from the abi3-6/35S::SGR overexpressors were assessed for their ability to germinate at either 10 or 25 [tM of ABA. At 24h post-plating, the transgenic lines exhibited relatively increased sensitivity to both concentrations of ABA
compared to abi3-6, but at 72 hours post-plating, almost all of the seeds had germinated at both concentrations of ABA (Figure 10 B, C). Thus de-greening seems to marginally influence ABA
sensitivity of seeds.
SGR1 and SGR2 are necessary for seed de-greening in Arabidopsis: Rescue of abi3-6 de-greening defect through SGR1I2 overexpression shows that SGR1 and 2 are sufficient to drive de-greening in maturing abi3-6 embryos. To prove necessity of SGR1 and 2 in embryo de-greening, we analyzed single and double mutants of SGR1 and 2. RT-PCR analysis of seeds at 16 DAF revealed that in sgrl-1 there was reduced expression of SGR1, while sgr2-2 plants had a complete absence of SGR2 transcripts (Figure 4A). The double mutants (sgr1-1/sgr2-2) mimicked the single mutants in SGR1 and SGR2 expression. Interestingly, in the single mutants, we observed an increase of SGR2 in sgrl-1 background and vice-versa, suggesting a compensatory increase in the transcript of the other SGR member in the single mutants (Figure 4A). When observed for seed de-greening defects at various time points post-fertilization, we observed no difference in seed de-greening in the single mutants compared to Col-0 (Figure 4B).
However, the double mutants, clearly displayed persistence of chlorophyll at stages when Col-0 and the single mutants were progressing through the de-greening process (Figure 4B). This green seed phenotype was maintained at maturity and also in stored seeds (Figure 4C). When seeds stored for four weeks were assayed for chlorophyll content, the double mutants had significantly high levels of chlorophyll (Figure 4C). Interestingly, in contrast to abi3-6 green seeds that were incapable of germinating after four weeks of storage, the sgr1-1/sgr2-2 seeds (after 4 weeks of storage) showed 100% germination following stratification (Figure 4D). When assayed for ABA sensitivity, sgr2-2 and sgr1-1/sgr2-2 had significantly higher radicle emergence at 2 04 ABA compared to sgrl-1 and Col-0 (Figure 4D). The ability of green sgr 1-1/sgr2-2 seeds to germinate prompted us to investigate if the seed storage protein levels are altered in the green seeds. Protein gels revealed that lack of SGR1 and SGR2 did not affect the ability of the seeds to accumulate the storage proteins as the single and double mutants mimicked the Col-0 protein expression pattern, while abi3-6 seeds showed a clear lack of accumulation of these proteins (Figure 11). Thus, SGR1 and 2 are required for embryo de-greening during seed maturation and this de-greening process is independent of seed storage protein accumulation, although de-greening seems to promote ABA sensitivity of mature brown seeds.
ABI3 overexpression rescues freezing-induced green seeds in canola and Arabidopsis: Frost is one of the major factors that can cause fixation of green color in mature seeds. Exposure of maturing canola plants to sub-lethal frost of 0 C to 1 C can fix the green color in seeds, resulting in major losses in the canola industry (3, 4). Based on our identification of ABI3 as the master regulator of de-greening, we hypothesized that if freezing resulted in the downregulation of chlorophyll degradation pathway, over-expression of ABI3 under a constitutive promoter should allow circumventing this problem.
To test this, we investigated if Arabidopsis can mimic the frost-induced green seed phenotype observed in canola. Exposure of maturing Arabidopsis pods at various days after flowering (11 to 13 DAF) to freezing temperatures resulted in mature green seeds (Figure 5A). When trangenic Arabidopsis lines overexpressing ABI3 in abi3-6 background (35S::AB13/abi3-6) were subjected to a similar treatment, the transgenic seeds proceeded to de-green to produce mature brown seeds despite the cold treatment (Figure 5A). Our RT-qPCR analyses revealed that the ABI3 overexpressing lines constitutively expressed significantly higher levels of ABI3, SGR1 and SGR2 compared to Col-0 prior to exposure to freezing (Figure 5B). SGR2 was induced in maturing seeds when Col-0 plants were exposed to freezing temperatures and allowed to recover for 1 or 2 days, while similar treatment only had a mild effect on expression of ABI3, SGR1 and 2 in ABI3-0X lines (Figure 5B).
For further validation, we also investigated the frost-induced green seed phenotype in canola.
Exposure of maturing WT canola plants at various days after flowering (21 to 28 DAF) to freezing temperatures resulted in mature green seeds.
When transgenic canola lines overexpressing ABI3 (RD29A::ABI3) were subjected to a similar treatment, the transgenic seeds proceeded to de-green to produce mature seeds despite the cold treatment (Figure 15).
Overexpression of ABI3 in RD29A::ABI3 transgenic canola also improved frost tolerance in canola plant tissues as compared to WT (Figure 14).
Conclusions Through utilizing the green seed mutant abi3-6, the present inventors have identified the genetic regulatory network that controls seed de-greening in Arabidopsis. The inventors have demonstrated that during embryo development, ABI3 functions in two independent programs;
one that regulates seed de-greening through the SGR family and the other that is dedicated to seed maturation and desiccation tolerance (Figure 6). Furthermore, this study demonstrates that the influence of ABI3 on chlorophyll degradation is seed specific, since abi3-6 plants did not display a stay-green leaf phenotype similar to sgrl-1 when kept under dark conditions (Figure 12). Thus, the transcriptional activation of SGR1/2 by ABI3 forms an exclusive seed specific de-greening module that is required for successful embryo de-greening.
Interestingly, retention of chlorophyll in seeds has been considered to be a detriment to the embryo due to the photo-toxic nature of chlorophyll and its catabolites. The sgr1-1/sgr2-2 double mutants, however, exhibited normal desiccation tolerance, were able to acquire dormancy and germinated 100% after storage (Figure 4). During senescence or leaf yellowing, loss of chlorophyll is initiated when chlorophyll (chl) a and chl b are broken-down through the action of Pheophytinase and Pheide a oxygenase (Pa0) into red chlorophyll catabolites (19). Lack of Pa0 is known to result in light-dependent accelerated cell death phenotypes due to accumulation of catabolites in the chl degradation pathway that are photo-toxic (20-23). In the leaf, SGR1 functions upstream of Pa0 as sgrl mutants do not accumulate any photo-toxic catabolites that accumulate in pao mutants (14). This model of SGR1 functioning upstream of Pa0 would explain the viability of mature sgr1-1/sgr2-2 green seed phenotype. By contrast, ABA
sensitivity in both abi3-6/SGR overexpressors and sgr1-1/sgr2-2 double mutants suggested the presence of chl could influence sensitivity of seeds to ABA. abi3-6/35S::SGR
overexpressors other than rescuing the green seed phenotype also reduced the ABA
insensitivity of abi3-6 (Figure 3). In contrast, in the sgr1-1/sgr2-2 mutants, lack of SGR1 and SGR2 resulted in marginal ABA insensitivity (Figure 4). The grs enhancer mutation that results in green seeds in the weak abi3-1 background did not alter ABA insensitivity of abi3-1, but these seeds were affected in their longevity (2) unlike the sgr1-1/sgr2-2 mutants. Whether these grs/abi3-1 mutants accumulate photo-toxic chl catabolites that affect seed longevity or the mechanism behind how grs mutation enhances abi3-1 phenotype are not known. The chloroplast localized, ABA binding, Mg-chelatase H subunit, CHLH, has been shown to participate in ABA responses independent of chlorophyll biosynthesis (24). Overexpression of CHLH resulted in increased sensitivity to ABA, without altering chlorophyll levels (24) while the chl-deficient chlh (cch) mutants were insensitive to ABA (24). Thus proteins involved in chl biosynthesis (CHLH) or degradation (SGR) could also influence ABA responses, although the insensitivity displayed is quite weak compared to strong ABA insensitive mutants such as abi3-6.
Misexpression of ABI3 was sufficient to rescue the cold-induced green seeds in Arabidopsis (Figure 5). There is precedence for overexpression of ABI3 conferring freezing tolerance to plants (25). These studies, which only focused on vegetative tissues, found overexpression of ABI3 resulted in increased ABA sensitivity of Arabidopsis leaves and accumulation of ABA-dependent, ABI3-regulated transcripts such as RAB18 (25-27). In the present study, the inventors found ABI3 overexpressors accumulated RAB18 as well as increased levels of SGR1 and SGR2 (Figure 13). Without wishing to be bound by theory in any way, one possibility is the misexpression of ABI3 results in the increased sensitivity of these lines to endogenous ABA, which in turn leads to priming for freezing and desiccation tolerance within the seed.

