WO2014058881A1 - Methods for treatment of alport syndrome - Google Patents
Methods for treatment of alport syndrome Download PDFInfo
- Publication number
- WO2014058881A1 WO2014058881A1 PCT/US2013/063884 US2013063884W WO2014058881A1 WO 2014058881 A1 WO2014058881 A1 WO 2014058881A1 US 2013063884 W US2013063884 W US 2013063884W WO 2014058881 A1 WO2014058881 A1 WO 2014058881A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- subject
- certain embodiments
- mir
- urine
- modified oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/4015—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having oxo groups directly attached to the heterocyclic ring, e.g. piracetam, ethosuximide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/59—Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
- A61K31/593—9,10-Secocholestane derivatives, e.g. cholecalciferol, i.e. vitamin D3
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/313—Phosphorodithioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3233—Morpholino-type ring
Definitions
- Type IV collagen a major component of the basement membrane, is a family of six alpha chains: alpha- 1 collagen (Type IV), alpha-2 collagen (Type IV), alpha-3 collagen (Type IV), alpha-4 collagen (Type IV), alpha-5 collagen (Type IV), and alpha-6 collagen (Type IV).
- the alpha-3, alpha-4 and alpha-6 chains of collagen IV are fundamental components of the collagen network of the glomerular basement membrane (GBM), which performs the critical function of filtration of blood by the kidney.
- GBM glomerular basement membrane
- Alport Syndrome is an inherited form of kidney disease in which an abnormal type of glomerular basement membrane (GBM) is produced, leading to interstitial fibrosis, glomerular sclerosis and eventual loss of kidney function. The disease is also frequently characterized by hearing defects and ocular anomalies. Alport Syndrome is caused by a mutation in Col4a3, Col4a4, or Col4a5, which encode the alpha3(IV), alpha4(IV), and alpha5(IV) chains of type IV collagen, respectively. Mutations in the Col4a5 gene on the X chromosome cause the X-linked form of Alport Syndrome, which accounts for 85% of all cases of the disease.
- GBM glomerular basement membrane
- An autosomal recessive form is due to inheritance of mutations in each copy of either Col4a3 or Col4a4, each of which is located on chromosome 2.
- the rare autosomal dominant form is due to inheritance of a dominant-negative mutation in either the Col4a3 or Col4a4 gene.
- the X-linked form is more severe in males than in females, with most cases in males progressing to end-stage renal disease (ESRD) .
- ESRD end-stage renal disease
- the autosomal form is of similar severity in males and females. Most cases of the disease are due to an inherited mutation, but some cases are due to a de novo mutation in one of the CoUaA genes.
- a modified oligonucleotide consisting of 12 to 25 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to miR- 21.
- the subject has been diagnosed as having Alport Syndrome prior to administering the modified oligonucleotide.
- the subject, prior to administration of the modified oligonucleotide was determined to have an increased level of miR-21 in the kidney tissue of the subject.
- oligonucleotide was determined to have an increased level of miR-21 in the urine or blood of the subject.
- administration of a modified oligonucleotide complementary to miR-21 may improve kidney function; delay the onset of end stage renal disease; delay time to dialysis; delay time to renal transplant; and/or improve life expectancy in the subject.
- administration of a modified oligonucleotide complementary to miR-21 , to a subject having or suspected of having Alport Syndrome may reduce hematuria; delay the onset of hematuria; reduce proteinuria; delay the onset of proteinuria; reduce kidney fibrosis; slow further progression of fibrosis; and/or halt further progression of fibrosis.
- the subject may have a mutation selected from a mutation in the gene encoding the alpha 3 chain of type IV collagen, a mutation in the gene encoding the alpha 4 chain of type IV collagen, or a mutation in the gene encoding the alpha 5 chain of type IV collagen.
- the subject is male.
- the subject is female.
- the subject is identified as having hematuria, and/or proteinuria.
- the subject has reduced kidney function.
- the subject is in need of improved kidney function.
- Any of the embodiments provided herein may comprise measuring blood urea nitrogen in the blood of the subject; measuring creatinine in the blood of the subject; measuring creatinine clearance in the subject; measuring proteinuria in the subject; measuring albumin: creatinine ratio in the subject; and/or measuring glomerular filtration rate in the subject.
- Any of the embodiments provided herein may comprise measuring N-acetyl- ⁇ - ⁇ - glucosaminidase (NAG) protein in the urine of the subject; measuring neutrophil gelatinase-associated lipocalin (NGAL) protein in the urine of the subject; measuring kidney injury molecule- 1 (KIM- 1) protein in the urine of the subject; measuring interleukin- 18 (IL- 18) protein in the urine of the subject; measuring monocyte chemoattractant protein (MCP1) levels in the urine of the subject; measuring connective tissue growth factor (CTGF) levels in the urine of the subject; measuring collagen IV (Col IV) fragments in the urine of the subject; measuring collagen III (Col III) fragments in the urine of the subject; and/or measuring podocyte protein levels in the urine of the subject, wherein the podocyte protein is selected from nephrin and podocin.
- Any of the embodiments provided herein may comprise measuring cystatin C protein in the blood of a subject; measuring ⁇ -trace protein (BTP) in
- Any of the methods provided herein may improve one or more markers of kidney function in the subject, selected from reduced blood urea nitrogen in the subject; reduced creatinine in the blood of the subject; improved creatinine clearance in the subject; reduced proteinuria in the subject; reduced albumimcreatinine ratio in the subject; and/or improved glomerular filtration rate in the subject.
- any of the methods provided herein may improve one or more markers of kidney function in the subject, selected from reduced NAG in the urine of the subject; reduced NGAL in the urine of the subject; reduced KIM- 1 in the urine of the subject; reduced IL- 18 in the urine of the subject; reduced MCP1 in the urine of the subject; reduced CTGF in the urine of the subject; reduced collagen IV fragments in the urine of the subject; reduced collagen III fragments in the urine of the subject; and reduced podocyte protein levels in the urine of the subject, wherein the podocyte protein is selected from nephrin and podocin.
- Any of the methods provided herein may improve one or more markers of kidney function selected from reduced cystatin C protein in the blood of a subject, reduced ⁇ -trace protein (BTP) in the blood of a subject, and reduced 2-microglobulin (B2M) in the blood of a subject.
- reduced cystatin C protein in the blood of a subject
- BTP reduced ⁇ -trace protein
- B2M 2-microglobulin
- the proteinuria is albuminuria.
- the albuminuria may be high normal albuminuria, microalbuminuria, or macroalbuminuria.
- the Alport Syndrome is the X-linked form of Alport Syndrome. In certain embodiments, the Alport Syndrome is the autosomal form of Alport Syndrome.
- any of the embodiments provided herein may comprise administering at least one additional therapy selected from an angiotensin II converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), an anti-hypertensive agent, a vitamin D analog, an oral phosphate binder, dialysis, and kidney transplant.
- ACE angiotensin II converting enzyme
- ARB angiotensin II receptor blocker
- the angiotensin II converting enzyme (ACE) inhibitors is selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril.
- the angiotensin II receptor blockers is selected from candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, and eprosartan.
- an ACE inhibitor is selected from cilazapril, perindopril, and trandolapril.
- an ACE inhibitor is administered at a dose ranging from 0.5 to 1 mg/m 2 /day , from 1 to 6 mg/m 2 /day, from 1 to 2 mg/m 2 /day, from 2 to 4 mg/m 2 /day, or from 4 to 8 mg/m 2 /day.
- an ARB is administered at a dose ranging from 6.25 to 150 mg/m2/day. In any of these embodiments, an ARB is administered at a dose of 6.25 mg/m 2 /day, 10 mg/m 2 /day, 12.5
- mg/m /day 18.75 mg/m /day, 37.5 mg/m /day, 50 mg/m /day, or 150 mg/m /day.
- the at least one additional therapy is an aldosterone antagonsist.
- an aldosterone antagonist is spironolactone.
- spironolactone is administered at a dose ranging from 10 to 35 mg daily. In certain embodiments, spironolactone is administered at a dose of 25 mg daily.
- the nucleobase sequence of the modified oligonucleotide is at least 90% complementary, is at least 95% complementary, or is 100%
- the modified oligonucleotide consists of 8 to 30, 12 to 25, or 15 to 25 linked nucleosides. In any of the embodiments provided herein, the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides. In any of the embodiments provided herein, the modified oligonucleotide consists of 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides.
- the modified oligonucleotide comprises at least one modified nucleoside.
- the modified nucleoside may be selected from an S-cEt nucleoside, a 2'-0- methoxyethyl nucleoside, and an LNA nucleoside.
- the modified oligonucleotide may comprise at least one modified internucleoside linkage.
- Each internucleoside linkage of the modified oligonucleotide may be a modified internucleoside linkage.
- the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
- the modified oligonucleotide may have the structure 5'-A E C s ATC s AGTC s TGAU s AAGC s TA E -3', (SEQ ID NO: 3) where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript "S” indicate S-cEt nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide consisting of 8 to 30, 12 to 25, or 15 to 25 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is
- Anti-miR-21 improves kidney function of Col4a3-/-mice.
- FIG. 3 Anti-miR-21 reduces fibrosis in Col4a3-/- mice.
- Anti-miR-21 reduces kidney injury ranking in Col4a3-/- mice.
- A Kidney injury rank score of renal sections of 9 week old mice.
- C C
- FIG. 5 Anti-miR-21 reduces macrophage infiltration (A) and decreases myofibroblasts (B) in Col4a3-/- mice.
- Anti-miR-21 reduces reactive oxygen species in Col4a3-/- mice.
- FIG. 8 Anti-miR-21 increases lifespan of Col4a3-/- mice.
- A Weight of Col4a3-/- mice treated with anti-miR-21 or PBS control (p ⁇ 0.01);
- B Lifespan of Col4a3-/- mice treated with anti-miR-21 or PBS control (p ⁇ 0.001).
- A Blood urea nitrogen at 7 weeks;
- B Lifespan of Col4a3-/- mice treated with anti-miR-21 at multiple doses, once weekly (QW) or twice weekly (BIW), or PBS control.
- GBM glomerular basement membrane
- Hematuria means the presence of red blood cells in the urine.
- Albuminuria means the presence of excess albumin in the urine, and includes without limitation, normal albuminuria, high normal albuminuria, microalbuminuria and macroalbuminuria.
- the glomerular filtration permeability barrier which is composed of podocyte, glomerular basement membrane and endothelial cells, prevents serum protein from leaking into urine.
- Albuminuria may reflect injury of the glomerular filtration permeability barrier.
- Albuminuria may be calculated from a 24-hour urine sample, an overnight urine sample or a spot-urine sample.
- High normal albuminuria means elevated albuminuria characterized by (i) the excretion of 15 to ⁇ 30 mg of albumin into the urine per 24 hours and/or (ii) an albumin/creatinine ratio of 1.25 to ⁇ 2.5 mg/mmol (or 10 to ⁇ 20 mg/g) in males or 1.75 to ⁇ 3.5 mg/mmol (or 15 to ⁇ 30 mg/g) in females.
- “Microalbuminuria” means elevated albuminuria characterized by (i) the excretion of 30 to 300 mg of albumin into the urine per 24 hours and/or (ii) an albumin/creatinine ratio of 2.5 to ⁇ 25 mg/mmol (or 20 to ⁇ 200 mg/g) in males or 3.5 to ⁇ 35 mg/mmol (or 30 to ⁇ 300 mg/g) in females.
- “Macroalbuminuria” means elevated albuminuria characterized by the excretion of more than 300 mg of albumin into the urine per 24 hours and/or (ii) an albumin/creatinine ratio of >25 mg/mmol (or >200 mg/g) in males or >35 mg/mmol (or >300 mg/g) in females.
- Albumin/creatinine ratio means the ratio of urine albumin (mg/dL) per urine creatinine (g/dL) and is expressed as mg/g. In certain embodiments, albumin/creatinine ratio may be calculated from a spot-urine sample and may be used as an estimate of albumin excretion over a 24 hour period.
- EstimateGFR or "glomerular filtration rate (GFR)” means a measurement of how well the kidneys are filtering creatinine, and is used as an estimate of how much blood passes through the glomeruli per minute. Normal results may range from 90-120 mL/min/1.73 m 2 . Levels below 60 mL/min/1.73 m 2 for 3 or more months may be an indicator chronic kidney disease. Levels below 15 mL/min/1.73 m 2 may be an indicator of kidney failure.
- Proteinuria means the presence of an excess of serum proteins in the urine. Proteinuria may be characterized by the excretion of > 250 mg of protein into the urine per 24 hours and/or a urine protein to creatinine ratio of > 0.20 mg/mg. Serum proteins elevated in association with proteinuria include, without limitation, albumin.
