WO2016077526A1 - Glycan-interacting compounds and methods of use - Google Patents
Glycan-interacting compounds and methods of use Download PDFInfo
- Publication number
- WO2016077526A1 WO2016077526A1 PCT/US2015/060287 US2015060287W WO2016077526A1 WO 2016077526 A1 WO2016077526 A1 WO 2016077526A1 US 2015060287 W US2015060287 W US 2015060287W WO 2016077526 A1 WO2016077526 A1 WO 2016077526A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- antibody
- antibodies
- cdr
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3076—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39591—Stabilisation, fragmentation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/68031—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being an auristatin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
- A61K47/6817—Toxins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6891—Pre-targeting systems involving an antibody for targeting specific cells
- A61K47/6897—Pre-targeting systems with two or three steps using antibody conjugates; Ligand-antiligand therapies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/44—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/5759—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds localised on the membrane of tumour or cancer cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
- A61K47/12—Carboxylic acids; Salts or anhydrides thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/77—Internalization into the cell
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- HHSN261201400027C awarded by the Department of Health and Human Services. The United States government may have certain rights in the invention.
- This invention relates to methods for the development of compounds and compositions, including, but not limited to antibodies for the detection and/or removal of glycosylated matter from an organism.
- Tn and STn formation is associated with somatic mutations in the gene Cosmc that encodes a molecular chaperon required for the formation of the activate T-synthase (Ju, T. et al., Nature. 2005 Oct
- STn alone has attracted attention as a target for cancer detection and therapy (Cheever, M.A. et al., Clin Cancer Res. 2009 Sep l;15(17):5323-37). STn is also present in mucins associated with cancer stem cells (Engelmann et al., Cancer research, 2008, 68, 2419-2426) and STn is implicated in immune supression (Carrascal, M.A., et al., Molecular Oncology. 2014. 8(3): 753-65).
- Neu5Gc N-acetylneuraminic acid (Neu5Ac) and Neu5Gc are the two major sialic acids on mammalian cell surfaces. Neu5Ac and Neu5Gc differ only in that Neu5Gc comprises an additional oxygen atom associated with chemical group attached to carbon 5. Due to the loss of a functional gene, humans can only synthesize sialic acid in the form of Neu5Ac, but not Neu5Gc. However Neu5Gc can be metabolically incorporated into humans from animal-derived dietary sources such as red meats
- Neu5Gc containing glycan epitopes on human tumors represent a valuable possibility for drug targeting.
- a recent study suggests the existence of antibodies against Neu5Gc-containing STn (GcSTn), but not Neu5Ac-STn (AcSTn), in cancer patients and explores their potential as a specific biomarker for cancer detection (Padler-Karavani, V. et al, Cancer Res. 2011 May l;71(9):3352-63).
- GcSTn Neu5Gc-containing STn
- AcSTn Neu5Ac-STn
- the present invention meets this need by providing antibodies that target glycans, by providing methods of developing anti-glycan antibodies, and by providing methods of using anti-glycan antibodies to identify and target cancerous cells and tissues in the diagnosis and treatment of disease.
- the present invention provides an antibody comprising a variable domain, the variable domain comprising at least 95% amino acid sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 15-52 or a fragment thereof.
- such antibodies comprise a variable domain pair selected from the group consisting of SEQ ID NO:29 and SEQ ID NO:30; SEQ ID NO: 15 and SEQ ID NO: 16; SEQ ID NO: 17 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO:20; SEQ ID NO:21 and SEQ ID NO:22; SEQ ID NO:23 and SEQ ID NO:24; SEQ ID NO:25 and SEQ ID NO:26; SEQ ID NO:27 and SEQ ID NO:28; SEQ ID NO:31 and SEQ ID NO:32; SEQ ID NO:35 and SEQ ID NO:36; SEQ ID NO:37 and SEQ ID NO:38; SEQ ID NO:39 and SEQ ID NO:40; SEQ ID NO:42
- Some antibodies of the invention comprise at least one complementarity
- CDR determining region
- such antibodies comprise a CDR with a heavy chain variable domain (VH) CDR (CDR-H) comprising at least 70% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 81-99, SEQ ID NOs: 143-148, and SEQ ID NOs: 152-155.
- VH heavy chain variable domain
- Some antibodies comprise a CDR-H3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 90- 99, and SEQ ID NOs: 152-155.
- antibodies comprise a light chain variable domain (VL) CDR (CDR-L) comprising at least 70% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 100-142, and SEQ ID NOs: 159-164.
- VL variable domain
- CDR-L CDR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 127-142.
- the present invention provides an antibody comprising: (1) a CDR-L1 selected from the group consisting of SEQ ID NOs: 100-114, and SEQ ID NOs: 159-167; (2) a CDR-L2 selected from the group consisting of SEQ ID NOs: 115-126, and SEQ ID NOs: 168-170; (3) a CDR-L3 selected from the group consisting of SEQ ID NOs: 127-142, and SEQ ID NOs: 171-173; (4) a CDR-H1 selected from the group consisting of SEQ ID NOs: 81-83, SEQ ID NO: 143, and SEQ ID NO: 144; (5) a CDR-H2 selected from the group consisting of SEQ ID NOs: 84-89, and SEQ ID NOs: 145-151; and (6) a CDR-H3 selected from the group consisting of SEQ ID NOs: 90-99, and SEQ ID NOs: 152-158.
- Some antibodies of the invention are monoclonal antibodies. Some antibodies comprise an IgGl isotype. Other antibodies comprise an IgG2 isotype. In some cases, antibodies of the invention belong to an antibody group selected from the group consisting of a Group 1 antibody, a Group 2 antibody, a Group 3 antibody and a Group 4 antibody. Some antibodies specifically target an antigen selected from the group consisting of N- acetylneuraminic sialyl Tn antigen (AcSTn) and N-glycolylneuraminic sialyl Tn antigen (GcSTn). Such antibodies may target antigens comprising a 9-O-acetyl group. Some antibodies bind to a cluster of two or more glycans. Further antibodies comprise bispecific antibodies.
- antibodies of the invention comprise an antibody-drug conjugate.
- Some antibody-drug conjugates comprise a therapeutic agent.
- Some antibody-drug conjugates comprise a cytotoxic agent.
- cytotoxic agents are conjugated to antibodies directly.
- cytotoxic agents are conjugated to antibodies via a linker.
- linkers may include cleavable linkers or non-cleavable linkers.
- the cytotoxic agent is a DNA damaging agent.
- the cytotoxic agent is a cytoskeletal inhibitor.
- TACAs may include Tn antigen, sialylated Tn antigen (STn,) Thomsen-Friedenreich antigen, Lewis Y (Le Y ) antigen, Lewis x (Le x ) antigen, Sialyl Lewis x (SLe x ) antigen, Sialyl Lewis A (SLe A ) antigen, Globo H, stage-specific embryonic antigen-3 (SSEA-3,) a glycosphingolipid comprising sialic acid, ganglioside GD2, ganglioside GD3, ganglioside GM2, fucosyl GM1, ganglioside Neu5GcGM3, or a polysialic acid-related antigen.
- the present invention provides a method of killing a tumor cell comprising contacting the tumor cell with an antibody of the invention.
- the present invention provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an antibody of the invention.
- such methods are used to treat an epithelial cancer.
- epithelial cancers may include breast, colon, lung, bladder, cervical, ovarian, stomach, prostate, and/or liver cancer.
- compositions comprising at least one of the antibodies of the invention. Further provided are kits comprising such
- compositions and instructions for use thereof are provided.
- the present invention provides methods of reducing tumor volume in a subject comprising administering to said subject a composition of the invention.
- methods of the invention may be used to increase anti-tumor cell immune activity by contacting at least one immune-resistant tumor cell with an antibody of the invention.
- anti-tumor cell immune activity may include innate immune activity (e.g., natural killer (NK) cell anti-tumor cell activity).
- anti-tumor cell activity includes adaptive immune activity (e.g., B cell anti-tumor cell activity or dendritic cell (DC) anti-tumor cell activity).
- compositions of the invention may increases DC expression of one or more factor selected from the group consisting of CD80, CD86, IL-12, and TNF-a.
- Further methods of the invention include treating an immune-resistant tumor in a subject in need thereof by administering a composition of the invention.
- the present invention provides methods of reducing or eliminating cancer stem cells (CSCs) in a subject comprising administering to the subject an antibody of the invention.
- CSCs cancer stem cells
- the CSCs are present in breast, ovarian, pancreatic, bladder, cervical, colon and/or lung tissue.
- the CSCs comprise CD 133 and/or CD44 biomarkers.
- methods of reducing or eliminating CSCs further comprise the administration of at least one chemotherapeutic agent.
- chemotherapeutic agents may be selected from paclitaxel and carboplatin.
- the present invention provides intrabodies comprising a variable domain comprising at least 95% amino acid sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 15-52 and a fragment thereof.
- Some intrabodies comprise a variable domain pair selected from the group consisting of SEQ ID NO:29 and SEQ ID NO:30; SEQ ID NO: 15 and SEQ ID NO: 16; SEQ ID NO: 17 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO:20; SEQ ID N0:21 and SEQ ID NO:22; SEQ ID NO:23 and SEQ ID NO:24; SEQ ID NO:25 and SEQ ID NO:26; SEQ ID NO:27 and SEQ ID NO:28; SEQ ID N0:31 and SEQ ID NO:32; SEQ ID NO:35 and SEQ ID NO:36; SEQ ID NO:37 and SEQ ID NO:38; SEQ ID NO:39 and SEQ ID NO:40; SEQ ID NO:42 and SEQ ID NO:
- the present invention provides a chimeric antigen receptor (CAR) comprising a variable domain comprising at least 95% amino acid sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 15-52 and a fragment thereof.
- CAR chimeric antigen receptor
- Some CARs comprise a variable domain pair selected from the group consisting of SEQ ID NO:29 and SEQ ID NO:30; SEQ ID NO: 15 and SEQ ID NO: 16; SEQ ID NO: 17 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO:20; SEQ ID NO:21 and SEQ ID NO:22; SEQ ID NO:23 and SEQ ID NO:24; SEQ ID NO:25 and SEQ ID NO:26; SEQ ID NO:27 and SEQ ID NO:28; SEQ ID NO:31 and SEQ ID NO:32; SEQ ID NO:35 and SEQ ID NO:36; SEQ ID NO:37 and SEQ ID NO:38; SEQ ID NO:39 and SEQ ID NO:40; SEQ ID NO:42 and SEQ ID NO:32; SEQ ID NO:44 and SEQ ID NO:45; SEQ ID NO:46 and SEQ ID NO:32; SEQ ID NO:47 and SEQ ID NO:32; SEQ ID NO:48 and SEQ ID NO:50
- the present invention provides constructs encoding antibodies of the invention.
- Such constructs may comprise at least one nucleotide sequence having at least 95% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 192-233 and a fragment thereof.
- constructs of the invention encode intrabodies or CARs of the invention.
- cells comprising one or more constructs of the invention.
- viruses comprising constructs of the invention.
- the present invention provides methods of identifying cells and/or tissues expressing STn with antibodies of the invention. Further provided are methods of identifying cancerous cells in tissues or organs with antibodies of the invention. Such tissues or organs may include breast, ovary, and pancreas.
- the present invention provides antibody variants comprising sequence analysis-informed variants of antibodies of the invention.
- Such antibody variants may comprise improved epitope specificity and/or affinity.
- Some antibody variants comprise a CDR length modification (e.g., a CDR-H3 length modification).
- Some antibody variants comprise a substitution of one or more amino acids in one or more CDRs.
- antibody variants comprise at least one germline gene modification.
- Some antibody variants comprise an scFv, monobody, diabody, intrabody, CAR, or antibody mimetic.
- the present invention provides a method of developing an antibody fragment display library comprising: (1) aligning variable domain amino acid sequences among two or more antibodies of the invention; (2) identifying conserved and variable amino acids among the aligned antibodies, and (3) constructing an antibody fragment display library, wherein variability among library members is limited to amino acid variation of the variable amino acids identified.
- Further embodiments provide antibody fragment display libraries produced according to such methods. Additional embodiments provide antibodies comprising variable domains isolated from such antibody fragment display libraries. Such antibodies may include an scFv, monobody, diabody, intrabody, CAR, or antibody mimetic.
- Figs. 1 A-1D are diagrams depicting a2,6-sialylated N-acetylgalactosamine (STn) and indicating putative epitopes involved in anti-STn antibody binding.
- the largest ellipse in each diagram indicates the specific region of STn targeted by each of 4 antibody groups.
- These groups include Group 1 antibodies (binding to the large elliptical region indicated in Fig. 1A), Group 2 antibodies (binding to the large elliptical region indicated in Fig. IB), Group 3 antibodies (binding to the large elliptical region indicated in Fig. 1C) and Group 4 antibodies (binding to the large elliptical region indicated in Fig. ID).
- Figs. 2A and 2B are bar graphs presenting antibody binding data.
- Fig. 2A is a bar graph presenting antibody binding results with OVCAR3 cells.
- Fig. 2B is a bar graph presenting antibody binding results with SNU-16 cells.
- glycans antibodies specific for or which interact with epitopes comprising carbohydrate groups referred to herein as glycans.
- Some glycan- interacting antibodies described herein may be used as biotherapeutics.
- Other embodiments provide methods for generating such glycan-interacting antibodies.
- glycans may be sialylated with N-acetylneuraminic acid (Neu5Ac) or N- glycolylneuraminic acid (Neu5Gc).
- Glycan-interacting antibodies according to the present invention may be directed to cancer-related glycans comprising a2,6-sialylated N- acetylgalactosamine (STn). Such antibodies may target any STns (pan-STn antibodies), glycans comprising STns having Neu5Ac specifically (AcSTn) or glycans having STns comprising Neu5Gc specifically (GcSTn).
- glycan-interacting antibodies of the present invention target other cancer-related glycan antigens.
- the present invention provides methods of producing glycan-interacting antibodies.
- Such methods may comprise the use of mice for generating an immune response to one or more antigens comprising STn (e.g. AcSTn and/or GcSTn).
- STn e.g. AcSTn and/or GcSTn
- a number of methods may be utilized in order to manipulate the resulting antibodies produced through mouse immunization.
- Such methods may include varying the strain and/or gender of the mice being immunized, varying the antigen used, varying the type and dose of adjuvant included in antigen administration and time course of immunization before initiation of hybridoma fusion.
- the present invention provides methods for eliminating cancer stem cells using glycan-interacting antibodies. In other embodiments, the present invention provides methods for treating cancer in a subject by eliminating cancer stem cells using glycan-interacting antibodies. In some aspects, glycan-interacting antibodies may be used alone. In other aspects, glycan-interacting antibodies are used in combination with chemotherapeutic agents.
- kits, assays and reagents comprising antibodies and/or methods of the present invention are presented. Definitions
- Adjacent refers to something that is adjoining, neighboring or next to a given entity.
- "adjacent residues” are sugar residues within a glycan chain that are linked to one another. In some embodiments,
- adjacent glycans are glycan chains that next to each other either in direct contact or within close proximity and without another glycan in between the two.
- combination means that a subject is simultaneously exposed to two or more agents administered at the same time or within an interval of time such that the subject is at some point in time simultaneously exposed to both and/or such that there may be an overlap in the effect of each agent on the patient.
- at least one dose of one or more agents is administered within about 24 hours, 12 hours, 6 hours, 3 hours, 1 hour, 30 minutes, 15 minutes, 10 minutes, 5 minutes, or 1 minute of at least one dose of one or more other agents.
- administration occurs in overlapping dosage regimens.
- the term "dosage regimen” refers to a plurality of doses spaced apart in time. Such doses may occur at regular intervals or may include one or more hiatus in administration.
- the administration of individual doses of one or more glycan-interacting antibodies, as described herein are spaced sufficiently closely together such that a combinatorial ⁇ e.g. , a synergistic) effect is achieved.
- amino acid As used herein, the terms "amino acid” and “amino acids” refer to all naturally occurring L-alpha-amino acids as well as non-naturally occurring amino acids. Amino acids are identified by either the one-letter or three-letter designations as follows: aspartic acid (Asp:D), isoleucine (Ile:I), threonine (Thr:T), leucine (Leu:L), serine (Ser:S), tyrosine (Tyr:Y), glutamic acid (Glu:E), phenylalanine (Phe:F), proline (Pro:P), histidine (His:H), glycine (Gly:G), lysine (Lys:K), alanine (Ala:A), arginine (Arg:R), cysteine (Cys:C), tryptophan (Trp:W), valine (Val:V), glutamine (Gln:Q) methionine (Asp:D),
- animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans at any stage of development. In some embodiments, “animal” refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal ⁇ e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone.
- Antibody As used herein, the term “antibody” is used in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies formed from at least two intact antibodies), and antibody fragments such as diabodies so long as they exhibit a desired biological activity. Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications such as with sugar moieties.
- Antibody fragment refers to a portion of an intact antibody, preferably comprising an antigen binding region thereof.
- antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab” fragments, each with a single antigen-binding site. Also produced is a residual "Fc” fragment, whose name reflects its ability to crystallize readily.
- Pepsin treatment yields an F(ab') 2 fragment that has two antigen-binding sites and is still capable of cross- linking antigen.
- Glycan-interacting antibodies may comprise one or more of these fragments.
- an antibody may comprise a heavy and light variable domain as well as an Fc region.
- association means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions.
- An “association” need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the "associated" entities remain physically associated.
- Bifunctional refers to any substance, molecule or moiety which is capable of or maintains at least two functions.
- the functions may affect the same outcome or a different outcome.
- the structure that produces the function may be the same or different.
- Biomolecule As used herein, the term "biomolecule” is any natural molecule which is amino acid-based, nucleic acid-based, carbohydrate -based or lipid-based, and the like.
- Bispecific antibody refers to an antibody capable of binding two different antigens. Such antibodies typically comprise regions from at least two different antibodies. Bispecific antibodies may include any of those described in Riethmuller, G. 2012. Cancer Immunity. 12: 12-18, Marvin, J.S. et al., 2005.
- Branch refers to an entity, moiety or appendage that is linked or extends out from a main entity or source.
- a "branch chain” or “branching chain” comprises one or more residues (including, but not limited to sugar residues) that extend from a parent chain.
- a "parent chain” is used to refer to a chain of residues (including, but not limited to sugar residues) from which a branching chain is linked. In the case of a glycan with multiple branches, the parent chain may also refer to the source chain from which all such branches are directly or indirectly attached.
- parent chain linkages typically occur between carbons 1 and 4 of adjacent residues while branching chains are attached to a parent chain through a linkage between carbon 1 of the branching residue and carbon 3 of the parent residue from which the branch extends.
- branching residue refers to the residue attached to the parent chain in a branching chain.
- cancer stem cells As used herein, cancer stem cells (CSCs) refer to a subset of tumor cells that have the ability to self-renew. CSCs may be able to regenerate diverse cell types. In some cases, these cells are difficult or impossible to remove through surgical or chemical treatment of a tumor.
- Compound As used herein, the term "compound,” refers to a distinct chemical entity. In some embodiments, a particular compound may exist in one or more isomeric or isotopic forms (including, but not limited to stereoisomers, geometric isomers and isotopes). In some embodiments, a compound is provided or utilized in only a single such form.
- a compound is provided or utilized as a mixture of two or more such forms (including, but not limited to a racemic mixture of stereoisomers).
- Those of skill in the art appreciate that some compounds exist in different such forms, show different properties and/or activities (including, but not limited to biological activities). In such cases it is within the ordinary skill of those in the art to select or avoid particular forms of the compound for use in accordance with the present invention.
- compounds that contain asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods on how to prepare optically active forms from optically active starting materials are known in the art, such as by resolution of racemic mixtures or by stereoselective synthesis.
- Cyclic or Cyclized As used herein, the term “cyclic” refers to the presence of a continuous loop. Cyclic molecules need not be circular, only joined to form an unbroken chain of subunits.
- Cytidine monphosphate-N-acetylneuraminic acid hydroxylase As used herein, the term “cytidine monophosphate-N-acetylneuraminic acid hydroxylase” or “CMAH” refers to an enzyme, absent in humans, but present in most other mammals (including, but not limited to mice, pigs and chimpanzees) that catalyzes the formation of N-glycolylneuraminic acid from N-acetylneuraminic acid. The absence of the enzyme in humans is due to a frameshift mutation resulting in the premature termination of the CMAH transcript and the production of a non-functional protein.
- CMAH cytidine monophosphate-N-acetylneuraminic acid hydroxylase
- Cytotoxic As used herein, the term "cytotoxic” is used to refer to an agent that kills or causes injurious, toxic, or deadly effects on a cell ⁇ e.g. , a mammalian cell ⁇ e.g. , a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.
- Delivery refers to the act or manner of transporting a compound, substance, entity, moiety, cargo or payload to an intended destination.
- Delivery Agent refers to any substance which facilitates, at least in part, the in vivo delivery of a compound, substance, entity, moiety, cargo or payload.
- Detectable label refers to one or more markers, signals, or moieties which are attached, incorporated or associated with another entity, which markers, signals or moieties are readily detected by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance and the like. Detectable labels include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands such as biotin, avidin, streptavidin and haptens, quantum dots, and the like. Detectable labels may be located at any position in the entity with which they are attached, incorporated or associated. For example, when attached, incorporated in or associated with a peptide or protein, they may be within the amino acids, the peptides, or proteins, or located at the N- or C- termini.
- Display library refers to a tool used in scientific discovery to identify biomolecular interactions. Different variations of display libraries exist that include the utilization of bacteriophages, yeast and ribosomes. In each case, proteins within a given library (also referred to herein as “library members”) are linked (physically or through association with a host) to the nucleic acid which encodes the protein. When a target molecule is incubated with the members of a display library, any library members that bind to the target may be isolated and the sequences encoding the bound protein may be determined through analysis of the linked nucleic acid. In some embodiments of display libraries exist.
- display libraries are "phage display libraries” wherein the display library is made up of bacteriophage viral particles (also referred to herein as “phage particles") wherein nucleic acids have been incorporated into the phage genome resulting in the production of viral coat proteins that are fused to proteins encoded by the nucleic acids that have been introduced. Such fused proteins are "displayed" on the outer surface of the assembled phage particles where they may interact with a given target.
- distal As used herein, the term “distal” means situated away from the center or away from a point or region of interest.
- Engineered As used herein, embodiments of the invention are "engineered” when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule. Thus, engineered agents or entities are those whose design and/or production include an act of the hand of man.
- an epitope refers to a surface or region on a molecule that is capable of interacting with components of the immune system, including, but not limited to antibodies.
- an epitope may comprise a target site.
- Epitopes may comprise a region on an antigen or between two or more antigens that is specifically recognized and bound by a corresponding antibody.
- Some epitopes may comprise one or more sugar residues along one or more glycan. Such epitopes may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar residues.
- Epitopes may also comprise one or more regions of interaction between entities.
- epitopes may comprise a junction between two sugar residues, between a branching chain and a parent chain or between a glycan and a protein.
