WO2013022149A1 - 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체 - Google Patents

카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체 Download PDF

Info

Publication number
WO2013022149A1
WO2013022149A1 PCT/KR2011/007924 KR2011007924W WO2013022149A1 WO 2013022149 A1 WO2013022149 A1 WO 2013022149A1 KR 2011007924 W KR2011007924 W KR 2011007924W WO 2013022149 A1 WO2013022149 A1 WO 2013022149A1
Authority
WO
WIPO (PCT)
Prior art keywords
sweet potato
transformed
anthocyanin
ibor
ipomoea batatas
Prior art date
Application number
PCT/KR2011/007924
Other languages
English (en)
French (fr)
Inventor
곽상수
이행순
김선하
박성철
정재철
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to CN201180072691.0A priority Critical patent/CN103917087B/zh
Publication of WO2013022149A1 publication Critical patent/WO2013022149A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

  • the present invention relates to a method for producing a carotenoid and anthocyanin transgenic sweet potato plant, and more particularly, to a plant according to the present invention. More specifically, the present invention relates to IbOr- artificially inserting a specific sequence into the IbOrange gene derived from sweet potato ( Ipomoea batatas ).
  • a method for producing a carotenoid and anthocyanin accumulating transformed sweet potato plant by transforming a recombinant vector comprising an Ins gene variant into an anthocyanin accumulating sweet potato plant, the carotenoid and anthocyanin accumulating transformed sweet potato plant produced by the method and its Seed, a method for producing an anthocyanin accumulatively transformed sweet potato plant with increased environmental stress resistance compared to the wild type by transforming the recombinant vector into a sweet potato plant accumulating anthocyanin, compared to the wild type produced by the method
  • Sweet potato ( Ipomoea batatas L. Lam) can be grown on relatively poor soils and is a representative root crop used for food and livestock feed with a yield of about 30 tons per hectare.
  • Colored sweet potatoes such as purple and yellow, contain various antioxidants, especially yellowish yellow sweet potatoes contain 14.7-20 mg / 100 g of beta-carotene, and purple sweet potatoes contain 2.28 g / 100 g of anthocyanin. It is an antioxidant that promotes aging and removes free radicals that cause various adult diseases.
  • sweet potatoes have been transformed through Agrobacterium co-culture since the 1990s, and have developed a plant regeneration system through induction of embryogenic culture cells and somatic embryogenesis from apical and lateral meristems (Lim et al. 2007 Mol Breeding 19, 227-239).
  • high molecular weight antioxidants such as carotenoids, anthocyanins and polyphenols. Therefore, the development of crops with complex stress tolerance and high production of low molecular weight antioxidants could contribute to solving the food, energy and environmental problems faced by humans in the 21st century.
  • Phenolic compounds of plants are recognized as the most important natural antioxidants because of their variety and wide distribution. Polyphenols and phenolic compounds are also known to play an important role in protecting the body from various oxidative stress in the body has received a lot of attention. Hydroxycinnamic acids (HCA), a representative polyphenol in sweet potato roots, is a potent antioxidant and is found in large amounts in most sweet potato varieties, regardless of the tissue and time of expression (Islam et al. 2002 J. Agric. Food Chem . 50, 3718-3722). Thus, polyphenols, along with carotenoids and anthocyanins, contribute greatly to the high antioxidant activity of sweet potatoes.
  • HCA Hydroxycinnamic acids
  • Beta-carotene is a precursor of vitamin A, and has the physiological activity of nutritional supplements and food supplements. Therefore, metabolic engineering studies on the accumulation of carotenoids in foods are essential subjects for enhancing nutritional value. Beta-carotene is a substance with high antioxidant activity and is known to play an important role not only in physiological activity but also in the defense mechanism against oxidative stress of the plant itself. Thus, the need for research on these antioxidants and environmental stresses has emerged.
  • Korean Patent No. 10-0813284 discloses a method of increasing the content of carotenoids by transforming a plant-derived phytoene biosynthetic enzyme gene from citrus fruits, and Korean Patent Publication No. 2010-0100097 discloses a sweet potato-derived MuS1 gene in plants. Methods of increasing salt stress tolerance by transformation are disclosed.
  • the present invention is derived from the above requirements, the present invention is transformed into sweet potato plants that accumulate anthocyanin in a recombinant vector comprising the IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato
  • the functional carotenoid and anthocyanin accumulatively transformed sweet potato plants were prepared, and the present invention was completed by confirming that the transgenic plants were resistant to environmental stress.
  • the present invention transforms a recombinant vector comprising an IbOr-Ins gene variant in which a specific sequence is artificially inserted into an IbOrange gene derived from sweet potato ( Ipomoea batatas ) and transformed into a sweet potato plant accumulating anthocyanin
  • a method for preparing carotenoid and anthocyanin accumulatively transformed sweet potato plants comprising overexpressing -Ins gene variants.
  • carotenoids and anthocyanin accumulatively transformed sweet potato plants produced by the method and seeds thereof.
  • the present invention transforms a recombinant vector comprising an IbOr-Ins gene variant in which a specific nucleotide sequence is artificially inserted into an IbOrange gene derived from sweet potato ( Ipomoea batatas ) to a sweet potato plant accumulating anthocyanin, thereby generating an IbOr-Ins gene variant.
  • a method for producing anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to wild-type comprising overexpressing is provided.
  • the present invention provides an anthocyanin accumulatively transformed sweet potato plant and its seed having increased environmental stress resistance compared to the wild type prepared by the above method.
  • the present invention also provides a composition for increasing the carotenoid content of sweet potato plants accumulating anthocyanins, including IbOr-Ins gene variants in which a specific base sequence is artificially inserted into IbOrange genes derived from sweet potatoes ( Ipomoea batatas ).
  • the present invention also provides a composition for increasing environmental stress resistance of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific sequence is artificially inserted into an IbOrange gene derived from sweet potato ( Ipomoea batatas ).
  • the carotenoids and anthocyanin accumulatively transformed sweet potato plants prepared through the present invention can be usefully used as functional foods, and are also expected to be very useful for increasing yields because they exhibit resistance to environmental stress.
  • Figure 1 shows a plant expression vector of IbOr-Ins gene artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ).
  • Figure 2 IbOr-Ins derived from sweet potatoes using somatic embryos of Shinjami sweet potato varieties
  • Results of the process of transforming the gene variant (A) and the result of gDNA PCR through the selection marker (HPTII) of the transformant (B) are shown (N / T (Non transgenic plants): non-transgenic plants, E / V ( Empty vector plants): control plants transformed with empty vectors, Zm-Or (transgenic plants).
  • FIG. 3 is a sweet potato-derived IbOr-Ins of the present invention Storage root cross section (A) and above-ground transformant (B) of transformed Shinjami sweet potato varieties overexpressed gene variants (Zm: nontransformed plant, E / V: control plant transformed with empty vector) , Zm-Or: transgenic plant, a; E / V plant, b; Zm-Or plant, c; E / V plant stem, d, e; Zm-Or plant stem).
  • 5 is sweet potato-derived IbOr-Ins Expression of anthocyanin biosynthesis-related genes in neonatal transformants transformed with gene variants is shown by electrophoresis by RT-PCR.
  • Figure 6 IbOr-Ins derived from sweet potatoes The total carotenoid content is measured using a spectrophotometer from the storage root of transgenic Shinjami overexpressed the gene variant.
  • Figure 7 IbOr-Ins derived from sweet potatoes The result of measuring the total anthocyanin content using the spectrophotometer from the storage root of the transgenic Shinjami overexpressed the gene variant is shown.
  • the present invention provides a recombinant vector comprising an IbOr-Ins gene variant in which a specific base sequence is artificially inserted into an IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1
  • a method for producing a carotenoid and anthocyanin accumulatively transformed sweet potato plant comprising the step of transforming the sweet potato plant accumulating anthocyanins to overexpress the IbOr-Ins gene variant.
  • IbOr-Ins gene variants were prepared by inserting the KSQNPNL amino acid into the IbOrange gene (see Korean Patent Registration No. 0990330), but are not particularly limited as long as it is a variant capable of increasing the carotenoid content or increasing the salt resistance.
  • the IbOr-Ins gene variant of the present invention may comprise a nucleotide sequence represented by SEQ ID NO: 1.
  • the genetic variant has a base sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the base sequence of SEQ ID NO: 1, respectively. It may include.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
  • Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.
  • the IbOr-Ins gene variant sequence may be inserted into a recombinant expression vector.
  • recombinant expression vector means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host.