- BUN Blood urea nitrogen
- the liver produces urea in the urea cycle as a waste product of the digestion of protein, and the urea is removed from the blood by the kidneys.
- Normal human adult blood may contain between 7 to 21 mg of urea nitrogen per 100 ml (7-21 mg/dL) of blood. Measurement of blood urea nitrogen is used as an indicator of renal health. If the kidneys are not able to remove urea from the blood normally, a subject's BUN rises.
- End stage renal disease means the complete or almost complete failure of kidney function.
- Impaired kidney function means reduced kidney function, relative to normal kidney function.
- Fibrosis means the formation or development of excess fibrous connective tissue in an organ or tissue. In certain embodiments, fibrosis occurs as a reparative or reactive process. In certain embodiments, fibrosis occurs in response to damage or injury.
- the term "fibrosis” is to be understood as the formation or development of excess fibrous connective tissue in an organ or tissue as a reparative or reactive process, as opposed to a formation of fibrous tissue as a normal constituent of an organ or tissue.
- “Slows further progression” means to reduce the rate at which a medical condition moves towards an advanced state.
- Salts further progression means to stop progression of a medical condition to an advanced state.
- Delay time to dialysis means to maintain sufficient kidney function such that the need for dialysis treatment is delayed.
- Delay time to renal transplant means to maintain sufficient kidney function such that the need for a kidney transplant is delayed.
- Improves life expectancy means to lengthen the life of a subject by treating one or more symptoms of a disease in the subject.
- Anti-miR means an oligonucleotide having a nucleobase sequence complementary to a microRNA. In certain embodiments, an anti-miR is a modified oligonucleotide.
- Anti-miR-X where "miR-X” designates a particular microRNA, means an oligonucleotide having a nucleobase sequence complementary to miR-X.
- an anti-miR-X is fully complementary (i.e., 100% complementary) to miR-X.
- an anti-miR-X is at least 80%, at least 85%, at least 90%, or at least 95% complementary to miR-X.
- an anti-miR-X is a modified oligonucleotide.
- miR-21 means the mature miRNA having the nucleobase sequence
- “miR-21 stem-loop sequence” means the stem-loop sequence having the nucleobase sequence UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAU GGGCUGUCUGACA (SEQ ID NO: 2).
- Target nucleic acid means a nucleic acid to which an oligomeric compound is designed to hybridize.
- Targeting means the process of design and selection of nucleobase sequence that will hybridize to a target nucleic acid.
- “Targeted to” means having a nucleobase sequence that will allow hybridization to a target nucleic acid.
- Modulation means a perturbation of function, amount, or activity. In certain embodiments, modulation means an increase in function, amount, or activity. In certain embodiments, modulation means a decrease in function, amount, or activity.
- “Expression” means any functions and steps by which a gene's coded information is converted into structures present and operating in a cell.
- Nucleobase sequence means the order of contiguous nucleobases in an oligomeric compound or nucleic acid, typically listed in a 5' to 3' orientation, independent of any sugar, linkage, and/or nucleobase modification.
- Contiguous nucleobases means nucleobases immediately adjacent to each other in a nucleic acid.
- Nucleobase complementarity means the ability of two nucleobases to pair non-covalently via hydrogen bonding.
- “Complementary” means that one nucleic acid is capable of hybridizing to another nucleic acid or oligonucleotide. In certain embodiments, complementary refers to an oligonucleotide capable of hybridizing to a target nucleic acid.
- “Fully complementary” means each nucleobase of an oligonucleotide is capable of pairing with a nucleobase at each corresponding position in a target nucleic acid.
- an oligonucleotide is fully complementary to a microRNA, i.e. each nucleobase of the oligonucleotide is complementary to a nucleobase at a corresponding position in the microRNA.
- an oligonucleotide wherein each nucleobase has complementarity to a nucleobase within a region of a microRNA stem-loop sequence is fully complementary to the microRNA stem-loop sequence.
- Percent complementarity means the percentage of nucleobases of an oligonucleotide that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligonucleotide that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total number of nucleobases in the
- Percent identity means the number of nucleobases in a first nucleic acid that are identical to nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
- the first nucleic acid is a microRNA and the second nucleic acid is a microRNA.
- the first nucleic acid is an oligonucleotide and the second nucleic acid is an oligonucleotide.
- Hybridize means the annealing of complementary nucleic acids that occurs through nucleobase complementarity.
- mismatch means a nucleobase of a first nucleic acid that is not capable of Watson-Crick pairing with a nucleobase at a corresponding position of a second nucleic acid.
- nucleobase sequences means having the same nucleobase sequence, independent of sugar, linkage, and/or nucleobase modifications and independent of the methyl state of any pyrimidines present.
- MicroRNA means an endogenous non-coding RNA between 18 and 25 nucleobases in length, which is the product of cleavage of a pre-microRNA by the enzyme Dicer. Examples of mature microRNAs are found in the microRNA database known as miRBase (http://microrna.sanger.ac.uk/). In certain embodiments, microRNA is abbreviated as “microRNA” or “miR.”
- Pre-microRNA or "pre-miR” means a non-coding RNA having a hairpin structure, which is the product of cleavage of a pri-miR by the double-stranded RNA-specific ribonuclease known as Drosha.
- Ste-loop sequence means an RNA having a hairpin structure and containing a mature microRNA sequence. Pre-microRNA sequences and stem-loop sequences may overlap. Examples of stem-loop sequences are found in the microRNA database known as miRBase
- PrimeRNA or “pri-miR” means a non-coding RNA having a hairpin structure that is a substrate for the double-stranded RNA-specific ribonuclease Drosha.
- microRNA precursor means a transcript that originates from a genomic DNA and that comprises a non-coding, structured RNA comprising one or more microRNA sequences.
- a microRNA precursor is a pre-microRNA.
- a microRNA precursor is a pri-microRNA.
- microRNA-regulated transcript means a transcript that is regulated by a microRNA.
- Seed sequence means a nucleobase sequence comprising from 6 to 8 contiguous nucleobases of nucleobases 1 to 9 of the 5 '-end of a mature microRNA sequence.
- Seed match sequence means a nucleobase sequence that is complementary to a seed sequence, and is the same length as the seed sequence.
- Oligomeric compound means a compound that comprises a plurality of linked monomelic subunits. Oligomeric compounds included oligonucleotides.
- Oligonucleotide means a compound comprising a plurality of linked nucleosides, each of which can be modified or unmodified, independent from one another.
- Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage between nucleosides.
- Natural sugar means a sugar found in DNA (2'-H) or RNA (2'-OH).
- Internucleoside linkage means a covalent linkage between adjacent nucleosides.
- Linked nucleosides means nucleosides joined by a covalent linkage.
- Nucleobase means a heterocyclic moiety capable of non-covalently pairing with another nucleobase.
- Nucleoside means a nucleobase linked to a sugar moiety.
- Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of a nucleoside.
- Compound comprising a modified oligonucleotide consisting of a number of linked nucleosides means a compound that includes a modified oligonucleotide having the specified number of linked nucleosides. Thus, the compound may include additional substituents or conjugates. Unless otherwise indicated, the compound does not include any additional nucleosides beyond those of the modified oligonucleotide.
- Modified oligonucleotide means an oligonucleotide having one or more modifications relative to a naturally occurring terminus, sugar, nucleobase, and/or internucleoside linkage. A modified oligonucleotide may comprise unmodified nucleosides.
- Single-stranded modified oligonucleotide means a modified oligonucleotide which is not hybridized to a complementary strand.
- Modified nucleoside means a nucleoside having any change from a naturally occurring nucleoside.
- a modified nucleoside may have a modified sugar and an unmodified nucleobase.
- a modified nucleoside may have a modified sugar and a modified nucleobase.
- a modified nucleoside may have a natural sugar and a modified nucleobase.
- a modified nucleoside is a bicyclic nucleoside.
- a modified nucleoside is a non-bicyclic nucleoside.
- Modified internucleoside linkage means any change from a naturally occurring internucleoside linkage.
- Phosphorothioate internucleoside linkage means a linkage between nucleosides where one of the non-bridging atoms is a sulfur atom.
- Modified sugar moiety means substitution and/or any change from a natural sugar.
- Unmodified nucleobase means the naturally occurring heterocyclic bases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methylcytosine), and uracil (U).
- 5-methylcytosine means a cytosine comprising a methyl group attached to the 5 position.
- Non-methylated cytosine means a cytosine that does not have a methyl group attached to the 5 position.
- Modified nucleobase means any nucleobase that is not an unmodified nucleobase.
- “Sugar moiety” means a naturally occurring furanosyl or a modified sugar moiety.
- Modified sugar moiety means a substituted sugar moiety or a sugar surrogate.
- 2'-0-methyl sugar or "2'-OMe sugar” means a sugar having a O-methyl modification at the 2' position.
- 2'-0-methoxyethyl sugar or "2'-MOE sugar” means a sugar having a O-methoxyethyl modification at the 2' position.
- “Bicyclic sugar moiety” means a modified sugar moiety comprising a 4 to 7 membered ring (including by not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure.
- the 4 to 7 membered ring is a sugar ring.
- the 4 to 7 membered ring is a furanosyl.
- the bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.
- Nonlimiting exemplary bicyclic sugar moieties include LNA, ENA, cEt, S-cEt, and R-cEt.
- LNA locked nucleic acid
- sugar moiety means a substituted sugar moiety comprising a (CH 2 )-0 bridge between the 4' and 2' furanose ring atoms.
- ENA sugar moiety means a substituted sugar moiety comprising a (CH 2 )2-0 bridge between the 4' and 2' furanose ring atoms.
- Consstrained ethyl (cEt) sugar moiety means a substituted sugar moiety comprising a CH(CH 3 )- O bridge between the 4' and the 2' furanose ring atoms.
- the CH(CH 3 )-0 bridge is constrained in the S orientation.
- the (CH 2 )2-0 is constrained in the R orientation.
- S-cEt sugar moiety means a substituted sugar moiety comprising an S-constrained CH(CH 3 )-0 bridge between the 4' and the 2' furanose ring atoms.
- R-cEt sugar moiety means a substituted sugar moiety comprising an R-constrained CH(CH 3 )-0 bridge between the 4' and the 2' furanose ring atoms.
- 2'-0-methyl nucleoside means a 2'-modified nucleoside having a 2'-0-methyl sugar modification.
- 2'-0-methoxyethyl nucleoside means a 2'-modified nucleoside having a 2'-0-methoxyethyl sugar modification.
- a 2'-0-methoxyethyl nucleoside may comprise a modified or unmodified nucleobase.
- 2'-fluoro nucleoside means a 2 '-modified nucleoside having a 2'-fluoro sugar modification.
- a 2'-fluoro nucleoside may comprise a modified or unmodified nucleobase.
- Bicyclic nucleoside means a 2 '-modified nucleoside having a bicyclic sugar moiety.
- a bicyclic nucleoside may have a modified or unmodified nucleobase.
- cEt nucleoside means a nucleoside comprising a cEt sugar moiety.
- a cEt nucleoside may comprise a modified or unmodified nucleobase.
- S-cEt nucleoside means a nucleoside comprising an S-cEt sugar moiety.
- ⁇ -D-deoxyribonucleoside means a naturally occurring DNA nucleoside.
- ⁇ -D-ribonucleoside means a naturally occurring RNA nucleoside.
- LNA nucleoside means a nucleoside comprising a LNA sugar moiety.
- ENA nucleoside means a nucleoside comprising an ENA sugar moiety.
- Subject means a human or non-human animal selected for treatment or therapy.
- Subject in need thereof means a subject that is identified as in need of a therapy or treatment.
- Subject suspected of having means a subject exhibiting one or more clinical indicators of a disease.
- administering means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
- Parental administration means administration through injection or infusion.
- Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, and intramuscular administration.
- Subcutaneous administration means administration just below the skin.
- Intravenous administration means administration into a vein.
- administering refers to the co-administration of two or more agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time.
- Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration.
- the effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
- Duration means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent or pharmaceutical composition are administered.
- “Therapy” means a disease treatment method.
- therapy includes, but is not limited to, chemotherapy, radiation therapy, or administration of a pharmaceutical agent.
- Treatment means the application of one or more specific procedures used for the cure or amelioration of a disease.
- the specific procedure is the administration of one or more pharmaceutical agents.
- “Ameliorate” means to lessen the severity of at least one indicator of a condition or disease.
- amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease.
- the severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art.
- At risk for developing means the state in which a subject is predisposed to developing a condition or disease.
- a subject at risk for developing a condition or disease exhibits one or more symptoms of the condition or disease, but does not exhibit a sufficient number of symptoms to be diagnosed with the condition or disease.