Alternatively, the increased expression of ABI3 may directly alter ABI3-dependent transcripts required for chlorophyll degradation (SGR1, SGR2) and freezing/desiccation tolerance (RAB18) (Figures 5B, 13). This ABI3-dependent priming allows these seeds to withstand the freezing treatment and continue to de-green to produce mature brown seeds. Of course, these two models are not mutually exclusive and both ABA sensitivity and ABI3 may be required for the seed priming and freezing tolerance. Whatever the case, in either an ABA or ABI3 centric model, the lack of basal accumulation of these transcripts in wild-type seeds results in a freezing-sensitive system that is defective in the chlorophyll degradation process following cold treatment. Given that green seed problem is a major industry concern in oil seed crops such as canola (3, 4), the identification of ABI3 as the master regulator of this pathway provides an important solution for the industry.
Using the abi3-6 embryo stay-green mutant, the inventors have found that ABI3 functions as the master regulator of de-greening during embryo maturation, through transcriptional control of SGR1 and SGR2 (Figure 6). This ABI3-mediated de-greening process is independent of acquisition of desiccation tolerance and is partially coupled to ABA
sensitivity.
While the invention has been described with reference to specific methods and embodiments, it will be appreciated that various modifications and changes may be made without departing from the invention. All publications cited herein are expressly incorporated herein by reference for the purpose of describing and disclosing compositions and methodologies that might be used in connection with the invention. All cited patents, patent applications, and sequence information in referenced web sites and public databases are also incorporated by reference.
References 1. Mansfield, S. G. B., L. G. (1991) Early embryogenesis in Arabidopsis thaliana. II. The developing emb ryo. Canadian Journal of Botany 69, 461-476.
2. Clerkx, E. J., Vries, H. B., Ruys, G. J., Groot, S. P., & Koornneef, M.
(2003) Characterization of green seed, an enhancer of abi3-1 in Arabidopsis that affects seed longevity. Plant Physiol 132, 1077-1084.
3. Johnson-Flanagan, A. M. M., L.L.D.; Pomeroy, M.K. (1994) Humidification of green canola seed leads to pigment degradation in the absence of germination. Crop Science 34, 1618.