- Ether bond refers to a chemical bond comprising an oxygen bonded between two carbon atoms.
- ether bonds link sugar residues to other entities, including, but not limited to other sugar residues to form a glycan chain. Such bonds are also referred to as “glycosidic bonds” or “glycosidic linkages".
- linkages may link glycans to other entities, including, but not limited to proteins, lipids, phospholipids and sphingolipids.
- sugar residues may be linked to protein, typically forming a link between a sugar residue and an amino acid residue.
- amino acid residues include serine and threonine.
- ether bonds link glycans to a glycan array comprising a carbohydrate linker that participates in bond formation.
- Glycosidic linkages may differ in their stereochemical properties.
- alpha oriented glycosidic linkages also referred to herein as "alpha linkages" result in an axial orientation between the bonded oxygen of the ether bond and the cyclohexane ring of the sugar reside.
- beta oriented glycosidic linkages (also referred to herein as "beta linkages”) result in an equatorial orientation between the bonded oxygen of the ether bond and the cyclohexane ring of the sugar residue.
- expression may refer to one or more of the following events: (1) production of an R A template from a DNA sequence ⁇ e.g., by transcription); (2) processing of an RNA transcript ⁇ e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an RNA into a polypeptide or protein; (4) folding of a polypeptide or protein; and (5) post-translational modification of a polypeptide or protein (e.g., by glycosylation).
- Feature refers to a characteristic, a property, or a distinctive element.
- a “formulation” refers to a material or mixture prepared according to a formula and which may comprise at least one antibody, compound, substance, entity, moiety, cargo or payload and a delivery agent, carrier or excipient.
- Functional As used herein, a "functional" biological molecule is a biological entity with a structure and in a form in which it exhibits a property and/or activity by which it is characterized.
- a “functional group” or “chemical group” refers to a characteristic group of atoms or chemical bonds that are part of a larger molecule. In some embodiments, functional groups may be associated with different molecules, but may participate in similar chemical reactions regardless of the molecule of which they are a part.
- Common functional groups include, but are not limited to carboxyl groups (-COOH), acetyl groups (-COH), amino groups (-NH 2 ), methyl groups (-CH 3 ), sulfate groups (-S0 3 H) and acyl groups.
- the addition of one or more functional group to a molecule may be conveyed using terms that modify the name of the functional group with the ending "-ylated", e.g., acetylated, methylated and sulfated.
- Glycan As used herein, the terms “glycan”, “oligosaccharide” and
- polysaccharide are used interchangeably and refer to polymers made up of sugar monomers, typically joined by glycosidic bonds also referred to herein as linkages.
- the terms “glycan”, “oligosaccharide” and “polysaccharide” may be used to refer to the carbohydrate portion of a glycoconjugate (e.g., glycoprotein, glycolipid or proteoglycan).
- Glycan chain refers to a sugar polymer comprising two or more sugars. In some embodiments, glycan chains are covalently linked to proteins through serine or threonine residues on the protein.
- Glycan-rich composition refers to composition comprising a large percentage of glycans.
- glycans within a glycan-rich composition may comprise from about 1% to about 10%, from about 5% to about 15%, from about 20%> to about 40%>, from about 30%> to about 50%>, from about 60% to about 80%, from about 70% to about 90% or at least 100% of the total weight of the composition.
- glycosidic bond refers to a covalent bond formed between a carbohydrate and another chemical group.
- glycosidic bonds are formed between the reducing end of one sugar molecule and the non- reducing end of a second sugar molecule or polysaccharide chain.
- Such glycosidic bonds are also known as O-glycosidic bonds due to the oxygen (or ether bond) between the joined sugars.
- a glycosidic bond between two sugars or between a sugar and a linker may also be referred to as a "linkage”.
- m vitro refers to events that occur in an artificial environment, e.g. , in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism ⁇ e.g., animal, plant, or microbe).
- in vivo refers to events that occur within an organism ⁇ e.g., animal, plant, or microbe or cell or tissue thereof).
- Isolated As used herein, the term “isolated” is synonymous with “separated”, but carries with it the inference separation was carried out by the hand of man. In one
- an isolated substance or entity is one that has been separated from at least some of the components with which it was previously associated (whether in nature or in an experimental setting). Isolated substances may have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%>, about 40%>, about 50%>, about 60%), about 70%o, about 80%>, about 90%>, or more of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%), about 97%), about 98%>, about 99%, or more than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components.
- Kit refers to a set comprising one or more components adapted for a cooperative purpose and instructions for use thereof.
- Knockout refers to an organism wherein an existing gene has been inactivated through a process that typically involves the hand of man. In a knockout organism, a gene that has been inactivated is said to have been "knocked out”. In some embodiments, the knocked out gene may be inactivated through the insertion of a nucleotide sequence into the gene or through replacement of the gene entirely.
- Linker refers to a moiety that connects two or more domains, moieties or entities.
- a linker may comprise 10, 11, 12, 13, 14, 15 or more atoms.
- a linker may comprise a group of atoms, e.g., 10- 1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
- the linker may comprise an amino acid, peptide, polypeptide or protein.
- a moiety bound by a linker may include, but is not limited to an atom, a chemical group, a nucleoside, a nucleotide, a nucleobase, a sugar, a nucleic acid, an amino acid, a peptide, a polypeptide, a protein, a protein complex, a payload (e.g., a therapeutic agent) or a marker (including, but not limited to a chemical, fluorescent, radioactive or bio luminescent marker).
- the linker can be used for any useful purpose, such as to form multimers or conjugates, as well as to administer a payload, as described herein.
- linker examples include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
- a disulfide bond e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol
- dextran polymers Other examples include, but are
- Non- limiting examples of a selectively cleavable bonds include an amido bond which may be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond which may be cleaved for example by acidic or basic hydrolysis.
- TCEP tris(2-carboxyethyl)phosphine
- a linker is a carbohydrate moiety used to link glycans to a substrate, such as in a glycan array.
- Such carbohydrate linkers include, but are not limited to -0(CH 2 ) 2 CH 2 HN 2 and -0(CH 2 ) 3 NHCOCH 2 (OCH 2 CH 2 ) 6 NH 2 .
- Mucin As used herein, the term “mucin” refers to a family of proteins that are heavily glycosylated. In some embodiments mucins are produced by the submaxillary glands and are found in saliva and mucous.
- Negative selection refers to the selection of library members from a display library based on their ability to bind entities and/or components of a composition that do not comprise a target antigen. In some embodiments, negative selection is used prior to positive selection to remove elements that might bind non-specifically to the target.
- Off-target refers to any unintended effect on any one or more target, gene, or cellular transcript.
- Patient refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained (e.g., licensed) professional for a particular disease or condition.
- Peptide As used herein, "peptide” is a protein or polypeptide which is less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
- compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- compositions comprising any ingredient other than active agents (e.g., as described herein) present in a pharmaceutical composition and having the properties of being substantially nontoxic and non-inflammatory in a patient.
- a pharmaceutically acceptable excipient is a vehicle capable of suspending or dissolving the active agent.
- Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration.
- antiadherents antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration.
- excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C,
- Pharmaceutically acceptable salts of the compounds described herein are forms of the disclosed compounds wherein the acid or base moiety is in its salt form (e.g., as generated by reacting a free base group with a suitable organic acid).
- Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
- Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate,
- alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
- Pharmaceutically acceptable salts include the conventional nontoxic salts, for example, from non-toxic inorganic or organic acids.
- a pharmaceutically acceptable salt is prepared from a parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two;
- nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
- Lists of suitable salts are found in Remington 's Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley- VCH, 2008, and Berge et al, Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.
- solvate refers to a crystalline form of a compound wherein molecules of a suitable solvent are incorporated in the crystal lattice.
- solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
- solvents examples include ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N'-dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC), l,3-dimethyl-2-imidazolidinone (DMEU), l,3-dimethyl-3,4,5,6-tetrahydro-2-(lH)- pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
- NMP N-methylpyrrolidinone
- DMSO dimethyl sulfoxide
- DMF N,N'-dimethylformamide
- DMAC N,N'-dimethylacetamide
- DMEU dimethyl-2-imidazolidinone
- DMPU
- the solvate When water is the solvent, the solvate is referred to as a "hydrate.”
- the solvent incorporated into a solvate is of a type or at a level that is physiologically tolerable to an organism to which the solvate is administered (e.g., in a unit dosage form of a pharmaceutical composition).
- Pharmacokinetic refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.
- Physicochemical means of or relating to a physical and/or chemical property.
- Positive selection refers to the selection of a given entity from a group of unique entities. Such entities and groups thereof may be, for example antibodies. In some cases they may be antibody fragments or antibody fragments expressed in association with an agent capable of expressing such fragments (e.g. library members from a display library). Selection may be based on the ability of selected entities to bind to a desired target or epitope. In some embodiments, positive selection may be used with phage display libraries to identify phage particles expressing scFvs that bind to the desired target. In other embodiments, positive selection may refer to the selection of antibody candidates from among a pool of antibodies.
- entities may be cells, cell lines or clones as in the selection of clones during hybridoma selection.
- positive selection may refer to clonal selection based on one or more features of antibodies (e.g. specificity for one or more desired epitopes) produced by such clones.
- desired epitopes in positive selection methods may comprise STn (e.g. AcSTn and/or GcSTn).
- negative selection included the same principles and examples described for positive selection, but with the distinguishing characteristic that it is used for removal of undesired entities from a group of unique entities.
- the term "preventing” refers to partially or completely delaying onset of an infection, disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying progression from an infection, a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and/or condition.
- Prodrug The present disclosure also includes prodrugs of the compounds described herein.
- prodrugs refer to any substance, molecule or entity which is in a form predicate for that substance, molecule or entity to act as a therapeutic upon chemical or physical alteration. Prodrugs may by covalently bonded or sequestered in some way and which release or are converted into the active drug moiety prior to, upon or after administered to a mammalian subject. Prodrugs can be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compounds.
- Prodrugs include compounds wherein hydroxyl, amino, sulfhydryl, or carboxyl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxyl, amino, sulfhydryl, or carboxyl group respectively.
- Preparation and use of prodrugs is discussed in T. Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems," Vol. 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American
- Proximal As used herein, the term “proximal” means situated nearer to the center or to a point or region of interest.
- Region of interaction refers to a region along any of two or more entities where such entities interact or overlap.
- a region of interaction may comprise one or more sugar residues along a glycan chain that contacts a second glycan chain.
- the glycan chains are branching chains from the same parent chain.
- a region of interaction may occur between two glycan chains wherein one chain is a branching chain and the second chain is a parent chain.
- regions of interaction may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar residues.
- regions of interaction may also occur between glycans and proteins or between glycans and lipids.
- Residue refers to a monomer associated with or capable of associating with a polymer.
- residues comprise sugar molecules including, but not limited to glucose, galactose, N-acetylglucosamine, N- acetylgalactosamine, sialic acids.
- residues comprise amino acids.
- sample refers to an aliquot or portion taken from a source and/or provided for analysis or processing.
- a sample is from a biological source such as a tissue, cell or component part (e.g. a body fluid, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen).
- a biological source such as a tissue, cell or component part (e.g. a body fluid, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen).
- a sample may be or comprise a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs.
- a sample comprises a medium, such as a nutrient broth or gel, which may contain cellular components, such as proteins or nucleic acid molecule.
- a "primary" sample is an aliquot of the source.
- a primary sample is subjected to one or more processing (e.g., separation, purification, etc.) steps to prepare a sample for analysis or other use.
- Sialyl As used herein, the prefix “sialyl” as well as the term “sialylated” describe compounds comprising sialic acid.
- Single-chain variable fragment refers to a fusion protein comprising antibody variable regions connected by a linker.
- scFvs are utilized in conjunction with phage display methods where they may be expressed in association with a phage coat protein and used in the identification of high affinity peptides for a given antigen.
- Single unit dose is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.
- a single unit dose is provided as a discrete dosage form (e.g., a tablet, capsule, patch, loaded syringe, vial, etc.).
- split dose As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses.
- Stable As used herein "stable” refers to a compound or entity that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and preferably capable of formulation into an efficacious therapeutic agent.
- Stabilized As used herein, the term “stabilize”, “stabilized,” “stabilized region” means to make or become stable. In some embodiments, stability is measured relative to an absolute value. In some embodiments, stability is measured relative to a reference compound or entity.
- Subject refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes.
- Typical subjects include animals ⁇ e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plants.
- Submaxillary glands As used herein, the term “submaxillary glands" or
- submandibular glands refers to mucous producing glands located beneath the mouth floor. These glands are capable of producing mucins and in some embodiments, may be extracted from mammals as a source of mucin.
- Susceptible to An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with and/or may not exhibit symptoms of the disease, disorder, and/or condition but harbors a propensity to develop a disease or its symptoms.
- an individual who is susceptible to a disease, disorder, and/or condition may be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and/or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition; (4) habits and/or lifestyles associated with development of the disease, disorder, and/or condition; (5) a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microbe associated with development of the disease, disorder, and/or condition.
- a genetic mutation associated with development of the disease, disorder, and/or condition for example, cancer
- a genetic polymorphism associated with development of the disease, disorder, and/or condition
- increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition (4) habits and/
- an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
- Synthetic means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or polypeptides or other molecules of the present invention may be chemical or enzymatic.
- Target refers to an object or entity to be affected by an action.
- targets refer to antigens to be used for the development of antibodies that specifically bind the antigens.
- Target screening refers to the use of a target substance to identify binding partners for that substance.
- Target site refers to a target on or within one or more glycans, biomolecules and/or biostructures within a cell, the extracellular space, a tissue, an organ and/or an organism.
- glycan target sites may reside exclusively on one sugar residue or may be formed by two or more residues.
- target sites are formed between two or more glycans.
- target sites are formed between branching chains of the same glycan or between one or more branching chains and a parent chain.
- Targeted cells refers to any one or more cells of interest.
- the cells may be found in vitro, in vivo, in situ or in the tissue or organ of an organism.
- the organism may be an animal, preferably a mammal, more preferably a human and most preferably a patient.
- Terminal residue refers to the last residue in a polymeric chain. In some embodiments, terminal residues are sugar residues located at the non-reducing end of a polysaccharide chain.
- Therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect.
- therapeutically effective amount means an amount of an agent to be delivered ⁇ e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.
- a therapeutically effective amount is provided in a single dose.
- a therapeutically effective amount is administered in a dosage regimen comprising a plurality of doses.
- a unit dosage form may be considered to comprise a therapeutically effective amount of a particular agent or entity if it comprises an amount that is effective when administered as part of such a dosage regimen.
- therapeutically effective outcome means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.
- Total daily dose As used herein, a "total daily dose” is an amount given or prescribed in 24 hr period. It may be administered as a single unit dose.
- Transgenic refers to an organism that comprises one or more genes incorporated within the organisms genome that are not naturally found in that organism.
- treating refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular infection, disease, disorder, and/or condition.
- treating cancer may refer to inhibiting survival, growth, and/or spread of a tumor.
- Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
- variable region As used herein, the term “variable region” or “variable domain” refers to specific antibody domains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen.
- Whole IgG As used herein, the term “whole IgG” refers to a complete IgG molecule. In some embodiments, whole IgG molecules comprise regions found naturally in two or more other organisms.
- Wild type refers to an organism comprising a natural genome (free from genes derived from other organisms).
- compositions of the invention are /. Compositions of the invention
- the present invention provides compounds as well as compositions that comprise at least one glycan-interacting antibody.
- monosaccharide monomers may all be the same or they may differ. Common monomers include, but are not limited to trioses, tetroses, pentoses, glucose, fructose, galactose, xylose, arabinose, lyxose, allose, altrose, mannose, gulose, iodose, ribose, mannoheptulose, sedoheptulose and talose.
- Amino sugars may also be monomers within a glycan. Glycans comprising such sugars are herein referred to as aminoglycans.
- Amino sugars are sugar molecules that comprise an amine group in place of a hydroxyl group, or in some embodiments, a sugar derived from such a sugar.
- amino sugars include, but are not limited to glucosamine, galactosamine, N-acetylglucosamine, N-acetylgalactosamine, sialic acids (including, but not limited to, N-acetylneuraminic acid and N-glycolylneuraminic acid) and L-daunosamine.
- glycan-interacting antibody refers to an antibody that can interact with a glycan moiety. Glycan-interacting antibodies may function to bind to, alter, activate, inhibit, stabilize, degrade and/or modulate a glycan or a glycan-associated molecule or entity. In so doing, glycan-interacting antibodies may function as a therapeutic, whether palliative, prophylactic or as an ongoing treatment composition. In some
- glycan-interacting antibodies may comprise conjugates or combinations with other molecules. In some embodiments, glycan-interacting antibodies are directed toward glycans comprising one or more amino sugar. In a further embodiment, one or more amino sugars is a sialic acid. In a further embodiment, one or more sialic acids is N- acetylneuraminic acid and/or N-glycolylneuraminic acid.
- Glycan-interacting antibodies may comprise entire antibodies or fragments thereof.
- antibody is used in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies formed from at least two intact antibodies), antibody conjugates (including, but not limited to antibody-drug conjugates), antibody variants [including, but not limited to antibody mimetics, chimeric antibodies (e.g. antibodies with amino acid sequences derived from more than one species), and synthetic variants] and antibody fragments such as diabodies so long as they exhibit a desired biological activity.
- Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications such as with sugar moieties.
- antibody fragment refers to a portion of an intact antibody or fusion-protein thereof, in some cases comprising at least one antigen binding region.
- antibody fragments include Fab, Fab', F(ab') 2 , Fv fragments, single-chain variable fragments (scFvs); diabodies; tri(a)bodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site. Also produced is a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab') 2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen.
- Glycan-interacting antibodies may comprise one or more of these fragments.
- “Native antibodies” are usually heterotetrameric glycoproteins of about 150,000 Daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Genes encoding antibody heavy and light chains are known and segments making up each have been well characterized and described (Matsuda, F. et al., 1998. The Journal of
- Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes.
- Each heavy and light chain also has regularly spaced intrachain disulfide bridges.
- Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
- Each light chain has a variable domain at one end (V L ) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
- variable domain refers to specific antibody domains found on both the antibody heavy and light chains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Variable domains comprise hypervariable regions. As used herein, the term “hypervariable region” refers to a region within a variable domain comprising amino acid residues responsible for antigen binding. The amino acids present within the variable domain
- hypervariable regions determine the structure of the complementarity determining regions (CDRs) that become part of the antigen-binding site of the antibody.
- CDR complementarity determining regions
- the term "CDR” refers to a region of an antibody comprising a structure that is complimentary to its target antigen or epitope. Other portions of the variable domain, not interacting with the antigen, are referred to as framework (FW) regions.
- the antigen-binding site also known as the antigen combining site or paratope
- the exact residues making up the antigen-binding site are typically elucidated by co-crystallography with bound antigen, however computational assessments can also be used based on comparisons with other antibodies (Strohl, W.R.
- Determining residues making up CDRs may include the use of numbering schemes including, but not limited to, those taught by Kabat [Wu, T.T. et al, 1970, JEM, 132(2):211-50 and Johnson, G. et al, 2000, Nucleic Acids Res. 28(1): 214-8, the contents of each of which are herein incorporated by reference in their entirety], Chothia [Chothia and Lesk, J. Mol. Biol. 196, 901 (1987), Chothia et al, Nature 342, 877 (1989) and Al-Lazikani, B. et al, 1997, J. Mol. Biol.
- VH and VL domains have three CDRs each.
- VL CDRs are referred to herein as CDR-Ll, CDR-L2 and CDR-L3, in order of occurrence when moving from N- to C- terminus along the variable domain polypeptide.
- VH CDRs are referred to herein as CDR-H1, CDR- H2 and CDR-H3, in order of occurrence when moving from N- to C- terminus along the variable domain polypeptide.
- Each of CDRs have favored canonical structures with the exception of the CDR-H3, which comprises amino acid sequences that may be highly variable in sequence and length between antibodies resulting in a variety of three-dimensional structures in antigen-binding domains (Nikoloudis, D.
- CDR-H3s may be analyzed among a panel of related antibodies to assess antibody diversity.
- Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, W.R. Therapeutic Antibody Engineering.
- Fv refers to an antibody fragment comprising the minimum fragment on an antibody needed to form a complete antigen-binding site. These regions consist of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. Fv fragments can be generated by proteolytic cleavage, but are largely unstable. Recombinant methods are known in the art for generating stable Fv fragments, typically through insertion of a flexible linker between the light chain variable domain and the heavy chain variable domain [to form a single chain Fv (scFv)] or through the introduction of a disulfide bridge between heavy and light chain variable domains (Strohl, W.R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p46-47, the contents of which are herein incorporated by reference in their entirety).
- Antibody "light chains" from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda based on amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2a, IgG2b, IgG2c, IgG3, IgG4, IgAl, and IgA2.
- single chain Fv or “scFv” refers to a fusion protein of VH and VL antibody domains, wherein these domains are linked together into a single polypeptide chain by a flexible peptide linker.
- the Fv polypeptide linker enables the scFv to form the desired structure for antigen binding.
- scFvs are utilized in conjunction with phage display, yeast display or other display methods where they may be expressed in association with a surface member (e.g. phage coat protein) and used in the identification of high affinity peptides for a given antigen.
- a surface member e.g. phage coat protein
- diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain V H connected to a light chain variable domain V L in the same polypeptide chain. By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
- Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al, Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993), the contents of each of which are incorporated herein by reference in their entirety.
- intrabody refers to a form of antibody that is not secreted from a cell in which it is produced, but instead target one or more intracellular protein. Intrabodies may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division.
- methods of the present invention may include intrabody- based therapies.
- variable domain sequences and/or CDR sequences disclosed herein may be incorporated into one or more construct for intrabody- based therapy.
- intrabodies of the invention may target one or more glycated intracellular protein or may modulate the interaction between one or more glycated intracellular protein and an alternative protein.
- chimeric antigen receptor refers to artificial receptors (also known as “chimeric immunoreceptors,” “artificial T cell receptors” or “chimeric T cell receptors”) that are engineered to be expressed on the surface of immune effector cells resulting in specific targeting of such immune effector cells to cells expressing entities that bind with high affinity to the artificial receptors.
- CARs may be designed to include one or more segments of an antibody, scFv, antibody variable domain, and/or antibody CDRs, such that when such CARs are expressed on immune effector cells, the immune effector cells bind and clear any cells that are recognized by the antibody portions of the CARs.
- CARs are designed to specifically bind cancer cells, leading to immune-regulated clearance of the cancer cells.
- the phrases "have antigen specificity” and “elicit antigen-specific response” as used with respect to CARs means that the CAR can specifically bind to and immunologically recognize an antigen to elicit an immune response.
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibody, such variants generally being present in minor amounts.
- each monoclonal antibody is directed against a single determinant on the antigen
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to
- Humanized forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin.
- humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the hypervariable region from an antibody of the recipient are replaced by residues from the hypervariable region from an antibody of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
- glycan-interacting antibodies of the present invention may be antibody mimetics.
- antibody mimetic refers to any molecule which mimics the function or effect of an antibody and which binds specifically and with high affinity to their molecular targets.