- a subject at risk for developing a condition or disease exhibits one or more symptoms of the condition or disease, but to a lesser extent required to be diagnosed with the condition or disease.
- Prevent the onset of means to prevent the development of a condition or disease in a subject who is at risk for developing the disease or condition.
- a subject at risk for developing the disease or condition receives treatment similar to the treatment received by a subject who already has the disease or condition.
- Delay the onset of means to delay the development of a condition or disease in a subject who is at risk for developing the disease or condition.
- a subject at risk for developing the disease or condition receives treatment similar to the treatment received by a subject who already has the disease or condition.
- “Therapeutic agent” means a pharmaceutical agent used for the cure, amelioration or prevention of a disease.
- Dose means a specified quantity of a pharmaceutical agent provided in a single administration.
- a dose may be administered in two or more boluses, tablets, or injections.
- the desired dose requires a volume not easily accommodated by a single injection.
- two or more injections may be used to achieve the desired dose.
- a dose may be administered in two or more injections to minimize injection site reaction in an individual.
- a dose is administered as a slow infusion.
- Dosage unit means a form in which a pharmaceutical agent is provided.
- a dosage unit is a vial containing lyophilized oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted oligonucleotide.
- “Therapeutically effective amount” refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
- “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual that includes a pharmaceutical agent.
- a pharmaceutical composition may comprise a sterile aqueous solution.
- “Pharmaceutical agent” means a substance that provides a therapeutic effect when administered to a subject.
- Active pharmaceutical ingredient means the substance in a pharmaceutical composition that provides a desired effect.
- organ function means a change in organ function toward normal limits.
- organ function is assessed by measuring molecules found in a subject's blood or urine.
- improved kidney function is measured by a reduction in blood urea nitrogen, a reduction in proteinuria, a reduction in albuminuria, etc.
- “Acceptable safety profile” means a pattern of side effects that is within clinically acceptable limits.
- “Side effect” means a physiological response attributable to a treatment other than desired effects.
- side effects include, without limitation, injection site reactions, liver function test abnormalities, kidney function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. Such side effects may be detected directly or indirectly. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
- Subject compliance means adherence to a recommended or prescribed therapy by a subject.
- “Comply” means the adherence with a recommended therapy by a subject.
- Recommended therapy means a treatment recommended by a medical professional for the treatment, amelioration, or prevention of a disease.
- blood encompasses whole blood and blood fractions, such as serum and plasma.
- Alport Syndrome is an inherited form of kidney disease in which an abnormal level of glomerular basement membrane (GBM) is produced, leading to interstitial fibrosis, glomerular sclerosis and typically leads to end-stage renal disease.
- GBM glomerular basement membrane
- ESRD end-stage renal disease
- Alport Syndrome is characterized by progressive fibrosis due to defects in GBM composition, thus improvements in GBM morphology and function are desirable. It is demonstrated herein that modified oligonucleotide targeted to miR-21 improves kidney function in an experimental model of Alport Syndrome. Additionally, glomerular sclerosis and fibrosis are reduced following anti-miR-21 treatment. It is further demonstrated herein that anti-miR-21 improves survival in an experimental model of Alport Syndrome. As such, these modified oligonucleotides targeted to miR-21 are useful for the treatment of Alport Syndrome.
- the subject has been diagnosed as having Alport Syndrome prior to administration of the modified oligonucleotide.
- Diagnosis of Alport Syndrome may be achieved through evaluation of parameters including, without limitation, a subject's family history, clinical features (including without limitation proteinuria, albuminuria, hematuria, impaired GFR, deafness and/or ocular changes) and results of tissue biopsies. Kidney biopsies may be tested for the presence or absence of the type IV collagen alpha-3, alpha-4, and alpha-5 chains. Additionally, structural changes in the glomerulus can be detected by electron microscopy of kidney biopsy material.
- a skin biopsy may be tested for the presence of the type IV collagen alpha-5 chain, which is normally present in skin and almost always absent from male subjects with the X-linked form of Alport Syndrome.
- Diagnosis of Alport Syndrome may also include screening for mutations in one or more of the Col4a3, Col4a4, or Col4a5 genes.
- levels of miR-21 are increased in the kidney of a subject having Alport Syndrome. In certain embodiments, prior to administration, a subject is determined to have an increased level of miR-21 in the kidney. miR-21 levels may be measured from kidney biopsy material. In certain embodiments, prior to administration, a subject is determined to have an increased level of miR-21 in the urine or blood of the subject.
- administration of a modified oligonucleotide complementary to miR-21 results in one or more clinically beneficial outcomes.
- the administration improves kidney function.
- the administration delays the onset of end-stage renal disease.
- the administration delays time to dialysis.
- the administration delays time to renal transplant.
- the administration improves life expectancy of the subject.
- the administering reduces kidney fibrosis. In certain embodiments the administering slows further progression of kidney fibrosis. In certain embodiments, the administration halts further progression of kidney fibrosis. In certain embodiments, the administration reduces hematuria. In certain embodiments, the administration delays the onset of hematuria. In certain embodiments, the administration reduces proteinuria. In certain embodiments, the administration delays the onset of proteinuria.
- the subject having or suspected of having Alport Syndrome may have a mutation in the gene encoding the alpha 3 chain of type IV collagen (Col4a3), a mutation in the gene encoding the alpha 4 chain of type IV collagen (Col4a4), or a mutation in the gene encoding the alpha 5 chain of type IV collagen (Col4a5).
- the subject is male. In certain embodiments, the subject is female.
- the subject has impaired kidney function. In certain embodiments, the subject is in need of improved kidney function. In certain embodiments, the subject is identified as having impaired kidney function. In certain embodiments, the subject is identified as having hematuria. In certain embodiments, the subject is identified as having proteinuria. In any of the embodiments provided herein, a subject may be subjected to certain tests to evaluate kidney function. Such tests include, without limitation, measurement of blood urea nitrogen in the subject; measuring creatinine in the blood of the subject; measuring creatinine clearance in the blood of the subject; measuring proteinuria in the subject; measuring albumimcreatinine ratio in the subject;
- proteins present in the urine or blood may be used to evaluate kidney function.
- tests of kidney function include, but are not limited to, measuring N- acetyl- -D-glucosaminidase (NAG) protein in the urine of the subject; measuring neutrophil gelatinase- associated lipocalin (NGAL) protein in the urine of the subject; measuring kidney injury molecule- 1 (KIM- 1) protein in the urine of the subject; measuring interleukin- 18 (IL- 18) protein in the urine of the subject; measuring connective tissue growth factor (CTGF) levels in the urine of the subject; measuring monocyte chemoattractant protein 1 (MCP 1) levels in the urine of the subject; measuring collagen IV (Col IV) fragments in the urine of the subject; measuring collagen III (Col III) fragment levels in the urine of the subject; measuring cystatin C protein in the blood of a subject; measuring ⁇ -trace protein (BTP) in the blood of a subject; and measuring 2-microglobulin (B2M) in
- markers of podocyte injury can be measuring in the urine.
- proteins include nephrin and podocin.
- the proteins may be quantitated, for example, by enzyme-linked immunosorbent assay (ELISA), or radioimmunoassay ( IA) using commercially available kits.
- ELISA enzyme-linked immunosorbent assay
- IA radioimmunoassay
- the administration of a modified oligonucleotide targeted to miR-21 improves one or more markers of kidney function in the subject. Improvements in markers of kidney function include, without limitation: reduced blood urea nitrogen in the subject;
- Treatments for Alport Syndrome or any of the conditions listed herein may comprise more than one therapy.
- methods for treating a subject having or suspected of having Alport Syndrome comprising administering at least one therapy in addition to administering a modified oligonucleotide having a nucleobase sequence complementary to a miR-21.
- the at least one additional therapy comprises a pharmaceutical agent.
- pharmaceutical agents include angiotensin II receptor blockers (ARB).
- an angiotensin II receptor blocker is candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, or eprosartan.
- pharmaceutical agents include angiotensin II converting enzyme (ACE) inhibitors.
- ACE angiotensin II converting enzyme
- an ACE inhibitor is captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, or ramipril.
- a pharmaceutical agent is an anti-hypertensive agent.
- Anti-hypertensive agents are used to control blood pressure of the subject.
- a pharmaceutical agent is a vitamin D analog.
- Vitamin D analogs may be used to limit the production of parathyroid hormone in the subject.
- a pharmaceutical agent is an oral phosphate binder that reduces dietary phosphate absorption.
- pharmaceutical agents include immunosuppressive agents.
- an immunosuppressive agent is a corticosteroid, cyclophosphamide, or mycophenolate mofetil.
- a pharmaceutical agent is cyclosporine, an HMG-Coenzyme A inhibitor, a vasopeptidase inhibitor, or a TGF-beta-antagonist.
- an additional therapy is gene therapy.
- the gene therapy provides a normal Col4a3 gene.
- the gene therapy provides a normal Col4a4 gene.
- the gene therapy provides a normal Col4a5 gene.
- an additional therapy is dialysis. In certain embodiments, an additional therapy is renal transplant.
- pharmaceutical agents include anti-inflammatory agents.
- an anti-inflammatory agent is a steroidal anti-inflammatory agent.
- a steroid anti-inflammatory agent is a corticosteroid.
- a corticosteroid is prednisone.
- an anti-inflammatory agent is a non-steroidal anti-inflammatory drug.
- a non-steroidal anti-inflammatory agent is ibuprofen, a COX-I inhibitor, or a COX-2 inhibitor.
- a pharmaceutical agent is a pharmaceutical agent that blocks one or more responses to fibrogenic signals.
- pharmaceutical agents include anti-diabetic agent.
- Antidiabetic agents include, but are not limited to, biguanides, glucosidase inhibitors, insulins, sulfonylureas, and
- the modified oligonucleotides described herein have a nucleobase sequence that is complementary to miR-21 (SEQ ID NO: 1), or a precursor thereof (SEQ ID NO: 2).
- each nucleobase of the modified oligonucleotide is capable of undergoing base-pairing with a nucleobase at each corresponding position in the nucleobase sequence of miR-21 , or a precursor thereof.
- the nucleobase sequence of a modified oligonucleotide may have one or more mismatched base pairs with respect to the nucleobase sequence of miR-21 or precursor sequence, and remains capable of hybridizing to its target sequence.
- a modified oligonucleotide having a nucleobase sequence complementary to miR-21 is also complementary to a region of the miR-21 precursor.
- a modified oligonucleotide consists of a number of linked nucleosides that is equal to the length of miR-21.
- the number of linked nucleosides of a modified oligonucleotide is less than the length of miR-21.
- a modified oligonucleotide having a number of linked nucleosides that is less than the length of miR-21 , wherein each nucleobase of the modified oligonucleotide is complementary to each nucleobase at a corresponding position of miR-21, is considered to be a modified oligonucleotide having a nucleobase sequence that is fully complementary to a region of the miR-21 sequence.
- a modified oligonucleotide consisting of 19 linked nucleosides, where each nucleobase is complementary to a corresponding position of miR-21 that is 22 nucleobases in length, is fully complementary to a 19 nucleobase region of miR-21.
- Such a modified oligonucleotide has 100% complementarity to a 19 nucleobase portion of miR-21 , and is considered to be 100% complementary to miR-21.
- a modified oligonucleotide comprises a nucleobase sequence that is complementary to a seed sequence, i.e. a modified oligonucleotide comprises a seed-match sequence.
- a seed sequence is a hexamer seed sequence.
- a seed sequence is nucleobases 1-6 of miR-21.
- a seed sequence is nucleobases 2-7 of miR-21.
- a seed sequence is nucleobases 3-8 of miR-21.
- a seed sequence is a heptamer seed sequence.
- a heptamer seed sequence is nucleobases 1-7 of miR-21. In certain such embodiments, a heptamer seed sequence is nucleobases 2-8 of miR-21. In certain embodiments, the seed sequence is an octamer seed sequence. In certain such embodiments, an octamer seed sequence is nucleobases 1-8 of miR-21. In certain
- an octamer seed sequence is nucleobases 2-9 of miR-21.
- a modified oligonucleotide has a nucleobase sequence having one mismatch with respect to the nucleobase sequence of miR-21 , or a precursor thereof. In certain embodiments, a modified oligonucleotide has a nucleobase sequence having two mismatches with respect to the nucleobase sequence of miR-21 , or a precursor thereof. In certain such embodiments, a modified oligonucleotide has a nucleobase sequence having no more than two mismatches with respect to the nucleobase sequence of miR-21, or a precursor thereof. In certain such embodiments, the mismatched nucleobases are contiguous. In certain such embodiments, the mismatched nucleobases are not contiguous.
