WO2013183863A1 - ３'영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법 - Google Patents

３'영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법 Download PDF

Info

Publication number
WO2013183863A1
WO2013183863A1 PCT/KR2013/004150 KR2013004150W WO2013183863A1 WO 2013183863 A1 WO2013183863 A1 WO 2013183863A1 KR 2013004150 W KR2013004150 W KR 2013004150W WO 2013183863 A1 WO2013183863 A1 WO 2013183863A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
protein
taa
gfp
foreign protein
Prior art date
Application number
PCT/KR2013/004150
Other languages
English (en)
French (fr)
Other versions
WO2013183863A9 (ko
Inventor
이상준
김영옥
남보혜
Original Assignee
대한민국(관리부서:국립수산과학원)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(관리부서:국립수산과학원) filed Critical 대한민국(관리부서:국립수산과학원)
Publication of WO2013183863A1 publication Critical patent/WO2013183863A1/ko
Publication of WO2013183863A9 publication Critical patent/WO2013183863A9/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/04—Inactivation or attenuation; Producing viral sub-units

Definitions

  • the present invention relates to a method for regulating the expression of a protein, and more particularly, to a method for regulating the expression of a whole protein through base variation of the 3 'region.
  • the inventors of the present invention discloses a mutated signal sequence and / or hydrophilicity including a hydrophobic fragment of a signal sequence including an N-region and / or an N-region of a directional signal in Korean Patent No. 0981356 and Patent No. 1049859.
  • an expression vector comprising a gene construct consisting of a polynucleotide encoding a mutated signal sequence comprising a secretion enhancer consisting of a polypeptide, wherein the pI value according to the length of the fragment of the N-region of the signal sequence is adhesive It was confirmed that it has an important effect on the water-soluble expression of the protein, it was found that the secretory enhancer sequence plays an important role in water-soluble expression when there is a membrane potential-like domain inside such as halibut hepcidin I.
  • the present inventors studied the water-soluble expression of the protein when the target protein to be expressed in the Republic of Korea Patent Registration No. 10-1184011 is a bulky active protein showing the activity by folding in the cytoplasm.
  • 1) the leading polypeptide having an acidic pI value, anchor sequence and high hydrophilicity value is linked to the target protein, or 2) a plurality of amino acids present at the N-terminus of the target protein are converted to acidic pI value and high hydrophilicity.
  • the present invention is to solve the various problems including the above problems.
  • the present invention improves and reduces overall protein expression of the large active foreign protein being folded, by mutating or inserting upstream or downstream amino acids and bases comprising the C-terminal stop codon of the foreign protein.
  • An object of the present invention is to provide a method.
  • these problems are exemplary, and the scope of the present invention is not limited thereby.
  • a promoter 1) restriction enzyme recognition sites for insertion of polynucleotides encoding foreign proteins including translation termination codons; And 3) a gene construct comprising a gene construct in which repeats or hexanucleotides of the trinucleotides are sequentially connected.
  • the translation termination codon may be a translation termination codon intrinsic to the foreign protein, or may be a homologous replacement codon thereof.
  • the homologous replacement codon may be TAA.
  • the trinucleotide or hexanucleotide may be inserted 1 to 30 times, and may be inserted 2 to 30 times or 2 to 15 times consecutively.
  • the repeat of the trinucleotide is described in SEQ ID NOs: 61-86. It may have a nucleic acid sequence.
  • the nucleic acid sequence can regulate the expression of the inserted protein, for example, a trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NOs: 61-63, 65-69, 72-82, or 85-86 may be an active foreign protein. Can increase the water soluble expression and secretion.
  • the trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84 can reduce the water-soluble expression and secretion of the active foreign protein.
  • the repeat of the hexanucleotide connecting the trinucleotide derivative and the inhibitor may preferably be inserted 1 to 10 times, and may be inserted 2 to 10 times consecutively, and the hexanucleotide repeat is SEQ ID NO: 87 It may have a nucleic acid sequence described as -101.
  • the nucleic acid sequence can regulate the overall expression of active foreign protein high, medium, low.