- antibody mimetics may be monobodies, designed to incorporate the fibronectin type III domain (Fn3) as a protein scaffold (US 6,673,901; US 6,348,584).
- antibody mimetics may be those known in the art including, but are not limited to affibody molecules, affilins, affitins, anticalins, avimers, DARPins, Fynomers and Kunitz and domain peptides.
- antibody mimetics may include one or more non-peptide region.
- antibody variant refers to a biomolecule resembling an antibody in structure and/or function comprising some differences in their amino acid sequence, composition or structure as compared to a native antibody.
- Glycan-interacting antibodies of the present invention are developed to bind antigens such as those described herein.
- an "antigen” is an entity which induces or evokes an immune response in an organism.
- An immune response is characterized by the reaction of the cells, tissues and/or organs of an organism to the presence of a foreign entity. Such an immune response typically leads to the production by the organism of one or more antibodies against the foreign entity, e.g., antigen or a portion of the antigen.
- methods of immunization may be altered based on one or more desired immunization outcomes.
- the term "immunization outcome" refers to one or more desired effects of immunization. Examples include high antibody titers and/or increased antibody specificity for a target of interest.
- Antigens of the invention may comprise glycans, glycoconjugates (including, but not limited to glycoproteins and glycolipids), peptides, polypeptides, fusion proteins, or any of the foregoing and may be conjugated or complexed to one or more separate adjuvants or heterologous proteins.
- antigens used according to methods of the present invention may comprise sialylated glycans, such as STn.
- Antigens comprising STn may comprise mucins. Mucins are a family of proteins that are heavily glycosylated. They are a component of many tumors originating from epithelial cells (Ishida, A. et al., 2008.
- Proteomics. 8: 3342-9 the contents of which are herein incorporated by reference in their entirety). They are highly expressed by submaxillary glands and can be found at high levels in saliva and mucous. Animal-derived submaxillary mucins may be used as antigens to generate anti-STn antibodies in immunogenic hosts. Submaxillary mucin from different species differ in their STn content with regard to AcSTn versus GcSTn forms. Porcine submaxillary mucin (PSM) is particularly rich in GcSTn, which makes up about 90% of total STn. STn from bovine submaxillary mucin (BSM) comprises roughly equal percentages of GcSTn and AcSTn.
- Ovine submaxillary mucin is particularly rich in AcSTn, which makes up about 90% of total STn.
- solutions prepared for immunization may be modified to include one or more of PSM, BSM and OSM depending on the desired target of antibodies resulting from such immunization.
- PSM may be used in immunizations to generate antibodies in immunogenic hosts that are more likely to be specific for GcSTn.
- PSM is rich in Neu5Gc-containing mucin-type, glycoproteins that are decorated with GcSTn.
- the present invention provides a glycan-interacting antibody that is GcSTn-specific.
- the antibody has little cross-reactivity to Neu5Ac-STn or Tn.
- the antibody can bind GcSTn but has reduced affinity for AcSTn.
- antigens may be subjected to enzymatic digestion prior to immunization to modulate the resulting immune response in immunogenic hosts.
- submaxillary mucins may be treated with trypsin or proteinase K enzymes prior to immunization. The activity of such enzymes may help to cleave off and thereby reduce the percentage and variability of non-STn epitopes.
- Glycan moieties may shield regions of the peptide where they are attached from enzymatic proteolysis and thereby remain intact.
- Antibody titers resulting from immunizations may comprise different levels depending on the type and amount of antigen used in such immunizations. In some cases, certain antigens may be selected for use in immunizations based on the expected titer.
- adjuvants may comprise oil-in-water emulsions (e.g. sub-micron oil-in-water emulsions).
- Adjuvants according to the present invention may also include any of those disclosed in US Patent Publication No. US20120027813 and/or US Patent No. US8506966, the contents of each of which are herein incorporated by reference in their entirety.
- Antibodies of the present invention may be polyclonal or monoclonal or recombinant, produced by methods known in the art or as described in this application.
- the antibodies of the present invention may be labeled for purposes of detection with a detectable label known by one of skill in the art.
- the label can be a radioisotope, fluorescent compound, chemiluminescent compound, enzyme, or enzyme co- factor, or any other labels known in the art.
- the antibody that binds to a desired antigen is not labeled, but may be detected by binding of a labeled secondary antibody that specifically binds to the primary antibody.
- Antibodies of the present invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly made antibodies (i.e., intrabodies), and epitope- binding fragments of any of the above.
- Antibodies of the present invention e.g., glycan- interacting antibodies
- such antibodies are of human, murine (e.g., mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken origin.
- the antibodies of the present invention can be monospecific or multispecific (e.g., bispecific, trispecific, or of greater multispecificity).
- Multispecific antibodies can be specific for different epitopes of a target antigen of the present invention, or can be specific for both a target antigen of the present invention, and a heterologous epitope, such as a heterologous glycan, peptide or solid support material.
- Glycan-interacting antibodies of the present invention comprising monoclonal antibodies can be prepared using well-established methods known by those skilled in the art.
- the monoclonal antibodies are prepared using hybridoma technology (Kohler, G. et al., Continuous cultures of fused cells secreting antibody of predefined specificity. Nature. 1975 Aug 7;256(5517):495-7).
- an immunizing agent e.g., a target antigen of the invention
- lymphocytes may be immunized in vitro. The lymphocytes are then fused with an immunizing agent to produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- an immunizing agent e.g., a target antigen of the invention
- Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, rabbit, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
- the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium”), which substances prevent the growth of HGPRT-deficient cells.
- HGPRT hypoxanthine guanine phosphoribosyl transferase
- Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, Calif, and the American Type Culture Collection, Manassas, Va. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, D. et al, A human hybrid myeloma for production of human monoclonal antibodies. J Immunol. 1984 Dec;133(6):3001-5; Brodeur, B. et al., Monoclonal Antibody Production Techniques and Applications. Marcel Dekker, Inc., New York. 1987; 33:51-63).
- myeloma cells may be subjected to genetic manipulation. Such manipulation may be carried out using zinc-finger nuclease (ZFN) mutagenesis as described herein. Alternatively, transfection methods known in the art may be used. NSO myeloma cells or other mouse myeloma cell lines may be used. For example, Sp2/0-Agl4 can be an alternative cell line for hybridoma development.
- ZFN zinc-finger nuclease
- TALENs Transcription Activator-Like Effector Nucleases
- TALENs are artificial restriction enzymes generated by fusing the TAL effector DNA binding domain to a DNA cleavage domain. Similar to ZFNs, TALENs induce double-strand breaks at desired loci that can be repaired by error-prone NHEJ to yield insertions/deletions at the break sites (Wood, A.J. et al, Targeted genome editing across species using ZFNs and TALENs. Science. 2011 Jul
- Cellectis Bioresearch provides the service of TALEN design and plasmid construction.
- the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies.
- the binding specificity i.e., specific immunoreactivity
- the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).
- RIA radioimmunoassay
- ELISA enzyme-linked immunosorbent assay
- the binding specificity of the monoclonal antibody can, for example, be determined by Scatchard analysis (Munson, P.J. et al., Ligand: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem. 1980 Sep l;107(l):220-39).
- antibody specificity for regions of a given antigen may be characterized by chemically modifying the antigens prior to assaying for antibody binding.
- periodate treatment may be used to destroy the C6 side chain of sialic acids. Assays may be conducted with and without periodate treatment to reveal whether or not binding in untreated samples is sialic acid-specific.
- antigens comprising 9-O-acetylated sialic acid may be subjected to mild base treatment (e.g. with 0.1 M NaOH) to destroy 9-O-acetyl groups.
- Assays may be conducted with and without mild base treatment to reveal whether or not binding in untreated samples depends on 9-O-acetylation of sialic acid.
- the clones may be subcloned by limiting dilution procedures and grown by standard methods. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium or RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
- Alternative methods to clone hybridomas may include those provided by kits from STEMCELL Technologies (Vancouver, BC, Canada), e.g. CLONACELLTM-HY kit, containing methylcellulose-based semi-solid medium and other media and reagents, to support the selection and growth of hybridoma clones.
- the media in this kit contain FCS, which provides an exogenous source for Neu5Gc incorporation.
- Neu5Gc incorporated from the culture media may also pose a problem in some cases (Bardor, M.
- the culture media may be supplemented with Neu5Ac to eliminate Neu5Gc incorporation by metabolic competition (Ghaderi, D. et al., Implications of the presence of N-glycolylneuraminic acid in recombinant therapeutic glycoproteins. Nat Biotechnol. 2010. 28: 863-867).
- the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
- the monoclonal antibodies of the present invention can also be made by recombinant DNA methods, such as those described in U.S. Pat. No.
- DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- the hybridoma cells of the invention serve as a preferred source of DNA.
- the DNA can be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
- the DNA also can be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Pat. No. 4,816,567) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non- immunoglobulin polypeptide.
- a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
- antibodies of the present invention may be produced by various procedures known by those skilled in the art.
- host animals such as rabbits, rats, mice, cows, horses, donkeys, chickens, monkeys, sheep or goats, are immunized with either free or carrier-coupled antigens, for example, by intraperitoneal and/or intradermal injection.
- injection material may be an emulsion containing about 100 ⁇ g of antigen or carrier protein.
- injection materials comprise a glycan-rich composition such as non-human mammalian submaxillary mucin in solution.
- adjuvants can also be used to increase the immunological response, depending on the host species.
- Adjuvants include, but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, TITERMAX® (CytRx Corp, Los Angeles, CA), keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
- BCG Bacille Calmette-Guerin
- corynebacterium parvum Such adjuvants are also well known in the art.
- booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of antibody which can be detected, for example, by ELISA assay using glycans and/or free peptide adsorbed to a solid surface.
- the titer of antibodies in serum from an immunized animal can be increased by selection of antibodies, e.g., by adsorption of antigens onto a solid support and elution of the selected antibodies according to methods well known in the art.
- Glycan-interacting antibodies, variants and fragments thereof may be selected and produced using high throughput methods of discovery.
- glycan- interacting antibodies comprising synthetic antibodies, variants and fragments thereof are produced through the use of display libraries.
- display refers to the expression or "display” of proteins or peptides on the surface of a given host.
- library refers to a collection of unique cDNA sequences and/or the proteins that are encoded by them. A library may contain from as little as two unique cDNAs to hundreds of billions of unique cDNAs.
- glycan-interacting antibodies comprising synthetic antibodies are produced using antibody display libraries or antibody fragment display libraries.
- antibody fragment display library refers to a display library wherein each member encodes an antibody fragment containing at least one variable region of an antibody.
- Such antibody fragments are preferably Fab fragments, but other antibody fragments such as single-chain variable fragments (scFvs) are contemplated as well.
- scFvs single-chain variable fragments
- each Fab encoded may be identical except for the amino acid sequence contained within the variable loops of the complementarity determining regions (CDRs) of the Fab fragment.
- CDRs complementarity determining regions
- amino acid sequences within the individual V H and/or V L regions may differ as well.
- Display libraries may be expressed in a number of possible hosts including, but not limited to yeast, bacteriophage, bacteria and retroviruses. Additional display technologies that may be used include ribosome-display, microbead-display and protein-DNA linkage techniques.
- Fab display libraries are expressed in yeast or in bacteriophages (also referred to herein as "phages" or "phage particles". When expressed, the Fabs decorate the surface of the phage or yeast where they can interact with a given antigen.
- An antigen comprising a glycan or other antigen from a desired target may be used to select phage particles or yeast cells expressing antibody fragments with the highest affinity for that antigen.
- the DNA sequence encoding the CDR of the bound antibody fragment can then be determined through sequencing using the bound particle or cell.
- positive selection is used in the development of antibodies.
- negative selection is utilized in the development of antibodies.
- both positive and negative selection methods are utilized during multiple rounds of selection in the
- yeast display cDNA encoding different antibody fragments are introduced into yeast cells where they are expressed and the antibody fragments are "displayed" on the cell surface as described by Chao et al. (Chao, G. et al., Isolating and engineering human antibodies using yeast surface display. Nat Protoc. 2006;l(2):755-68).
- expressed antibody fragments contain an additional domain comprising the yeast agglutinin protein, Aga2p. This domain allows the antibody fragment fusion protein to attach to the outer surface of the yeast cell through the formation of disulphide bonds with surface- expressed Agalp. The result is a yeast cell, coated in a particular antibody fragment.
- Display libraries of cDNA encoding these antibody fragments are utilized initially in which the antibody fragments each have a unique sequence.
- These fusion proteins are expressed on the cell surface of millions of yeast cells where they can interact with a desired antigenic target antigen, incubated with the cells.
- Target antigens may be covalently or otherwise modified with a chemical or magnetic group to allow for efficient cell sorting after successful binding with a suitable antibody fragment takes place. Recovery may be by way of magnetic- activated cell sorting (MACS), fluorescence-activated cell sorting (FACS) or other cell sorting methods known in the art.
- MCS magnetic- activated cell sorting
- FACS fluorescence-activated cell sorting
- Bacteriophage display technology typically utilizes filamentous phage including, but not limited to fd, Fl and Ml 3 virions. Such strains are non- lytic, allowing for continued propagation of the host and increased viral titres. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in
- Miersch et al. (Miersch, S. et al., Synthetic antibodies: Concepts, potential and practical considerations. Methods. 2012 Aug; 57(4):486-98), Bradbury et al. (Bradbury, A.R. et al, Beyond natural antibodies: the power of in vitro display technologies. Nat Biotechnol. 2011 Mar;29(3):245-54), Brinkman et al. (Brinkmann, U. et al., Phage display of disulfide- stabilized Fv fragments. J Immunol Methods. 1995 May 11; 182(l):41-50); Ames et al.
- Antibody fragment expression on bacteriophages may be carried out by inserting the cDNA encoding the fragment into the gene expressing a viral coat protein.
- the viral coat of filamentous bacteriophages is made up of five coat proteins, encoded by a single-stranded genome.
- Coat protein pill is the preferred protein for antibody fragment expression, typically at the N-terminus.
- antibody fragment expression compromises the function of pill
- viral function may be restored through coexpression of a wild type pill, although such expression will reduce the number of antibody fragments expressed on the viral coat, but may enhance access to the antibody fragment by the target antigen.
- Expression of viral as well as antibody fragment proteins may alternatively be encoded on multiple plasmids. This method may be used to reduce the overall size of infective plasmids and enhance the transformation efficiency.
- the coding regions from the antibody or antibody fragment can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
- affinity maturation refers to a method whereby antibodies are produced with increasing affinity for a given antigen through successive rounds of mutation and selection of antibody- or antibody fragment-encoding cDNA sequences. In some cases, this process is carried out in vitro. To accomplish this, amplification of CDR coding sequences may be carried out using error-prone PCR to produce millions of copies containing mutations including, but not limited to point mutations, regional mutations, insertional mutations and deletional mutations.
- point mutation refers to a nucleic acid mutation in which one nucleotide within a nucleotide sequence is changed to a different nucleotide.
- regional mutation refers to a nucleic acid mutation in which two or more consecutive nucleotides are changed to different nucleotides.
- insertional mutation refers to a nucleic acid mutation in which one or more nucleotides are inserted into a nucleotide sequence.
- deletional mutation refers to a nucleic acid mutation in which one or more nucleotides are removed from a nucleotide sequence.
- Insertional or deletional mutations may include the complete replacement of an entire codon or the change of one codon to another by altering one or two nucleotides of the starting codon.
- Mutagenesis may be carried out on CDR-encoding cDNA sequences to create millions of mutants with singular mutations in CDR heavy and light chain regions.
- random mutations are introduced only at CDR residues most likely to improve affinity.
- These newly generated mutagenic libraries can be used to repeat the process to screen for clones that encode antibody fragments with even higher affinity for the target antigen. Continued rounds of mutation and selection promote the synthesis of clones with greater and greater affinity (Chao, G. et al., Isolating and engineering human antibodies using yeast surface display. Nat Protoc. 2006;l(2):755-68).
- Examples of techniques that can be used to produce antibodies and antibody fragments, such as Fabs and scFvs, include those described in U.S. Pat. Nos. 4,946,778 and 5,258, 498; Miersch et al. (Miersch, S. et al, Synthetic antibodies: Concepts, potential and practical considerations . Methods. 2012 Aug;57(4):486-98), Chao et al. (Chao, G. et al, Isolating and engineering human antibodies using yeast surface display. Nat Protoc.
- Huston et al. Huston, J.S. et al, Protein engineering of single-chain Fv analogs and fusion proteins. Methods Enzymol. 1991;203:46-88
- Shu et al. Shu et al. (Shu, L. et al, Secretion of a single-gene-encoded immunoglobulin from myeloma cells. Proc Natl Acad Sci U S A. 1993 Sep l;90(17):7995-9)
- Skerra et al. Skerra, A. et al, Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science. 1988 May
- chimeric, humanized, or human antibodies are a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal immunoglobulin and a human immunoglobulin constant region.
- Methods for producing chimeric antibodies are known in the art. (Morrison, S.L., Transfectomas provide novel chimeric antibodies. Science. 1985 Sep 20;229(4719): 1202-7; Gillies, S.D.
- Humanized antibodies are antibody molecules from non-human species that bind to the desired antigen and have one or more complementarity determining regions (CDRs) from the nonhuman species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions are substituted with corresponding residues from the CDR and framework regions of the donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding, and by sequence comparison to identify unusual framework residues at particular positions. (U.S. Pat. Nos. 5,693,762 and 5,585, 089; Riechmann, L.
- Antibodies can be humanized using a variety of techniques known in the art, including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089); veneering or resurfacing (EP 592,106; EP 519,596; Padlan, E.A., A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-binding properties. Mol Immunol.
- Human- engineered monoclonal antibodies retain full specific binding activity by preserving non-CDR complementarity-modulating residues. Protein Eng. 1994 Jun;7(6):805-14; Roguska, M.A. et al, Humanization of murine monoclonal antibodies through variable domain resurfacing. Proc Natl Acad Sci U S A. 1994 Feb l;91(3):969-73); and chain shuffling (U.S. Pat. No. 5,565,332); each of which is incorporated herein by reference in their entirety. Humanized antibodies of the present invention may be developed for desired binding specificity, complement-dependent cytotoxicity, and antibody-dependent cellular-mediated cytotoxicity, etc.
- Completely human antibodies are particularly desirable for therapeutic treatment of human patients, so as to avoid or alleviate immune reaction to foreign protein.
- Human antibodies can be made by a variety of methods known in the art, including the antibody display methods described above, using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO
- Human antibodies e.g., glycan-interacting antibodies
- transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin polynucleotides.
- the human heavy and light chain immunoglobulin polynucleotide complexes can be introduced randomly, or by homologous recombination, into mouse embryonic stem cells.
- the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells, in addition to the human heavy and light chain polynucleotides.
- the mouse heavy and light chain immunoglobulin polynucleotides can be rendered nonfunctional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the 1 ⁇ 2 region prevents endogenous antibody production.
- the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express human antibodies.
- the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a glycan, glycoconjugate and/or polypeptide of the invention.
- an antibody molecule of the present invention has been produced by an animal, a cell line, chemically synthesized, or recombinantly expressed, it can be purified (i.e., isolated) by any method known in the art for the purification of an immunoglobulin or polypeptide molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen, Protein A, and sizing column
- chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen, Protein A, and sizing column
- the affinity between an antibody and a target or ligand (such as an antigen used to generate a given antibody) may be measured in terms of K D using one or more binding assays as described herein. Depending on the desired application for a given antibody, varying K D values may be desirable.
- High affinity antibodies typically form ligand bonds with a K D of about 10 ⁇ 5 M or less, e.g. about 10 ⁇ 6 M or less, about 10 ⁇ 7 M or less, about 10 ⁇ 8 M or less, about 10 "9 M or less, about 10 "10 M or less, about 10 "11 M or less or about 10 "12 M or less.
- antibodies of the invention may be characterized according to their half maximal effective or inhibitory concentration (EC 50 or IC 50 , respectively). In some cases, this value may represent the concentration of antibody necessary to inhibit cells expressing STn (e.g. kill, reduce proliferation and/or reduce one or more cell function) at a level equal to half of the maximum inhibition observed with the highest concentrations of antibody.
- EC 50 or IC 50 half maximal effective or inhibitory concentration
- Such IC 50 values may be from about 0.001 nM to about 0.01 nM, from about 0.005 nM to about 0.05 nM, from about 0.01 nM to about 1 nM, from about 0.05 nM to about 5 nM, from about 0.1 nM to about 10 nM, from about 0.5 nM to about 25 nM, from about 1 nM to about 50 nM, from about 5 nM to about 75 nM, from about 10 nM to about 100 nM, from about 25 nM to about 250 nM, from about 200 nM to about 1000 nM or more than 1000 nM.
- Glycan-interacting antibodies of the present invention exert their effects via binding (reversibly or irreversibly) to one or more glycan or glycan-associated or glycan- related targets.
- glycan-interacting antibodies can be prepared from any region of the targets taught herein.
- targets of the present invention comprise glycans.
- Glycans used for generating antibodies may comprise a chain of sugars comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 residues.
- glycans used for generating antibodies comprise from about 2 residue to about 5 residues.
- glycan-interacting antibody target antigens comprise sialic acids.
- N-acetylneuraminic acid (Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc) are the major sialic acids on mammalian cell surfaces.
- Neu5Ac is naturally produced in humans.
- Neu5Gc is naturally produced in most mammals with the exception of humans due to a mutation in the cytidine monophosphate (CMP)-N-acetylneuraminic acid hydroxylase (CMAH) gene responsible for CMP-Neu5Gc production from CMP-Neu5Ac.
- CMP cytidine monophosphate
- CMAH cytidine monophosphate
- CMAH cytidine monophosphate
- CMAH cytidine monophosphate
- CMAH cytidine monophosphate
- CMAH cytidine
- glycoproteins Such glycoproteins are contemplated as targets of the invention.
- Glycan target antigens of the present invention include, but are not limited to those listed in Table 1.
- O-glycosidic bonds are present between each residue in the glycans listed with a and ⁇ indicating the relative stoichiometry between the two residues joined by the bond, wherein a indicates an axial orientation and ⁇ indicates an equatorial orientation.
- the glycans listed in Table 1 represent individual glycan target antigens contemplated, the present invention also includes embodiments wherein the above presented glycans comprise different combinations of a and ⁇ -oriented O-glycosidic bonds than the ones presented.
- R represents an entity that the glycan may be coupled with.
- R is a protein wherein the glycan is linked typically to a serine or threonine residue.
- R is a linker molecule used to join the glycan to a substrate, such as in a glycan array.
- R may be a linker comprising -(CH 2 ) 2 CH 2 NH 2 or - (CH 2 ) 3 NHCOCH 2 (OCH 2 CH 2 ) 6 NH 2 .
- the R group may comprise a combination of the R groups presented here, e.g. a biotinylated polyacrylamide.
- the R group in combination with underlying substrates effect glycan residue spacing.
- Glycan targets of the present invention may comprise regions of antibody recognition.