- the number of linked nucleosides of a modified oligonucleotide is greater than the length of miR-21.
- the nucleobase of an additional nucleoside is complementary to a nucleobase of the miR-21 stem-loop sequence.
- the number of linked nucleosides of a modified oligonucleotide is one greater than the length of miR-21.
- the additional nucleoside is at the 5' terminus of an oligonucleotide. In certain such embodiments, the additional nucleoside is at the 3 ' terminus of an oligonucleotide. In certain
- the number of linked nucleosides of a modified oligonucleotide is two greater than the length of miR-21.
- the two additional nucleosides are at the 5' terminus of an oligonucleotide.
- the two additional nucleosides are at the 3' terminus of an oligonucleotide.
- one additional nucleoside is located at the 5' terminus and one additional nucleoside is located at the 3 ' terminus of an oligonucleotide.
- a region of the oligonucleotide may be fully complementary to the nucleobase sequence of miR-21 , but the entire modified oligonucleotide is not fully complementary to miR-21.
- a modified oligonucleotide consisting of 24 linked nucleosides, where the nucleobases of nucleosides 1 through 22 are each complementary to a corresponding position of miR-21 that is 22 nucleobases in length has a 22 nucleoside portion that is fully complementary to the nucleobase sequence of miR-21 and approximately 92% overall complementarity to the nucleobase sequence of miR-21.
- a modified oligonucleotide has the structure 5'- A E CsATCsAGTCsTGAUsAAGC s TA E -3' (SEQ ID NO: 3), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript "S” indicate S-cEt nucleosides; and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide has the structure 5'- A E CsATCsA s GTCsUsGAU s A s AGCsUsA E -3' (SEQ ID NO: 3), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript "S” indicate S-cEt nucleosides; and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide has the structure 5'- Me C E A s A s T E CsUsA E A E UsA s A E G E CsT E A s -3' (SEQ ID NO: 4), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript "S” indicate S-cEt nucleosides; a superscript "Me” indicates a 5-methyl group on the base of the nucleoside; and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide has the structure 5'- A E CsA E T E CsA E G E T E CsTGAUsAAGCsU s A s -3' (SEQ ID NO: 3), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript "S” indicate S-cEt nucleosides; and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide comprises one or more 5-methylcytosines. In certain embodiments, each cytosine of a modified oligonucleotide comprises a 5-methylcytosine.
- a modified oligonucleotide consists of 8 to 30 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 12 to 25 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 15 to 30 linked nucleosides. In certain
- a modified oligonucleotide consists of 15 to 25 linked nucleosides.
- a modified oligonucleotide consists of 15 to 16 linked nucleosides.
- a modified oligonucleotide consists of 19 to 24 linked nucleosides.
- a modified oligonucleotide consists of 21 to 24 linked nucleosides.
- a modified oligonucleotide consists of 8 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 9 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 10 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 1 1 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 12 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 13 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 14 linked nucleosides.
- a modified oligonucleotide consists of 15 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 16 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 17 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 21 linked nucleosides.
- a modified oligonucleotide consists of 22 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 23 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 24 linked nucleosides. In certain embodiments, a modified oligonucleotide consists of 25 linked nucleosides.
- oligonucleotides provided herein may comprise one or more
- a modified nucleobase, sugar, and/or internucleoside linkage may be selected over an unmodified form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and increased stability in the presence of nucleases.
- a modified oligonucleotide comprises one or more modified nucleosides.
- a modified nucleoside is a stabilizing nucleoside.
- An example of a stabilizing nucleoside is a sugar-modified nucleoside.
- a modified nucleoside is a sugar-modified nucleoside.
- the sugar-modified nucleosides can further comprise a natural or modified heterocyclic base moiety and/or a natural or modified internucleoside linkage and may include further modifications independent from the sugar modification.
- a sugar modified nucleoside is a 2'- modified nucleoside, wherein the sugar ring is modified at the 2' carbon from natural ribose or 2'-deoxy- ribose.
- a 2 '-modified nucleoside has a bicyclic sugar moiety.
- the bicyclic sugar moiety is a D sugar in the alpha configuration.
- the bicyclic sugar moiety is a D sugar in the beta configuration.
- the bicyclic sugar moiety is an L sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the beta configuration.
- bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4'-CH 2 -0-2') BNA; (B) ⁇ -D-Methyleneoxy (4'-CH 2 -0-2') BNA; (C) Ethyleneoxy (4'- (CH 2 ) 2 -0-2') BNA; (D) Aminooxy (4'-CH 2 -0-N(R)-2') BNA; (E) Oxyamino (4'-CH 2 -N(R)-0-2') BNA; (F) Methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA (also referred to as constrained ethyl or cEt); (G) methylene-thio (4'-CH 2 -S-2') BNA; (H)
- Bx is a nucleobase moiety and R is, independently, H, a protecting group, or Q-C12 alkyl.
- a 2 '-modified nucleoside comprises a 2'-substituent group selected from F, 0-CH 3 , and OCH 2 CH 2 OCH 3 .
- a sugar-modified nucleoside is a 4'-thio modified nucleoside.
- a sugar-modified nucleoside is a 4 '-thio-2 '-modified nucleoside.
- a 4'-thio modified nucleoside has a ⁇ -D-ribonucleoside where the 4'-0 replaced with 4'-S.
- a 4'-thio-2'-modified nucleoside is a 4'-thio modified nucleoside having the 2'-OH replaced with a 2'-substituent group.
- Suitable 2'- substituent groups include 2'-OCH 3 , 2'-0-(CH 2 ) 2 -OCH 3 , and 2'-F.
- a modified oligonucleotide comprises one or more internucleoside modifications.
- each internucleoside linkage of a modified oligonucleotide is a modified internucleoside linkage.
- a modified internucleoside linkage comprises a phosphorus atom.
- a modified oligonucleotide comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified
- oligonucleotide is a phosphorothioate internucleoside linkage.
- a modified oligonucleotide comprises one or more modified
- a modified nucleobase is selected from 5-hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine. In certain embodiments, a modified nucleobase is selected from 7- deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. In certain embodiments, a modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
- a modified nucleobase comprises a polycyclic heterocycle. In certain embodiments, a modified nucleobase comprises a tricyclic heterocycle. In certain embodiments, a modified nucleobase comprises a phenoxazine derivative. In certain embodiments, the phenoxazine can be further modified to form a nucleobase known in the art as a G-clamp.
- a modified oligonucleotide is conjugated to one or more moieties which enhance the activity, cellular distribution or cellular uptake of the resulting antisense
- the moiety is a cholesterol moiety.
- the moiety is a lipid moiety. Additional moieties for conjugation include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
- the carbohydrate moiety is N-acetyl-D- galactosamine (GalNac).
- a conjugate group is attached directly to an
- a conjugate group is attached to a modified oligonucleotide by a linking moiety selected from amino, hydroxy 1, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 - carboxylate (SMCC), 6-aminohexanoic acid (AHEX or AHA), substituted CI -CIO alkyl, substituted or unsubstituted C2-C10 alkenyl, and substituted or unsubstituted C2-C10 alkynyl.
- a linking moiety selected from amino, hydroxy 1, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-
- a substituent group is selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- the compound comprises a modified oligonucleotide having one or more stabilizing groups that are attached to one or both termini of a modified oligonucleotide to enhance properties such as, for example, nuclease stability.
- stabilizing groups include cap structures. These terminal modifications protect a modified oligonucleotide from exonuclease degradation, and can help in delivery and/or localization within a cell.
- the cap can be present at the 5'- terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini.
- Cap structures include, for example, inverted deoxy abasic caps.
- compositions comprising oligonucleotides.
- a pharmaceutical composition provided herein comprises a compound comprising a modified oligonucleotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence complementary to miR-21.
- a pharmaceutical composition provided herein comprises a compound consisting of a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence complementary to miR-21.
- a pharmaceutical composition provided herein comprises a compound comprising a modified oligonucleotide consisting of 12 to 25 linked nucleosides and having a nucleobase sequence complementary to miR-21.
- Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracardiac, intraventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous).
- intrathecals are administered to achieve local rather than systemic exposures.
- pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the kidney).
- a pharmaceutical composition is administered in the form of a dosage unit (e.g., tablet, capsule, bolus, etc.).
- a pharmaceutical compositions comprises a modified oligonucleotide at a dose within a range selected from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to 600 mg, 25 mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to 500 mg, 300 mg to 400 mg, and 400 mg to 600 mg.
- such pharmaceutical compositions comprise a modified oligonucleotide in a dose selected from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 1 10 mg, 1 15 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 270 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg,
- composition of the comprises a dose of modified oligonucleotide selected from 25 mg, 50 mg, 75 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 600 mg, 700 mg, and 800mg.
- a pharmaceutical agent is sterile lyophilized modified oligonucleotide that is reconstituted with a suitable diluent, e.g., sterile water for injection or sterile saline for injection.
- a suitable diluent e.g., sterile water for injection or sterile saline for injection.
- the reconstituted product is administered as a subcutaneous injection or as an intravenous infusion after dilution into saline.
- the lyophilized drug product consists of a modified oligonucleotide which has been prepared in water for injection, or in saline for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized.
- the lyophilized modified oligonucleotide may be 25-800 mg of an oligonucleotide.
- the lyophilized modified oligonucleotide is an amount of an oligonucleotide within a range selected from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to 600 mg, 25 mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to 500 mg, 300 mg to 400 mg, and 400 mg to 600 mg.
- the lyophilized drug product may be packaged in a 2 mL Type I, clear glass vial (ammonium sulfate -treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum FLIP-OFF® overseal.
- the pharmaceutical compositions provided herein may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art- established usage levels.
- the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or antiinflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forms of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
- the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- INTRALIPID is used to prepare a pharmaceutical composition comprising an oligonucleotide.
- Intralipid is fat emulsion prepared for intravenous administration. It is made up of 10% soybean oil, 1.2% egg yolk phospholipids, 2.25% glycerin, and water for injection. In addition, sodium hydroxide has been added to adjust the pH so that the final product pH range is 6 to 8.9.
- a pharmaceutical composition provided herein comprise a polyamine compound or a lipid moiety complexed with a nucleic acid.
- such preparations comprise one or more compounds each individually having a structure defined by formula (Z) or a pharmaceutically acceptable salt thereof, wherein each X a and X b , for each occurrence, is independently Ci_6 alkylene; n is 0, 1 , 2, 3, 4, or 5; each R is independently H, wherein at least n + 2 of the R moieties in at least about 80% of the molecules of the compound of formula (Z) in the preparation are not H; m is 1 , 2, 3 or 4; Y is O, NR 2 , or S; R 1 is alkyl, alkenyl, or alkynyl; each of which is optionally substituted with one or more substituents; and R 2 is H, alkyl, alkenyl, or alkynyl; each of which is optionally substituted each of which is optionally substituted with one or more substituents; and R
- compositions provided herein comprise one or more modified oligonucleotides and one or more excipients.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
- a pharmaceutical composition provided herein is prepared using known techniques, including, but not limited to mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes.
- a pharmaceutical composition provided herein is a liquid (e.g., a suspension, elixir and/or solution).
- a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.
- a pharmaceutical composition provided herein is a solid (e.g., a powder, tablet, and/or capsule).
- a solid pharmaceutical composition comprising one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrating agents.
- a pharmaceutical composition provided herein is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot preparations are prepared using suitable polymeric or hydrophobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- a pharmaceutical composition provided herein comprises a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
- a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- a pharmaceutical composition provided herein comprises a sustained- release system.
- a sustained-release system is a semi-permeable matrix of solid hydrophobic polymers.
- sustained-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
- a pharmaceutical composition provided herein comprises a modified oligonucleotide in a therapeutically effective amount.
- the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
- one or more modified oligonucleotides provided herein is formulated as a prodrug.
- a prodrug upon in vivo administration, is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide.
- prodrugs are useful because they are easier to administer than the corresponding active form.
- a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form.
- a prodrug may have improved solubility compared to the corresponding active form.
- prodrugs are less water soluble than the corresponding active form.
- a prodrug is an ester.
- the ester is metabolically hydrolyzed to carboxylic acid upon administration.
- the carboxylic acid containing compound is the corresponding active form.
- a prodrug comprises a short peptide (polyaminoacid) bound to an acid group.
- the peptide is cleaved upon administration to form the corresponding active form.
- a prodrug is produced by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration.
- the prodrug can be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug.
- Treatments for a disease associated with miR-21 may comprise more than one therapy.
- methods for treating a subject having or suspected of having a disease associated with miR-21 comprising administering at least one therapy in addition to administering a modified oligonucleotide having a nucleobase sequence complementary to the microRNA.