  • An important feature of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.
  • Expression vectors comprising an IbOr-Ins protein-encoding DNA sequence and appropriate transcriptional / translational control signals can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.
  • Preferred examples of recombinant vectors of the invention are Ti-plasmid vectors capable of transferring part of themselves, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens.
  • Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences to protoplasts from which plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have.
  • a particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.
  • viral vectors such as those that can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc.
  • CaMV double stranded plant viruses
  • gemini viruses single stranded viruses
  • it may be selected from an incomplete plant viral vector.
  • the use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.
  • the expression vector will preferably comprise one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, which corresponds to all genes capable of distinguishing transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance genes include, but are not limited to.
  • the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter.
  • the term “promoter” refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the possibility of selection.
  • terminators can be used, for example nopalin synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene of), but is not limited thereto.
  • NOS nopalin synthase
  • rice ⁇ -amylase RAmy1 A terminator Phaseoline terminator
  • Agrobacterium tumefaciens Agrobacterium tumefaciens
  • Terminator of the octopine gene of but is not limited thereto.
  • terminators such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.
  • Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol.
  • the sweet potato plant accumulating the anthocyanin is preferably a purple sweet potato, more preferably may be a Shinjami sweet potato variety, but is not limited thereto.
  • the present invention also provides carotenoid and anthocyanin accumulatively transformed sweet potato plants prepared by the above method and seeds of the plants.
  • the present invention is a recombinant vector comprising the IbOr-Ins gene variant in which the specific base sequence is artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1 to sweet potato plants accumulating anthocyanin
  • a method for producing anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to wild-type comprising the step of overexpressing IbOr-Ins gene variants by transformation.
  • the sweet potato plant accumulating the anthocyanin is preferably a purple sweet potato, more preferably may be a Shinjami sweet potato variety, but is not limited thereto.
  • the environmental stress may be preferably abiotic (biotic) stress, more preferably may be a salt or methyl viologen, but is not limited thereto.
  • the present invention also provides anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to the wild type produced by the above method and seeds of the plants.
  • the present invention provides a carotenoid content of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific nucleotide sequence is artificially inserted into an IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1 It provides an increasing composition.
  • the composition of the present invention comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, by increasing the carotenoid content of sweet potato plants accumulating anthocyanin by transforming the genetic variants into sweet potato plants accumulating anthocyanins It can be done.
  • the present invention is the environmental stress of the sweet potato plant accumulating anthocyanin, including the IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1
  • a composition for increasing resistance comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, and transforms the genetic variant into sweet potato plants accumulating anthocyanins, thereby improving the environmental stress resistance of the sweet potato plants accumulating anthocyanins. It can be increased.
  • PCR primers were prepared for cloning the Orange gene in sweet potatoes and the primer sequence was as follows: forward primer (5'-atggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 2) and reverse primer (5'-ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 3 ).
  • the IbOr obtained therefrom was subjected to overlapping PCR with a template to carry out an artificial mutation of a specific nucleotide sequence of IbOr.
  • PCR primers were prepared to insert a nucleotide sequence estimated to be -KSQNPNL- from amino acid 133 in the amino acid sequence of the IbOrange gene (see Korean Patent Registration No.
  • the cDNA gene was named IbOr-Ins.
  • the total length of the IbOr-Ins gene of the present invention is 924 bp of cDNA encoding 307 amino acids.
  • the isoelectric point (pI) and molecular weight (Mw) predicted by the amino acid sequence are 8.45 and 33.74 kDa, respectively.
  • the nucleotide sequence of the primer was added with an adapter sequence (upper case) at the 5 'end of the primer.
  • the base sequences are forward primers (5'- CAAAAAAGCAGGCTNN a tggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 6) and reverse primers (5'- CAAGAAAGCTGGGTN ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 7).
  • the PCR product of the expected size was cloned using a pGEMeasy cloning vector (Promega), followed by sequencing to confirm the entire sequence.
  • the cDNA gene was named IbOr-Ins.
  • the gene was cloned into the pDONR207 vector by BP reaction of the pGEMeasy vector cloned with the IbOr-Ins gene. Thereafter, a plant expression vector of IbOr-Ins gene cloned by pDONR207 and LR reaction with pGWB11 vector, which is a plant expression vector, was prepared (FIG. 1).
  • Anthocyanin biosynthesis related gene expression was analyzed by RT-PCR in non-transformed and transformed Shinjami sweet potato plants. As a result, the expression of most anthocyanin-related genes was strongly expressed in non-transformed sweet potato plants and transformed empty vector sweet potato plants, whereas in the case of Zm-Or, CHS, CHI, F3H, ANS, 3GT The expression of most anthocyanin biosynthetic major genes was reduced. However, for genes involved in the accumulation of anthocyanins in vascular tissues such as VP24 , there was no significant difference in expression from nontransgenic plants (FIG. 5).
  • the carotenoid content in the storage root tissues of the non-transformed and transformed sweet potato plant was measured at 440 nm by absorbance through a spectrophotometer.
  • the transformed Shinjami sweet potato plant showed a beta-carotene content increased more than three times than the non-transformed control (Fig. 6).
  • the content of anthocyanin in the storage root tissues of the non-transformed and transformed sweet potato plant was measured by spectrophotometer.
  • the transformed Shinjami sweet potato plant showed a reduced anthocyanin content by about 0.6 to 0.8 times or more than the control group (FIG. 7).
  • transgenic plant # 1-1 showed the same anthocyanin content as the non-transformed plant, and in this transgenic strain, the carotenoid content was also the highest, thus selecting the ideal transgenic plant (FIGS. 6 and 7).
  • DPPH radical scavenging activity was measured to compare the content of low molecular weight antioxidants in transformed Shinjami sweet potato plant leaves (FIG. 8A).
  • ASA ascorbic acid
  • g FW fresh weight
  • 310 ⁇ 610 ⁇ g of transformant Ascorbic acid (ASA) showed a significant amount of activity, particularly transformant # 1-1 showed the highest antioxidant activity.
  • the polyphenol content was 170-190 ⁇ g chlorogenic acid per g FW of non-transformer and empty vector transformed plants, whereas the transformant was 230-360 ⁇ g chlorogenic acid equivalent. Transformants showed a higher content than the control (Fig. 8B).
  • IbOr-Ins derived from sweet potato Beta-carotene was increased 2.5 ⁇ 2.9 times more than non-transformed Shinjami in the Shinjami sweet potato plants transformed with the genetic variants. Therefore, abiotic stresses such as salts and MV were treated to confirm whether transgenic plants confer stress resistance by conventional anthocyanins and carotenoids increased by the present invention.
  • the fourth and fifth leaves at the leaf stem apex of the control and transformants were made into leaf disks having a diameter of 8 mm, and then immersed in a NaCl solution at 0, 150, 200, and 400 mM concentrations for 24 hours at 25 ° C. in a dark condition. And the oxidative stress of each leaf disk was observed through DAB (3.3 diaminobezidine) staining. DAB reacts with intracellular H 2 O 2 to give a brown precipitate. Each treatment was immersed in 1 mg / ml DAB-HCl (pH 3.8) solution for 24 hours and photographed for color development.
  • MV methyl viologen
  • Control plants transformed with non-transformers and empty vectors showed high ionic conductivity of 37.3% and 55.7% by 48 hours after 2.5 ⁇ M MV treatment, showing strong susceptibility to oxidative stress produced by MV. And it was found.
  • the transformants showed low ionic conductivity of 25.6% and 31.2%, showing strong resistance to oxidative stress generated by MV.
  • Control plants transformed with the non-transformer and the empty vector showed high ionic conductivity of 51.9% and 62.5% until 48 hours after 5 ⁇ M MV treatment, showing strong susceptibility to oxidative stress produced by MV. And it was found.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 고구마 (Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체를 제조하는 방법, 상기 방법에 의해 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자, 상기 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체를 제조하는 방법, 상기 방법에 의해 제조된 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자, 상기 IbOr-Ins 유전자 변이체를 포함하는 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량 및 환경 스트레스 내성 증가용 조성물에 관한 것이다.