- region of antibody recognition refers to one or more regions located on any part of the molecule, an attached group or located on a region of interaction between the glycan and another molecule, including, but not limited to another glycan.
- regions of antibody recognition are located at interchain target sites, wherein the term interchain means within the present polymeric chain.
- Interchain target sites may comprise regions of antibody recognition comprising 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 residues, bonds between residues or combinations of residues and bonds.
- regions of antibody recognition are located at regions of interaction between one or more glycan chains.
- regions of antibody recognition are located at regions of interaction between glycan branch chains connected to a common parent chain. In some embodiments, regions of antibody recognition are located at regions of interaction between a glycan branch chain and a parent chain. In some embodiments, regions of antibody recognition are located at regions of interaction between glycans and proteins. Such regions of interaction may comprise chemical bonds between the glycan and the protein, including, but not limited to covalent bonds, ionic bonds, hydrostatic bonds, hydrophobic bonds and hydrogen bonds. In some embodiments, regions of antibody recognition are located at regions of interaction between glycans and other biomolecules including, but not limited to lipids and nucleic acids. Such regions of interaction may comprise chemical bonds between the glycan and the biomolecule, including, but not limited to covalent bonds, ionic bonds, hydrostatic bonds, hydrophobic bonds and hydrogen bonds.
- glycan targets of the present invention are components of glycoconjugates.
- glycoconjugate refers to any entity comprising a glycan moiety.
- glycoconjugates are glycolipids.
- glycolipid refers to a class of lipids wherein a carbohydrate moiety is covalently attached.
- carbohydrate moieties present on glycolipids comprise glycans.
- lipid components of glycolipids comprise ceramide moieties.
- glycolipids contemplated as targets of the present invention include, but are not limited to glyceroglycolipids (including, but not limited to galactolipids and sulfolipids), glycosphingolipids (including, but not limited to cerebrosides (e.g., galactocerebrosides, glucocerebrosides and sulfatides), gangliosides, globosides and glycophosphosphingolipids) and glycosylphosphatidylinositols.
- glycan moieties of glycolipids are located on the extracellular side of the membrane where they may interact with other cells as well as cell signaling ligands (Maccioni, H.J. et al, Organization of the synthesis of glycolipid oligosaccharides in the Golgi complex. FEBS Lett. 2011 Jun
- glycoconjugate targets of the present invention are glycoprotein and/or proteoglycans.
- Glycoproteins refer to any proteins that are covalently bonded with glycans.
- Proteoglycans are a class of proteins that are heavily glycosylated with glycans that often carry a negative charge. This property makes them very hydrophilic and important components of connective tissue. Recombinant antibodies
- Recombinant antibodies e.g., glycan-interacting antibodies
- recombinant antibodies may be anti-glycan antibodies.
- Further antibodies may be anti-STn antibodies (e.g. anti-GcSTn or anti-AcSTn antibodies).
- Recombinant antibodies of the invention may be produced using variable domains obtained from hybridoma cell-derived antibodies produced according to methods described herein. Heavy and light chain variable region cDNA sequences of antibodies may be determined using standard biochemical techniques. Total RNA may be extracted from antibody-producing hybridoma cells and converted to cDNA by reverse transcriptase (RT) polymerase chain reaction (PCR).
- RT reverse transcriptase
- PCR polymerase chain reaction
- PCR amplification may be carried out on resulting cDNA to amplify variable region genes. Such amplification may comprise the use of primers specific for amplification of heavy and light chain sequences.
- recombinant antibodies may be produced using variable domains obtained from other sources. This includes the use of variable domains selected from one or more antibody fragment library, such as an scFv library used in antigen panning. Resulting PCR products may then be subcloned into plasmids for sequence analysis. Once sequenced, antibody coding sequences may be placed into expression vectors. For humanization, coding sequences for human heavy and light chain constant domains may be used to substitute for homologous murine sequences. The resulting constructs may then be transfected into mammalian cells for large scale translation.
- recombinant antibodies of the invention may be anti-Tn antibodies. Such antibodies may bind to targets comprising Tn.
- Anti-Tn antibodies may be specific for Tn or may bind other modified forms of Tn, such as Tn linked to other moieties, including, but not limited to additional
- anti-Tn antibodies may be anti-sialyl-Tn antibodies. Such antibodies may bind to targets comprising sialylated Tn comprising Neu5Ac and/or targets comprising sialylated Tn comprising Neu5Gc. Some anti-Tn antibodies may bind specifically to clusters of Tn antigen.
- Anti-STn antibodies may be anti-sialyl-Tn antibodies. Such antibodies may bind to targets comprising sialylated Tn comprising Neu5Ac and/or targets comprising sialylated Tn comprising Neu5Gc. Some anti-Tn antibodies may bind specifically to clusters of Tn antigen.
- Anti-STn antibodies may be anti-sialyl-Tn antibodies.
- antibodies of the invention may specifically bind to antigens comprising STn.
- Anti-STn antibodies of the invention may be categorized by their binding to specific portions of STn antigens and/or by their specificity for AcSTn versus GcSTn.
- anti-STn antibodies of the invention are Group 1 antibodies.
- Group 1 antibodies according to the invention are antibodies capable of binding AcSTn and GcSTn. Such antibodies may also be referred to herein as pan-STn antibodies due to their ability to associate with a wider range of STn structures.
- Group 1 antibodies may associate with the portion of STn indicated by the large oval in Fig. 1 A.
- anti-STn antibodies of the invention are Group 2 antibodies.
- “Group 2" antibodies are antibodies capable of binding STn as well as some related structures that include an O-linkage to serine or threonine.
- Group 2 antibodies may associate with glycans comprising a sialylated galactose residue.
- Group 2 antibodies may associate with the portion of STn indicated by the large oval in Fig. IB.
- Some Group 2 antibodies preferably bind to structures with AcSTn over structures with GcSTn.
- Further anti-STn antibodies may be Group 3 antibodies.
- “Group 3" antibodies are antibodies capable of binding STn, but may also bind a broader set of related structures.
- Group 3 antibodies do not require that such structures have an O-linkage to serine or threonine.
- Group 3 antibodies may associate with the portion of STn indicated by the large oval in Fig. 1C.
- some anti-STn antibodies of the invention may be Group 4 antibodies.
- Group 4" antibodies are capable of binding to both AcSTn and GcSTn as well as the un-sialylated Tn antigen, and therefore have broader specificity.
- Group 4 antibodies may associate with the portion of STn indicated by the large oval in Fig. ID.
- anti-STn antibodies of the invention may bind specifically to clusters of STn on a particular antigen or cell surface. Some such antibodies may recognize epitopes formed by the clustering of STn, including epitopes that include areas of contact between neighboring STn structures. Such epitopes may be formed by the clustering of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more STn structures.
- Antibody components may bind specifically to clusters of STn on a particular antigen or cell surface. Some such antibodies may recognize epitopes formed by the clustering of STn, including epitopes that include areas of contact between neighboring STn structures. Such epitopes may be formed by the clustering of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more STn structures.
- antibodies or antigen binding fragments thereof of the invention may comprise variable domain and/or CDR amino acid sequences provided herein. Some antibodies or antigen binding fragments may comprise different combinations of such sequences. In some cases, antibodies or antigen binding fragments of the invention may comprise one or more of the variable domain sequences listed in Table 2. Residues indicated with an "X" may be absent or selected from any amino acid residues. Light chain variable domains presented in the Table may be expressed with or without a C-terminal arginine residue. This residue typically links light chain variable domains with light chain constant domains and may be expressed as part of the light chain constant domain instead of the light chain variable domain.
- antibodies or antigen binding fragments thereof may comprise an amino acid sequence with from about 50% to about 99.9% sequence identity (e.g. from about 50%> to about 60%>, from about 55% to about 65%, from about 60%> to about 70%), from about 65%> to about 75%, from about 70% to about 80%, from about 75% to about 85%, from about 80% to about 90%, from about 85% to about 95%, from about 90% to about 99.9%, from about 95% to about 99.9%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%, about 99.6%, about 99.7% or about 99.8%) with one or more of the variable domain sequences listed in Table 2 or a fragment thereof (e.g., an N-terminal fragment, C-terminal fragment, or internal fragment).
- sequence identity e.g. from about 50%> to about 60%>, from about 55% to about 65%, from about 60%> to about 70%
- 80% from about 75% to about 85%, from about
- antibodies of the invention may be developed using one or more CDRs derived from any of the variable domain sequences presented in the previous Table.
- CDR sequences are determined from a variable domain sequence through the use of one or more numbering schemes including, but not limited to, those taught by Kabat [Wu, T.T. et al, 1970, JEM, 132(2):211-50 and Johnson, G. et al, 2000, Nucleic Acids Res. 28(1): 214-8, the contents of each of which are herein incorporated by reference in their entirety], Chothia [Chothia and Lesk, J. Mol. Biol.
- antibodies or antigen binding fragments thereof of the invention may comprise one or more of the CDR amino acid sequences listed in Table 3. Residues indicated with an "X" may be absent or selected from any amino acid residues. In some cases, antibodies or antigen binding fragments thereof may comprise an amino acid sequence with from about 50% to about 99.9% sequence identity (e.g.
- antibodies or antigen binding fragments thereof of the invention may comprise an amino acid sequence comprising one or more fragments of any of the sequences listed in Table 3.
- Consensus refers to an antibody sequence derived from alignment of multiple sequences wherein the most conserved residues were used to form the consensus sequence.
- B72.3 Thermo Fisher Scientific, Waltham, MA
- CC49 see Muraro, R. et al., 1988. Cancer Res. 48: 4588-96 are commercially available antibodies.
- antibodies or antigen binding fragments of the invention may be encoded by a nucleotide sequence comprising one or more of the variable domain sequences listed in Table 4. Residues labeled "N" may be absent or selected from nucleotides A, C, G or T. In some cases, antibodies or antigen binding fragments thereof may be encoded by a nucleotide sequence comprising a sequence with from about 50% to about 99.9% sequence identity (e.g.
- antibodies or antigen binding fragments thereof of the invention may be encoded by a nucleotide sequence comprising one or more fragments of any of the sequences listed in Table 4.
- D4-1B4 Light CAAATTGTTCTCACCCAGTCTCCAGCAATCATGT 188 chain CTGCATCTCCAGGGGAGAAGGTCACCATGACCT
- G9-1A8 Light CAAATTGTTCTCACCCAGTCTCCAGCAATCATGT 186 chain CTGCATCTCCAGGGGAGAAGGTCACCATGACCT
- F4-1E2 Heavy CAGGTTCAGCTGCAGCAGTCTGACGCTGAGTTG 200 chain GTGAAACCTGGGGCTTCAGTGAAGATATCCTGC
- G2-1B3 Light GACATCCAGATGACTCAGTCTCCAGCCTCCCTAT 207 chain CTGTTTCTGTGGGAGAAACTGTCACCATCACATG
- A6-2A2 Light AACATTGTAATGACCCAATCTCCCAAATCCATGT 209 chain CCATGTCAGTAGGAGAGAGGGTCACCTTGACCT
- 1F6-1B7 Light GACATTGTGATGACACAGTCTCCATCCTCCCTGA 214 (also chain CTGTGACAGCAGGAGAGAGGGTCACTATGAGCT sequence GCAAGTCCAGTCAGAGTCTGTTAAACAGTGGAA of 1F6- ATCAAAAGAGCTACTTGACCTGGTACCAGCAGA 1C10) AACCAGGGCAGCCTCCTAAACTGTTGATCTCCT
- E5-1A8 Light TTTTTATACGCCACTTTCTAATACGCCTCACTAT 220 chain AGGGCAAGCAGTGGTATCAACGCAGATTACAAA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- AIDS & HIV (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Pulmonology (AREA)
Priority Applications (18)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/526,593 US20170306046A1 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| ES15859152T ES2941897T3 (es) | 2014-11-12 | 2015-11-12 | Compuestos que interaccionan con glicanos y procedimientos de uso |
| DK15859152.9T DK3218005T5 (da) | 2014-11-12 | 2015-11-12 | Glycan-interagerende forbindelser og anvendelsesfremgangsmåder |
| JP2017526592A JP6951973B2 (ja) | 2014-11-12 | 2015-11-12 | グリカン相互作用化合物及び使用方法 |
| MX2017006167A MX2017006167A (es) | 2014-11-12 | 2015-11-12 | Compuestos que interactúan con glicanos y métodos de uso. |
| SI201531933T SI3218005T1 (sl) | 2014-11-12 | 2015-11-12 | Z glikanom delujoče spojine, in postopki uporabe |
| CA2967595A CA2967595A1 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| FIEP15859152.9T FI3218005T3 (fi) | 2014-11-12 | 2015-11-12 | Glykaanin kanssa vuorovaikutteisia yhdisteitä ja käyttömenetelmiä |
| IL313511A IL313511A (en) | 2014-11-12 | 2015-11-12 | Compounds acting on glycans and methods of using them |
| IL278574A IL278574B2 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| EP22201604.0A EP4183806A3 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| EP15859152.9A EP3218005B1 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| PL15859152.9T PL3218005T3 (pl) | 2014-11-12 | 2015-11-12 | Związki oddziałujące z glikanami i sposoby ich zastosowania |
| US14/987,432 US9879087B2 (en) | 2014-11-12 | 2016-01-04 | Glycan-interacting compounds and methods of use |
| IL251988A IL251988A0 (en) | 2014-11-12 | 2017-04-27 | Glycan-interacting compounds and methods of use |
| US16/776,188 USRE49435E1 (en) | 2014-11-12 | 2020-01-29 | Glycan-interacting compounds and methods of use |
| US16/791,174 US20210011021A1 (en) | 2014-11-12 | 2020-02-14 | Glycan-Interacting Compounds and Methods of Use |
| US17/331,290 US20220057402A1 (en) | 2014-11-12 | 2021-05-26 | Glycan-Interacting Compounds and Methods of Use |
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462078610P | 2014-11-12 | 2014-11-12 | |
| US62/078,610 | 2014-11-12 | ||
| US201562102527P | 2015-01-12 | 2015-01-12 | |
| US62/102,527 | 2015-01-12 | ||
| US201562145214P | 2015-04-09 | 2015-04-09 | |
| US62/145,214 | 2015-04-09 | ||
| US201562173560P | 2015-06-10 | 2015-06-10 | |
| US62/173,560 | 2015-06-10 | ||
| US201562187587P | 2015-07-01 | 2015-07-01 | |
| US62/187,587 | 2015-07-01 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/526,593 A-371-Of-International US20170306046A1 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
| US14/987,432 Continuation-In-Part US9879087B2 (en) | 2014-11-12 | 2016-01-04 | Glycan-interacting compounds and methods of use |
| US16/791,174 Continuation US20210011021A1 (en) | 2014-11-12 | 2020-02-14 | Glycan-Interacting Compounds and Methods of Use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016077526A1 true WO2016077526A1 (en) | 2016-05-19 |
Family
ID=55955018
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/060287 Ceased WO2016077526A1 (en) | 2014-11-12 | 2015-11-12 | Glycan-interacting compounds and methods of use |
Country Status (15)
| Country | Link |
|---|---|
| US (4) | US20170306046A1 (https=) |
| EP (2) | EP4183806A3 (https=) |
| JP (3) | JP6951973B2 (https=) |
| CA (1) | CA2967595A1 (https=) |
| CY (1) | CY1125977T1 (https=) |
| DK (1) | DK3218005T5 (https=) |
| ES (1) | ES2941897T3 (https=) |
| FI (1) | FI3218005T3 (https=) |
| HU (1) | HUE061672T2 (https=) |
| IL (3) | IL313511A (https=) |
| MX (2) | MX2017006167A (https=) |
| PL (1) | PL3218005T3 (https=) |
| PT (1) | PT3218005T (https=) |
| SI (1) | SI3218005T1 (https=) |
| WO (1) | WO2016077526A1 (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016201240A1 (en) * | 2015-06-12 | 2016-12-15 | Siamab Therapeutics, Inc. | Compositions and methods for targeting cancer stem cells |
| WO2018144769A1 (en) * | 2017-02-02 | 2018-08-09 | The Scripps Research Institute | Engineered cells and methods of use |
| WO2018160909A1 (en) * | 2017-03-03 | 2018-09-07 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| EP3288580A4 (en) * | 2015-05-01 | 2018-12-26 | The Regents of The University of California | Glycan-dependent immunotherapeutic molecules |
| EP3373969A4 (en) * | 2015-11-12 | 2019-08-14 | Siamab Therapeutics, Inc. | GLYCANINTERAGING COMPOUNDS AND METHOD OF USE |
| EP3541847A4 (en) * | 2016-11-17 | 2020-07-08 | Seattle Genetics, Inc. | COMPOUNDS INTERACTING WITH GLYCANE AND METHODS OF USE |
| WO2021105989A1 (en) * | 2019-11-26 | 2021-06-03 | Ramot At Tel-Aviv University Ltd. | Chimeric antigen receptor to carbohydrate antigens |
| WO2022113066A1 (en) * | 2020-11-24 | 2022-06-02 | Ramot At Tel-Aviv University Ltd. | Humanized antibodies and fragments thereof binding to carbohydrate antigens and uses thereof |
| WO2022224242A1 (en) * | 2021-04-20 | 2022-10-27 | Ramot At Tel-Aviv University Ltd. | Humanized anti-sialyl-tn glycan antibodies and uses thereof |
| WO2022224241A1 (en) * | 2021-04-20 | 2022-10-27 | Ramot At Tel-Aviv University Ltd. | Chimeric antigen receptors to sialyl-tn glycan antigen |
| USRE49435E1 (en) | 2014-11-12 | 2023-02-28 | Seagen Inc. | Glycan-interacting compounds and methods of use |
| US11692039B2 (en) | 2020-12-31 | 2023-07-04 | Innate Pharma | Multifunctional natural killer (NK) cell engagers binding to NKp46 and CD123 |
| WO2024078288A1 (zh) * | 2022-10-11 | 2024-04-18 | 上海交通大学医学院附属瑞金医院 | 一种抗rcp抗体及其制备方法 |
| US12195555B2 (en) | 2022-05-27 | 2025-01-14 | Sanofi | Natural killer (NK) cell engagers binding to NKp46 and BCMA variants with Fc-engineering |
| US12552874B2 (en) | 2019-11-26 | 2026-02-17 | Ramot At Tel-Aviv University Ltd. | Antibodies to carbohydrate antigens |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3048312A1 (en) * | 2017-01-01 | 2018-07-05 | Chi-Yu Gregory Lee | Rp215 chimeric antigen receptor construct and methods of making and using same |
| US12406510B2 (en) * | 2021-03-26 | 2025-09-02 | Howard University | Method for the detection, segmentation and morphological mapping on neural cell images of the whole brain |
| EP4326766A1 (en) * | 2021-04-23 | 2024-02-28 | Amgen Inc. | Anti-tslp antibody compositions and uses thereof |
| US20250186494A1 (en) * | 2022-02-10 | 2025-06-12 | The Scripps Research Institute | Car-t therapies targeted via covalently bonded adapters |
| WO2024193794A1 (en) * | 2023-03-17 | 2024-09-26 | Danmarks Tekniske Universitet | Combotope antibody libraries |
| CN120882741A (zh) | 2023-03-17 | 2025-10-31 | 丹麦科技大学 | 组合表位抗体库 |
| WO2025006452A2 (en) * | 2023-06-26 | 2025-01-02 | Sri International | NEU5GC-LEWISa-TARGETING MOLECULES AND USES THEREOF IN CANCER |
| WO2026032010A1 (en) * | 2024-08-05 | 2026-02-12 | The Hong Kong University Of Science And Technology | Glycan-targeting protein aggregation therapy |
Citations (147)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4301144A (en) | 1979-07-11 | 1981-11-17 | Ajinomoto Company, Incorporated | Blood substitute containing modified hemoglobin |