- the at least one additional therapy comprises a pharmaceutical agent.
- pharmaceutical agents include anti-inflammatory agents.
- an anti-inflammatory agent is a steroidal anti-inflammatory agent.
- a steroid anti-inflammatory agent is a corticosteroid.
- a corticosteroid is prednisone.
- an anti-inflammatory agent is a non-steroidal anti-inflammatory drugs.
- a non-steroidal anti-inflammatory agent is ibuprofen, a COX-I inhibitors, or a COX-2 inhibitors.
- pharmaceutical agents include anti-diabetic agents.
- Antidiabetic agents include, but are not limited to, biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones.
- pharmaceutical agents include, but are not limited to, diuretics (e.g. spironolactone, eplerenone, furosemide), inotropes (e.g. dobutamine, milrinone), digoxin, vasodilators, angiotensin II converting enzyme (ACE) inhibitors (e.g. are captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril), angiotensin II receptor blockers (ARB) (e.g.
- diuretics e.g. spironolactone, eplerenone, furosemide
- inotropes e.g. dobutamine, milrinone
- digoxin e.g. dobutamine, milrinone
- vasodilators e.g. are captopril, enalapril, lisinopril, benaze
- an ACE inhibitor is selected from cilazapril, perindopril, and trandolapril.
- an ACE inhibitor is administered at a dose of 0.025 to 0.1 mg/kg body weight. In certain embodiments, an ACE inhibitor is administered at a dose of 0.125 to 1.0 mg/kg bodyweight. In certain embodiments, an ACE inhibitor is administered at a dose ranging from 1 to 6 mg/m 2 /day. In certain embodiments, an ACE inhibitor is administered at a dose ranging from 1 to 2 mg/m 2 /day. In certain embodiments, an ACE inhibitor is administered at a dose ranging from 2 to 4 mg/m 2 /day. In certain embodiments, an ACE inhibitor is administered at a dose ranging from 0.5 to 1 mg/m 2 /day.
- ramipril is administered at a dose ranging from 1 to 6 mg/m 2 /day. In certain embodiments, ramipril is administered at a dose ranging from 1 to 2 mg/m 2 /day. In certain embodiment, enalapril is administered at a dose ranging from 2 to 4 mg/m 2 /day. In certain embodiment, lisinopril is administered at a dose ranging from 4 to 8 mg/m 2 /day. In certain embodiment, benazepril is administered at a dose ranging from 4 to 8 mg/m 2 /day. In certain embodiment, fosinopril is administered at a dose ranging from 4 to 8 mg/m 2 /day.
- quinapril is administered at a dose ranging from 4 to 8 mg/m 2 /day.
- cilazapril is administered at a dose ranging from 1 to 2 mg/m 2 /day.
- perinpril is administered at a dose ranging from 1 to 2 mg/m 2 /day.
- trandolapril is administered at a dose ranging from 0.5 to 1 mg/m 2 /day.
- an ARB is administered at a dose ranging from 6.25 to 150 mg/m2/day. In certain embodiments, an ARB is administered at a dose of 6.25 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 10 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 12.5 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 18.75 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 37.5 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 50 mg/m 2 /day. In certain embodiments, an ARB is administered at a dose of 150 mg/m 2 /day.
- losartan is administered at a dose of 12.5 mg/m 2 /day. In certain embodiments, losartan is administered at a dose of 12.5 mg/m 2 /day. In certain embodiments, candesartan is administered at a dose of 6.25 mg/m 2 /day. In certain embodiments, irbestartan is administered at a dose of 37.5 mg/m 2 /day. In certain embodiments, telmisartan is administered at a dose of 10 mg/m 2 /day. In certain embodiments, valsartan is administered at a dose of 18.75 mg/m 2 /day. In certain embodiments, espresartan is administered at a dose of 150 mg/m 2 /day.
- a pharmaceutical agent is an aldosterone antagonsist.
- an aldosterone antagonist is spironolactone.
- spironolactone is administered at a dose ranging from 10 to 35 mg daily. In certain embodiments, spironolactone is administered at a dose of 25 mg daily.
- pharmaceutical agents include heparinoids.
- a heparinoid is pentosan polysulfate.
- a pharmaceutical agent is a pharmaceutical agent that blocks one or more responses to fibrogenic signals.
- a pharmaceutical agent is an anti-connective tissue growth factor therapy.
- an anti-CTGF therapy is a monoclonal antibody against CTGF.
- an additional therapy may be a pharmaceutical agent that enhances the body's immune system, including low-dose cyclophosphamide, thymostimulin, vitamins and nutritional supplements (e.g., antioxidants, including vitamins A, C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q- 10 and echinacea), and vaccines, e.g., the immunostimulating complex (ISCOM), which comprises a vaccine formulation that combines a multimeric presentation of antigen and an adjuvant.
- vitamins and nutritional supplements e.g., antioxidants, including vitamins A, C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q- 10 and echinacea
- vaccines e.g., the immunostimulating complex (ISCOM), which comprises a vaccine formulation that combines a multimeric presentation of antigen and an adjuvant.
- ISCOM immunostimulating complex
- the additional therapy is selected to treat or ameliorate a side effect of one or more pharmaceutical compositions of the present invention.
- side effects include, without limitation, injection site reactions, liver function test abnormalities, kidney function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
- increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
- increased bilirubin may indicate liver toxicity or liver function abnormality.
- additional pharmaceutical agents include, but are not limited to,
- immunoglobulins including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); salicylates; antibiotics; antivirals; antifungal agents; adrenergic modifiers; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and thyroid hormones); immunomodulators; muscle relaxants; antihistamines; osteoporosis agents (e.g., biphosphonates, calcitonin, and estrogens); prostaglandins, antineoplastic agents; psychotherapeutic agents; sedatives; poison oak or poison sumac products; antibodies; and vaccines.
- IVIg intravenous immunoglobulin
- analgesics e.g., acetaminophen
- salicylates antibiotics
- antivirals e.g., antivirals
- antifungal agents e.g., antifung
- kits comprise one or more compounds of the invention comprising a modified oligonucleotide, wherein the nucleobase sequence of the oligonucleotide is complementary to the nucleobase sequence of miR-21.
- the compounds complementary to miR-21 can have any of the nucleoside patterns described herein.
- the compounds complementary to miR-21 can be present within a vial.
- a plurality of vials, such as 10, can be present in, for example, dispensing packs.
- the vial is manufactured so as to be accessible with a syringe.
- the kit can also contain instructions for using the compounds complementary to miR-21.
- kits may be used for administration of the compound complementary to miR-21 to a subject.
- the kit can further comprise one or more of the following: syringe, alcohol swab, cotton ball, and/or gauze pad.
- the compounds complementary to miR-21 can be present in a pre-filled syringe (such as a single-dose syringes with, for example, a 27 gauge, 1 ⁇ 2 inch needle with a needle guard), rather than in a vial.
- a plurality of pre-filled syringes, such as 10 can be present in, for example, dispensing packs.
- the kit can also contain instructions for administering the compounds complementary to miR-21.
- the present invention provides methods of using and/or testing modified oligonucleotides of the present invention in an experimental model. Those having skill in the art are able to select and modify the protocols for such experimental models to evaluate a pharmaceutical agent of the invention.
- modified oligonucleotides are first tested in cultured cells.
- Suitable cell types include those that are related to the cell type to which delivery of a modified oligonucleotide is desired in vivo.
- suitable cell types for the study of the methods described herein include primary or cultured cells.
- the extent to which a modified oligonucleotide interferes with the activity of miR-21 is assessed in cultured cells.
- inhibition of microRNA activity may be assessed by measuring the levels of the microRNA.
- the level of a predicted or validated microRNA-regulated transcript may be measured.
- An inhibition of microRNA activity may result in the increase in the miR-21 -regulated transcript, and/or the protein encoded by miR-21 -regulated transcript.
- certain phenotypic outcomes may be measured.
- inhibitors of miR-21 may be studied in an experimental model of Alport Syndrome, for example CoUa knockout mice (Col4a3 ' mice).
- the severity of the disease in the mouse model depends upon the genetic background of the mouse carrying the Col4a3 mutation.
- the onset and progression of the disease are generally more rapid on the 129Xl/SvJ relative to the C57BL/6J background.
- the genetic background of the Col4a3 ' mouse may be selected to vary the onset and progression of disease.
- Additional models include canine models of X- linked, autosomal recessive or autosomal dominant Alport Syndrome. See, for example, Kashtan, Nephrol. Dial. Transplant, 2002, 17: 1359-1361.
- antisense inhibition of miR-21 following the administration of modified oligonucleotides may be assessed by a variety of methods known in the art. In certain embodiments, these methods are be used to quantitate microRNA levels in cells or tissues in vitro or in vivo. In certain embodiments, changes in microRNA levels are measured by microarray analysis. In certain embodiments, changes in microRNA levels are measured by one of several commercially available PCR assays, such as the TaqMan® MicroRNA Assay (Applied Biosystems). In certain embodiments, antisense inhibition of miR-21 is assessed by measuring the mRNA and/or protein level of a target of miR-21. Antisense inhibition of miR-21 generally results in the increase in the level of mRNA and/or protein of a target of the microRNA.
- Modulation of microRNA activity with an anti-miR or microRNA mimic may be assessed by measuring target engagement.
- target engagement is measured by microarray profiling of mRNAs.
- the sequences of the mRNAs that are modulated (either increased or decreased) by the anti-miR or microRNA mimic are searched for microRNA seed sequences, to compare modulation of mRNAs that are targets of the microRNA to modulation of mRNAs that are not targets of the microRNA. In this manner, the interaction of the anti-miR with miR-21, or miR-21 mimic with its targets, can be evaluated.
- mRNAs whose expression levels are increased are screened for the mRNA sequences that comprise a seed match to the microRNA to which the anti-miR is complementary.
- Example 1 Anti-miR-21 in a model of Alport Syndrome
- Modified oligonucleotides complementary to miR-21 were tested in the Col4a3 ' model of Alport Syndrome. Wild-type mice were used as control mice.
- the structure of the anti-miR-21 compound is 5'-A E C s ATC s AGTC s TGAU s AAGC s TA E -3' (SEQ ID NO: 3), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides;
- nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript “S” indicate S-cEt nucleosides.
- Each internucleoside linkage is a phosphorothioate internucleoside linkage.
- Endpoints in blood or urine included measurement of blood urea nitrogen (BUN), albuminuria, albumin/creatinine ratio, glomerular filtration rate. Histological analysis included evaluation of glomerular sclerosis, interstitial fibrosis, injury to the tubules, macrophage infiltration, and presence of myofibroblasts.
- BUN blood urea nitrogen
- albuminuria albumin/creatinine ratio
- glomerular filtration rate included evaluation of glomerular sclerosis, interstitial fibrosis, injury to the tubules, macrophage infiltration, and presence of myofibroblasts.
- BUN Blood urea nitrogen
- Col4a3+/+ mice was approximately 12.5 mg/kL (within normal limits; not shown).
- BUN is a blood marker of kidney function. Higher BUN correlates with poorer kidney function. A reduction in BUN is an indicator of reduced kidney injury and damage and improved function.
- Albuminuria is a sensitive measure of glomerular and tubular damage. A reduction in albumin to creatinine ratio indicates a reduction in glomerular and/or tubular disease.
- Alport Sydrome is also characterized by progressive development of glomerulosclerosis and significant interstitial kidney fibrosis that occurs as inappropriate glomerular leakage occurs.
- Renal tissue injury was assessed in paraffin-embedded and paraformaldehyde (4%)-fixed tissue sections stained by the periodic acid-Schiff (PAS) reaction. Initially the kidney sections were ranked for overall injury based on tubule and glomerular injury and inflammation. Damage was assessed based on a variety of factors including tubule dilation, loss of brush border, cellular infiltration, glomerular inflammation, interstitial edema and cellular necrosis. Kidney sections were ranked in a blinded fashion for overall injury and given a kidney injury rank score. The kidney sections from Col4a3 -/- mice showed a significantly lower kidney injury rank score, which is indicative of less kidney injury (Figure 4A).
- the glomeruli were assessed by a blinded observer for the proportion that had glomerular crescents.
- the crescent is a proliferation of cells within Bowman's capsule, is defined by ⁇ 2 layers of cells within Bowman's space.
- the crescent is a well-established marker of glomerular injury.
- the proportion of glomeruli with crescents was approximately 44%, whereas in mice that received the PBS control treatment, the proportion of glomeruli with crescents was approximately 19% ( Figure 4B).
- the proportion of glomeruli with crescents was less than 5% (not shown).
- the tubules of the nephrons of the kidney are also a site for damage.