4. Jalink, H. v. d. S., R.; Frandas, A.; van Pijlen, J.G.; Bino, R.J. (1998) Chlorophyll fluorescence of Brassica oleracea seeds as a non-destructive marker for seed maturity and seed performance. Seed Science Research 8, 437-443.
5. Whitmarsh, C. J., Ortiz-Lopez, A. (2000) The de-greening of canola, USDA
Agricultural research Magazine, 48, 9.
6. Chung, D.W., Pruzinska, A., Hortensteiner, S., Ort, D.R. (2006) The role of pheophorbide a oxygenase expression and activity in the canola green seed problem. Plant Physiology 142, 88-97.
7. Finkelstein, R., Reeves, W., Ariizumi, T., & Steber, C. (2008) Molecular aspects of seed dormancy. Annu Rev Plant Biol 59, 387-415.
8. Nambara, E., Keith, K., McCourt, P., & Naito, S. (1994) Isolation of an internal deletion mutant of the Arabidopsis thaliana ABI3 gene.Plant Cell Physiol 35, 509-513.
9. Nakashima, K., Fujita, Y., Kanamori, N., Katagiri, T., Umezawa, T., Kidokoro, S., Maruyama, K., Yoshida, T., Ishiyama, K., Kobayashi, M., et al. (2009) Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/0ST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy.
Plant Cell Physiol 50, 1345-1363.
10. Armstead, I., Donnison, I., Aubry, S., Harper, J., Hortensteiner, S., James, C., Mani, J., Moffet, M., Ougham, H., Roberts, L., et al. (2007) Cross-species identification of Mendel's I
locus. Science 315, 73.