Description

카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체
본 발명은 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체에 관한 것으로, 더욱 상세하게는 본 발명은 고구마 (Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체를 제조하는 방법, 상기 방법에 의해 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자, 상기 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체를 제조하는 방법, 상기 방법에 의해 제조된 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자, 상기 IbOr-Ins 유전자 변이체를 포함하는 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량 및 환경 스트레스 내성 증가용 조성물에 관한 것이다.
고구마(Ipomoea batatas L. Lam)는 비교적 척박한 땅에도 재배가 가능할 뿐만 아니라 헥타르당 생산량이 약 30톤으로 식량과 가축사료로 이용되는 대표적인 뿌리작물이다. 자색, 황색 등의 유색고구마들은 다양한 항산화 물질을 포함하고 있는데, 특히 황색을 띄는 황색 고구마는 베타카로틴을 14.7 ~ 20 mg/100g 함유하며, 자색고구마는 안토시아닌을 2.28 g/100g 내외 함유하고 있어 세포의 노화를 촉진시키고 각종 성인병의 원인이 되는 활성산소를 제거하는 항산화 작용이 탁월하다. 또한 고구마는 1990년대 이후 아그로박테리움 공동배양을 통한 형질전환이 시도되었고, 정단 및 측아 분열조직으로부터 배발생 배양세포 유도 및 체세포배 발생을 통한 식물체 재분화 형질전환시스템을 발전시켜왔다 (Lim et al. 2007 Mol Breeding 19, 227-239). 그러나 아직 카로티노이드, 안토시아닌, 폴리페놀과 같은 저분자 항산화 물질을 고생산하는 고구마는 보고된 바 없다. 따라서 복합 스트레스 내성을 가지고 저분자 항산화 물질까지 고생산하는 작물 개발은 21세기 인류가 당면한 식량, 에너지, 환경문제를 해결하는데 기여할 수 있을 것으로 사료된다.
Islam 등 (Islam et al. 2002 Biosci. Biotechnol. Biochem. 66, 2483-2486)은 고구마 잎에 적어도 15종 이상의 생리활성이 높은 안토시아닌이 존재하며 이는 비타민 C나 E보다 강력한 항산화활성을 보이는 것으로 보고하였다 (Philpott et al. 2003 J. Sci. Food Agric. 83, 1076-1082). 흥미롭게도 많은 식물체의 잎에서 안토시아닌 생합성은 활성산소를 유발하는 외부 환경 스트레스에 의해 유도되는 것으로 보고되었으며, 특히 잎이나 뿌리에서의 안토시아닌은 외부 공격으로부터 식물체를 보호하는 방어 기작에 주요한 역할을 하는 것으로 알려져 있다 (Neill et al. 2002 Plant Cell Environ. 25, 539-547).
식물의 페놀성 화합물은 그 다양성과 광범위한 분포로 인해 가장 중요한 천연 항산화제로 인식되고 있다. 폴리페놀과 페놀성 화합물 또한 인체에서 각종 산화 스트레스로부터 우리 몸을 보호하는 중요한 역할을 하는 것으로 알려져 많은 주목을 받고 있다. 고구마 뿌리의 대표적 폴리페놀인 히드록시신남산 (hydroxycinnamic acids, HCA)는 강력한 항산화제로서 고구마 조직과 발현시기에 상관없이 대부분의 고구마 품종에 다량으로 함유되어 있다 (Islam et al. 2002 J. Agric. Food Chem. 50, 3718-3722). 이와 같이 폴리페놀은 카로티노이드, 안토시아닌과 더불어 고구마가 높은 항산화활성을 나타내는데 크게 기여하고 있다.
세계보건기구 (WHO)는 전 세계 1억 명 이상의 어린이들이 비타민 A의 부족으로 고생하고 있으며 이로 인해 매년 50만 명 이상의 어린이들이 실명하고 있다고 발표하였다. 베타카로틴은 비타민 A의 전구체로서 영양강화제, 식품보조제의 생리활성 기능을 가지고 있어 식품에서의 카로티노이드 축적에 관한 대사공학 연구는 영양학적 가치를 높이기 위한 필수 연구 대상이라 할 수 있다. 베타카로틴은 높은 항산화 활성을 가진 물질로서 생리활성 기능뿐 아니라 식물 자체의 산화 스트레스에 대한 방어 기작에도 중요한 역할을 하는 것으로 알려져 있으며 최근 카로티노이드 생합성이 식물호르몬의 하나인 ABA에 의해 영향을 받는 것이 밝혀짐으로써, 이들 항산화 물질과 환경 스트레스에 대한 연구의 필요성이 대두 되었다.
형질전환 식물체로부터 유용물질을 생산하기 위하여 많은 연구가 진행되고 있으나 생산성이 낮아 상업화에 도달하지 못하였다. 따라서 고부가가치 생리활성물질을 보다 경제적으로 대량생산하기 위해 식물배양세포 및 식물체 자체를 이용하여 생산비를 낮추는 방법이 유용하게 이용될 것으로 사료된다. 또한 유용물질을 고생산하는 식물체를 개발하여 다시 식물배양세포를 유도하면 유용물질을 생산하고 대량생산 하기까지의 시간이 적게 소요되며 배양세포의 스케일 업 배양이 용이하다. 또한 형질전환 식물체에서 발생할 수 있는 환경 위해성 문제를 배제할 수 있으며 생리활성 단백질 등 여러 가지 대상화합물에 폭넓게 적용 가능할 뿐만 아니라 의약품, 식품용도라도 미생물, 동물세포 배양에 비하여 거부감이 적다.
한국등록특허 제10-0813284호에는 감귤 유래 피토엔 생합성 효소 유전자를 식물체에 형질전환시켜 카로티노이드의 함량을 증가시키는 방법이 개시되어 있으며, 한국공개특허 제2010-0100097호에는 고구마 유래 MuS1 유전자를 식물체에 형질전환시켜 염 스트레스 내성을 증가시키는 방법이 개시되어 있다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 고구마 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 기능성의 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체를 제조하였고, 또한 이 형질전환 식물체가 환경 스트레스에 내성을 나타내는 것을 확인함으로써 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법을 제공한다.
또한, 상기 방법에 의해 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자를 제공한다.
또한, 본 발명은 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체 및 이의 종자를 제공한다.
또한, 본 발명은 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량 증가용 조성물을 제공한다.