| US4444887A (en) | 1979-12-10 | 1984-04-24 | Sloan-Kettering Institute | Process for making human antibody producing B-lymphocytes |
| US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
| US4485045A (en) | 1981-07-06 | 1984-11-27 | Research Corporation | Synthetic phosphatidyl cholines useful in forming liposomes |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US4544545A (en) | 1983-06-20 | 1985-10-01 | Trustees University Of Massachusetts | Liposomes containing modified cholesterol for organ targeting |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4670417A (en) | 1985-06-19 | 1987-06-02 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| EP0239400A2 (en) | 1986-03-27 | 1987-09-30 | Medical Research Council | Recombinant antibodies and methods for their production |
| US4714681A (en) | 1981-07-01 | 1987-12-22 | The Board Of Reagents, The University Of Texas System Cancer Center | Quadroma cells and trioma cells and methods for the production of same |
| US4716111A (en) | 1982-08-11 | 1987-12-29 | Trustees Of Boston University | Process for producing human antibodies |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US4925648A (en) | 1988-07-29 | 1990-05-15 | Immunomedics, Inc. | Detection and treatment of infectious and inflammatory lesions |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| WO1991000360A1 (en) | 1989-06-29 | 1991-01-10 | Medarex, Inc. | Bispecific reagents for aids therapy |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| WO1991009967A1 (en) | 1989-12-21 | 1991-07-11 | Celltech Limited | Humanised antibodies |
| WO1991010737A1 (en) | 1990-01-11 | 1991-07-25 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| WO1991010741A1 (en) | 1990-01-12 | 1991-07-25 | Cell Genesys, Inc. | Generation of xenogeneic antibodies |
| WO1991019739A1 (en) * | 1990-06-11 | 1991-12-26 | Celltech Limited | Multivalent antigen-binding proteins |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1992005793A1 (en) | 1990-10-05 | 1992-04-16 | Medarex, Inc. | Targeted immunostimulation with bispecific reagents |
| WO1992008802A1 (en) | 1990-10-29 | 1992-05-29 | Cetus Oncology Corporation | Bispecific antibodies, method of production, and uses thereof |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| EP0519596A1 (en) | 1991-05-17 | 1992-12-23 | Merck & Co. Inc. | A method for reducing the immunogenicity of antibody variable domains |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1993011161A1 (en) | 1991-11-25 | 1993-06-10 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| WO1993017715A1 (en) | 1992-03-05 | 1993-09-16 | Board Of Regents, The University Of Texas System | Diagnostic and/or therapeutic agents, targeted to neovascular endothelial cells |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| EP0592106A1 (en) | 1992-09-09 | 1994-04-13 | Immunogen Inc | Resurfacing of rodent antibodies |
| US5413923A (en) | 1989-07-25 | 1995-05-09 | Cell Genesys, Inc. | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| WO1995015982A2 (en) | 1993-12-08 | 1995-06-15 | Genzyme Corporation | Process for generating specific antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1995020401A1 (en) | 1994-01-31 | 1995-08-03 | Trustees Of Boston University | Polyclonal antibody libraries |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5516637A (en) | 1994-06-10 | 1996-05-14 | Dade International Inc. | Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO1996034096A1 (en) | 1995-04-28 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO1996033735A1 (en) | 1995-04-27 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US5573920A (en) | 1991-04-26 | 1996-11-12 | Surface Active Limited | Antibodies, and methods for their use |
| US5601819A (en) | 1988-08-11 | 1997-02-11 | The General Hospital Corporation | Bispecific antibodies for selective immune regulation and for selective immune cell binding |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5698426A (en) | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| US5710038A (en) | 1994-11-25 | 1998-01-20 | Universite De Montreal | Primary cultures of normal and tumoral human ovarian epithelium |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| WO1998016654A1 (en) | 1996-10-11 | 1998-04-23 | Japan Tobacco, Inc. | Production of a multimeric protein by cell fusion method |
| US5750753A (en) | 1996-01-24 | 1998-05-12 | Chisso Corporation | Method for manufacturing acryloxypropysilane |
| WO1998024893A2 (en) | 1996-12-03 | 1998-06-11 | Abgenix, Inc. | TRANSGENIC MAMMALS HAVING HUMAN IG LOCI INCLUDING PLURAL VH AND Vλ REGIONS AND ANTIBODIES PRODUCED THEREFROM |
| US5780225A (en) | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| US5786464A (en) | 1994-09-19 | 1998-07-28 | The General Hospital Corporation | Overexpression of mammalian and viral proteins |
| US5807715A (en) | 1984-08-27 | 1998-09-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| WO1998046645A2 (en) | 1997-04-14 | 1998-10-22 | Micromet Gesellschaft Für Biomedizinische Forschung Mbh | Method for the production of antihuman antigen receptors and uses thereof |
| WO1998050433A2 (en) | 1997-05-05 | 1998-11-12 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| WO1999014353A2 (en) | 1997-09-19 | 1999-03-25 | Dana-Farber Cancer Institute, Inc. | Intrabody-mediated control of immune reactions |
| US5919652A (en) | 1994-11-09 | 1999-07-06 | The Regents Of The University Of California | Nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof |
| US5932448A (en) | 1991-11-29 | 1999-08-03 | Protein Design Labs., Inc. | Bispecific antibody heterodimers |
| US5951983A (en) | 1993-03-05 | 1999-09-14 | Universite Catholique De Louvain | Methods of inhibiting T cell mediated immune responses with humanized LO-CD2A-specific antibodies |
| WO2000023573A2 (en) | 1998-10-20 | 2000-04-27 | City Of Hope | Cd20-specific redirected t cells and their use in cellular immunotherapy of cd20+ malignancies |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6114148A (en) | 1996-09-20 | 2000-09-05 | The General Hospital Corporation | High level expression of proteins |
| WO2000054057A1 (en) | 1999-03-10 | 2000-09-14 | Medical Research Council | Selection of intracellular immunoglobulins |
| WO2001040276A2 (en) | 1999-12-06 | 2001-06-07 | Agensys, Inc | Serpentine transmembrane antigens expressed in human prostate cancers and uses thereof |
| WO2001043778A1 (en) | 1999-12-17 | 2001-06-21 | Gene Therapy Systems, Inc. | Use of cationic lipids for intracellular protein delivery |
| US6348584B1 (en) | 1996-10-17 | 2002-02-19 | John Edward Hodgson | Fibronectin binding protein compounds |
| WO2002035237A2 (en) | 2000-10-24 | 2002-05-02 | S.I.S.S.A. Scuola Internazionale Superiore Di Studi Avanzati | Method for in vivo identification of intracellular epitopes |
| WO2002067849A2 (en) | 2001-02-26 | 2002-09-06 | Sabina Glozman | Systems devices and methods for intrabody targeted delivery and reloading of therapeutic agents |
| WO2002077029A2 (en) | 2000-11-07 | 2002-10-03 | City Of Hope | Cd19-specific redirected immune cells |
| WO2002086096A2 (en) | 2001-01-23 | 2002-10-31 | University Of Rochester Medical Center | Methods of producing or identifying intrabodies in eukaryotic cells |
| WO2002086505A2 (en) | 2001-03-31 | 2002-10-31 | Univ Manchester | Intracellular analysis |
| WO2002088334A1 (en) | 2001-04-30 | 2002-11-07 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| WO2003008451A2 (en) | 2001-07-19 | 2003-01-30 | Universität Zürich | Modification of human variable domains |
| WO2003014960A2 (en) | 2001-08-03 | 2003-02-20 | Medical Research Council | Method of identifying a consensus sequence for intracellular antibodies |
| WO2003062415A2 (en) | 2002-01-24 | 2003-07-31 | Erasmus University | Transgenic animal comprising intracellular immunoglobins for xenotransplantation |
| WO2003077945A1 (en) | 2002-03-14 | 2003-09-25 | Medical Research Council | Intracellular antibodies |
| WO2003086276A2 (en) | 2002-04-05 | 2003-10-23 | Selective Genetics, Inc. | Compositions and methods for portal specific gene delivery and treatment of infection |
| WO2003095641A1 (en) | 2002-05-06 | 2003-11-20 | Gene Therapy Systems, Inc. | Intracellular protein delivery compositions and methods of use |
| WO2003097697A2 (en) | 2002-05-22 | 2003-11-27 | Esbatech Ag | Immunoglobulin frameworks which demonstrate enhanced stability in the intracellular environment and methods of identifying same |
| US6673901B2 (en) | 1997-06-12 | 2004-01-06 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| WO2004046187A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Antibodies for in vitro use |
| WO2004046189A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Method for generating immunoglobulin genes |
| WO2004046192A2 (en) | 2002-11-21 | 2004-06-03 | Lay Line Genomics S.P.A. | Method for isolating intracellular antibodies able to neutralize protein interactions |
| WO2004046186A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Intrabodies against the oncogenic form of ras |
| WO2004046188A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Anti-activated ras antibodies |
| WO2004046185A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Intracellular antibodies |
| WO2004099775A1 (en) | 2003-05-07 | 2004-11-18 | Institut Curie | Means for detecting protein conformation and applications thereof |
| WO2005063817A2 (en) | 2003-12-22 | 2005-07-14 | Amgen Inc. | Methods for identifying functional antibodies |
| WO2007059298A2 (en) | 2005-11-16 | 2007-05-24 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| WO2008070363A2 (en) | 2006-10-31 | 2008-06-12 | Domantis Limited | Intrabodies |
| WO2009018438A1 (en) | 2007-07-31 | 2009-02-05 | Cornell Research Foundation, Inc. | Protein discovery using intracellular ribosome display |
| US20090041836A1 (en) | 2006-01-03 | 2009-02-12 | University Of Georgia Research Foundation, Inc. | Glycolipopeptide and uses thereof |
| WO2009091826A2 (en) | 2008-01-14 | 2009-07-23 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to a human cd19-specific chimeric antigen receptor (h-car) |
| US20100009424A1 (en) | 2008-07-14 | 2010-01-14 | Natasha Forde | Sonoporation systems and methods |
| WO2010004432A1 (en) | 2008-07-10 | 2010-01-14 | Institut Pasteur | Variable domains of camelid heavy-chain antibodies directed against glial fibrillary acidic proteins |
| WO2010030666A2 (en) | 2008-09-09 | 2010-03-18 | The Regents Of The University Of California | Elimination of a contaminating non-human sialic acid by metabolic competition |
| US7682794B2 (en) | 2003-07-15 | 2010-03-23 | The Regents Of The University Of California | Methods for detecting and analyzing N-glycolylneuraminic acid (Neu5Gc) in biological materials |
| US20100104572A1 (en) | 2006-11-02 | 2010-04-29 | Sylvie Luria | Methods for screening for therapeutic molecules and use of the molecules therefrom |
| WO2010065818A1 (en) | 2008-12-05 | 2010-06-10 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| US20100178292A1 (en) | 2009-01-12 | 2010-07-15 | The Board Of Trustees Of The Leland Stanford Junior University | Cryptic glycan markers and applications thereof |
| US20100196983A1 (en) | 2009-02-05 | 2010-08-05 | Ut-Battelle, Llc | Transformation of gram positive bacteria by sonoporation |
| WO2011003896A1 (en) | 2009-07-06 | 2011-01-13 | Ludwig-Maximilians-Universität | Detection and visualization of the cell cycle in living cells |
| WO2011041093A1 (en) | 2009-10-01 | 2011-04-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer |
| US20110135570A1 (en) | 2006-03-23 | 2011-06-09 | Mary Jo Janatpour | Anti-Tumor Cell Antigen Antibody Therapeutics |
| WO2011088385A2 (en) | 2010-01-15 | 2011-07-21 | The Regents Of The University Of California | Compositions and methods for detecting cancer |
| WO2012007167A1 (en) | 2010-07-14 | 2012-01-19 | F-Star Biotechnologische Forschungs-Und Entwicklungsges. M.B.H | Multispecific modular antibody |
| US20120027813A1 (en) | 2008-02-22 | 2012-02-02 | Novartis Vaccines And Diagnostics Srl | Adjuvanted influenza vaccines for pediatric use |
| US20120039984A1 (en) | 2008-07-03 | 2012-02-16 | University Of Georgia Research Foundation, Inc. | Glycopeptide and uses thereof |
| EP2422811A2 (en) | 2004-10-27 | 2012-02-29 | MedImmune, LLC | Modulation of antibody specificity by tailoring the affinity to cognate antigens |
| WO2012048332A2 (en) | 2010-10-08 | 2012-04-12 | John Williams | A monoclonal antibody framework binding interface for meditopes, meditope delivery systems and methods for their use |
| WO2012079000A1 (en) | 2010-12-09 | 2012-06-14 | The Trustees Of The University Of Pennsylvania | Use of chimeric antigen receptor-modified t cells to treat cancer |
| WO2013023251A1 (en) | 2011-08-18 | 2013-02-21 | Affinity Biosciences Pty Ltd | Soluble polypeptides |
| WO2013033420A1 (en) | 2011-08-30 | 2013-03-07 | Whitehead Institute For Biomedical Research | Methods of downregulating translocated oncogene expression using bromodomain inhibitors |
| US8399625B1 (en) | 2009-06-25 | 2013-03-19 | ESBATech, an Alcon Biomedical Research Unit, LLC | Acceptor framework for CDR grafting |
| WO2013040557A2 (en) | 2011-09-16 | 2013-03-21 | The Trustees Of The University Of Pennsylvania | Rna engineered t cells for the treatment of cancer |
| WO2013055404A1 (en) | 2011-10-10 | 2013-04-18 | City Of Hope | Meditopes and meditope-binding antibodies and uses thereof |
| WO2013074916A1 (en) | 2011-11-18 | 2013-05-23 | Board Of Regents, The University Of Texas System | Car+ t cells genetically modified to eliminate expression of t- cell receptor and/or hla |
| WO2013092001A1 (en) | 2011-12-19 | 2013-06-27 | Synimmune Gmbh | Bispecific antibody molecule |
| US8506966B2 (en) | 2008-02-22 | 2013-08-13 | Novartis Ag | Adjuvanted influenza vaccines for pediatric use |
| WO2013126712A1 (en) | 2012-02-22 | 2013-08-29 | The Trustees Of The University Of Pennsylvania | Compositions and methods for generating a persisting population of t cells useful for the treatment of cancer |
| US20130236486A1 (en) | 2010-06-11 | 2013-09-12 | Mayo Foundation For Medical Education And Research | Immunogenic vaccine |
| WO2013138795A1 (en) | 2012-03-15 | 2013-09-19 | Permeon Biologics, Inc. | Cell penetrating compositions for delivery of intracellular antibodies and antibody-like moieties and methods of use |
| WO2014028560A2 (en) | 2012-08-14 | 2014-02-20 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| WO2014030780A1 (en) | 2012-08-22 | 2014-02-27 | Mogam Biotechnology Research Institute | Screening and engineering method of super-stable immunoglobulin variable domains and their uses |
| EP2703485A1 (en) | 2011-03-30 | 2014-03-05 | National University Corporation University Of Toyama | Method for selecting plasma cells and plasmablasts, method for producing target antigen-specific antibody, and new monoclonal antibody |
| WO2014039513A2 (en) | 2012-09-04 | 2014-03-13 | The Trustees Of The University Of Pennsylvania | Inhibition of diacylglycerol kinase to augment adoptive t cell transfer |
| WO2014055771A1 (en) | 2012-10-05 | 2014-04-10 | The Trustees Of The University Of Pennsylvania | Human alpha-folate receptor chimeric antigen receptor |
| WO2014074532A2 (en) | 2012-11-06 | 2014-05-15 | Scholar Rock Inc. | Compositions and methods for modulating cell signaling |
| US20140178365A1 (en) | 2012-04-04 | 2014-06-26 | Sialix Inc | Glycan-interacting compounds |
| WO2014106639A1 (en) | 2013-01-03 | 2014-07-10 | Sanofi | Intracellular phenotypic screening |
| WO2014144573A2 (en) | 2013-03-15 | 2014-09-18 | Memorial Sloan-Kettering Cancer Center | Multimerization technologies |
| WO2014144357A1 (en) | 2013-03-15 | 2014-09-18 | Merck Patent Gmbh | Tetravalent bispecific antibodies |
| WO2015054600A2 (en) | 2013-10-10 | 2015-04-16 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
Family Cites Families (100)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5807A (en) | 1848-09-26 | Brake fob cabs | ||
| US715A (en) | 1838-04-28 | Improvement in water-wheels | ||
| US823244A (en) | 1906-01-18 | 1906-06-12 | Emerson Mfg Co | Wheeled plow. |
| US6872868B1 (en) | 1981-06-12 | 2005-03-29 | Ohio University | Transgenic mammals |
| IN164232B (https=) | 1986-04-11 | 1989-02-04 | Hoechst India | |
| US4695198A (en) | 1986-05-23 | 1987-09-22 | Chevron Research Company | Lip-type sealing system for a removable bottom founded structure |
| CA1340456C (en) * | 1986-07-07 | 1999-03-23 | Hubert J.P. Schoemaker | Chimeric rodent/human immunoglobulins specific for tumor-associated antigens |
| US5059680A (en) | 1986-11-24 | 1991-10-22 | Centocor, Inc. | Method of isolating ca 125 antigen |
| CA1340927C (en) | 1987-10-09 | 2000-03-14 | Peter S. Linsley | Method for increasing the sensitivity of assays for target ligand |
| IT1212041B (it) | 1987-11-02 | 1989-11-08 | Fidia Farmaceutici | Gangliosidi esteri interni come agenti terapeutici capaci di eliminare il dolore nelle neuropatie periferiche |
| JPH02486A (ja) | 1987-11-13 | 1990-01-05 | Mect Corp | 遊離n−アセチルノイラミン酸を認識するモノクローナル抗体 |
| US4978745A (en) | 1987-11-23 | 1990-12-18 | Centocor, Inc. | Immunoreactive heterochain antibodies |
| US4975369A (en) | 1988-04-21 | 1990-12-04 | Eli Lilly And Company | Recombinant and chimeric KS1/4 antibodies directed against a human adenocarcinoma antigen |
| US6300129B1 (en) | 1990-08-29 | 2001-10-09 | Genpharm International | Transgenic non-human animals for producing heterologous antibodies |
| US20030108548A1 (en) | 1993-06-01 | 2003-06-12 | Bluestone Jeffrey A. | Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies |
| US5811510A (en) | 1995-04-14 | 1998-09-22 | General Hospital Corporation | Biodegradable polyacetal polymers and methods for their formation and use |
| US5733920A (en) | 1995-10-31 | 1998-03-31 | Mitotix, Inc. | Inhibitors of cyclin dependent kinases |
| US5849733A (en) | 1996-05-10 | 1998-12-15 | Bristol-Myers Squibb Co. | 2-thio or 2-oxo flavopiridol analogs |
| JP2000514919A (ja) | 1996-07-03 | 2000-11-07 | ミレニアム ファーマシューティカルズ,インコーポレイテッド | 少くとも三分枝の連鎖オリゴ糖を持つ癌特異的抗原の検定による癌の検出 |
| US6852533B1 (en) | 1998-01-23 | 2005-02-08 | Cornell Research Foundation, Inc. | Purified populations of stem cells |
| US20030170249A1 (en) | 1999-02-19 | 2003-09-11 | Hakomori Sen-Itiroh | Vaccines directed to cancer-associated carbohydrate antigens |
| US20020012660A1 (en) | 1999-03-04 | 2002-01-31 | Alan Colman | Method of preparing a somatic cells for nuclear transfer |
| WO2000076319A1 (en) | 1999-06-16 | 2000-12-21 | Biocrystal Ltd. | Vaccine formulations and methods for immunizing an individual against shed antigen-specific b cells |
| US7279294B2 (en) | 2000-04-03 | 2007-10-09 | The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services, Nih | Tumor markers in ovarian cancer |
| US7166278B2 (en) | 2001-04-30 | 2007-01-23 | Rbc Biotechnology, Inc. | Modified organs and cells for xenotransplantation |
| KR100486784B1 (ko) | 2001-05-22 | 2005-04-29 | 김하형 | 솔비나무로 부터 추출된 렉틴 단백질, 그의 제조방법 및용도 |
| US20020192231A1 (en) | 2001-05-24 | 2002-12-19 | Immucom Inc. | Method of increasing anti-neuGc antibody levels in blood |
| US6814734B2 (en) | 2001-06-18 | 2004-11-09 | Sdgi Holdings, Inc, | Surgical instrumentation and method for forming a passage in bone having an enlarged cross-sectional portion |
| AU2002336981A1 (en) | 2001-08-17 | 2003-03-03 | Charite | Glycoconjugates of sialic acid derivates, methods for their production and use thereof |
| WO2003040185A2 (de) | 2001-11-09 | 2003-05-15 | Hexal Biotech Forschungsgmbh | Anti-n-glykolyl-neuraminsäure-antikörper und ihre verwendung zur bestimmung von glykoproteinen |