11. Sato, Y., Morita, R., Nishimura, M., Yamaguchi, H., & Kusaba, M. (2007) Mendel's green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway.Proc Natl Acad Sci USA 104, 14169-14174.

12. Thomas, H. & Howarth, C. J. (2000) Five ways to stay green. J Exp Bot 51 Spec No, 329-337.

13. Ren, G., An, K., Liao, Y., Zhou, X., Cao, Y., Zhao, H., Ge, X., & Kuai, B.
(2007) Identification of a novel chloroplast protein AtNYE1 regulating chlorophyll degradation during leaf senescence in Arabidopsis. Plant Physiol 144, 1429-1441.

14. Aubry, S., Mani, J., & Hortensteiner, S. (2008) Stay-green protein, defective in Mendel's green cotyledon mutant, acts independent and upstream of pheophorbide a oxygenase in the chlorophyll catabolic pathway. Plant Mot Biol 67, 243-256.

15. Suzuki, M. M., D.R. (2008) Functional symmetry of the B3 network controlling seed development. Current Opinion in Plant Biology 11, 548-553.

16. Nambara, E., Suzuki, M., Abrams, S., McCarty, D. R., Kamiya, Y., &
McCourt, P. (2002) A
screen for genes that function in abscisic acid signaling in Arabidopsis thaliana. Genetics 161, 1247-1255.

17. Kroj, T., Savino, G., Valon, C., Giraudat, J., & Parcy, F. (2003) Regulation of storage protein gene expression in Arabidopsis. Development 130, 6065-6073.

18. Thimm, 0., Blasing, 0., Gibon, Y., Nagel, A., Meyer, S., Kruger, P., Selbig, J., Muller, L.
A., Rhee, S. Y., & Stitt, M. (2004) MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. Plant J 37, 914-939.

19. Sakuraba, Y., Schelbert, S., Park, S. Y., Han, S. H., Lee, B. D., Andres, C. B., Kessler, F., Hortensteiner, S., & Paek, N. C. (2012) STAY-GREEN and chlorophyll catabolic enzymes interact at light-harvesting complex II for chlorophyll detoxification during leaf senescence in Arabidopsis. The Plant cell 24, 507-518.

20. Mach, J. M., Castillo, A. R., Hoogstraten, R., & Greenberg, J. T. (2001) The Arabidopsis-accelerated cell death gene ACD2 encodes red chlorophyll catabolite reductase and suppresses the spread of disease symptoms. Proc Natl Acad Sci USA 98, 771-776.

21. Pruzinska, A., Anders, I., Aubry, S., Schenk, N., Tapernoux-Luthi, E., Muller, T., Krautler, B., & Hortensteiner, S. (2007) In vivo participation of red chlorophyll catabolite reductase in chlorophyll breakdown. The Plant cell 19, 369-387.

22. Pruzinska, A., Tanner, G., Anders, I., Roca, M., & Hortensteiner, S.
(2003) Chlorophyll breakdown: pheophorbide a oxygenase is a Rieske-type iron-sulfur protein, encoded by the accelerated cell death 1 gene. Proc Natl Acad Sci USA 100, 15259-15264.