- the tubule damage was assessed by overlaying a grid over sequential images covering the whole sagittal section of each kidney. In a blinded fashion, damage of the tubules was assessed in each square of the grid.
- Tubular damage was assessed based on the presence of tubule dilation/flattening, loss of brush border, cellular infiltration, and cellular necrosis. The presence of these features results in a positive score for that square on the grid.
- An overall score is applied to each image which is the % of squares that has tubule damage. This is averaged for all the images from that kidney. The average score for each kidney is then subjected to statistical analysis.
- tubule injury score was significantly lower in the Col4a3-/- mice treated with anti-miR-21, relative to the Col4a3-/- receiving PBS ( Figure 4C).
- the tubule injury score in Col4a3+/+ littermates was less than 10% (not shown).
- ROS Reactive oxygen species
- one mechanism by which anti-miR-21 may reduce kidney injury may include a reduction in the generation of reactive oxygen species.
- Podocytes are highly specialized epithelial cells that are an essential component of the glomerular filtration barrier. Podocyte loss can lead to proteinuria, and in some disease states to glomerularsclerosis.
- podocyte number was measured in anti-miR-21 and PBS-treated mice. Podocyte number was significantly increased in Col4a3-/- mice that received anti-miR-21 , relative to PBS-treated mice, and was comparable to the podocyte number observed in wild type littermates of Col4a3-/- mice ( Figure 7). Accordingly, one mechanism by which anti-miR-21 may reduce kidney injury in a model of Alport Syndrome is by preventing or reducing podocyte loss.
- anti-miR-21 compound #1 (above): 5'-A E CsATCsAGTCsTGAUsAAGC s TA E -3 ' (SEQ ID NO:3) anti-miR-21 compound #2: 5'-A E CsATCsA s GTCsUsGAU s A s AGCsUsA E -3 ' (SEQ ID NO: 3); anti-miR-21 compound #3 : 5'- Me C E A s A s T E CsUsA E A E UsA s A E G E C s T E A s -3 ' (SEQ ID NO: 4); and anti-miR-21 compound #4: 5'-A E CsA E T E CsA E G E T E CsTGAUsAAGCsU s A s -3 ' (SEQ ID NO: 3); where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides; nucleosides followed by a sub
- Each compound was administered to three-week old Col4a3-/- mice at a dose of 25 mg/kg, twice weekly, for nine weeks.
- Control groups included Col4a3-/- mice treated with PBS, and wild-type littermates of Col4a37- mice. Each treatment group contained 10 to 12 mice.
- endpoints were evaluated as described above and included BUN, urinary albumin to creatinine ratio, kidney injury (PAS staining), glomerulosclerosis, and proportion of glomeruli with crescents.
- endpoints included BUN, urinary albumin to creatinine ratio, and collagen gene expression (as a measure of fibrosis), evaluated as described above.
- anti-miR-21 compound #1 improved all endpoints evaluated.
- the efficacy of both anti-miR-21 compounds #2 was similar to that of compound #1 , with improvements observed in BUN, urinary albumin to creatinine ratio, kidney injury, extent of
- Example 2 Elevation of miR-21 in a model of Alport Syndrome
- miR-21 levels were measured in kidney tissue harvested from mice. RNA was isolated from whole kidney and miR-21 was measured by quantitative PCR. In Col4a3-/- mice, miR-21 levels were elevated
- a subject receiving treatment for Alport Syndrome may be identified as having elevated miR-21 in kidney biopsy material, urine, or blood, prior to administration of the treatment.
- Example 3 Survival studies in a model of Alport Syndrome
- Wild-type mice generally live for 2 to 3 years (or 730 to 1095 days).
- end-stage renal failure can occur as early as 2 months of age.
- Col4a3-/-on a C57BL/6J background end-stage renal failure can occur as early as 6 months of age.
- the lifespan of Col4a3-/- mice is significantly shorter than that of wild-type mice.
- Col4a3-/- mice, on any genetic background can be serve as a model for end-stage renal failure in Alport Syndrome and can be used to evaluate the effects of candidate therapeutic agents on life expectancy.
- mice are genotyped to identify Col4a3-/- mice.
- Anti-miR-21 is administered subcutaneously at a dose of ranging from 10 to 25 mg/kg, once or twice per week for up to one year.
- PBS may be administered as a control treatment.
- Overnight urine samples (approximately 16 hours) are collected on a weekly or monthly schedule throughout the study. Age of each mouse at death is recorded. Plasma and kidneys are collected at death or at the end of the study. Fluid and tissue samples are analyzed to determine changes in kidney function, glomerularsclerosis, and fibrosis.
- Fluid and tissue samples are analyzed to determine changes in kidney function, kidney damage and glomerular sclerosis and interstitial fibrosis.
- Endpoints in blood or urine include measurement of blood urea nitrogen (BUN), albuminuria, albumin/creatinine ratio, glomerular filtration rate.
- Histological analysis includes evaluation of glomerular sclerosis, interstitial fibrosis, injury to the tubules, macrophage infiltration, and presence of myofibroblasts.
- Anti-miR-21 increases survival in a model of Alport Syndrome-single dose study
- anti-miR-21 compound was administered to Col4a3-/- mice.
- the structure of the anti-miR-21 compound is 5'-A E CsATCsAGTCsTGAUsAAGC s TA E -3' (SEQ ID NO: 3), where nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides;
- nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript “S” indicate S-cEt nucleosides.
- Each internucleoside linkage is a phosphorothioate
- Col4a3+/l mice (heterozygotes) on a 129Xl/SvJ background were crossed to generate Col4a3-/- mice. At 3 weeks of age, mice were genotyped to identify Col4a3-/- mice.
- Col4a3-/- mice experienced weight loss beginning at around 9 weeks of age, and death occurred between 9 and 1 1 weeks of age.
- anti-miR-21 increased peak body weight and significantly delayed weight loss (p ⁇ 0.01).
- anti-miR-21 significantly increased lifespan (p ⁇ 0.001).
- treatment with anti-miR-21 not only delayed the weight loss, but importantly improved survival of Col4a3-/- mice.
- Anti-miR-2 liner eases survival in a model of Alport Syndrome-dose response study
- the structure of the anti-miR-21 compound is 5'-A E CsATCsAGTCsTGAUsAAGC s TA E -3' (SEQ ID NO:
- nucleosides not followed by a subscript indicate ⁇ -D-deoxyribonucleosides
- nucleosides followed by a subscript "E” indicate 2'-MOE nucleosides; nucleosides followed by a subscript “S” indicate S-cEt nucleosides.
- Each internucleoside linkage is a phosphorothioate
- mice were genotyped to identify Col4a3-/- mice.
- Treatment groups were:
- treatment with anti-miR-21 increased the lifespan of Col4a3-/- mice in a dose responsive manner.
- the increased lifespan was observed for both twice weekly and once weekly treatments.
- the median survival was as follows: PBS, 62 days; 12.5 mg/kg anti-miR-21 once weekly (QW), 72.5 days; 25 mg/kg anti-miR-21 once weekly (QW), 77 days; 50 mg/kg anti-miR-21 once weekly (QW), 89 days; 25 mg/kg anti-miR-21 twice weekly (BIW), 82.5 days.
- Oligonucleotides including anti-miR compounds, are known to distribute to several cell types within the kidney. As reported by Chau et al., Sci Transl Med., 2012, 121ral 8, following administration of a Cy3-labeled anti-miR to either normal mice or mice subjected to kidney injury (unilateral ureteral obstruction, a model of interstitial fibrosis), the greatest fluorescence intensity in the kidney was in proximal tubule epithelium. The endothelium, pericytes, myofibroblasts, and macrophages also all contained detectable amounts of Cy3 -labeled anti-miR.
- glomerulus in particular podocytes, did not appear to take up significant amounts of anti-miR consistent with the known distribution of chemically modified oligonucleotides (Masarjian et al., Oligonucleotides, 2004, 14, 299- 310).
- Sections of kidney tissue were co-labeled with antibodies specific to several different cellular markers to identify anti-miR uptake in particular cell types. Staining was performed for alpha-SMA (a myofibroblast marker), PDGFR-beta (a pericyte/myofibroblast marker), CD31 (an endothelial cell marker), F4/80 (a macrophage marker), and GP38 (a podocyte marker).
- alpha-SMA a myofibroblast marker
- PDGFR-beta a pericyte/myofibroblast marker
- CD31 an endothelial cell marker
- F4/80 a macrophage marker
- GP38 a podocyte marker
- the efficacy observed following anti-miR-21 administration in an experimental model of Alport Syndrome is accompanied by improvements not only in interstitial fibrosis surrounding tubules but also fibrosis in the glomeruli (known as glomerulosclerosis). These data suggest that those improvements may be directly related to anti-miR-21 effects in the glomeruli, in addition to or instead of feedback from an improved tubule structure and function.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Epidemiology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Obesity (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (34)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| UAA201504453A UA116639C2 (uk) | 2012-10-09 | 2013-08-10 | Способи лікування синдрому альпорта |
| MYPI2015000876A MY183921A (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| BR112015007709-9A BR112015007709B1 (pt) | 2012-10-09 | 2013-10-08 | Uso de um oligonucleotídeo modificado |
| JP2015535891A JP6272880B2 (ja) | 2012-10-09 | 2013-10-08 | アルポート症候群の処置方法 |
| AU2013329427A AU2013329427B2 (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of Alport Syndrome |
| KR1020237031594A KR20230136686A (ko) | 2012-10-09 | 2013-10-08 | 알포트 증후군의 치료 방법 |
| DK13777458T DK2906698T3 (da) | 2012-10-09 | 2013-10-08 | Fremgangsmåde til behandling af alports syndrom |
| EP19188663.9A EP3620522B1 (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| HRP20191948TT HRP20191948T1 (hr) | 2012-10-09 | 2013-10-08 | Postupci za liječenje alportovog sindroma |
| CN201380051249.9A CN104718295B (zh) | 2012-10-09 | 2013-10-08 | 用于治疗奥尔波特综合征的方法 |
| EP13777458.4A EP2906698B1 (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| PL13777458T PL2906698T3 (pl) | 2012-10-09 | 2013-10-08 | Sposoby leczenia zespołu alporta |
| RS20191380A RS60014B1 (sr) | 2012-10-09 | 2013-10-08 | Postupci za lečenje alportovog sindroma |
| NZ630596A NZ630596A (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| LT13777458T LT2906698T (lt) | 2012-10-09 | 2013-10-08 | Alporto sindromo gydymo būdai |
| SG11201502748RA SG11201502748RA (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| EA201590711A EA201590711A1 (ru) | 2012-10-09 | 2013-10-08 | Способы лечения синдрома альпорта |
| HK16100081.2A HK1212378B (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| KR1020157009045A KR102165189B1 (ko) | 2012-10-09 | 2013-10-08 | 알포트 증후군의 치료 방법 |
| MX2015004460A MX356340B (es) | 2012-10-09 | 2013-10-08 | Oligonucleótidos para usarse en el tratamiento del síndrome de alport. |
| SI201331597T SI2906698T1 (sl) | 2012-10-09 | 2013-10-08 | Postopki zdravljenja Alportovega sindroma |
| ES13777458T ES2753174T3 (es) | 2012-10-09 | 2013-10-08 | Métodos de tratamiento de Síndrome de Alport |