  • hexanucleotide repeats having the nucleic acid sequences set forth in SEQ ID NOs: 87, 91, 92, 94, 97, 98, and 101 can increase the water soluble expression and secretion of active foreign proteins
  • SEQ ID NOs: 89 Hexanucleotide repeats having nucleic acid sequences described as 95, 96, and 100 can moderately regulate the aqueous expression and secretion of active foreign proteins
  • the active foreign protein may be a protein having one or more membrane potential domains therein and folding, and the folding active foreign protein may be a green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • the active foreign protein may be a therapeutic protein, but is not limited thereto.
  • the polynucleotide encoding the therapeutic protein when inserted into the expression vector of the present invention and expressed, it can be used for in vivo or ex vivo gene therapy.
  • the expression of the entire protein can be used for regulation.
  • a promoter 1) a promoter; 2) a polynucleotide encoding an active foreign protein from which a translation codon has been removed; And 3) a gene construct sequentially comprising a homologous replacement codon of the translation termination codon, an expression vector for overall expression control of the active foreign protein is provided.
  • the active foreign protein may have a unique C-terminal polypeptide.
  • the gene construct may additionally include a repeat of a trinucleotide immediately below the homologous replacement codon, wherein the trinucleotide may be inserted 1 to 30 times, continuously 2 to 30 times, or It may be inserted 2 to 15 times, and the repeat of the trinucleotide may have a nucleic acid sequence set forth in SEQ ID NOs: 61-86.
  • the nucleic acid sequence can regulate the expression of the inserted protein, for example, a trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NOs: 61-63, 65-69, 72-82, or 85-86 may be an active foreign protein. May increase the overall expression of.
  • the trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84 can reduce the overall expression of the active foreign protein.
  • the repeat of the hexanucleotide connecting the trinucleotide derivative and the inhibitor may preferably be inserted 1 to 10 times, and may be inserted 2 to 10 times consecutively, and the hexanucleotide repeat is SEQ ID NO: 87-101. It may have a nucleic acid sequence described as. The nucleic acid sequence can regulate the overall expression of active foreign protein high, medium, low.
  • hexanucleotide repeats having the nucleic acid sequences set forth in SEQ ID NOs: 87, 91, 92, 94, 97, 98, and 101 can increase the water soluble expression and secretion of active foreign proteins
  • SEQ ID NOs: 89 Hexanucleotide repeats having nucleic acid sequences described as 95, 96, and 100 can moderately regulate the aqueous expression and secretion of active foreign proteins
  • the active foreign protein may be a protein having one or more membrane potential domains therein and folding, and the folding active foreign protein may be a green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • the active foreign protein may be a therapeutic protein, but is not limited thereto.
  • the polynucleotide encoding the therapeutic protein when inserted into the expression vector of the present invention and expressed, it can be used for in vivo or ex vivo gene therapy.
  • the expression of the entire protein can be used for regulation.
  • a promoter 1) a promoter; 2) a polynucleotide encoding an active foreign protein comprising a translational codon; And 3) a gene construct sequentially comprising a repeat of a trinucleotide and a hexanucleotide directly linked to the translation termination codon, an expression vector for regulating the overall expression of an active foreign protein is provided.
  • the active foreign protein may have a unique C-terminal polypeptide.
  • the translation termination codon may be a translation termination codon specific to the foreign protein, and may be a homologous replacement codon thereof.
  • the homologous replacement codon may be TAA.
  • the trinucleotide may be inserted 1 to 30 times, and may be inserted 2 to 30 or 2 to 15 times consecutively, and the repeat of the trinucleotide may have a nucleic acid sequence represented by SEQ ID NOs: 61-86. .
  • the nucleic acid sequence can regulate the expression of the inserted protein, for example, a trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NOs: 61-63, 65-69, 72-82, or 85-86 may be an active foreign protein. May increase the overall expression of.
  • the trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84 can reduce the overall expression of the active foreign protein.
  • the repeat of the hexanucleotide connecting the trinucleotide derivative and the inhibitor may preferably be inserted 1 to 10 times, and may be inserted 2 to 10 times consecutively, and the hexanucleotide repeat is SEQ ID NO: 87-101. It may have a nucleic acid sequence described as. The nucleic acid sequence can regulate the overall expression of active foreign protein high, medium, low.