23. Pruzinska, A., Tanner, G., Aubry, S., Anders, I., Moser, S., Muller, T., Ongania, K. H., Krautler, B., Youn, J. Y., Liljegren, S. J., et al. (2005) Chlorophyll breakdown in senescent Arabidopsis leaves. Characterization of chlorophyll catabolites and of chlorophyll catabolic enzymes involved in the degreening reaction. Plant Physiol 139, 52-63.

24. Wu, F.Q., Xin, Q., Cao, Z., Liu, Z.Q., Du, S.Y., Mei, C., Zhao, C.X., Wang, X.F., Shang, Y., Jiang, T., Zhang, X.F., Yan, L., Zhao, R., Cui, Z.N., Liu, R., Sun, H.L., Yang, X.L., Su, Z., and Zhang, D.P. (2009). The magnesium-chelatase H subunit binds abscisic acid and functions in abscisic acid signaling: new evidence in Arabidopsis. Plant physiology 150, 1940-1954.

25. Tamminen, I., Makela, P., Heino, P., and Palva, E.T. (2001). Ectopic expression of ABI3 gene enhances freezing tolerance in response to abscisic acid and low temperature in Arabidopsis thaliana. Plant J25, 1-8.

26. Mantyla, E., Lang, V., and Palva, E.T. (1995). Role of Abscisic Acid in Drought-Induced Freezing Tolerance, Cold Acclimation, and Accumulation of LT178 and RAB18 Proteins in Arabidopsis thaliana. Plant physiology 107, 141-148.

27. Parcy, F., and Giraudat, J. (1997). Interactions between the ABIl and the ectopically expressed ABI3 genes in controlling abscisic acid responses in Arabidopsis vegetative tissues. Plant J 11, 693-702.

28. McCourt, P. & Keith, K. (1998) Sterile techniques in Arabidopsis. Methods Mot Blot 82, 13-17.

29. Clough, S. J. & Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J16, 735-743.

30. Samuel, M. A., Chong, Y. T., Haasen, K. E., Aldea-Brydges, M. G., Stone, S. L., & Goring, D. R. (2009) Cellular pathways regulating responses to compatible and self-incompatible pollen in Brassica and Arabidopsis stigmas intersect at Exo70A1, a putative component of the exocyst complex. The Plant cell 21, 2655-2671.

31. Gao, M. J., Allard, G., Byass, L., Flanagan, A. M., & Singh, J. (2002) Regulation and characterization of four CBF transcription factors from Brassica napus. Plant Mot Biol 49, 459-471.

32. Sasaki, K., Mitsuhara, I., Seo, S., Ito, H., Matsui, H., & Ohashi, Y.
(2007) Two novel AP2/ERF domain proteins interact with cis-element VWRE for wound-induced expression of the Tobacco tpoxN1 gene. Plant J 50, 1079-1092.

33. Bhalla PL and Singh MB. 2008. Agrobacterium-mediated transformation of Brass/ca napus and Brass/ca oleracea. Nature Protocols. 3. 2.181-189

Claims (29)

WHAT IS CLAIMED IS:

1. A method of inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions, the method comprising modulating activity or expression in said plant or seeds of ABA Insensitive 3 (ABI3), Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity.

2. The method of claim 1, wherein said at least one polypeptide comprises an amino acid sequence with at least 80% percent identity to the amino acid sequence of SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.

3. The method of claim 1, wherein said at least one polypeptide comprises an amino acid sequence with at least 95% percent identity to the amino acid sequence of SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.

4. The method of claim 1, wherein modulating expression comprises the steps of: a) introducing into said plant a nucleic acid construct encoding at least one promoter operably linked to at least one nucleic acid that modulates expression of ABI3, SGR1 or SGR2, or the polypeptide having ABI3, SGR1 or SGR2 activity in said plant; and b) selecting for and regenerating and/or propagating the resulting transgenic plant.

5. The method of any one of claims 1 to 4, wherein modulating expression in said plant or seeds comprises overexpressing ABI3, SGR1 or SGR2, or the polypeptide having ABI3, SGR1 or SGR2 activity, such that the expression level of said ABI3, SGR1, SGR2, or polypeptide having ABI3, SGR1 or SGR2 activity is increased in said seeds as compared to expression levels of said ABI3, SGR1, SGR2, or polypeptide having ABI3, SGR1 or SGR2 activity in seeds in the absence of overexpression.