| AU2002364586A1 (en) | 2001-12-21 | 2003-07-30 | Delta Biotechnology Limited | Albumin fusion proteins |
| MXPA04005939A (es) | 2002-01-22 | 2005-01-25 | Warner Lambert Co | 2-(piridin-2-ilamino)-pirido[2,3-d]pirimidin-7-onas. |
| US7119200B2 (en) | 2002-09-04 | 2006-10-10 | Schering Corporation | Pyrazolopyrimidines as cyclin dependent kinase inhibitors |
| AU2004255934B2 (en) | 2003-07-11 | 2010-02-25 | Warner-Lambert Company Llc | Isethionate salt of a selective CDK4 inhibitor |
| ITMI20031909A1 (it) | 2003-10-03 | 2005-04-04 | Keryos Spa | Linee cellulari di mammifero modificate per la produzione di glicoproteine ricombinanti. |
| JP2007527539A (ja) | 2004-03-05 | 2007-09-27 | ザ スクリプス リサーチ インスティテュート | ハイスループットグリカンマイクロアレイ |
| PT1740616E (pt) | 2004-04-30 | 2012-03-23 | Inst Nat Sante Rech Med | Anticorpo anti-rtf |
| KR100620554B1 (ko) | 2004-06-05 | 2006-09-06 | 한국생명공학연구원 | Tag-72에 대한 인간화 항체 |
| EP1771733A2 (en) | 2004-06-24 | 2007-04-11 | The Scripps Research Institute | Arrays with cleavable linkers |
| US7638467B2 (en) | 2004-08-03 | 2009-12-29 | Intevep, S.A. | Reversible gelling system and method using same during well treatments |
| WO2006068758A2 (en) | 2004-11-19 | 2006-06-29 | The Scripps Research Institute | Detection, prevention and treatment of breast cancer |
| US8008443B2 (en) | 2005-04-26 | 2011-08-30 | Medimmune, Llc | Modulation of antibody effector function by hinge domain engineering |
| US20090041783A1 (en) | 2005-04-28 | 2009-02-12 | Mochida Pharmaceutical Co., Ltd. | Anti-platelet membrane glycoprotein vi monoclonal antibody |
| EP1893756B1 (en) | 2005-06-08 | 2015-08-12 | The Regents of The University of California | Elimination of n-glycolylneuraminic acid from mammalian products for human use |
| CA3000520C (en) | 2005-08-24 | 2023-04-04 | Immunogen, Inc. | Process for preparing antibody maytansinoid conjugates |
| NZ616992A (en) | 2005-12-20 | 2015-07-31 | Sbi Biotech Co Ltd | Anti-ilt7 antibody |
| ATE509027T1 (de) | 2006-01-13 | 2011-05-15 | Pasteur Institut | Enzymatische synthese von grossen mengen von mucin glyconjugaten und deren immunogenische anwendungen |
| JPWO2007116779A1 (ja) | 2006-03-31 | 2009-08-20 | 持田製薬株式会社 | 新規血小板活性化マーカー及びその測定方法 |
| US20070265170A1 (en) | 2006-05-15 | 2007-11-15 | Ola Blixt | Detection, prevention and treatment of ovarian cancer |
| GB0613209D0 (en) | 2006-07-03 | 2006-08-09 | Ucb Sa | Methods |
| AU2007304590A1 (en) | 2006-10-04 | 2008-04-10 | Cancer Research Technology Limited | Generation of a cancer-specific immune response toward MUC1 and cancer specific MUC1 antibodies |
| EP2014302A1 (en) | 2007-07-12 | 2009-01-14 | Institut Curie | An antibody specific for the Tn antigen for the treatment of cancer |
| WO2009035494A2 (en) | 2007-07-30 | 2009-03-19 | The Scripps Research Institute | Methods for producing anti-glycan antibodies, vaccines and methods for treating cancer or infectious disease |
| FI20070853A0 (fi) | 2007-11-09 | 2007-11-09 | Glykos Finland Oy | Glykaania sitovat monoklonaaliset vasta-aineet |
| UA104132C2 (en) | 2007-11-13 | 2014-01-10 | Тева Биофармасьютикалз Юесей, Инк. | Humanized antibodies against tl1a |
| US8298773B2 (en) | 2008-05-02 | 2012-10-30 | Marko Vuskovic | Methods, assays and kits for cancer diagnosis and screening utilizing glycan-binding and glycan epitopes |
| US9226934B2 (en) | 2008-06-02 | 2016-01-05 | The University Of Tokyo | Anti-cancer drug |
| FI20095418A0 (fi) | 2009-04-16 | 2009-04-16 | Suomen Punainen Risti Veripalv | Kryptinen subpopulaatio |
| ES2522346T3 (es) | 2008-08-22 | 2014-11-14 | Novartis Ag | Compuestos de pirrolopirimidina como inhibidores de CDK |
| US20120045816A1 (en) | 2008-09-09 | 2012-02-23 | Sialix, Inc. | Novel Glycosylated Polypeptides |
| PA8852901A1 (es) | 2008-12-22 | 2010-07-27 | Lilly Co Eli | Inhibidores de proteina cinasa |
| AU2010254013A1 (en) | 2009-05-28 | 2011-11-24 | Mersana Therapeutics, Inc. | Polyal drug conjugates comprising variable rate-releasing linkers |
| US9290577B2 (en) | 2009-07-03 | 2016-03-22 | Avipep Pty Limited | Immuno-conjugates and methods for producing them |
| WO2011016238A1 (en) | 2009-08-06 | 2011-02-10 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| EP2287202A1 (en) * | 2009-08-07 | 2011-02-23 | Dublin City University | Anti-sialic acid antibody molecules |
| CN102770456B (zh) | 2009-12-04 | 2018-04-06 | 弗·哈夫曼-拉罗切有限公司 | 多特异性抗体、抗体类似物、组合物和方法 |
| EP2347769A1 (en) | 2010-01-20 | 2011-07-27 | Glycotope GmbH | Cancer stem cell markers and uses thereof |
| WO2011135869A1 (ja) | 2010-04-28 | 2011-11-03 | 塩野義製薬株式会社 | 新規なmuc1抗体 |
| EP2566514A4 (en) | 2010-05-03 | 2013-11-27 | Abbvie Inc | METHODS OF INHIBITING FIBROSIS WITH ANTI-PAI-1 ANTIBODIES |
| KR20140003380A (ko) | 2010-07-13 | 2014-01-09 | 울트라제닉스 파마수티컬 인코포레이티드 | 시알산 결함 치료용 방법들 및 제형들 |
| US20120115878A1 (en) | 2010-11-10 | 2012-05-10 | John Vincent Calienni | Salt(s) of 7-cyclopentyl-2-(5-piperazin-1-yl-pyridin-2-ylamino)-7h-pyrrolo[2,3-d]pyrimidine-6-carboxylic acid dimethylamide and processes of making thereof |
| US20130243744A1 (en) | 2011-01-06 | 2013-09-19 | Michael J. Betenbaugh | Method of production of recombinant glycoproteins with increased circulatory half-life in mammalian cells |
| EP3202425A1 (en) | 2011-02-01 | 2017-08-09 | HIBM Research Group, Inc. | Methods and compositions for increasing sialic acid production and treating sialic related disease conditions |
| US20140005069A1 (en) | 2011-03-01 | 2014-01-02 | Glycosensors And Diagnostics, Llc. | Glycoprofiling with multiplexed suspension arrays |
| WO2012171020A1 (en) | 2011-06-10 | 2012-12-13 | Mersana Therapeutics, Inc. | Protein-polymer-drug conjugates |
| AU2013203422A1 (en) | 2012-01-06 | 2013-07-18 | Bioalliance C.V. | Anti-transferrin receptor antibodies and methods using same |
| PT2850106T (pt) | 2012-05-18 | 2022-07-18 | Aptevo Res & Development Llc | Imunofusão biespecífica (bif) de scfv de ligação a cd123 e cd3 |
| WO2014093379A1 (en) | 2012-12-10 | 2014-06-19 | Mersana Therapeutics, Inc. | Auristatin compounds and conjugates thereof |
| CA2896058A1 (en) | 2012-12-24 | 2014-07-03 | Abbvie Inc. | Prolactin receptor binding proteins and uses thereof |
| WO2014160360A1 (en) | 2013-03-14 | 2014-10-02 | Mersana Therapeutics Inc. | Tubulysin compounds and conjugates thereof |
| CA2919168A1 (en) | 2013-07-23 | 2015-01-29 | Ohio State Innovation Foundation | Methods and compositions related to single chain antibody fragments that bind to tumor-associated glycoprotein 72 (tag-72) |
| WO2015048748A1 (en) | 2013-09-30 | 2015-04-02 | Board Of Regents, The University Of Texas System | Myeloid-derived suppressor cell-specific peptides for diagnostic and therapeutic use |
| KR20220013460A (ko) | 2014-03-04 | 2022-02-04 | 시그마-알드리치 컴퍼니., 엘엘씨 | 바이러스 내성 세포 및 이의 용도 |
| GB201406767D0 (en) | 2014-04-15 | 2014-05-28 | Cancer Rec Tech Ltd | Humanized anti-Tn-MUC1 antibodies anf their conjugates |
| SI3148579T1 (sl) | 2014-05-28 | 2021-07-30 | Agenus Inc. | Proti GITR antitelesa in postopki z njihovo uporabo |
| TWI695011B (zh) | 2014-06-18 | 2020-06-01 | 美商梅爾莎納醫療公司 | 抗her2表位之單株抗體及其使用之方法 |
| JP2017526676A (ja) | 2014-08-27 | 2017-09-14 | オンコメッド ファーマシューティカルズ インコーポレイテッド | がんの処置のための併用療法 |
| WO2016057916A1 (en) | 2014-10-10 | 2016-04-14 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| US20170305950A1 (en) | 2014-10-10 | 2017-10-26 | Siamab Therapeutics, Inc. | Glycan analysis and profiling |
| FI3218005T3 (fi) | 2014-11-12 | 2023-03-31 | Seagen Inc | Glykaanin kanssa vuorovaikutteisia yhdisteitä ja käyttömenetelmiä |
| US9879087B2 (en) * | 2014-11-12 | 2018-01-30 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| US20180334490A1 (en) | 2014-12-03 | 2018-11-22 | Qilong H. Wu | Methods for b cell preconditioning in car therapy |
| SG11201707538XA (en) | 2015-03-17 | 2017-10-30 | Memorial Sloan Kettering Cancer Center | Anti-muc16 antibodies and uses thereof |
| EP3091032A1 (en) | 2015-05-08 | 2016-11-09 | Miltenyi Biotec GmbH | Humanized antibody or fragment thereof specific for cd3 |
| WO2016201240A1 (en) | 2015-06-12 | 2016-12-15 | Siamab Therapeutics, Inc. | Compositions and methods for targeting cancer stem cells |
| CA3002097A1 (en) | 2015-11-12 | 2017-05-18 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| US20190031780A1 (en) | 2016-01-27 | 2019-01-31 | Siamab Therapeutics, Inc. | Compositions and methods for targeting cancer stem cells |
| WO2018094143A1 (en) | 2016-11-17 | 2018-05-24 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| WO2018094144A1 (en) | 2016-11-17 | 2018-05-24 | Siamab Therapeutics, Inc. | Compositions and methods for treating cancer |
| WO2018160909A1 (en) | 2017-03-03 | 2018-09-07 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
-
2015
- 2015-11-12 FI FIEP15859152.9T patent/FI3218005T3/fi active
- 2015-11-12 MX MX2017006167A patent/MX2017006167A/es unknown
- 2015-11-12 EP EP22201604.0A patent/EP4183806A3/en not_active Withdrawn
- 2015-11-12 SI SI201531933T patent/SI3218005T1/sl unknown
- 2015-11-12 PL PL15859152.9T patent/PL3218005T3/pl unknown
- 2015-11-12 JP JP2017526592A patent/JP6951973B2/ja active Active
- 2015-11-12 HU HUE15859152A patent/HUE061672T2/hu unknown
- 2015-11-12 WO PCT/US2015/060287 patent/WO2016077526A1/en not_active Ceased
- 2015-11-12 PT PT158591529T patent/PT3218005T/pt unknown
- 2015-11-12 US US15/526,593 patent/US20170306046A1/en not_active Abandoned
- 2015-11-12 ES ES15859152T patent/ES2941897T3/es active Active
- 2015-11-12 IL IL313511A patent/IL313511A/en unknown
- 2015-11-12 EP EP15859152.9A patent/EP3218005B1/en active Active
- 2015-11-12 DK DK15859152.9T patent/DK3218005T5/da active
- 2015-11-12 CA CA2967595A patent/CA2967595A1/en active Pending
- 2015-11-12 IL IL278574A patent/IL278574B2/en unknown
-
2017
- 2017-04-27 IL IL251988A patent/IL251988A0/en unknown
- 2017-05-11 MX MX2022008523A patent/MX2022008523A/es unknown
-
2020
- 2020-01-29 US US16/776,188 patent/USRE49435E1/en active Active
- 2020-02-14 US US16/791,174 patent/US20210011021A1/en not_active Abandoned
-
2021
- 2021-04-09 JP JP2021066180A patent/JP2021118699A/ja active Pending
- 2021-05-26 US US17/331,290 patent/US20220057402A1/en not_active Abandoned
-
2023
- 2023-03-07 JP JP2023034165A patent/JP2023063357A/ja active Pending
- 2023-04-03 CY CY20231100175T patent/CY1125977T1/el unknown
Patent Citations (188)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4301144A (en) | 1979-07-11 | 1981-11-17 | Ajinomoto Company, Incorporated | Blood substitute containing modified hemoglobin |
| US4444887A (en) | 1979-12-10 | 1984-04-24 | Sloan-Kettering Institute | Process for making human antibody producing B-lymphocytes |
| US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
| US4714681A (en) | 1981-07-01 | 1987-12-22 | The Board Of Reagents, The University Of Texas System Cancer Center | Quadroma cells and trioma cells and methods for the production of same |
| US4485045A (en) | 1981-07-06 | 1984-11-27 | Research Corporation | Synthetic phosphatidyl cholines useful in forming liposomes |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4716111A (en) | 1982-08-11 | 1987-12-29 | Trustees Of Boston University | Process for producing human antibodies |
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4544545A (en) | 1983-06-20 | 1985-10-01 | Trustees University Of Massachusetts | Liposomes containing modified cholesterol for organ targeting |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US5807715A (en) | 1984-08-27 | 1998-09-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin |
| US4670417A (en) | 1985-06-19 | 1987-06-02 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| EP0239400A2 (en) | 1986-03-27 | 1987-09-30 | Medical Research Council | Recombinant antibodies and methods for their production |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US4925648A (en) | 1988-07-29 | 1990-05-15 | Immunomedics, Inc. | Detection and treatment of infectious and inflammatory lesions |
| US5601819A (en) | 1988-08-11 | 1997-02-11 | The General Hospital Corporation | Bispecific antibodies for selective immune regulation and for selective immune cell binding |
| US5571698A (en) | 1988-09-02 | 1996-11-05 | Protein Engineering Corporation | Directed evolution of novel binding proteins |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US6180370B1 (en) | 1988-12-28 | 2001-01-30 | Protein Design Labs, Inc. | Humanized immunoglobulins and methods of making the same |
| US5693761A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Polynucleotides encoding improved humanized immunoglobulins |
| US5693762A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| WO1991000360A1 (en) | 1989-06-29 | 1991-01-10 | Medarex, Inc. | Bispecific reagents for aids therapy |
| US5413923A (en) | 1989-07-25 | 1995-05-09 | Cell Genesys, Inc. | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| WO1991009967A1 (en) | 1989-12-21 | 1991-07-11 | Celltech Limited | Humanised antibodies |
| WO1991010737A1 (en) | 1990-01-11 | 1991-07-25 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| US5780225A (en) | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| US5939598A (en) | 1990-01-12 | 1999-08-17 | Abgenix, Inc. | Method of making transgenic mice lacking endogenous heavy chains |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6114598A (en) | 1990-01-12 | 2000-09-05 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| WO1991010741A1 (en) | 1990-01-12 | 1991-07-25 | Cell Genesys, Inc. | Generation of xenogeneic antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5580717A (en) | 1990-05-01 | 1996-12-03 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1991019739A1 (en) * | 1990-06-11 | 1991-12-26 | Celltech Limited | Multivalent antigen-binding proteins |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5698426A (en) | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| WO1992005793A1 (en) | 1990-10-05 | 1992-04-16 | Medarex, Inc. | Targeted immunostimulation with bispecific reagents |
| WO1992008802A1 (en) | 1990-10-29 | 1992-05-29 | Cetus Oncology Corporation | Bispecific antibodies, method of production, and uses thereof |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5658727A (en) | 1991-04-10 | 1997-08-19 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5573920A (en) | 1991-04-26 | 1996-11-12 | Surface Active Limited | Antibodies, and methods for their use |
| EP0519596A1 (en) | 1991-05-17 | 1992-12-23 | Merck & Co. Inc. | A method for reducing the immunogenicity of antibody variable domains |
| US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
| WO1993011161A1 (en) | 1991-11-25 | 1993-06-10 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5932448A (en) | 1991-11-29 | 1999-08-03 | Protein Design Labs., Inc. | Bispecific antibody heterodimers |
| WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US5885793A (en) | 1991-12-02 | 1999-03-23 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1993017715A1 (en) | 1992-03-05 | 1993-09-16 | Board Of Regents, The University Of Texas System | Diagnostic and/or therapeutic agents, targeted to neovascular endothelial cells |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5475092A (en) | 1992-03-25 | 1995-12-12 | Immunogen Inc. | Cell binding agent conjugates of analogues and derivatives of CC-1065 |
| US5585499A (en) | 1992-03-25 | 1996-12-17 | Immunogen Inc. | Cyclopropylbenzindole-containing cytotoxic drugs |
| US5846545A (en) | 1992-03-25 | 1998-12-08 | Immunogen, Inc. | Targeted delivery of cyclopropylbenzindole-containing cytotoxic drugs |
| EP0592106A1 (en) | 1992-09-09 | 1994-04-13 | Immunogen Inc | Resurfacing of rodent antibodies |
| US5951983A (en) | 1993-03-05 | 1999-09-14 | Universite Catholique De Louvain | Methods of inhibiting T cell mediated immune responses with humanized LO-CD2A-specific antibodies |
| WO1995015982A2 (en) | 1993-12-08 | 1995-06-15 | Genzyme Corporation | Process for generating specific antibodies |
| WO1995020401A1 (en) | 1994-01-31 | 1995-08-03 | Trustees Of Boston University | Polyclonal antibody libraries |
| US5516637A (en) | 1994-06-10 | 1996-05-14 | Dade International Inc. | Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage |
| US5786464A (en) | 1994-09-19 | 1998-07-28 | The General Hospital Corporation | Overexpression of mammalian and viral proteins |
| US5786464C1 (en) | 1994-09-19 | 2012-04-24 | Gen Hospital Corp | Overexpression of mammalian and viral proteins |
| US5919652A (en) | 1994-11-09 | 1999-07-06 | The Regents Of The University Of California | Nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof |
| US5710038A (en) | 1994-11-25 | 1998-01-20 | Universite De Montreal | Primary cultures of normal and tumoral human ovarian epithelium |
| WO1996033735A1 (en) | 1995-04-27 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO1996034096A1 (en) | 1995-04-28 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US5750753A (en) | 1996-01-24 | 1998-05-12 | Chisso Corporation | Method for manufacturing acryloxypropysilane |
| US6114148A (en) | 1996-09-20 | 2000-09-05 | The General Hospital Corporation | High level expression of proteins |
| US6114148C1 (en) | 1996-09-20 | 2012-05-01 | Gen Hospital Corp | High level expression of proteins |
| US5916771A (en) | 1996-10-11 | 1999-06-29 | Abgenix, Inc. | Production of a multimeric protein by cell fusion method |
| WO1998016654A1 (en) | 1996-10-11 | 1998-04-23 | Japan Tobacco, Inc. | Production of a multimeric protein by cell fusion method |
| US6348584B1 (en) | 1996-10-17 | 2002-02-19 | John Edward Hodgson | Fibronectin binding protein compounds |
| WO1998024893A2 (en) | 1996-12-03 | 1998-06-11 | Abgenix, Inc. | TRANSGENIC MAMMALS HAVING HUMAN IG LOCI INCLUDING PLURAL VH AND Vλ REGIONS AND ANTIBODIES PRODUCED THEREFROM |
| WO1998046645A2 (en) | 1997-04-14 | 1998-10-22 | Micromet Gesellschaft Für Biomedizinische Forschung Mbh | Method for the production of antihuman antigen receptors and uses thereof |
| WO1998050433A2 (en) | 1997-05-05 | 1998-11-12 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| US6673901B2 (en) | 1997-06-12 | 2004-01-06 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| WO1999014353A2 (en) | 1997-09-19 | 1999-03-25 | Dana-Farber Cancer Institute, Inc. | Intrabody-mediated control of immune reactions |
| US20060034834A1 (en) | 1997-09-19 | 2006-02-16 | Dana-Farber Cancer Institute, Inc. | Intrabody-mediated control of immune reactions |
| WO2000023573A2 (en) | 1998-10-20 | 2000-04-27 | City Of Hope | Cd20-specific redirected t cells and their use in cellular immunotherapy of cd20+ malignancies |
| EP1166121A1 (en) | 1999-03-10 | 2002-01-02 | Medical Research Council | Selection of intracellular immunoglobulins |
| US7897347B2 (en) | 1999-03-10 | 2011-03-01 | Medical Research Council | Selection of intracellular immunoglobulins |
| WO2000054057A1 (en) | 1999-03-10 | 2000-09-14 | Medical Research Council | Selection of intracellular immunoglobulins |
| US7569390B1 (en) | 1999-03-10 | 2009-08-04 | Medical Research Council | Selection of intracellular immunoglobulins |
| WO2001040276A2 (en) | 1999-12-06 | 2001-06-07 | Agensys, Inc | Serpentine transmembrane antigens expressed in human prostate cancers and uses thereof |
| WO2001043778A1 (en) | 1999-12-17 | 2001-06-21 | Gene Therapy Systems, Inc. | Use of cationic lipids for intracellular protein delivery |
| WO2002035237A2 (en) | 2000-10-24 | 2002-05-02 | S.I.S.S.A. Scuola Internazionale Superiore Di Studi Avanzati | Method for in vivo identification of intracellular epitopes |
| US20030235850A1 (en) | 2000-10-24 | 2003-12-25 | Antonino Cattaneo | Method for in vivo identification of intracellular epitopes |
| EP1328814A2 (en) | 2000-10-24 | 2003-07-23 | S.I.S.S.A. Scuola Internazionale Superiore di Studi Avanzati | Method for in vivo identification of intracellular epitopes |