  • hexanucleotide repeats having the nucleic acid sequences set forth in SEQ ID NOs: 87, 91, 92, 94, 97, 98, and 101 can increase the water soluble expression and secretion of active foreign proteins
  • SEQ ID NOs: 89 Hexanucleotide repeats having nucleic acid sequences described as 95, 96, and 100 can moderately regulate the aqueous expression and secretion of active foreign proteins
  • the active foreign protein may be a protein having one or more membrane potential domains therein and folding, and the folding active foreign protein may be a green fluorescent protein (GFP).
  • the active foreign protein may be a therapeutic protein, but is not limited thereto.
  • the promoter operably linked to the promoter, wherein at least one codon having a stop codon is substituted with a homologous replacement codon or present within 1 to 120 nucleotides of the translation codon and the translation stop codon is homologous.
  • the homologous replacement codon means that the same amino acid is encoded but the nucleic acid sequence of the codon is different.
  • the translation stop codon may be TAA, TAG, or TGA.
  • the active foreign protein may be a protein having at least one membrane potential domain therein and folding, and the folding active foreign protein may be a green fluorescent protein (GFP).
  • the active foreign protein may be a therapeutic protein, but is not limited thereto.
  • the polynucleotide encoding the therapeutic protein is inserted into the expression vector of the present invention and expressed, it can be used for in vivo or ex vivo gene therapy.
  • by inserting a variety of other proteins into the expression vector according to the invention it is possible to control the expression of the entire protein.
  • a promoter A polynucleotide operably linked to the promoter, the polynucleotide encoding an active foreign protein; And a gene construct comprising a repeat of a nucleotide and a trinucleotide linked to a translation termination codon downstream of the polynucleotide.
  • the trinucleotide may be inserted 1 to 30 times, and may be inserted 2 to 30 or 2 to 15 times consecutively, and the repeat of the trinucleotide is a nucleic acid set forth in SEQ ID NOs: 61-86. May have a sequence.
  • the nucleic acid sequence can regulate the expression of the inserted protein, for example, a trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NOs: 61-63, 65-69, 72-82, or 85-86 may be an active foreign protein. May increase the overall expression of.
  • the trinucleotide repeat having a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84 can reduce the overall expression of the active foreign protein.
  • the repeat of the hexanucleotide connecting the trinucleotide derivative and the inhibitor may preferably be inserted 1 to 10 times, and may be inserted 2 to 10 times consecutively, and the hexanucleotide repeat is SEQ ID NO: 87-101. It may have a nucleic acid sequence described as. The nucleic acid sequence can regulate the overall expression of active foreign protein high, medium, low.
  • hexanucleotide repeats having the nucleic acid sequences set forth in SEQ ID NOs: 87, 91, 92, 94, 97, 98, and 101 can increase the water soluble expression and secretion of active foreign proteins
  • SEQ ID NOs: 89 Hexanucleotide repeats having nucleic acid sequences described as 95, 96, and 100 can moderately regulate the aqueous expression and secretion of active foreign proteins
  • the active foreign protein may be a protein in which one or more membrane potential domains are present and folded, and the folded foreign protein may be a green fluorescent protein (GFP). .
  • the active foreign protein may be a therapeutic protein, but is not limited thereto.
  • the polynucleotide encoding the therapeutic protein when inserted into the expression vector of the present invention and expressed, it can be used for in vivo or ex vivo gene therapy.
  • the expression of the entire protein can be used for regulation.
  • a promoter a restriction enzyme recognition site for insertion of a polynucleotide encoding a foreign protein from which translation termination codons have been removed; And transforming the host cell with an expression vector comprising a gene construct sequentially comprising a translation stop codon as an expression regulator to produce a transformant. Culturing the transformant; Measuring the expression level of the foreign protein introduced into the expression vector in the culture medium of the transformant; And a method for screening expression regulators which significantly increased or decreased the expression level of the foreign protein as compared to a control vector without an expression derivative inserted.
  • the translational codon which increases the expression level of the foreign protein may be an expression derivative, and the termination codon that decreases the expression level of the foreign protein may be an expression inhibitor.
  • the translation stop codon may be a translation stop codon specific to the foreign protein and may be a homologous replacement codon thereof.
  • the homologous replacement codon may be TAA.
  • a gene construct for a restriction enzyme recognition site for insertion of a polynucleotide encoding a foreign protein including a promoter, a translation termination codon, and a trinucleotide and hexanucleotide repeats as an expression regulator is sequentially connected.