| CA2885605A CA2885605A1 (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
| KR1020207028577A KR102349184B1 (ko) | 2012-10-09 | 2013-10-08 | 알포트 증후군의 치료 방법 |
| KR1020227000173A KR20220005634A (ko) | 2012-10-09 | 2013-10-08 | 알포트 증후군의 치료 방법 |
| IL237768A IL237768B (en) | 2012-10-09 | 2015-03-16 | Methods for treating Alport syndrome |
| TNP2015000099A TN2015000099A1 (en) | 2012-10-09 | 2015-03-16 | Methods for treatment of alport syndrome |
| ZA2015/02087A ZA201502087B (en) | 2012-10-09 | 2015-03-26 | Methods for treatment of alport syndrome |
| PH12015500781A PH12015500781A1 (en) | 2012-10-09 | 2015-04-08 | Methods for treatment of alport syndrome |
| CR20150236A CR20150236A (es) | 2012-10-09 | 2015-05-07 | Métodos para el tratamiento del síndrome de alport |
| IL262200A IL262200A (en) | 2012-10-09 | 2018-10-08 | Methods for treating Alport syndrome |
| AU2019210494A AU2019210494A1 (en) | 2012-10-09 | 2019-07-29 | Methods for treatment of Alport Syndrome |
| CY20191101129T CY1122479T1 (el) | 2012-10-09 | 2019-10-30 | Μεθοδοι για θεραπεια συνδρομου alport |
| AU2021269404A AU2021269404A1 (en) | 2012-10-09 | 2021-11-18 | Methods for treatment of Alport Syndrome |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261711514P | 2012-10-09 | 2012-10-09 | |
| US61/711,514 | 2012-10-09 | ||
| US201361779137P | 2013-03-13 | 2013-03-13 | |
| US61/779,137 | 2013-03-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014058881A1 true WO2014058881A1 (en) | 2014-04-17 |
Family
ID=49382663
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/063884 Ceased WO2014058881A1 (en) | 2012-10-09 | 2013-10-08 | Methods for treatment of alport syndrome |
Country Status (34)
| Country | Link |
|---|---|
| US (8) | US9012423B2 (https=) |
| EP (2) | EP3620522B1 (https=) |
| JP (4) | JP6272880B2 (https=) |
| KR (4) | KR20230136686A (https=) |
| CN (1) | CN104718295B (https=) |
| AR (1) | AR092940A1 (https=) |
| AU (3) | AU2013329427B2 (https=) |
| BR (1) | BR112015007709B1 (https=) |
| CA (1) | CA2885605A1 (https=) |
| CL (1) | CL2015000873A1 (https=) |
| CR (1) | CR20150236A (https=) |
| CY (1) | CY1122479T1 (https=) |
| DK (1) | DK2906698T3 (https=) |
| EA (1) | EA201590711A1 (https=) |
| ES (2) | ES2960488T3 (https=) |
| HR (1) | HRP20191948T1 (https=) |
| HU (1) | HUE045858T2 (https=) |
| IL (2) | IL237768B (https=) |
| LT (1) | LT2906698T (https=) |
| MX (1) | MX356340B (https=) |
| MY (1) | MY183921A (https=) |
| NZ (1) | NZ630596A (https=) |
| PH (1) | PH12015500781A1 (https=) |
| PL (1) | PL2906698T3 (https=) |
| PT (1) | PT2906698T (https=) |
| RS (1) | RS60014B1 (https=) |
| SG (1) | SG11201502748RA (https=) |
| SI (1) | SI2906698T1 (https=) |
| TN (1) | TN2015000099A1 (https=) |
| TW (1) | TWI641388B (https=) |
| UA (1) | UA116639C2 (https=) |
| UY (1) | UY35069A (https=) |
| WO (1) | WO2014058881A1 (https=) |
| ZA (1) | ZA201502087B (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9012423B2 (en) | 2012-10-09 | 2015-04-21 | Regulus Therapeutics Inc. | Methods for treatment of alport syndrome |
| US9181547B2 (en) | 2011-04-25 | 2015-11-10 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating MIR-21 activity |
| US9267137B2 (en) | 2012-04-25 | 2016-02-23 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating miR-21 activity |
| EP3564373A4 (en) * | 2016-12-28 | 2020-12-16 | Daiichi Sankyo Company, Limited | THERAPEUTIC DRUG FOR ALPORT SYNDROME |
| US10953020B2 (en) | 2016-11-08 | 2021-03-23 | Reata Pharmaceuticals, Inc. | Methods of treating Alport syndrome using bardoxolone methyl or analogs thereof |
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| US12440539B2 (en) | 2020-03-20 | 2025-10-14 | Keros Therapeutics, Inc. | Methods of using activin receptor type IIB variants |
| US12522646B2 (en) | 2020-03-20 | 2026-01-13 | Keros Therapeutics, Inc. | Activin receptor type II chimeras and methods of use thereof |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2302055B1 (en) | 2004-11-12 | 2014-08-27 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US9994846B2 (en) | 2013-10-25 | 2018-06-12 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating miR-21 activity |
| GB201410693D0 (en) | 2014-06-16 | 2014-07-30 | Univ Southampton | Splicing modulation |
| WO2016014781A1 (en) * | 2014-07-25 | 2016-01-28 | Rgdi3, Inc. | Collagen iv replacement |
| CA2958585C (en) * | 2014-08-21 | 2024-01-09 | Stealth Biotherapeutics Corp | Use of peptide d-arg-2',6'-dmt-lys-phe-nh2 for the treatment of alport syndrome |
| AU2015327836B2 (en) | 2014-10-03 | 2021-07-01 | Cold Spring Harbor Laboratory | Targeted augmentation of nuclear gene output |
| CN108603230A (zh) | 2015-10-09 | 2018-09-28 | 南安普敦大学 | 基因表达的调节与蛋白质表达失调的筛选 |
| WO2017106377A1 (en) | 2015-12-14 | 2017-06-22 | Cold Spring Harbor Laboratory | Antisense oligomers for treatment of autosomal dominant mental retardation-5 and dravet syndrome |
| US11096956B2 (en) | 2015-12-14 | 2021-08-24 | Stoke Therapeutics, Inc. | Antisense oligomers and uses thereof |
| KR20190141770A (ko) * | 2017-05-04 | 2019-12-24 | 사노피 | 알포트 증후군의 치료 방법 |
| WO2018226880A1 (en) | 2017-06-06 | 2018-12-13 | Zymergen Inc. | A htp genomic engineering platform for improving escherichia coli |
| WO2018226900A2 (en) | 2017-06-06 | 2018-12-13 | Zymergen Inc. | A htp genomic engineering platform for improving fungal strains |
| KR102318434B1 (ko) | 2017-08-25 | 2021-11-01 | 스톡 테라퓨틱스, 인크. | 병태 및 질환 치료용 안티센스 올리고머 |
| HUE070436T2 (hu) | 2017-10-23 | 2025-06-28 | Stoke Therapeutics Inc | Antiszensz oligomerek nonszensz-mediált RNS-lebomláson alapuló állapotok és betegségek kezelésére |
| CA3099280A1 (en) | 2018-05-04 | 2019-11-07 | Stoke Therapeutics, Inc. | Methods and compositions for treatment of cholesteryl ester storage disease |
| SG11202104409YA (en) | 2018-10-31 | 2021-05-28 | Zymergen Inc | Multiplexed deterministic assembly of dna libraries |
| AU2020227825B2 (en) | 2019-02-27 | 2026-03-26 | Stoke Therapeutics, Inc. | Antisense oligomers for treatment of conditions and diseases |
| CN113728106A (zh) | 2019-03-08 | 2021-11-30 | 齐默尔根公司 | 微生物中的迭代基因组编辑 |
| US11053515B2 (en) | 2019-03-08 | 2021-07-06 | Zymergen Inc. | Pooled genome editing in microbes |
| CN115867657A (zh) | 2020-05-11 | 2023-03-28 | 斯托克制药公司 | 用于治疗疾患和疾病的opa1反义寡聚物 |
| TW202413355A (zh) * | 2022-05-09 | 2024-04-01 | 瑞士商卡利迪塔斯療法瑞士股份有限公司 | 新醫藥用途 |
| WO2024238950A1 (en) * | 2023-05-18 | 2024-11-21 | Keros Therapeutics, Inc. | Methods of using activin receptor type ii variants |
| WO2025110217A1 (ja) * | 2023-11-22 | 2025-05-30 | 国立大学法人東海国立大学機構 | 嚢胞性腎疾患の予防及び/又は治療剤 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013163258A1 (en) * | 2012-04-25 | 2013-10-31 | Regulus Therapeutics Inc. | Microrna compounds and methods for modulating mir-21 activity |
Family Cites Families (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100574597B1 (ko) * | 1998-05-22 | 2006-04-28 | 보이스 타운 내셔널 리서치 호스피탈 | α1β1 인테그린 수용체 저해제 및 TGF-β1 저해제의신장 질환의 치료용 용도 |
| HUP0202048A3 (en) * | 1998-05-22 | 2006-11-28 | Boys Town Nat Res Hospital Oma | Use of alpha1betha1 integrin receptor inhibitors and tgf-betha1 inhibitors in the treatment of kidney disease |
| US20060008817A1 (en) | 2000-12-08 | 2006-01-12 | Invitrogen Corporation | Methods and compositions for generating recombinant nucleic acid molecules |
| EP2447370B1 (en) | 2001-09-28 | 2018-07-18 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | MicroRNA molecules |
| US7585501B2 (en) * | 2002-06-14 | 2009-09-08 | Stowers Institute For Medical Research | Compositions and methods for treating kidney disease |
| US20050124591A1 (en) * | 2003-07-29 | 2005-06-09 | Jin Tian | Use of vitamin Ds to treat kidney disease |
| US7683036B2 (en) | 2003-07-31 | 2010-03-23 | Regulus Therapeutics Inc. | Oligomeric compounds and compositions for use in modulation of small non-coding RNAs |
| ITMI20032528A1 (it) * | 2003-12-19 | 2005-06-20 | Francesco Santangelo | Uso di cistina o di cisteina per la prevenzione e il |
| US7585550B2 (en) | 2004-02-02 | 2009-09-08 | College Of William And Mary | Process for modifying polymeric surfaces using deep UV irradiation |
| EP2290073A3 (en) | 2004-05-28 | 2011-08-31 | Asuragen, Inc. | Methods and compositions involving microRNA |
| EP1791567B1 (en) | 2004-08-10 | 2015-07-29 | Alnylam Pharmaceuticals Inc. | Chemically modified oligonucleotides |
| EP1802331A2 (en) | 2004-09-08 | 2007-07-04 | Boys Town National Research Hospital | Treatment of glomerular basement membrane disease involving matrix metalloproteinase-12 |
| EP2302055B1 (en) | 2004-11-12 | 2014-08-27 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| EP1838870A2 (en) | 2004-12-29 | 2007-10-03 | Exiqon A/S | NOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF MICRORNAS AND THEIR TARGET MRNAs |
| US6995235B1 (en) | 2005-05-02 | 2006-02-07 | Univation Technologies, Llc | Methods of producing polyolefins and films therefrom |
| EP1931780B1 (en) * | 2005-08-29 | 2016-01-06 | Regulus Therapeutics Inc. | Antisense compounds having enhanced anti-microrna activity |
| AU2007211082B2 (en) | 2006-01-27 | 2012-09-27 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of microRNAs |
| SG10201406016SA (en) | 2006-04-03 | 2014-11-27 | Stella Aps | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
| EP2007888A2 (en) | 2006-04-03 | 2008-12-31 | Santaris Pharma A/S | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
| CA2927045A1 (en) | 2006-10-03 | 2008-04-10 | Muthiah Manoharan | Lipid containing formulations |
| EP2208798B1 (de) | 2006-10-09 | 2013-08-07 | Medizinische Hochschule Hannover | MicroRNA (miRNA) zur Diagnose und Therapie von Herzerkrankungen |
| AU2007333107A1 (en) | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | miR-21 regulated genes and pathways as targets for therapeutic intervention |
| WO2008086807A2 (en) | 2007-01-19 | 2008-07-24 | Exiqon A/S | Mediated cellular delivery of lna oligonucleotides |
| WO2008151631A2 (en) | 2007-06-15 | 2008-12-18 | Exiqon A/S | Use of short oligonucleotides for reagent redundancy experiments in rna functional analysis |
| CA2691691C (en) * | 2007-06-20 | 2013-09-24 | Seth J. Baum | Compositions and methods of treating chronic kidney disease |
| EP2623599B1 (en) | 2007-10-04 | 2019-01-02 | Roche Innovation Center Copenhagen A/S | Micromirs |
| US8211867B2 (en) | 2007-10-29 | 2012-07-03 | Regulus Therapeutics Inc. | Targeting microRNAs for the treatment of liver cancer |
| WO2009091972A2 (en) | 2008-01-18 | 2009-07-23 | Alnylam Pharmaceuticals, Inc. | Chemically modified oligonucleotides and small molecules for use in reducing micro rna activity levels and uses thereof |
| WO2009099326A1 (en) | 2008-02-08 | 2009-08-13 | Prosensa Holding Bv | Methods and means for treating dna repeat instability associated genetic disorders |
| EP2096171A1 (en) | 2008-02-27 | 2009-09-02 | Julius-Maximilians-Universität Würzburg | MicroRNA (miRNA) and down-stream targets for diagnostic and therapeutic purposes |
| CA2717792A1 (en) | 2008-03-07 | 2009-09-11 | Santaris Pharma A/S | Pharmaceutical compositions for treatment of microrna related diseases |
| US20120027753A1 (en) | 2009-02-26 | 2012-02-02 | The Ohio State University | MicroRNAs in Never-Smokers and Related Materials and Methods |