또한, 본 발명은 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 환경 스트레스 내성 증가용 조성물을 제공한다.
본 발명을 통하여 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체는 기능성 식품으로 유용하게 사용될 수 있으며, 또한 환경 스트레스에 내성을 나타내므로 수확량 증대를 위해 활용 가치가 매우 클 것으로 기대된다.
도 1은 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자의 식물 발현 벡터를 나타낸 것이다.
도 2는 신자미 고구마 품종의 체세포배를 이용한 고구마 유래의 IbOr-Ins 유전자 변이체를 형질전환하는 과정 (A) 및 형질전환체의 선발마커(HPTⅡ)를 통한 gDNA PCR 수행 결과 (B)를 나타낸다 (N/T (Non transgenic plants): 비형질전환 식물체, E/V (Empty vector plants): 빈 벡터로 형질전환된 대조구 식물체, Zm-Or (transgenic plants): 형질전환 식물체).
도 3은 본 발명의 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미 고구마 품종의 저장뿌리 단면(A)과 지상부 형질전환체의 모습(B)을 나타낸다 (Zm: 비형질전환 식물체, E/V: 빈 벡터로 형질전환된 대조구 식물체, Zm-Or: 형질전환 식물체, a; E/V 식물체, b; Zm-Or 식물체, c; E/V 식물체 줄기, d, e; Zm-Or 식물체 줄기).
도 4는 고구마 유래 IbOr-Ins 유전자 변이체를 형질전환한 신자미 형질전환체에서 카로티노이드 생합성 관련 유전자의 발현 양상을 RT-PCR을 수행하여 전기영동한 결과를 나타낸다.
도 5는 고구마 유래 IbOr-Ins 유전자 변이체를 형질전환한 신자미 형질전환체에서 안토시아닌 생합성 관련 유전자의 발현 양상을 RT-PCR을 수행하여 전기영동한 결과를 나타낸다.
도 6은 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미의 저장뿌리로부터 전체 카로티노이드 함량을 스펙트로포토미터를 이용해 측정한 결과를 나타낸다.
도 7은 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미의 저장뿌리로부터 전체 안토시아닌 함량을 스펙트로포토미터를 이용해 측정한 결과를 나타낸다.
도 8은 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미의 잎으로부터 DPPH 라디칼 소거활성(A)과 폴리페놀 함량을 분석한 결과(B)를 나타낸다.
도 9는 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미의 잎 디스크에서 다양한 농도의 NaCl 스트레스 내성을 분석한 결과를 나타낸다.
도 10은 고구마 유래 IbOr-Ins 유전자 변이체를 과발현시킨 형질전환 신자미의 잎 디스크에서 다양한 농도의 MV 처리에 의한 스트레스 내성을 분석한 결과를 나타낸다.
본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법을 제공한다.
본 발명에서는 IbOrange 유전자 (한국특허등록 제0990330호 참고)에 KSQNPNL 아미노산을 삽입하여 IbOr-Ins 유전자 변이체를 제조하였으나, 카로티노이드 함량을 증가시키거나 내염성을 증가시킬 수 있는 변이체이면 특별히 제한되지 않는다.
바람직하게는, 본 발명의 IbOr-Ins 유전자 변이체는 서열번호 1로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기 서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자 변이체는 서열번호 1의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명에서, 상기 IbOr-Ins 유전자 변이체 서열은 재조합 발현 벡터 내로 삽입될 수 있다. 용어 "재조합 발현 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다. 상기 발현 벡터의 중요한 특성은 복제 원점, 프로모터, 마커 유전자 및 번역 조절 요소(translation control element)를 가지는 것이다.
IbOr-Ins 단백질-암호화 DNA 서열 및 적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관내 재조합 DNA 기술, DNA 합성 기술 및 생체내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터 (EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.
식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), 원형질체의 전기천공법(Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), 식물 요소로의 현미주사법(Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), 각종 식물 요소의 (DNA 또는 RNA-코팅된) 입자 충격법(Klein T.M. et al., 1987, Nature 327, 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 투머파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다. 특히 바람직한 것은 EP A 120 516호 및 미국 특허 제4,940,838호에 기재된 바와 같은 소위 이원 벡터 기술을 이용하는 것이다.
본 발명의 일 구현 예에 따른 방법에서, 상기 안토시아닌을 축적하는 고구마 식물체는 바람직하게는 자색 고구마이며, 더욱 바람직하게는 신자미 고구마 품종일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 상기 방법에 의해 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체 및 이 식물체의 종자를 제공한다.
본 발명의 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체는 IbOrange 유전자 및 카로티노이드 생합성 관련 주요 유전자인 PSY, LCY-β, LCY-ε및 CHY-β의 발현량이 비형질전환 식물체보다 증가하였고, 또한 카로티노이드 함량이 비형질전환 식물체보다 약 3배 이상 증가된 것을 확인하였다(도 4 및 도 6 참고).