| WO2002077029A2 (en) | 2000-11-07 | 2002-10-03 | City Of Hope | Cd19-specific redirected immune cells |
| WO2002086096A2 (en) | 2001-01-23 | 2002-10-31 | University Of Rochester Medical Center | Methods of producing or identifying intrabodies in eukaryotic cells |
| US20030104402A1 (en) | 2001-01-23 | 2003-06-05 | University Of Rochester | Methods of producing or identifying intrabodies in eukaryotic cells |
| WO2002067849A2 (en) | 2001-02-26 | 2002-09-06 | Sabina Glozman | Systems devices and methods for intrabody targeted delivery and reloading of therapeutic agents |
| US20040047891A1 (en) | 2001-02-26 | 2004-03-11 | Sabina Glozman | Systems devices and methods for intrabody targeted delivery and reloading of therapeutic agents |
| US20040115740A1 (en) | 2001-03-31 | 2004-06-17 | Benson Roderick Simon Patrick | Intracellular analysis |
| WO2002086505A2 (en) | 2001-03-31 | 2002-10-31 | Univ Manchester | Intracellular analysis |
| WO2002088334A1 (en) | 2001-04-30 | 2002-11-07 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| WO2003008451A2 (en) | 2001-07-19 | 2003-01-30 | Universität Zürich | Modification of human variable domains |
| US7608453B2 (en) | 2001-08-03 | 2009-10-27 | MRC Sissa-Scuola Internazionale Superiore de Studi Avanzati | Intracellular antibodies |
| WO2003014960A2 (en) | 2001-08-03 | 2003-02-20 | Medical Research Council | Method of identifying a consensus sequence for intracellular antibodies |
| WO2003062415A2 (en) | 2002-01-24 | 2003-07-31 | Erasmus University | Transgenic animal comprising intracellular immunoglobins for xenotransplantation |
| WO2003077945A1 (en) | 2002-03-14 | 2003-09-25 | Medical Research Council | Intracellular antibodies |
| WO2003086276A2 (en) | 2002-04-05 | 2003-10-23 | Selective Genetics, Inc. | Compositions and methods for portal specific gene delivery and treatment of infection |
| WO2003095641A1 (en) | 2002-05-06 | 2003-11-20 | Gene Therapy Systems, Inc. | Intracellular protein delivery compositions and methods of use |
| WO2003097697A2 (en) | 2002-05-22 | 2003-11-27 | Esbatech Ag | Immunoglobulin frameworks which demonstrate enhanced stability in the intracellular environment and methods of identifying same |
| EP2314622A1 (en) | 2002-05-22 | 2011-04-27 | ESBATech, an Alcon Biomedical Research Unit LLC | Immunoglobulin frameworks which demonstrate enhanced stability in the intracellular environment and methods of identifying same |
| WO2004046189A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Method for generating immunoglobulin genes |
| EP1560853A2 (en) | 2002-11-15 | 2005-08-10 | Medical Research Council | Intracellular antibodies |
| US20050272107A1 (en) | 2002-11-15 | 2005-12-08 | Medical Research Council | Intracellular antibodies |
| US20050276800A1 (en) | 2002-11-15 | 2005-12-15 | Medical Research Council | Intrabodies |
| US20050288492A1 (en) | 2002-11-15 | 2005-12-29 | Medical Research Council | Anti-activated RAS antibodies |
| WO2004046185A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Intracellular antibodies |
| WO2004046188A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Anti-activated ras antibodies |
| WO2004046186A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Intrabodies against the oncogenic form of ras |
| US20100143939A1 (en) | 2002-11-15 | 2010-06-10 | Medical Research Council | Intracellular antibodies |
| WO2004046187A2 (en) | 2002-11-15 | 2004-06-03 | Medical Research Council | Antibodies for in vitro use |
| EP1565558A2 (en) | 2002-11-21 | 2005-08-24 | Lay Line Genomics SpA | Method for isolating intracellular antibodies able to neutralize protein interactions |
| WO2004046192A2 (en) | 2002-11-21 | 2004-06-03 | Lay Line Genomics S.P.A. | Method for isolating intracellular antibodies able to neutralize protein interactions |
| WO2004099775A1 (en) | 2003-05-07 | 2004-11-18 | Institut Curie | Means for detecting protein conformation and applications thereof |
| US7682794B2 (en) | 2003-07-15 | 2010-03-23 | The Regents Of The University Of California | Methods for detecting and analyzing N-glycolylneuraminic acid (Neu5Gc) in biological materials |
| US20120142903A1 (en) | 2003-07-15 | 2012-06-07 | The University Of California | Methods For Detecting And Analyzing N-Glycolylneuraminic Acid (NEU5GC) In Biological Materials |
| US8084219B2 (en) | 2003-07-15 | 2011-12-27 | The Regents Of The University Of California | Methods for detecting and analyzing N-glycolylneuraminic acid (Neu5Gc) in biological materials |
| US7884054B2 (en) | 2003-12-22 | 2011-02-08 | Amgen Inc. | Methods for identifying functional antibodies |
| WO2005063817A2 (en) | 2003-12-22 | 2005-07-14 | Amgen Inc. | Methods for identifying functional antibodies |
| EP2422811A2 (en) | 2004-10-27 | 2012-02-29 | MedImmune, LLC | Modulation of antibody specificity by tailoring the affinity to cognate antigens |
| WO2007059298A2 (en) | 2005-11-16 | 2007-05-24 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| US20090041836A1 (en) | 2006-01-03 | 2009-02-12 | University Of Georgia Research Foundation, Inc. | Glycolipopeptide and uses thereof |
| US20090196916A1 (en) | 2006-01-03 | 2009-08-06 | Sampat Ingale | Liposome-mediated ligation |
| US20110135570A1 (en) | 2006-03-23 | 2011-06-09 | Mary Jo Janatpour | Anti-Tumor Cell Antigen Antibody Therapeutics |
| WO2008070363A2 (en) | 2006-10-31 | 2008-06-12 | Domantis Limited | Intrabodies |
| US20100104572A1 (en) | 2006-11-02 | 2010-04-29 | Sylvie Luria | Methods for screening for therapeutic molecules and use of the molecules therefrom |
| WO2009018438A1 (en) | 2007-07-31 | 2009-02-05 | Cornell Research Foundation, Inc. | Protein discovery using intracellular ribosome display |
| WO2009091826A2 (en) | 2008-01-14 | 2009-07-23 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to a human cd19-specific chimeric antigen receptor (h-car) |
| US8506966B2 (en) | 2008-02-22 | 2013-08-13 | Novartis Ag | Adjuvanted influenza vaccines for pediatric use |
| US20120027813A1 (en) | 2008-02-22 | 2012-02-02 | Novartis Vaccines And Diagnostics Srl | Adjuvanted influenza vaccines for pediatric use |
| US20120039984A1 (en) | 2008-07-03 | 2012-02-16 | University Of Georgia Research Foundation, Inc. | Glycopeptide and uses thereof |
| WO2010004432A1 (en) | 2008-07-10 | 2010-01-14 | Institut Pasteur | Variable domains of camelid heavy-chain antibodies directed against glial fibrillary acidic proteins |
| US20100009424A1 (en) | 2008-07-14 | 2010-01-14 | Natasha Forde | Sonoporation systems and methods |
| WO2010030666A2 (en) | 2008-09-09 | 2010-03-18 | The Regents Of The University Of California | Elimination of a contaminating non-human sialic acid by metabolic competition |
| WO2010065818A1 (en) | 2008-12-05 | 2010-06-10 | City Of Hope | Chimeric immunoreceptor useful in treating human cancers |
| US20130108624A1 (en) | 2009-01-12 | 2013-05-02 | Imperial College Of London | Cryptic glycan markers and applications thereof |
| US20100178292A1 (en) | 2009-01-12 | 2010-07-15 | The Board Of Trustees Of The Leland Stanford Junior University | Cryptic glycan markers and applications thereof |
| US20100196983A1 (en) | 2009-02-05 | 2010-08-05 | Ut-Battelle, Llc | Transformation of gram positive bacteria by sonoporation |
| US8399625B1 (en) | 2009-06-25 | 2013-03-19 | ESBATech, an Alcon Biomedical Research Unit, LLC | Acceptor framework for CDR grafting |
| EP2275442A1 (en) | 2009-07-06 | 2011-01-19 | Ludwig-Maximilians-Universität München | Detection and vizualization of the cell cycle in living cells |
| WO2011003896A1 (en) | 2009-07-06 | 2011-01-13 | Ludwig-Maximilians-Universität | Detection and visualization of the cell cycle in living cells |
| WO2011041093A1 (en) | 2009-10-01 | 2011-04-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer |
| WO2011088385A2 (en) | 2010-01-15 | 2011-07-21 | The Regents Of The University Of California | Compositions and methods for detecting cancer |
| US20130236486A1 (en) | 2010-06-11 | 2013-09-12 | Mayo Foundation For Medical Education And Research | Immunogenic vaccine |
| WO2012007167A1 (en) | 2010-07-14 | 2012-01-19 | F-Star Biotechnologische Forschungs-Und Entwicklungsges. M.B.H | Multispecific modular antibody |
| WO2012048332A2 (en) | 2010-10-08 | 2012-04-12 | John Williams | A monoclonal antibody framework binding interface for meditopes, meditope delivery systems and methods for their use |
| US20140106449A1 (en) * | 2010-12-09 | 2014-04-17 | The Trustees Of The University Of Pennsylvania | Use of Chimeric Antigen Receptor-Modified T Cells to Treat Cancer |
| WO2012079000A1 (en) | 2010-12-09 | 2012-06-14 | The Trustees Of The University Of Pennsylvania | Use of chimeric antigen receptor-modified t cells to treat cancer |
| EP2703485A1 (en) | 2011-03-30 | 2014-03-05 | National University Corporation University Of Toyama | Method for selecting plasma cells and plasmablasts, method for producing target antigen-specific antibody, and new monoclonal antibody |
| WO2013023251A1 (en) | 2011-08-18 | 2013-02-21 | Affinity Biosciences Pty Ltd | Soluble polypeptides |
| WO2013033420A1 (en) | 2011-08-30 | 2013-03-07 | Whitehead Institute For Biomedical Research | Methods of downregulating translocated oncogene expression using bromodomain inhibitors |
| WO2013040557A2 (en) | 2011-09-16 | 2013-03-21 | The Trustees Of The University Of Pennsylvania | Rna engineered t cells for the treatment of cancer |
| WO2013055404A1 (en) | 2011-10-10 | 2013-04-18 | City Of Hope | Meditopes and meditope-binding antibodies and uses thereof |
| WO2013074916A1 (en) | 2011-11-18 | 2013-05-23 | Board Of Regents, The University Of Texas System | Car+ t cells genetically modified to eliminate expression of t- cell receptor and/or hla |
| WO2013092001A1 (en) | 2011-12-19 | 2013-06-27 | Synimmune Gmbh | Bispecific antibody molecule |
| WO2013126712A1 (en) | 2012-02-22 | 2013-08-29 | The Trustees Of The University Of Pennsylvania | Compositions and methods for generating a persisting population of t cells useful for the treatment of cancer |
| WO2013138795A1 (en) | 2012-03-15 | 2013-09-19 | Permeon Biologics, Inc. | Cell penetrating compositions for delivery of intracellular antibodies and antibody-like moieties and methods of use |
| US20140178365A1 (en) | 2012-04-04 | 2014-06-26 | Sialix Inc | Glycan-interacting compounds |
| WO2014028560A2 (en) | 2012-08-14 | 2014-02-20 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| WO2014030780A1 (en) | 2012-08-22 | 2014-02-27 | Mogam Biotechnology Research Institute | Screening and engineering method of super-stable immunoglobulin variable domains and their uses |
| WO2014039513A2 (en) | 2012-09-04 | 2014-03-13 | The Trustees Of The University Of Pennsylvania | Inhibition of diacylglycerol kinase to augment adoptive t cell transfer |
| WO2014055771A1 (en) | 2012-10-05 | 2014-04-10 | The Trustees Of The University Of Pennsylvania | Human alpha-folate receptor chimeric antigen receptor |
| WO2014074532A2 (en) | 2012-11-06 | 2014-05-15 | Scholar Rock Inc. | Compositions and methods for modulating cell signaling |
| WO2014106639A1 (en) | 2013-01-03 | 2014-07-10 | Sanofi | Intracellular phenotypic screening |
| WO2014144573A2 (en) | 2013-03-15 | 2014-09-18 | Memorial Sloan-Kettering Cancer Center | Multimerization technologies |
| WO2014144357A1 (en) | 2013-03-15 | 2014-09-18 | Merck Patent Gmbh | Tetravalent bispecific antibodies |
| WO2015054600A2 (en) | 2013-10-10 | 2015-04-16 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
Non-Patent Citations (221)
| Title |
|---|
| "GenBank", Database accession no. U00562 |
| "Remington: The Science and Practice of Pharmacy", 2006, LIPPINCOTT, WILLIAMS & WILKINS |
| "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY, pages: 1418 |
| ACRES ET AL., EXPERT REVIEW OF VACCINES, vol. 4, 2005, pages 493 - 502 |
| ALDERSON, K.L. ET AL., J BIOMED BIOTECHNOL., vol. 2011, 2011, pages 379123 |
| ALLAVENA, P. ET AL., CLIN DEV IMMUNOL., vol. 2010, 2010, pages 547179 |
| AL-LAZIKANI, B. ET AL., J. MOL. BIOL., vol. 273, no. 4, 1997, pages 927 - 48 |
| AMES, R.S. ET AL.: "Conversion of murine Fabs isolatedfrom a combinatorial phage display library to full length immunoglobulins", J IMMUNOL METHODS, vol. 184, no. 2, 18 August 1995 (1995-08-18), pages 177 - 86, XP004020985, DOI: 10.1016/0022-1759(95)00086-P |
| AMYERE, M. ET AL., INT J MED MICROBIOL., vol. 291, no. 6-7, February 2002 (2002-02-01), pages 487 - 94 |
| ARAFAT ET AL., CANCER GENE THER., vol. 7, 2000, pages 1250 - 6 |
| BAEUERLE PA ET AL., CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 11, no. 1, 2009, pages 22 - 30 |
| BAPAT, S. A.: "Human ovarian cancer stem cells", REPRODUCTION, vol. 140, 2010, pages 33 - 41 |
| BARDOR, M. ET AL.: "Mechanism of uptake and incorporation of the non-human sialic acid N-glycolylneuraminic acid into human cells", J BIOL CHEM., vol. 280, 2005, pages 4228 - 4237, XP055046441, DOI: 10.1074/jbc.M412040200 |
| BENOIT ET AL., BIOMACROMOLECULES, vol. 12, 2011, pages 2708 - 2714 |
| BERGE ET AL., JOURNAL OF PHARMACEUTICAL SCIENCE, vol. 66, 1977, pages 1 - 19 |
| BIOCCA, ANTIBODY EXPRESSION AND PRODUCTION CELL ENGINEERING, vol. 7, 2011, pages 179 - 195 |
| BIOCCANEUBERGERCATTANEO, EMBO J., vol. 9, 1990, pages 101 - 108 |
| BLIXT ET AL.: "Anticarbohydrate Antibodies", 27 November 2011, SPRINGER-VERLAG, article "Glycan Microarray Analysis of Tumor-Associated Antibodies" |
| BRADBURY, A.R. ET AL.: "Beyond natural antibodies: the power of in vitro display technologies", NAT BIOTECHNOL., vol. 29, no. 3, March 2011 (2011-03-01), pages 245 - 54, XP055547293, DOI: 10.1038/nbt.1791 |
| BRINKMANN, U. ET AL.: "Phage display of disulfide-stabilized Fv fragments", J IMMUNOL METHODS, vol. 182, no. 1, 11 May 1995 (1995-05-11), pages 41 - 50, XP004021178, DOI: 10.1016/0022-1759(95)00016-4 |
| BROCKHAUSEN ET AL., BIOLOGICAL CHEMISTRY, vol. 382, 2001, pages 219 - 232 |
| BROCKHAUSEN, I. ET AL., BIOL CHEM., vol. 382, no. 2, February 2001 (2001-02-01), pages 219 - 32 |
| BRODEUR, B. ET AL.: "Monoclonal Antibody Production Techniques and Applications", vol. 33, 1987, MARCEL DEKKER, INC., pages: 51 - 63 |
| BURGOS-OJEDA ET AL., CANCER LETTERS, vol. 322, 2012, pages 1 - 7 |
| CAO, Y. ET AL., VIRCHOWS ARCH., vol. 431, no. 3, September 1997 (1997-09-01), pages 159 - 66 |
| CARDINALEBIOCCA, CURR. MOL. MED., vol. 8, 2008, pages 2 - 11 |
| CARON ET AL., MOL. THER., vol. 3, no. 3, 2001, pages 310 - 8 |
| CARRASCAL, M.A. ET AL., MOLECULAR ONCOLOGY, vol. 8, no. 3, 2014, pages 753 - 65 |
| CARRASCAL, MA ET AL., MOL ONCOL., vol. 1574-7891, no. 14, 2014, pages 00047 - 7 |
| CASADESUS, A.V. ET AL., GLYCOCONJ J., vol. 30, no. 7, 2013, pages 687 - 99 |
| CAZET ET AL., BREAST CANCER RESEARCH: BCR, vol. 12, 2010, pages 204 |
| CHAO, G. ET AL.: "Isolating and engineering human antibodies using yeast surface display", NAT PROTOC., vol. 1, no. 2, 2006, pages 755 - 68, XP002520702, DOI: 10.1038/NPROT.2006.94 |
| CHEEVER, M.A. ET AL., CLIN CANCER RES., vol. 15, no. 17, 1 September 2009 (2009-09-01), pages 5323 - 37 |
| CHEN ET AL., HUM. GENE THER., vol. 5, 1994, pages 595 - 601 |
| CHEN ET AL., HUM. GENE THERAP., vol. 7, 1996, pages 1515 - 1525 |
| CHEN ET AL., JOURNAL OF PROTEOME RESEARCH, vol. 12, 2013, pages 1408 - 1418 |
| CHEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 5932 - 5936 |
| CHEN, X. ET AL.: "Advances in the biology and chemistry of sialic acids", ACS CHEM BIOL., vol. 5, no. 2, 19 February 2010 (2010-02-19), pages 163 - 76, XP055368201, DOI: 10.1021/cb900266r |
| CHIARELLA ET AL., CURR GENE THER., vol. 10, 2010, pages 128 - 138 |
| CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 |
| CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 901 |
| CHU ET AL., INFECTION IMMUNITY, vol. 68, no. 3, 2000, pages 1450 - 6 |
| CHUNG, C.H. ET AL.: "Cetuximab-induced anaphylaxis and IgE specific for galactose-alpha-l,3-galactose", N ENGL J MED., vol. 358, no. 11, 13 March 2008 (2008-03-13), pages 1109 - 17 |
| COHEN ET AL., ONCOGENE, vol. 17, 1998, pages 2445 - 2456 |
| COLBY ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17616 - 21 |
| COLCHER, D. ET AL., PNAS, vol. 78, no. 5, 1981, pages 3199 - 203 |
| CRONICAN ET AL., ACS CHEM. BIOL., vol. 5, 2010, pages 747 - 752 |
| CURRY ET AL., JOURNAL OF SURGICAL ONCOLOGY, vol. 107, 2013, pages 713 - 722 |
| DAUGHERTY ET AL.: "Formulation and delivery issues for monoclonal antibody therapeutics", ADV DRUG DELIV REV., vol. 58, no. 5-6, 7 August 2006 (2006-08-07), pages 686 - 706, XP024892149, DOI: 10.1016/j.addr.2006.03.011 |
| DAVIS, MOL PHARM., vol. 6, 2009, pages 659 - 668 |
| DAVIS, NATURE, vol. 464, 2010, pages 1067 - 1070 |
| DER MAUR ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 45075 - 85 |
| DESHAYES ET AL., CELL. MOL. LIFE SCI., vol. 62, no. 16, 2005, pages 1839 - 49 |
| DEVINE, P.L. ET AL., CANCER RES., vol. 51, 1991, pages 5826 - 5836 |
| DHARMAWARDHANE, S. ET AL., MOL BIOL CELL, vol. 11, no. 10, October 2000 (2000-10-01), pages 3341 - 52 |
| DIAZ, S.L. ET AL., PLOS ONE., vol. 4, 2009, pages e4241 |
| EDWARDS, B.M. ET AL., JMB, vol. 334, 2003, pages 103 - 18 |
| EL-ANDALOUSSI ET AL., CURR. PHARM. DES., vol. 11, no. 28, 2003, pages 3597 - 611 |
| ENGELMANN ET AL., CANCER RESEARCH, vol. 68, 2008, pages 4311 - 4320 |
| EPPSTEIN, D.A. ET AL.: "Biological activity of liposome-encapsulated murine interferon gamma is mediated by a cell membrane receptor", PROC NATL ACAD SCI USA., vol. 82, no. 11, June 1985 (1985-06-01), pages 3688 - 92 |
| FERREIRA ET AL., MOLECULAR ONCOLOGY, vol. 7, 2013, pages 719 - 731 |
| FINNEY, J IMMUNOLOGY, vol. 172, 2004, pages 104 - 113 |
| FOSTER ET AL., CANCER LETTERS, vol. 338, 2013, pages 147 - 157 |
| FRIEL ET AL., CELL CYCLE, vol. 7, 2008, pages 242 - 249 |
| G. S. BANKER: "Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences", vol. 72, 1996, MARCEL DEKKER |
| GHADERI, D. ET AL.: "Implications of the presence of N-glycolylneuraminic acid in recombinant therapeutic glycoproteins", NAT BIOTECHNOL., vol. 28, 2010, pages 863 - 867, XP055046334, DOI: 10.1038/nbt.1651 |
| GILL ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 110, 2013, pages E3152 - 3161 |
| GILLIES, S.D. ET AL.: "High-level expression of chimeric antibodies using adapted cDNA variable region cassettes", J IMMUNOL METHODS, vol. 125, no. 1-2, 20 December 1989 (1989-12-20), pages 19 1 - 202, XP023973835, DOI: 10.1016/0022-1759(89)90093-8 |
| GODING, J.W.: "Monoclonal Antibodies: Principles and Practice", 1986, ACADEMIC PRESS, pages: 59 - 1031 |
| GUPTA ET AL., NATURE MEDICINE, vol. 15, 2009, pages 1010 - 1012 |
| HAMILTON, T.C. ET AL., CANCER RES., vol. 43, 1983, pages 5379 - 89 |
| HASSANZADEH ET AL., FEBSLETT., vol. 437, 1998, pages 81 - 6 |
| HEDLUND, M. ET AL., PROC NATL ACAD SCI USA., vol. 105, no. 48, 2 December 2008 (2008-12-02), pages 18936 - 41 |
| HEIMBURG-MOLINARO ET AL., VACCINE, vol. 29, no. 48, 8 November 2011 (2011-11-08), pages 8802 - 8826 |
| HEIMBURG-MOLINARO, J. ET AL.: "Cancer vaccines and carbohydrate epitopes", VACCINE, vol. 29, no. 48, 8 November 2011 (2011-11-08), pages 8802 - 26, XP028326010, DOI: 10.1016/j.vaccine.2011.09.009 |
| HENGCAO, MED HYPOTHESES, vol. 64, 2005, pages 1105 - 8 |
| HENGCAO, MED HYPOTHESES., vol. 64, 2005, pages 1105 - 8 |
| HIGASHI, H. ET AL., CANCER RES., vol. 45, no. 8, August 1985 (1985-08-01), pages 3796 - 802 |
| HIRABAYASHI, Y. ET AL., JPN J CANCER RES., vol. 78, 1987, pages 614 - 620 |
| HOLLINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 7889 - 7893 |
| HONEGGER, A.PLUCKTHUN, A., J. MOL. BIOL., vol. 309, no. 3, 2001, pages 657 - 70 |
| HUSTON, J.S. ET AL.: "Protein engineering of single-chain Fv analogs andfusion proteins", METHODS ENZYMOL., vol. 203, 1991, pages 46 - 88 |
| HWANG, K.J. ET AL.: "Hepatic uptake and degradation of unilamellar sphingomyelinlcholesterol liposomes: a kinetic study", PROC NATL ACAD SCI USA., vol. 77, no. 7, July 1980 (1980-07-01), pages 4030 - 4 |