  • Preparing a transformant by transforming a host cell with an expression vector comprising a transcript; Culturing the transformant; Measuring the expression level of the foreign protein introduced into the expression vector in the culture medium of the transformant; And a method for screening expression regulators which significantly increased or decreased the expression level of the foreign protein as compared to a control vector without an expression derivative inserted.
  • the trinucleotide repeat that increases the expression level of the foreign protein may be an expression derivative, and the trinucleotide repeat that decreases the expression level of the foreign protein may be an expression inhibitor.
  • the trinucleotide repeat as the expression regulator may be inserted repeatedly 1 to 30 times, but is not limited thereto.
  • hexanucleotide repeats that increase the expression level of foreign proteins may be expression derivatives, and hexanucleotide repeats that decrease the expression level of foreign proteins may be expression inhibitors.
  • the hexanucleotide repeat may be inserted 1 to 10 times as the expression regulator, but is not limited thereto.
  • a polynucleotide encoding an active foreign protein including a promoter, a translation termination codon; And preparing a transformant by transforming the host cell with an expression vector including a gene construct sequentially comprising the homologous replacement codon of the translation termination codon as an expression regulator. Culturing the transformant; Measuring the expression level of the foreign protein introduced into the expression vector in the culture medium of the transformant; And a method for screening expression regulators which significantly increased or decreased the expression level of the foreign protein as compared to a control vector without an expression derivative inserted.
  • the translation stop codon may be a translation stop codon specific to the foreign protein and may be a homologous replacement codon thereof.
  • the homologous replacement codon may be TAA.
  • a polynucleotide encoding an active foreign protein including a promoter, a translation termination codon; And preparing a transformant by transforming the host cell with an expression vector comprising a gene construct sequentially comprising a repeat of a trinucleotide or a repeat of a hexanucleotide that is directly linked to the translation termination codon. Culturing the transformant; Measuring the expression level of the foreign protein introduced into the expression vector in the culture medium of the transformant; And a method for screening expression regulators which significantly increased or decreased the expression level of the foreign protein as compared to a control vector without an expression derivative inserted.
  • the trinucleotide to increase the expression level of the foreign protein may be an expression derivative, and the trinucleotide to decrease the expression level of the foreign protein may be an expression inhibitor.
  • the trinucleotide sequence may be inserted once to 30 times, but is not limited thereto.
  • hexanucleotide repeats that increase the expression level of foreign proteins may be expression derivatives, and hexanucleotide repeats that decrease the expression level of foreign proteins may be expression inhibitors.
  • the hexanucleotide repeat may be inserted 1 to 10 times as the expression regulator, but is not limited thereto.
  • an attenuated cell line or virus transformed with an expression vector according to an embodiment of the present invention is provided.
  • the cell line may be a bacterial, fungal or cancer cell.
  • expression of genes that are essential for the proliferation or survival of the cell line or virus and correlated with pathogenicity are completely inhibited. By attenuating without doing so, attenuation can be achieved by eliminating pathogenicity without affecting the survival of the cell line or virus.
  • the attenuation may be achieved by transforming a vector according to an embodiment of the present invention, and replacing the pathogenic gene originally possessed by the wild-type cell line or strain with a gene including a translational regulator according to one embodiment of the present invention.
  • the gene replacement method can be accomplished using methods well known in the art such as the loxP-Cre system.
  • the trinucleotide repeat may have a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84.
  • the hexanucleotide repeat may have a nucleic acid sequence set forth in SEQ ID NO: 88, 90, 93 or 99.
  • a promoter comprising a gene construct consisting of a polynucleotide encoding a polypeptide wherein the C-terminal hydrophilicity value is adjusted to 0.35 to 2.00.
  • Expression vectors for controlling these are provided.