또한, 본 발명은 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에서, 상기 안토시아닌을 축적하는 고구마 식물체는 바람직하게는 자색 고구마이며, 더욱 바람직하게는 신자미 고구마 품종일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 환경 스트레스는 바람직하게는 비생물학적(abiotic) 스트레스일 수 있으며, 더욱 바람직하게는 염 또는 메틸 비올로겐일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 상기 방법에 의해 제조된 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체 및 이 식물체의 종자를 제공한다.
또한, 본 발명은 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량 증가용 조성물을 제공한다. 본 발명의 조성물은 유효성분으로 서열번호 1의 염기서열로 이루어진 IbOr-Ins 유전자 변이체를 포함하며, 상기 유전자 변이체를 안토시아닌을 축적하는 고구마 식물체에 형질전환함으로써 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량을 증가시킬 수 있는 것이다.
또한, 본 발명은 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 환경 스트레스 내성 증가용 조성물을 제공한다. 본 발명의 조성물은 유효성분으로 서열번호 1의 염기서열로 이루어진 IbOr-Ins 유전자 변이체를 포함하며, 상기 유전자 변이체를 안토시아닌을 축적하는 고구마 식물체에 형질전환함으로써 안토시아닌을 축적하는 고구마 식물체의 환경 스트레스 내성을 증가시킬 수 있는 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1: IbOr-Ins 유전자의 클로닝 및 염기서열 분석
고구마에서 Orange 유전자를 클로닝하기 위한 PCR 프라이머를 제작하였고 프라이머 서열은 하기와 같다: 정방향 프라이머 (5'-atggtatattcaggtagaatcttgtcgctc-3'; 서열번호 2) 및 역방향 프라이머 (5'-ttaatcaaatgggtcaattcgtgggtcatg-3'; 서열번호 3). 이로부터 얻어진 IbOr를 주형으로 오버랩핑(overlapping) PCR을 수행하여 IbOr의 특정 염기서열의 인위적인 돌연변이를 수행하였다. IbOrange 유전자의 아미노산 서열(한국특허등록 제0990330호 참고) 내의 133번 아미노산부터 -KSQNPNL-로 추정되는 염기서열을 삽입하기 위하여 PCR 프라이머를 제작하였고, 이때 사용한 프라이머 서열은 하기와 같다: 정방향 프라이머 (5'- gaaaagcaagaaaataaacttaa atcccagaaccctaac -3'; 서열번호 4) 및 역방향 프라이머 (5'- aagatttgcggatgtcaggtt agggttctgggatttaag -3'; 서열번호 5). 그 결과, 약 921bp의 PCR 산물을 얻어 pGEM-T-vector에 클로닝한 후 시퀀싱을 통하여 133번 아미노산부터 -KSQNPNL-로 삽입된 돌연변이를 확인하였다. Clonetech 사의 advantage2 중합효소를 이용하여 PCR을 수행하였고, 예상 크기의 PCR 산물을 pGEMeasy 클로닝 벡터(Promega)를 이용하여 클로닝한 후, 시퀀싱하여 전체 염기서열을 확인하였다. 이 cDNA 유전자의 이름을 IbOr-Ins이라고 명명하였다. 본 발명의 IbOr-Ins 유전자의 전체 길이는 924 bp의 cDNA가 307개의 아미노산을 코딩하고 있다. 아미노산 배열로 예측한 등전점 (pI)과 분자량 (Mw)은 각각 8.45 과 33.74 kDa 이다.
프라이머의 염기서열에는 Invitrogen의 gateway 발현 시스템을 이용하기 위해 상기 프라이머의 5' 말단에 어댑터 서열(대문자 표기)을 각각 추가하였다. 염기서열은 정방향 프라이머 (5'-CAAAAAAGCAGGCTNNa tggtatattcaggtagaatcttgtcgctc-3'; 서열번호 6) 및 역방향 프라이머 (5'-CAAGAAAGCTGGGTNttaatcaaatgggtcaattcgtgggtcatg-3'; 서열번호 7)이다. 먼저 상기 예상 크기의 PCR 산물을 pGEMeasy 클로닝 벡터 (Promega)를 이용하여 클로닝한 후, 시퀀싱하여 전체 염기서열을 확인하였다. 이 cDNA 유전자의 이름을 IbOr-Ins이라고 명명하였다. IbOr-Ins 유전자가 클로닝되어 있는 pGEMeasy 벡터를 BP 반응시켜 pDONR207 벡터에 유전자를 클로닝하였다. 이후 pDONR207와 식물발현 벡터인 pGWB11 벡터와 LR 반응으로 클로닝한 IbOr-Ins 유전자의 식물발현 벡터를 제작하였다 (도 1).
실시예 2. 신자미 고구마 체세포 배양세포에 고구마 유래 IbOr-Ins 유전자 변이체의 형질전환
안토시아닌 고함유 품종인 신자미 체세포 배양세포에 고구마 유래 IbOr-Ins 유전자 변이체를 35S 프로모터 조절 하에 형질전환하였다(도 2A). 그 결과 선발배지를 통해 형질전환 소식물체를 얻었고, 이들을 대상으로 gDNA PCR을 통해 형질전환체 선발마커인 하이그로마이신 유전자 HPT II 의 발현을 조사하여 형질전환체를 선발하였다. 이들 형질전환체를 Zm-Or로 표기하였다 (도 2B).
실시예 3. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 표현형 분석
자색고구마인 신자미에 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 후 저장뿌리를 얻은 결과 도 3처럼 비형질전환 신자미의 경우 진한 자색으로 변화가 없음에 반해 Zm-Or의 경우 노란색과 자색이 섞여있는 표현형을 나타내었다 (도 3A). 또한 줄기표현형의 경우 형질전환체는 다수의 측아와 측지가 발달하고 잎의 수 또한 많은 것으로 관찰되었다 (도 3B).
실시예 4. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 카로티노이드 생합성 관련 유전자 발현분석
비형질전환 및 형질전환 신자미 고구마 식물체를 대상으로 카로티노이드 생합성 관련 유전자 및 IbOrange 유전자의 발현을 RT-PCR을 통해 분석하였다. 그 결과 비형질전환 식물체 및 빈 벡터를 형질전환한 식물체의 경우 Iborange 유전자의 발현이 약하거나 발현되지 않았음에 반해, Zm-Or의 경우 IbOrange 유전자의 발현이 크게 증가하였다. 더욱이 비형질전환 식물체 및 빈 벡터를 형질전환한 식물체의 경우 대부분의 카로티노이드 관련 유전자의 발현이 매우 약하거나 발현되지 않았음에 반해 Zm-Or의 경우 PSY, LCY-β LCY-ε, CHY-β 등 대부분의 카로티노이드 생합성 주요유전자의 발현이 증가하였다. 게다가 CCR4, CCR 유전자와 같은 스트리고락톤 생합성 관련 유전자 (strigolactone biosynthesis related gene)와 ABA 생합성 주요 유전자인 NCED 유전자 발현 또한 증가하였다 (도 4).