| IBRAHIM ET AL., JOURNAL OF CLINICAL ONCOLOGY: OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 22, 2004, pages 2547 |
| IKEHARA ET AL., GLYCOBIOLOGY, vol. 9, 1999, pages 1213 - 1224 |
| IKEHARA, Y. ET AL., GLYCOBIOLOGY, vol. 9, no. 11, November 1999 (1999-11-01), pages 1213 - 24 |
| INOUE, S. ET AL., GLYCOBIOLOGY, vol. 20, no. 6, 2010, pages 752 - 762 |
| ISHIDA, A. ET AL., PROTEOMICS, vol. 8, 2008, pages 3342 - 9 |
| ITZKOWITZ, S.H. ET AL., CANCER, vol. 66, no. 9, 1 November 1990 (1990-11-01), pages 1960 - 6 |
| J. MOL BIOL, vol. 266, no. 4, 1997, pages 814 - 830 |
| JANDUS, C. ET AL., JCI, 2014, pages 65899 |
| JASS, J.R. ET AL., J PATHOL., vol. 176, no. 2, June 1995 (1995-06-01), pages 143 - 9 |
| JOHANNES, L. ET AL., TRAFFIC, vol. 3, no. 7, July 2002 (2002-07-01), pages 443 - 51 |
| JOHNSON, G. ET AL., NUCLEIC ACIDS RES., vol. 28, no. 1, 2000, pages 214 - 8 |
| JU ET AL., NATURE, vol. 437, 2005, pages 125 |
| JU, T. ET AL., CANCER RES., vol. 68, no. 6, 15 March 2008 (2008-03-15), pages 1636 - 46 |
| JU, T. ET AL., NATURE, vol. 437, no. 7063, 27 October 2005 (2005-10-27), pages 1252 |
| JULIEN ET AL., BIOMOLECULES, vol. 2, 2012, pages 435 - 466 |
| JULIEN ET AL., BRITISH JOURNAL OF CANCER, vol. 100, 2009, pages 1746 - 1751 |
| JULIEN ET AL., GLYCOBIOLOGY, vol. 16, 2006, pages 54 - 64 |
| JULIEN ET AL., GLYCOCONJUGATE JOURNAL, vol. 18, 2001, pages 883 - 893 |
| JULIEN, S. ET AL., BR J CANCER., vol. 100, no. 11, 2 June 2009 (2009-06-02), pages 1746 - 54 |
| JULIEN, S. ET AL., GLYCOCONJUGATE JOURNAL., vol. 18, 2001, pages 883 - 93 |
| KARLEN, P. ET AL., GASTROENTEROLOGY, vol. 11 5, no. 6, December 1998 (1998-12-01), pages 1395 - 404 |
| KARSTENGOLETZ, SPRINGERPLUS, vol. 2, 2013, pages 301 |
| KAWACHI. S ET AL., INT ARCH ALLERGY APPL IMMUNOL., vol. 85, 1988, pages 381 - 383 |
| KETTLEBOROUGH, C.A. ET AL.: "Isolation of tumor cell-specific single-chain Fv from immunized mice using phage-antibody libraries and the re-construction of whole antibodies from these antibody fragments", EUR J IMMUNOL., vol. 24, no. 4, April 1994 (1994-04-01), pages 952 - 8, XP000570464, DOI: 10.1002/eji.1830240426 |
| KINNEY ET AL., CANCER, vol. 80, 1997, pages 2240 - 2249 |
| KIRKEBY, S. ET AL., ARCH ORAL BIOL., vol. 55, no. 11, November 2010 (2010-11-01), pages 830 - 41 |
| KOBAYASHI ET AL., JOURNAL OF CLINICAL ONCOLOGY: OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 10, 1992, pages 95 - 101 |
| KOBAYASHI ET AL., JOURNAL OF CLINICAL ONCOLOGY: OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY, vol. 9, 1991, pages 983 - 987 |
| KOBAYASHI, H. ET AL., J CLIN ONCOL., vol. 10, no. 1, January 1992 (1992-01-01), pages 95 - 101 |
| KOHLER, G. ET AL.: "Continuous cultures of fused cells secreting antibody of predefined specificity", NATURE, vol. 256, no. 5517, 7 August 1975 (1975-08-07), pages 495 - 7, XP002024548 |
| KOSTELNY, S.A. ET AL.: "Formation of a bispecific antibody by the use of leucine zippers", J IMMUNOL., vol. 148, no. 5, 1 March 1992 (1992-03-01), pages 1547 - 53 |
| KOSTELNY, S.A. ET AL.: "Formation of a bispecific antibody by the use of leucine zippers", J. IMMUNOL., vol. 148, no. 5, 1 March 1992 (1992-03-01), pages 1547 - 53 |
| KOZBOR, D. ET AL.: "A human hybrid myeloma for production of human monoclonal antibodies", J IMMUNOL., vol. 133, no. 6, December 1984 (1984-12-01), pages 3001 - 5 |
| LANGEL: "Cell-Penetrating Peptides: Processes and Applications", 2002, CRC PRESS |
| LEFRANC, M.P. ET AL., IMMUNOME RES., vol. 1, 2005, pages 3 |
| LETH-LARSEN ET AL., MOLECULAR MEDICINE, vol. 18, 2012, pages 1109 - 1121 |
| LI, A. ET AL., BLOOD, vol. 103, no. 12, 2004, pages 4602 - 9 |
| LIANG, D. ET AL., BMC CANCER, vol. 12, 2012, pages 201 - 47 |
| LONBERG, N. ET AL.: "Human antibodies from transgenic mice", INT REV IMMUNOL., vol. 13, no. 1, 1995, pages 65 - 93 |
| MACCIONI, H.J. ET AL.: "Organization of the synthesis of glycolipid oligosaccharides in the Golgi complex", FEBS LETT., vol. 585, no. 11, 6 June 2011 (2011-06-06), pages 1691 - 8, XP028219701, DOI: 10.1016/j.febslet.2011.03.030 |
| MACIEJEWSKI ET AL., NATURE MED., vol. 1, 1995, pages 667 - 673 |
| MACK ET AL., PROC. NATL. ACAD. SCI., vol. 92, 1995, pages 7021 - 7025 |
| MALYKH, Y.N. ET AL., BIOCHIMIE, vol. 83, 2001, pages 623 - 634 |
| MARASCO, GENE THER., vol. 4, 1997, pages 11 - 15 |
| MARASCO, IMMUNOTECH, vol. 1, 1995, pages 1 - 19 |
| MARASCO, WA: "Intrabodies: Basic Research and Clinical Gene Therapy Applications", 1998, SPRINGER |
| MARTIN, F.J. ET AL.: "Irreversible coupling of immunoglobulin fragments to preformed vesicles. An improved method for liposome targeting", J BIOL CHEM., vol. 257, no. 1, 10 January 1982 (1982-01-10), pages 286 - 8, XP001098117 |
| MARVIN, J.S. ET AL., ACTA PHARMACOLOGICA SINICA, vol. 26, no. 6, 2005, pages 649 - 58 |
| MARVIN, J.S. ET AL., ACTA PHARMACOLOGICA SINICA., vol. 26, no. 6, 2005, pages 649 - 58 |
| MASSIGNANI ET AL.: "Cellular delivery of antibodies: effective targeted subcellular imaging and new therapeutic tool", NATURE PROCEEDINGS, May 2010 (2010-05-01) |
| MATSUDA, F. ET AL., THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 188, no. 11, 1998, pages 2151 - 62 |
| MCCAFFERTY ET AL., NATURE, vol. 348, 1990, pages 552 - 4 |
| MCCANN ET AL., PLOS ONE, vol. 6, 2011, pages e28077 |
| MCNAUGHTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 106, 2009, pages 6111 - 6116 |
| MEDEMA ET AL., NATURE CELL BIOLOGY, vol. 15, 2013, pages 338 - 344 |
| MEUNIER, L. ET AL., TRANSL ONCOL., vol. 3, no. 4, 2010, pages 230 - 8 |
| MHASHILKAR ET AL., EMBO J., vol. 14, 1995, pages 1542 - 51 |
| MHASHILKAR ET AL., GENE THER., vol. 9, 2002, pages 307 - 19 |
| MIERSCH, S. ET AL.: "Synthetic antibodies: Concepts, potential and practical considerations", METHODS, vol. 57, no. 4, August 2012 (2012-08-01), pages 486 - 98, XP055185200, DOI: 10.1016/j.ymeth.2012.06.012 |
| MILES ET AL., THE ONCOLOGIST, vol. 16, 2011, pages 1092 - 1100 |
| MIYOSHI I. ET AL., MOL IMMUNOL., vol. 23, 1986, pages 631 - 638 |
| MORRISON, S.L.: "Transfectomas provide novel chimeric antibodies", SCIENCE, vol. 229, no. 4719, 20 September 1985 (1985-09-20), pages 1202 - 7, XP001030113, DOI: 10.1126/science.3929380 |
| MORTEZAI, N. ET AL., GLYCOBIOLOGY, vol. 23, no. 7, 2013, pages 844 - 52 |
| MOTOO, Y. ET AL., ONCOLOGY, vol. 48, no. 4, 1991, pages 321 - 6 |
| MUKHERJEE, K. ET AL., BIOL CHEM., vol. 390, 2009, pages 325 - 35 |
| MUKHERJEE, K. ET AL., J CELL BIOCHEM., vol. 105, 2008, pages 724 - 34 |
| MUNSON, P.J. ET AL.: "Ligand: a versatile computerized approach for characterization of ligand-binding systems", ANAL BIOCHEM., vol. 107, no. 1, 1 September 1980 (1980-09-01), pages 220 - 39, XP024830028, DOI: 10.1016/0003-2697(80)90515-1 |
| MURARO, R. ET AL., CANCER RES., vol. 48, 1988, pages 4588 - 96 |
| NAOR ET AL., SEMINARS IN CANCER BIOLOGY, vol. 18, 2008, pages 260 - 267 |
| NATURE BIOTECHNOLOGY, vol. 10, 1992, pages 1446 - 1449 |
| NEGI ET AL., JOURNAL OF DRUG TARGETING, vol. 20, 2012, pages 561 - 573 |
| NELSON, A. L., MABS, vol. 2, no. 1, January 2010 (2010-01-01), pages 77 - 83 |
| NEWMANBETTINGER, GENE THER., vol. 14, 2007, pages 465 - 475 |
| NGUYEN, D.H. ET AL., J IMMUNOL., vol. 175, no. 1, 1 July 2005 (2005-07-01), pages 228 - 36 |
| NIKOLOUDIS, D. ET AL., PEERJ., vol. 2, 2014, pages e456 |
| NOLLAU, P. ET AL., J HISTOCHEM CYTOCHEM., vol. 61, no. 3, 2013, pages 199 - 205 |
| OGATA, S. ET AL., CANC. RES., vol. 52, 1992, pages 4741 - 6 |
| OGATA, S. ET AL.: "Tumor-associated sialylated antigens are constitutively expressed in normal human colonic mucosa", CANCER RES., vol. 55, no. 9, 1 May 1995 (1995-05-01), pages 1869 - 74 |
| OHAGE ET AL., J. MOL. BIOL., vol. 291, 1999, pages 1129 - 1134 |
| OHNO, S. ET AL., ANTICANCER RES., vol. 26, no. 6A, November 2006 (2006-11-01), pages 4047 - 53 |
| PADLAN, E.A.: "A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-bindingproperties", MOL IMMUNOL., vol. 28, no. 4-5, April 1991 (1991-04-01), pages 489 - 98, XP023795271, DOI: 10.1016/0161-5890(91)90163-E |
| PADLER-KARAVANI ET AL., CANCER RESEARCH, vol. 71, 2011, pages 3352 - 3363 |
| PADLER-KARAVANI, V. ET AL., CANCER RES., vol. 71, no. 9, 1 May 2011 (2011-05-01), pages 3352 - 63 |
| PADLER-KARAVANI, V. ET AL., GLYCOBIOLOGY, vol. 18, no. 10, October 2008 (2008-10-01), pages 818 - 30 |
| PANOWSKI, S. ET AL., MABS, vol. 6, no. 1, 2014, pages 34 - 45 |
| PARK J.G. ET AL., CANCER RES., vol. 50, 1990, pages 2773 - 80 |
| PERSHAD, K. ET AL., PROTEIN ENGINEERING DESIGN AND SELECTION, vol. 23, 2010, pages 279 - 88 |
| PERSIC, L. ET AL.: "An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries", GENE, vol. 187, no. 1, 10 March 1997 (1997-03-10), pages 9 - 18, XP002057893, DOI: 10.1016/S0378-1119(96)00628-2 |
| PINHO ET AL., CANCER LETTERS, vol. 249, 2007, pages 157 - 170 |
| PINHO, S. ET AL., CANCER LETT., vol. 249, no. 2, 8 May 2007 (2007-05-08), pages 157 - 70 |
| PITELLA ET AL., BIOMATERIALS, vol. 32, 2011, pages 3106 - 3114 |
| PORTER ET AL., N. ENGL. J. MED., vol. 365, 2011, pages 725 - 733 |
| POSTEMAGILJA, CURR PHARM BIOTECHNOL., vol. 8, 2007, pages 355 - 361 |
| PROBA ET AL., J. MOL. BIOL., vol. 275, 1998, pages 245 - 253 |
| RABU ET AL., FUTURE ONCOLOGY, vol. 8, 2012, pages 943 - 960 |
| RICHARDSON ET AL., GENE THER., vol. 5, 1998, pages 635 - 44 |
| RIECHMANN, L. ET AL.: "Reshaping human antibodies for therapy", NATURE, vol. 332, no. 6162, 24 March 1988 (1988-03-24), pages 323 - 7, XP002007067, DOI: 10.1038/332323a0 |
| RIETHMULLER, G., CANCER IMMUNITY, vol. 12, 2012, pages 12 - 18 |
| ROGUSKA, M.A. ET AL.: "Humanization of murine monoclonal antibodies through variable domain resurfacing", PROC NATL ACAD SCI USA., vol. 91, no. 3, 1 February 1994 (1994-02-01), pages 969 - 73, XP002271704, DOI: 10.1073/pnas.91.3.969 |
| RONDONMARASCO, ANNU. REV. MICROBIOL., vol. 51, 1997, pages 257 - 283 |
| ROZEMA ET AL., PROC NATL ACAD SCI USA., vol. 104, 2007, pages 12982 - 12887 |
| SADELAIN ET AL., CURRENT OPINION IN IMMUNOLOGY, vol. 21, no. 2, 2009, pages 215 - 223 |
| SAWYER, CHEM BIOL DRUG DES., vol. 73, 2009, pages 3 - 6 |
| SCHAEFER, W. ET AL., PNAS, vol. 108, no. 27, 2011, pages 11187 - 92 |
| SCHOFIELD, D. ET AL., GENOME BIOL., vol. 8, 2007, pages R254 |
| SCHULTZ ET AL., CANCER METASTASIS REVIEWS, vol. 31, 2012, pages 501 - 518 |
| SEN ET AL., INFECTION IMMUNITY, vol. 74, no. 3, 2006, pages 2177 - 86 |
| SHI, W-X. ET AL., J OF BIOL CHEM., vol. 271, no. 49, 1996, pages 31526 - 32 |
| SHU, L. ET AL.: "Secretion of a single-gene-encoded immunoglobulin from myeloma cells", PROC NATL ACAD SCI USA., vol. 90, no. 17, 1 September 1993 (1993-09-01), pages 7995 - 9, XP002982148, DOI: 10.1073/pnas.90.17.7995 |
| SIEGEL ET AL.: "Cancer statistics", CA: A CANCER JOURNAL FOR CLINICIANS, vol. 63, 2013, pages 11 - 30 |
| SIEGWART ET AL., PROC NATL ACAD SCI USA., vol. 108, 2011, pages 12996 - 13001 |
| SIMONSEN, A. ET AL., CURR OPIN CELL BIOL., vol. 13, no. 4, August 2001 (2001-08-01), pages 485 - 92 |
| SJOBERG, E.R. ET AL., JCB, vol. 126, no. 2, 1994, pages 549 - 562 |
| SKERRA, A. ET AL.: "Assembly of a functional immunoglobulin Fv fragment in Escherichia coli", SCIENCE, vol. 240, no. 4855, 20 May 1988 (1988-05-20), pages 1038 - 41, XP002521062, DOI: 10.1126/science.3285470 |
| STEINBERGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 805 - 810 |
| STUDNICKA, G.M. ET AL.: "Human-engineered monoclonal antibodies retain full specific binding activity by preserving non-CDR complementarity-modulating residues", PROTEIN ENG., vol. 7, no. 6, June 1994 (1994-06-01), pages 805 - 14, XP009166823, DOI: 10.1093/protein/7.6.805 |
| T. E. CREIGHTON: "Proteins: Structure and Molecular Properties", 1983, W.H. FREEMAN & CO., pages: 79 - 86 |
| T. HIGUCHIV. STELLA: "A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design", vol. 14, 1987, AMERICAN PHARMACEUTICAL ASSOCIATION AND PERGAMON PRESS, article "Pro-drugs as Novel Delivery Systems" |
| TANGVORANUNTAKUL, P. ET AL., PROC NATL ACAD SCI USA, vol. 100, no. 21, 14 October 2003 (2003-10-14), pages 12045 - 50 |
| TANGVORANUNTAKUL, P. ET AL., PROC NATL ACAD SCI USA., vol. 100, 2003, pages 12045 - 12050 |
| TODA, M. ET AL., BIOCHEM BIOPHYS RES COMMUN., vol. 372, no. 1, 2008, pages 45 - 50 |
| TUTT, A. ET AL.: "Trispecific F(ab)3 derivatives that use cooperative signaling via the 3 complex and CD2 to activate and redirect resting cytotoxic T cells", J IMMUNOL., vol. 147, no. 1, 1 July 1991 (1991-07-01), pages 60 - 9, XP000863699 |
| TUTT, A. ET AL.: "Trispecific F(ab)3 derivatives that use cooperative signaling via the 3 complex and CD2 to activate and redirect resting cytotoxic T cells", J. IMMUNOL., vol. 147, no. 1, 1 July 1991 (1991-07-01), pages 60 - 9, XP000863699 |
| VAN VLIET, SJ. ET AL., J IMMUNOL., vol. 181, no. 5, 2008, pages 3148 - 55 |
| VARKI, A. ET AL., GLYCOCONJ J., vol. 26, 2009, pages 231 - 245 |
| VARKI, N.M. ET AL., ANNU REV PATHOL., vol. 6, 2011, pages 365 - 93 |
| VERDINEHILINSKI, METHODS ENZYMOL., vol. 503, 2012, pages 3 - 33 |
| WEISBART ET AL., INT. J. ONCOL., vol. 25, no. 4, October 2004 (2004-10-01), pages 1113 - 8 |
| WEISBART ET AL., INT. J. ONCOL., vol. 25, no. 6, December 2004 (2004-12-01), pages 1867 - 73 |
| WHEELER ET AL., FASEB J., vol. 17, 2003, pages 1733 - 5 |
| WILLIAMS ET AL., EXPERIMENTAL BIOLOGY AND MEDICINE, vol. 238, 2013, pages 324 - 338 |
| WIRTZSTEIPE, PROTEIN SCI., vol. 8, 1999, pages 2245 - 2250 |
| WOOD, A.J. ET AL.: "Targeted genome editing across species using ZFNs and TALENs", SCIENCE, vol. 333, no. 6040, 15 July 2011 (2011-07-15), pages 307, XP055102329, DOI: 10.1126/science.1207773 |
| WU, T.T. ET AL., JEM, vol. 132, no. 2, 1970, pages 211 - 50 |
| YIN, J. ET AL., CANCER RES., vol. 66, no. 6, 15 March 2006 (2006-03-15), pages 2937 - 45 |
| YOONPARK, EXPERT OPIN DRUG DELIV., vol. 7, 2010, pages 321 - 330 |
| ZHU ET AL., J. IMMUNOL. METHODS, vol. 231, 1999, pages 207 - 222 |
| ZOLLER, CANCER, vol. 11, 2011, pages 254 - 267 |
Cited By (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USRE49435E1 (en) | 2014-11-12 | 2023-02-28 | Seagen Inc. | Glycan-interacting compounds and methods of use |
| US10925972B2 (en) | 2015-05-01 | 2021-02-23 | The Regents Of The University Of California | Glycan-dependent immunotherapeutic molecules |
| US11666660B2 (en) | 2015-05-01 | 2023-06-06 | The Regents Of The University Of California | Glycan-dependent immunotherapeutic molecules |
| EP3288580A4 (en) * | 2015-05-01 | 2018-12-26 | The Regents of The University of California | Glycan-dependent immunotherapeutic molecules |
| EP4088732A1 (en) * | 2015-05-01 | 2022-11-16 | The Regents of The University of California | Glycan-dependent immunotherapeutic molecules |
| WO2016201240A1 (en) * | 2015-06-12 | 2016-12-15 | Siamab Therapeutics, Inc. | Compositions and methods for targeting cancer stem cells |
| EP3373969A4 (en) * | 2015-11-12 | 2019-08-14 | Siamab Therapeutics, Inc. | GLYCANINTERAGING COMPOUNDS AND METHOD OF USE |
| US11028181B2 (en) | 2015-11-12 | 2021-06-08 | Seagen Inc. | Glycan-interacting compounds and methods of use |
| US11401330B2 (en) | 2016-11-17 | 2022-08-02 | Seagen Inc. | Glycan-interacting compounds and methods of use |
| EP3541847A4 (en) * | 2016-11-17 | 2020-07-08 | Seattle Genetics, Inc. | COMPOUNDS INTERACTING WITH GLYCANE AND METHODS OF USE |
| US11753619B2 (en) | 2017-02-02 | 2023-09-12 | The Scripps Research Institute | Engineered cells and methods of use |
| WO2018144769A1 (en) * | 2017-02-02 | 2018-08-09 | The Scripps Research Institute | Engineered cells and methods of use |
| CN110913903A (zh) * | 2017-03-03 | 2020-03-24 | 西雅图基因公司 | 聚糖相互作用化合物和使用方法 |
| CN110913903B (zh) * | 2017-03-03 | 2024-03-01 | 思进股份有限公司 | 聚糖相互作用化合物和使用方法 |
| US11253609B2 (en) | 2017-03-03 | 2022-02-22 | Seagen Inc. | Glycan-interacting compounds and methods of use |
| JP2022160669A (ja) * | 2017-03-03 | 2022-10-19 | シージェン インコーポレイテッド | グリカン相互作用化合物および使用の方法 |
| JP2022160668A (ja) * | 2017-03-03 | 2022-10-19 | シージェン インコーポレイテッド | グリカン相互作用化合物および使用の方法 |
| KR102653141B1 (ko) * | 2017-03-03 | 2024-04-01 | 씨젠 인크. | 글리칸-상호작용 화합물 및 사용 방법 |
| JP7316421B2 (ja) | 2017-03-03 | 2023-07-27 | シージェン インコーポレイテッド | グリカン相互作用化合物および使用の方法 |
| KR20190125398A (ko) * | 2017-03-03 | 2019-11-06 | 시애틀 지네틱스, 인크. | 글리칸-상호작용 화합물 및 사용 방법 |
| WO2018160909A1 (en) * | 2017-03-03 | 2018-09-07 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| JP2020510671A (ja) * | 2017-03-03 | 2020-04-09 | シアトル ジェネティックス, インコーポレイテッド | グリカン相互作用化合物および使用の方法 |
| WO2021105989A1 (en) * | 2019-11-26 | 2021-06-03 | Ramot At Tel-Aviv University Ltd. | Chimeric antigen receptor to carbohydrate antigens |
| US12552874B2 (en) | 2019-11-26 | 2026-02-17 | Ramot At Tel-Aviv University Ltd. | Antibodies to carbohydrate antigens |
| WO2022113066A1 (en) * | 2020-11-24 | 2022-06-02 | Ramot At Tel-Aviv University Ltd. | Humanized antibodies and fragments thereof binding to carbohydrate antigens and uses thereof |
| US11692039B2 (en) | 2020-12-31 | 2023-07-04 | Innate Pharma | Multifunctional natural killer (NK) cell engagers binding to NKp46 and CD123 |
| WO2022224241A1 (en) * | 2021-04-20 | 2022-10-27 | Ramot At Tel-Aviv University Ltd. | Chimeric antigen receptors to sialyl-tn glycan antigen |
| WO2022224242A1 (en) * | 2021-04-20 | 2022-10-27 | Ramot At Tel-Aviv University Ltd. | Humanized anti-sialyl-tn glycan antibodies and uses thereof |
| US12195555B2 (en) | 2022-05-27 | 2025-01-14 | Sanofi | Natural killer (NK) cell engagers binding to NKp46 and BCMA variants with Fc-engineering |
| WO2024078288A1 (zh) * | 2022-10-11 | 2024-04-18 | 上海交通大学医学院附属瑞金医院 | 一种抗rcp抗体及其制备方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4183806A3 (en) | 2023-08-02 |
| DK3218005T5 (da) | 2024-10-14 |
| US20220057402A1 (en) | 2022-02-24 |
| IL313511A (en) | 2024-08-01 |
| MX2017006167A (es) | 2018-03-23 |
| EP3218005B1 (en) | 2023-01-04 |
| SI3218005T1 (sl) | 2023-06-30 |
| US20170306046A1 (en) | 2017-10-26 |
| JP2023063357A (ja) | 2023-05-09 |
| EP4183806A2 (en) | 2023-05-24 |
| EP3218005A4 (en) | 2018-09-12 |
| MX2022008523A (es) | 2022-09-26 |
| IL278574B2 (en) | 2024-11-01 |
| JP2018503600A (ja) | 2018-02-08 |
| JP2021118699A (ja) | 2021-08-12 |
| HUE061672T2 (hu) | 2023-08-28 |
| PT3218005T (pt) | 2023-04-11 |
| US20210011021A1 (en) | 2021-01-14 |
| JP6951973B2 (ja) | 2021-10-20 |
| ES2941897T3 (es) | 2023-05-26 |
| IL278574A (https=) | 2021-01-31 |
| USRE49435E1 (en) | 2023-02-28 |
| DK3218005T3 (da) | 2023-03-27 |
| CY1125977T1 (el) | 2026-02-25 |
| FI3218005T3 (fi) | 2023-03-31 |
| PL3218005T3 (pl) | 2023-05-02 |
| IL278574B1 (en) | 2024-07-01 |
| CA2967595A1 (en) | 2016-05-19 |
| IL251988A0 (en) | 2017-06-29 |
| EP3218005A1 (en) | 2017-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| USRE49435E1 (en) | Glycan-interacting compounds and methods of use | |
| US20230331868A1 (en) | Glycan-Interacting Compounds and Methods of Use | |
| US9879087B2 (en) | Glycan-interacting compounds and methods of use | |
| US20240343834A1 (en) | Compositions and Methods for Targeting Cancer Stem Cells | |
| JP2022160668A (ja) | グリカン相互作用化合物および使用の方法 | |
| US20240342279A1 (en) | Glycan-Interacting Compounds and Methods of Use | |
| US20240343826A1 (en) | Compositions and Methods for Targeting Cancer Stem Cells | |
| HK40085609A (en) | Glycan-interacting compounds and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15859152 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 251988 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2967595 Country of ref document: CA Ref document number: 2017526592 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/006167 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015859152 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 313511 Country of ref document: IL |