| SG176716A1 (en) | 2009-06-08 | 2012-01-30 | Miragen Therapeutics | CHEMICAL MODIFICATION MOTIFS FOR miRNA INHIBITORS AND MIMETICS |
| WO2011126842A2 (en) | 2010-03-30 | 2011-10-13 | Regulus Therapeutics Inc. | Targeting micrornas for the treatment of cardiac disorders |
| HUE031595T2 (en) | 2011-04-25 | 2017-07-28 | Regulus Therapeutics Inc | Micro RNA Compounds s Methods for Modulating Mir-21 Activity |
| WO2013013165A2 (en) | 2011-07-21 | 2013-01-24 | The Trustees Of The University Of Pennsylvania | Use of lna compounds for therapeutic inhibition of mir-21 in systemic lupus erythematosus |
| CN107236735B (zh) | 2012-06-21 | 2019-11-08 | 米拉根医疗股份有限公司 | 包含锁核酸基序的基于寡核苷酸的抑制剂 |
| AU2013324716B2 (en) | 2012-09-26 | 2019-06-13 | Guandong Mijinjia Biotechnology Co., Ltd | Oligomers with improved off-target profile |
| UA116639C2 (uk) * | 2012-10-09 | 2018-04-25 | Рег'Юлес Терап'Ютікс Інк. | Способи лікування синдрому альпорта |
-
2013
- 2013-08-10 UA UAA201504453A patent/UA116639C2/uk unknown
- 2013-10-08 EP EP19188663.9A patent/EP3620522B1/en active Active
- 2013-10-08 PT PT137774584T patent/PT2906698T/pt unknown
- 2013-10-08 MY MYPI2015000876A patent/MY183921A/en unknown
- 2013-10-08 RS RS20191380A patent/RS60014B1/sr unknown
- 2013-10-08 JP JP2015535891A patent/JP6272880B2/ja active Active
- 2013-10-08 NZ NZ630596A patent/NZ630596A/en not_active IP Right Cessation
- 2013-10-08 SG SG11201502748RA patent/SG11201502748RA/en unknown
- 2013-10-08 KR KR1020237031594A patent/KR20230136686A/ko not_active Withdrawn
- 2013-10-08 ES ES19188663T patent/ES2960488T3/es active Active
- 2013-10-08 CA CA2885605A patent/CA2885605A1/en active Pending
- 2013-10-08 BR BR112015007709-9A patent/BR112015007709B1/pt not_active IP Right Cessation
- 2013-10-08 KR KR1020227000173A patent/KR20220005634A/ko not_active Ceased
- 2013-10-08 UY UY35069A patent/UY35069A/es not_active Application Discontinuation
- 2013-10-08 CN CN201380051249.9A patent/CN104718295B/zh active Active
- 2013-10-08 WO PCT/US2013/063884 patent/WO2014058881A1/en not_active Ceased
- 2013-10-08 LT LT13777458T patent/LT2906698T/lt unknown
- 2013-10-08 PL PL13777458T patent/PL2906698T3/pl unknown
- 2013-10-08 SI SI201331597T patent/SI2906698T1/sl unknown
- 2013-10-08 KR KR1020207028577A patent/KR102349184B1/ko active Active
- 2013-10-08 EA EA201590711A patent/EA201590711A1/ru unknown
- 2013-10-08 AU AU2013329427A patent/AU2013329427B2/en not_active Ceased
- 2013-10-08 HR HRP20191948TT patent/HRP20191948T1/hr unknown
- 2013-10-08 KR KR1020157009045A patent/KR102165189B1/ko active Active
- 2013-10-08 HU HUE13777458A patent/HUE045858T2/hu unknown
- 2013-10-08 AR ARP130103643A patent/AR092940A1/es not_active Application Discontinuation
- 2013-10-08 MX MX2015004460A patent/MX356340B/es active IP Right Grant
- 2013-10-08 TW TW102136388A patent/TWI641388B/zh active
- 2013-10-08 ES ES13777458T patent/ES2753174T3/es active Active
- 2013-10-08 DK DK13777458T patent/DK2906698T3/da active
- 2013-10-08 EP EP13777458.4A patent/EP2906698B1/en active Active
- 2013-10-08 US US14/048,827 patent/US9012423B2/en active Active
-
2015
- 2015-03-16 TN TNP2015000099A patent/TN2015000099A1/fr unknown
- 2015-03-16 IL IL237768A patent/IL237768B/en active IP Right Grant
- 2015-03-26 ZA ZA2015/02087A patent/ZA201502087B/en unknown
- 2015-04-02 US US14/677,387 patent/US9359609B2/en active Active
- 2015-04-07 CL CL2015000873A patent/CL2015000873A1/es unknown
- 2015-04-08 PH PH12015500781A patent/PH12015500781A1/en unknown
- 2015-05-07 CR CR20150236A patent/CR20150236A/es unknown
-
2016
- 2016-05-10 US US15/151,290 patent/US9688986B2/en active Active
-
2017
- 2017-05-26 US US15/606,554 patent/US9970011B2/en active Active
- 2017-12-28 JP JP2017253345A patent/JP2018080190A/ja active Pending
-
2018
- 2018-04-09 US US15/948,450 patent/US20180298385A1/en not_active Abandoned
- 2018-10-08 IL IL262200A patent/IL262200A/en unknown
-
2019
- 2019-07-29 AU AU2019210494A patent/AU2019210494A1/en not_active Abandoned
- 2019-10-16 JP JP2019189071A patent/JP2020073479A/ja active Pending
- 2019-10-30 CY CY20191101129T patent/CY1122479T1/el unknown
-
2020
- 2020-01-21 US US16/747,837 patent/US20200283765A1/en not_active Abandoned
-
2021
- 2021-07-02 US US17/366,796 patent/US20220098582A1/en not_active Abandoned
- 2021-11-18 AU AU2021269404A patent/AU2021269404A1/en not_active Abandoned
-
2022
- 2022-05-23 JP JP2022083586A patent/JP2022110140A/ja active Pending
-
2023
- 2023-07-21 US US18/356,404 patent/US20240167032A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013163258A1 (en) * | 2012-04-25 | 2013-10-31 | Regulus Therapeutics Inc. | Microrna compounds and methods for modulating mir-21 activity |
Non-Patent Citations (8)
| Title |
|---|
| CHEUK-CHUN SZETO ET AL: "Micro-RNA Expression in the Urinary Sediment of Patients with Chronic Kidney Diseases", DISEASE MARKERS, vol. 33, no. 3, 28 September 2012 (2012-09-28), pages 137 - 144, XP055094930, ISSN: 0278-0240, DOI: 10.3233/DMA-2012-0914 * |
| DAMIEN NOONE ET AL: "An update on the pathomechanisms and future therapies of Alport syndrome", PEDIATRIC NEPHROLOGY, vol. 28, no. 7, 18 August 2012 (2012-08-18), pages 1025 - 1036, XP055094834, ISSN: 0931-041X, DOI: 10.1007/s00467-012-2272-z * |
| DOMINIC COSGROVE: "Glomerular pathology in Alport syndrome: a molecular perspective", PEDIATRIC NEPHROLOGY, vol. 27, no. 6, 1 April 2011 (2011-04-01), pages 885 - 890, XP055094836, ISSN: 0931-041X, DOI: 10.1007/s00467-011-1868-z * |
| JIN CHEN ET AL: "Relation between MicroRNA Expression in Peritoneal Dialysis Effluent and Peritoneal Transport Characteristics", DISEASE MARKERS, vol. 33, no. 1, April 2012 (2012-04-01), pages 35 - 42, XP055094926, ISSN: 0278-0240, DOI: 10.3233/DMA-2012-0901 * |
| OLIVER GROSS ET AL: "Treatment of Alport syndrome: beyond animal models", KIDNEY INTERNATIONAL, vol. 76, no. 6, 17 June 2009 (2009-06-17), pages 599 - 603, XP055094837, ISSN: 0085-2538, DOI: 10.1038/ki.2009.223 * |
| SAAL SAMUEL ET AL: "MicroRNAs and the kidney: coming of age", CURRENT OPINION IN NEPHROLOGY AND HYPERTENSION, RAPID SCIENCE, LONDON, GB, vol. 18, no. 4, 3 July 2009 (2009-07-03), pages 317 - 323, XP008146126, ISSN: 1062-4813, DOI: 10.1097/MNH.0B013E32832C9DA2 * |
| SANJEEV AKKINA ET AL: "MicroRNAs in kidney function and disease", TRANSLATIONAL RESEARCH, ELSEVIER, AMSTERDAM, NL, vol. 157, no. 4, 3 February 2011 (2011-02-03), pages 236 - 240, XP028368085, ISSN: 1931-5244, [retrieved on 20110125], DOI: 10.1016/J.TRSL.2011.01.011 * |
| X. ZHONG ET AL: "Smad3-Mediated Upregulation of miR-21 Promotes Renal Fibrosis", JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY, vol. 22, no. 9, 18 August 2011 (2011-08-18), pages 1668 - 1681, XP055094890, ISSN: 1046-6673, DOI: 10.1681/ASN.2010111168 * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9790496B2 (en) | 2011-04-25 | 2017-10-17 | Regulus Therapeutics Inc. | Microrna compounds and methods for modulating MIR-21 activity |
| US9181547B2 (en) | 2011-04-25 | 2015-11-10 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating MIR-21 activity |
| US12331294B2 (en) | 2011-04-25 | 2025-06-17 | Sanofi | MicroRNA compounds and methods for modulating mir-21 activity |
| US9267137B2 (en) | 2012-04-25 | 2016-02-23 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating miR-21 activity |
| US9970009B2 (en) | 2012-04-25 | 2018-05-15 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating miR-21 activity |
| US9688985B2 (en) | 2012-04-25 | 2017-06-27 | Regulus Therapeutics Inc. | MicroRNA compounds and methods for modulating miR-21 activity |
| US9970011B2 (en) | 2012-10-09 | 2018-05-15 | Regulus Therapeutics Inc. | Methods for treatment of alport syndrome |
| US9688986B2 (en) | 2012-10-09 | 2017-06-27 | Regulus Therapeutis Inc. | Methods for treatment of alport syndrome |
| US9012423B2 (en) | 2012-10-09 | 2015-04-21 | Regulus Therapeutics Inc. | Methods for treatment of alport syndrome |
| US9359609B2 (en) | 2012-10-09 | 2016-06-07 | Regulus Therapeutics Inc. | Methods for treatment of alport syndrome |
| US10953020B2 (en) | 2016-11-08 | 2021-03-23 | Reata Pharmaceuticals, Inc. | Methods of treating Alport syndrome using bardoxolone methyl or analogs thereof |
| US11446313B2 (en) | 2016-11-08 | 2022-09-20 | Reata Pharmaceuticals Holdings, LLC | Methods of treating Alport syndrome using bardoxolone methyl or analogs thereof |
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| EP3564373A4 (en) * | 2016-12-28 | 2020-12-16 | Daiichi Sankyo Company, Limited | THERAPEUTIC DRUG FOR ALPORT SYNDROME |
| US11230709B2 (en) | 2016-12-28 | 2022-01-25 | National University Corporation Kobe University | Therapeutic drug for Alport's syndrome |
| US12440539B2 (en) | 2020-03-20 | 2025-10-14 | Keros Therapeutics, Inc. | Methods of using activin receptor type IIB variants |
| US12522646B2 (en) | 2020-03-20 | 2026-01-13 | Keros Therapeutics, Inc. | Activin receptor type II chimeras and methods of use thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240167032A1 (en) | Methods for Treatment of Alport Syndrome | |
| US9267137B2 (en) | MicroRNA compounds and methods for modulating miR-21 activity | |
| AU2016312590B2 (en) | Methods for treatment of polycystic kidney disease | |
| WO2018106566A1 (en) | Modified oligonucleotides for treatment of polycystic kidney disease | |
| HK40022692A (en) | Methods for treatment of alport syndrome | |
| HK1212378B (en) | Methods for treatment of alport syndrome | |
| HK40101442A (en) | Compound for use in methods for treatment of polycystic kidney disease | |
| OA17284A (en) | Methods for treatment of Alport syndrome. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13777458 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2885605 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2015000151 Country of ref document: DZ Ref document number: 237768 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2013329427 Country of ref document: AU Date of ref document: 20131008 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2015535891 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015000873 Country of ref document: CL |
|
| ENP | Entry into the national phase |
Ref document number: 20157009045 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12015500781 Country of ref document: PH |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2015/004460 Country of ref document: MX |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015007709 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IDP00201502427 Country of ref document: ID |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A201504453 Country of ref document: UA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201590711 Country of ref document: EA Ref document number: 2013777458 Country of ref document: EP Ref document number: CR2015-000236 Country of ref document: CR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 38083 Country of ref document: MA |
|
| ENP | Entry into the national phase |
Ref document number: 112015007709 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150407 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 630596 Country of ref document: NZ |