실시예 5. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 안토시아닌 생합성 관련 유전자 발현분석
비형질전환 및 형질전환 신자미 고구마 식물체를 대상으로 안토시아닌 생합성 관련 유전자 발현을 RT-PCR을 통해 분석하였다. 그 결과 비형질전환 신자미 고구마 식물체와 빈 벡터를 형질전환한 신자미 고구마 식물체의 경우 대부분의 안토시아닌 관련 유전자의 발현이 매우 강하게 발현되는데 반해, Zm-Or의 경우 CHS, CHI, F3H, ANS, 3GT 등 대부분의 안토시아닌 생합성 주요유전자의 발현이 감소하였다. 그러나 VP24와 같은 vascular 안에 안토시아닌의 축적에 관련된 유전자의 경우 비형질전환 식물체와 발현차이는 크지 않았다 (도 5).
실시예 6. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 카로티노이드 함량분석
형질전환 신자미 고구마 식물체의 카로티노이드 함량이 변화하는지를 알아보기 위해, 비형질전환 및 형질전환 신자미 고구마 식물체를 대상으로 저장뿌리 조직에서의 카로티노이드의 함량을 스펙트로포토미터를 통해 흡광도 440nm에서 측정하였다. 그 결과 대조구인 비형질전환체 보다 형질전환 신자미 고구마 식물체의 경우 약 3배 이상 증가된 베타카로틴 함량을 보였다 (도 6).
실시예 7. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 안토시아닌 함량 분석
형질전환 신자미 고구마 식물체의 안토시아닌 함량이 변화하는지를 알아보기 위해, 비형질전환 및 형질전환 신자미 고구마 식물체를 대상으로 저장뿌리 조직에서의 안토시아닌의 함량을 스펙트로포토미터를 통해 측정하였다. 그 결과 대조구인 비형질전환체 보다 형질전환 신자미 고구마 식물체의 경우 약 0.6 ~ 0.8배 이상 감소된 안토시아닌 함량을 보였다 (도 7). 그러나 형질전환 식물체 #1-1의 경우, 비형질전환 식물체와 거의 같은 안토시아닌 함량을 보였으며 이 형질전환주의 경우 카로티노이드 함량 또한 가장 높아 이상적인 형질전환 식물체로 선정하였다(도 6, 도 7).
실시예 8. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 잎에서 저분자 항산화활성 분석
형질전환한 신자미 고구마 식물체 잎을 대상으로 저분자 항산화 물질의 함량을 비교하기 위해, DPPH 라디칼 소거활성을 측정하였다 (도 8A). 그 결과 비형질전화체와 빈 벡터를 형질전환한 식물체의 경우 g FW (fresh weight)당 약 250~ 340 μg 아스코르브산 (ASA) 상당의 활성을 보였으며, 형질전환체의 경우 약 310~ 610 μg 아스코르브산 (ASA) 상당의 활성을 보였고, 특히 형질전환체 #1-1의 경우 가장 높은 항산화활성을 보였다. 그리고 폴리페놀 함량은 비형질전화체와 빈 벡터를 형질전환한 식물체의 경우 g FW당 170~190 μg 클로로겐산 (chlorogenic acid) 상당의 활성을 가지는 반면에, 형질전환체의 경우 230~ 360 μg 클로로겐산 상당의 활성을 보여 형질전환체들이 대조구보다 높은 함량을 보였다 (도 8B).
실시예 9. 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 비생물학적(abiotic) 스트레스 내성 분석
본 발명에 따르면, 고구마 유래 IbOr-Ins 유전자 변이체로 형질전환시킨 신자미 고구마 식물체의 경우 베타카로틴이 비형질전환 신자미와 비교하여 2.5 ~ 2.9배 이상 증가함을 보였다. 따라서 기존의 안토시아닌과 본 발명에 의해 증가된 카로티노이드에 의해 형질전환 식물체가 스트레스 내성을 부여하는지를 확인하기 위해 염 (salt), MV와 같은 비생물학적 스트레스를 처리하였다.
먼저 대조구와 형질전환체의 잎줄기 정단에서 4, 5번째 잎을 직경 8mm의 잎 디스크로 만든 후 0, 150, 200, 400 mM의 농도의 NaCl 용액에 24시간, 25℃ 암 조건에 침지하였다. 그리고 각각의 잎 디스크가 받는 산화 스트레스를 DAB (3.3 diaminobezidine) 염색을 통해 관찰하였다. DAB은 세포내 H2O2와 반응하여 갈색의 침전물을 만든다. 1 mg/ml DAB-HCl (pH 3.8) 용액에 각각의 처리구를 24시간 침지한 뒤 발색 정도를 사진을 찍었다. 그 결과 대조구인 신자미와 빈벡터를 형질전환한 신자미의 경우 NaCl 농도가 높아짐에 따라 갈색으로 발색 정도가 심하여 농도에 따른 산화스트레스를 많이 받음에 반해 형질전환체의 경우 대조구에 비해 발색 정도가 적어 염에 의한 산화스트레스에 내성을 나타내었다 (도 9).
또 다른 산화 스트레스원인 메틸 비올로겐 (MV)을 8 mm 직경의 잎 디스크를 6개씩 취해 0, 2.5, 5, 10 μM의 MV를 포함하는 0.4% 솔비톨 용액 3 mL씩 들어 있는 직경 2.5 cm의 멀티 페트리 디쉬에 각각 띄웠다. 25℃의 암 조건에서 12 시간 동안 배양하여 MV가 흡수되도록 한 후 연속 광 조건에서 24시간 배양하여 12시간 간격으로 전기 전도도계 (model 455C, Istek, Co., Korea)를 이용하여 용액의 이온 전도도와 24시간 후의 산화 스트레스를 DAB 염색을 통해 측정하여 잎의 손상 정도를 조사하였다. 비형질전환체와 빈 벡터를 형질전환한 대조구 식물체의 경우 2.5 μM의 MV 처리 후 48시간째까지 37.3%와 55.7%의 높은 이온 전도도를 보임으로써 MV에 의해 생성되는 산화스트레스에 대해 강한 감수성을 보임을 알 수 있었다. 반면에 형질전환체의 경우 25.6%와 31.2%의 낮은 이온 전도도를 보임으로써 MV에 의해 생성되는 산화스트레스에 대해 강한 내성을 보였다. 비형질전환체와 빈 벡터를 형질전환한 대조구 식물체의 경우 5 μM의 MV 처리 후 48시간째까지 51.9%와 62.5%의 높은 이온 전도도를 보임으로써 MV에 의해 생성되는 산화스트레스에 대해 강한 감수성을 보임을 알 수 있었다. 그러나 형질전환체의 경우 34.8%와 40.8%의 낮은 이온 전도도를 보임으로써 MV에 의해 생성되는 산화스트레스에 대해 강한 내성을 보였다 (도 10A). 또한 1 mg/ml DAB-HCl (pH 3.8) 용액에 각각의 처리구를 24시간 침지한 뒤 발색시킨 결과 비형질전환체와 빈 벡터를 형질전환한 대조구 식물체의 경우 MV 농도가 높아짐에 따라 갈색으로 발색 정도가 심하여 농도에 따른 산화 스트레스를 많이 받음에 반해 형질전환 식물체의 경우 대조구에 비해 발색 정도가 적어 MV에 의한 산화스트레스에 내성을 나타내었다 (도 10B).