6. The method of any one of claims 1 to 5, wherein said stress conditions are selected from the group consisting of cold, drought, heat, or osmotic.

7. A transgenic plant produced according to the method defined in any one of claims 1 to 6.

8. The transgenic plant of claim 7, wherein said plant is selected from the group consisting of canola, soybean, maize, wheat, rye, oat, triticale, rice, millet, sorghum, barley, peanut, cotton, rapeseed, manihot, pepper, sunflower, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass and a forage crop plant.

9. A cell of the transgenic plant defined in claim 7 or 8.

10. A seed of the transgenic plant defined in claim 7 or 8.

11. A nucleic acid construct for inducing in a plant the ability to produce seeds which remove chlorophyll under stress conditions, comprising at least one promoter operably linked to at least one nucleic acid that modulates activity or expression of ABA
Insensitive 3 (ABI3), Staygreen 1 (SGR1) or Staygreen 2 (SGR2), or a polypeptide having ABI3, SGR1 or SGR2 activity.

12. The nucleic acid construct of claim 11, wherein said at least one polypeptide comprises an amino acid sequence with at least 80% percent identity to the amino acid sequence of SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7.

13. The nucleic acid construct of claim 11, wherein said at least one polypeptide comprises an amino acid sequence with at least 95% percent identity to the amino acid sequence of SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7.

14. The nucleic acid construct of claim 11, wherein said at least one nucleic acid comprises a polynucleotide sequence having 60% identity to SEQ ID NO:2, SEQ ID NO:4, SEQ
ID
NO:6, or SEQ ID NO:8, or the complement thereof.

15. The nucleic acid construct of claim 11, wherein said at least one nucleic acid comprises a polynucleotide sequence having 80% identity to SEQ ID NO:2, SEQ ID NO:4, SEQ
ID
NO:6, or SEQ ID NO:8, or the complement thereof.

16. The nucleic acid construct of claim 11, wherein said at least one nucleic acid comprises a polynucleotide sequence having 95% identity to SEQ ID NO:2, SEQ ID NO:4, SEQ
ID
NO:6, or SEQ ID NO:8, or the complement thereof.

17. The nucleic acid construct of any one of claims 11 to 16, wherein said at least one nucleic acid encodes ABI3 or a fragment thereof retaining the functionality of ABI3.

18. A vector comprising the nucleic acid construct of any one of claims 11 to 17.

19. A transgenic plant cell comprising the nucleic acid construct of any one of claims 11 to 17.

20. A transgenic tissue culture comprising the nucleic acid construct of any one of claims 11 to 17.

21. A transgenic plant regenerated and comprising the plant cell of claim 19.

22. A transgenic plant regenerated and comprising the tissue culture of claim 20.

23. The transgenic plant of claim 21 or 22, wherein said plant is hemizygous for said at least one nucleic acid.

24. The transgenic plant of claim 21 or 22, wherein said plant is homozygous for said at least one nucleic acid.

25. The transgenic plant of claim 21 or 22, wherein the plant is a monocot.

26. The transgenic plant of claim21 or 22, wherein the plant is a dicot.

27. The transgenic plant of claim 21 or 22, wherein the plant is selected from the group consisting of fruit-bearing plants, vegetable-bearing plants, plants used in the cut flower industry, grain-producing plants, oil-producing plants, nut-producing plants, crops including sugar beet, coffee, cacao, tea, soybean, cotton, flax, tobacco, pepper, perennial grasses, conifers and evergreens.

28. A plant seed produced by the transgenic plant of any one of claims 21 to 27, wherein the seed comprises the nucleic acid construct.

29. The seed of claim 28, wherein the seed is true breeding for producing plants with seeds that remove chlorophyll under stress conditions, as compared to a wild type variety of the seed.