Claims (11)

  1. 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법.
  2. 제1항에 있어서, 상기 고구마 식물체는 자색 고구마인 것을 특징으로 하는 방법.
  3. 제1항 또는 제2항의 방법에 의해 제조된 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체.
  4. 제3항에 따른 고구마 식물체의 종자.
  5. 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는 재조합 벡터를 안토시아닌을 축적하는 고구마 식물체에 형질전환시켜 IbOr-Ins 유전자 변이체를 과발현하는 단계를 포함하는 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법.
  6. 제5항에 있어서, 상기 고구마 식물체는 자색 고구마인 것을 특징으로 하는 방법.
  7. 제5항에 있어서, 상기 환경 스트레스는 비생물학적(abiotic) 스트레스인 것을 특징으로 하는 방법.
  8. 제5항 내지 제7항 중 어느 한 항의 방법에 의해 제조된 야생형에 비해 환경 스트레스 내성이 증가된 안토시아닌 고축적 형질전환 고구마 식물체.
  9. 제8항에 따른 고구마 식물체의 종자.
  10. 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 카로티노이드 함량 증가용 조성물.
  11. 서열번호 1의 염기서열로 이루어진, 고구마(Ipomoea batatas) 유래의 IbOrange 유전자에 특정 염기서열을 인위적으로 삽입한 IbOr-Ins 유전자 변이체를 포함하는, 안토시아닌을 축적하는 고구마 식물체의 환경 스트레스 내성 증가용 조성물.
PCT/KR2011/007924 2011-08-05 2011-10-24 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체 WO2013022149A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201180072691.0A CN103917087B (zh) 2011-08-05 2011-10-24 大量蓄积类胡萝卜素以及花青素的转化甘薯植物体的制备方法以及由此制备的植物体

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020110078073A KR101359308B1 (ko) 2011-08-05 2011-08-05 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체
KR10-2011-0078073 2011-08-05

Publications (1)

Publication Number Publication Date
WO2013022149A1 true WO2013022149A1 (ko) 2013-02-14

Family

ID=47668639

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/007924 WO2013022149A1 (ko) 2011-08-05 2011-10-24 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체

Country Status (3)

Country Link
KR (1) KR101359308B1 (ko)
CN (1) CN103917087B (ko)
WO (1) WO2013022149A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111448206A (zh) * 2017-12-19 2020-07-24 韩国生命工学研究院 源自番薯的IbOr-R96H变异体及其用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108218969B (zh) * 2017-12-28 2021-07-06 江苏师范大学 甘薯花青素转运相关蛋白IbGSTF4及其编码基因与应用
CN110663385B (zh) * 2019-10-23 2022-03-04 青岛农业大学 一种新型复合物在提高平邑甜茶抵抗钾离子胁迫中的新应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100990330B1 (ko) * 2008-06-20 2010-10-29 한국생명공학연구원 고구마 유래의 카로티노이드 축적에 관련된ＩｂＯｒａｎｇｅ 유전자
KR20120054712A (ko) * 2010-11-22 2012-05-31 한국생명공학연구원 고구마 유래의 ＩｂＯｒ-Ｉｎｓ 유전자 변이체 및 이의 용도

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8138391B1 (en) * 2005-12-07 2012-03-20 The United States Of America As Represented By The Secretary Of Agriculture Or gene and its use in manipulating carotenoid content and composition in plants and other organisms
KR101190257B1 (ko) * 2009-11-13 2012-10-12 한국생명공학연구원 식물의 베타카로틴 함량을 증가시키는 베타카로틴 히드록실라아제 유전자 및 이의 용도
KR101134004B1 (ko) * 2009-11-13 2012-04-09 한국생명공학연구원 식물의 베타카로틴 함량을 증가시키는 라이코펜 ε-사이클라아제 유전자 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100990330B1 (ko) * 2008-06-20 2010-10-29 한국생명공학연구원 고구마 유래의 카로티노이드 축적에 관련된ＩｂＯｒａｎｇｅ 유전자
KR20120054712A (ko) * 2010-11-22 2012-05-31 한국생명공학연구원 고구마 유래의 ＩｂＯｒ-Ｉｎｓ 유전자 변이체 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HIRONORI MANO ET AL.: "Isolation of a Regulatory Gene of Anthocyanin Biosynthesis in Tuberous Roots of Purple-Fleshed Sweet Potato", PLANT PHYSIOLOGY, vol. 143, 2007, pages 1252 - 1268 *
MYOUNG DUCK, KIM ET AL.: "Selection of transgenic sweetpotato plants expressing 2-Cys peroxiredoxin with enhanced tolerance to oxidative stress", JOURNAL OF PLANT BIOTECHNOLOGY, vol. 36, no. 1, 2009, pages 75 - 80 *
SALGADO-GARCIGLIA ET AL.: "NaCl-resistant variant cells isolated from sweet potato cell suspensions", PLANT CELL TISSUE ORGAN CULTURE, vol. 5, 1985, pages 3 - 12 *
SHAN LU ET AL.: "The Cauliflower or Gene Encodes a DnaJ Cysteine-Rich Domain-Containing Protein That Mediates High Levels of b-Carotene Accumulation", THE PLANT CELL, vol. 18, 2006, pages 3594 - 3605 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111448206A (zh) * 2017-12-19 2020-07-24 韩国生命工学研究院 源自番薯的IbOr-R96H变异体及其用途
CN111448206B (zh) * 2017-12-19 2022-11-29 韩国生命工学研究院 源自番薯的IbOr-R96H变异体及其用途

Also Published As

Publication number Publication date
CN103917087B (zh) 2016-07-06
KR101359308B1 (ko) 2014-02-10
CN103917087A (zh) 2014-07-09
KR20130015819A (ko) 2013-02-14

Similar Documents

Publication Publication Date Title
AU2016201885B2 (en) Isolated Polynucleotides And Polypeptides, And Methods Of Using Same For Improving Plant Properties
US20170306343A1 (en) Methods of increasing biomass and/or growth rate of a plant under non-stress conditions
AU2009250806B2 (en) Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility
Tak et al. Overexpression of MusaMYB31, a R2R3 type MYB transcription factor gene indicate its role as a negative regulator of lignin biosynthesis in banana
BR122019015761B1 (pt) método para aumentar a tolerância ao estresse abiótico, o rendimento, a biomassa, a taxa de crescimento, o vigor, o teor de óleo, o rendimento das fibras, a qualidade das fibras e/ou a eficiência do uso do nitrogênio de uma planta, polinucleotídeo isolado, construto de ácido nucleico isolado, e, polipeptídeo isolado
BR122020005664B1 (pt) Método para aumentar a taxa de crescimento, biomassa, vigor, capacidade fotossintéticae/ou tolerância ao estresse abiótico de uma planta e construção de ácido nucleico
WO2013098819A9 (en) Isolated polynucleotides and polypeptides, and methods of using same for increasing yield of plants
WO2014188428A1 (en) Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics
BR122019028229B1 (pt) Método para aumentar o rendimento, a taxa de crescimento, a biomassa, e/ou o rendimento das sementes de uma planta em comparação com uma planta controle da mesma espécie que é cultivada nas mesmas condições de crescimento, e, construção de ácido nucleico
WO2014033714A1 (en) Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants
BRPI0912898B1 (pt) Método para aumentar a eficiência de uso do nitrogênio e/ou tolerância à deficiência de nitrogênio de uma planta
BR122020018204B1 (pt) Método para aumentar o rendimento, biomassa, taxa de crescimento, tolerância ao estresse abiótico e/ou eficiência no uso de nitrogênio de uma planta
CA3172119A1 (en) Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency
EP3702364A1 (en) Transcriptional regulation for improved plant productivity
BRPI0710455A2 (pt) polipeptìdeo isolado, polinucleotìdeo isolado e métodos para aumentar o nìvel de um polipeptìdeo em uma planta, para modular o nìvel de um polipeptìdeo em uma planta e para modificar o crescimento de uma planta
WO2013022149A1 (ko) 카로티노이드 및 안토시아닌 고축적 형질전환 고구마 식물체의 제조 방법 및 그에 따른 식물체
KR101465692B1 (ko) AtbHLH113 유전자를 이용한 안토시아닌 생합성이 조절된 형질전환 식물체의 제조방법 및 그에 따른 식물체
WO2015125985A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 ＯｓＮＦ-ＹＡ7 유전자 및 이의 용도
KR20140040372A (ko) Ｒｏｍｔ 및 ｓｔｓ 유전자를 이용한 식물의 스틸벤 함량을 증가시키고 화색을 변화시키는 방법
WO2014061932A1 (ko) 애기장대 유래의 ｒｅｃａ１ 유전자를 이용한 병원균에 대한 면역능력이 증진된 형질전환 식물체의 제조방법 및 그에 따른 식물체
CN116419673A (zh) 从tss启动子表达ipt7增加根质量和碳固存
KR101351265B1 (ko) 안토시아닌 함량이 증가된 형질전환 알팔파 식물체의 제조 방법 및 그에 따른 알팔파 식물체
CN116157526A (zh) 提高c3植物的生产率
KR101376522B1 (ko) 내염성을 증가시키는 벼 유래의 ＯｓＭＬＤ 유전자 및 이의 용도
WO2018164293A1 (ko) 식물의 가뭄 스트레스 내성을 증가시키는 벼 유래의 Ｒｏｃ10 유전자 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11870606

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11870606

Country of ref document: EP

Kind code of ref document: A1