  • FIG. 1 shows the C-terminal Le ⁇ glu (XhoI recognition site, hereinafter referred to as XhoI) -6XHis (His tag, 6aa, hy -0.28) peptide (hereinafter, XhoI-6XHis) in several GFP clones with different N-terminus. And cloned to have the hydrophilic C-terminus of the original GFP (MDELYK, 6aa, hy +0.35), and then examined the fluorescence of the whole and water-soluble expression fraction (about 50 ⁇ g) of the protein, FIG. 1 A description of the 1-6 line and bar graphs of is as follows:
  • Lane 1 GFP-Le ⁇ glu (XhoI) -6XHis-Stop (TGA), control (clone # 1);
  • Lane 2 GFP-Stop (TAA) -ctcgag ( XhoI ) -6Xcac (6X His ) (clone # 2);
  • Lane 4 ME 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 4);
  • Lane 5 MK 6 -GFP-XhoI-6XHis-Stop (TGA) control (clone # 5);
  • Figure 2 is homologous to the codon (5 codons) and translation termination codon corresponding to the C-terminus of the clone corresponding to MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) showing low water-soluble expression ( as to the substitution with synonymous) codon or translation termination ctcgag the lower portion of the codons (downstream) (XhoI) nucleotide tree (constituting a trinucleotide -6Xcac (6XHis), the general case) ctc, single or repeated, and in the gag cac MK 6 -GFP-Stop (TAA) -After inserting between the translation termination codon of XhoI-6XHis clone # 6 and XhoI-6XHis , the fluorescence of the entire protein fraction expressed in each clone (about 50 ⁇ g) was confirmed.
  • Lane 1 MK 6 -GFP (C-terminal: MDELYK) -Stop (TAA) -XhoI-6XHis , control (clone # 6);
  • Lane 2 MK 6 -GFP [C-terminal-1 K (AAG ⁇ AAA)]-Stop (TAA) -XhoI-6XHis ( clone # 7);
  • Lane 3 MK 6 -GFP [C-terminal-2 Y (TAC ⁇ TAT)]-Stop (TAA) -XhoI-6XHis ( clone # 8);
  • Lane 4 MK 6 -GFP [C-terminal-3 L (CTG ⁇ CTA)]-Stop (TAA) -XhoI-6XHis ( clone # 9);
  • Lane 5 MK 6 -GFP [C-terminal -3 L (CTG ⁇ CTT)]-Stop (TAA) -XhoI-6XHis ( clone # 10);
  • Lane 6 MK 6 -GFP [C-terminal -3 L (CTG ⁇ CTC)] -Stop ( TAA) -XhoI-6XHis ( clone # 11);
  • Lane 7 MK 6 -GFP [C-terminal-4 E (GAG ⁇ GAA)]-Stop (TAA) -XhoI-6XHis (clone # 12);
  • Lane 8 MK 6 -GFP [C-terminal-5 D (GAC ⁇ GAT)]-Stop (TAA) -XhoI-6XHis (clone # 13);
  • Lane 9 MK 6 -GFP [C-terminal-11 G (GGG ⁇ GGC)]-Stop (TAA) -XhoI-6XHis (clone # 14);
  • Lane 10 MK 6 -GFP [C-terminal-15 V (GTG ⁇ GTC)]-Stop (TAA) -XhoI-6XHis (clone # 15);
  • Lane 11 MK 6 -GFP [C-terminal-19 L (CTG ⁇ CTC)]-Stop (TAA) -XhoI-6XHis (clone # 16);
  • Lane 12 MK 6 -GFP [C-terminal-25 K (AAG ⁇ AAA)]-Stop (TAA) -XhoI-6XHis (clone # 17);
  • Lane 13 MK 6 -GFP [C-terminal -32 L (CTG ⁇ CTC))] -Stop (TAA) -XhoI-6XHis (clone # 18);
  • Lane 14 MK 6 -GFP-Stop (TAG) -XhoI-6XHis (clone # 19);
  • Lane 15 MK 6 -GFP-Stop (TGA) -XhoI-6XHis (clone # 20);
  • Lane 16 MK 6 -GFP-Stop (TAA) -6Xctc- XhoI - 6XHis (clone # 21);
  • Lane 17 MK 6 -GFP-Stop (TAA) -1Xgag- XhoI - 6XHis (clone # 22);
  • Lane 18 MK 6 -GFP-Stop (TAA) -3Xgag- XhoI - 6XHis (clone # 23);
  • Lane 19 MK 6 -GFP-Stop (TAA) -6Xgag- XhoI - 6XHis (clone # 24); And
  • Line 20 MK 6 -GFP-Stop (TAA) -6Xcac- XhoI-6XHis (clone # 25).
  • Figure 3 is showing a low water-soluble expression of MK 6 -GFP-Stop (TAA) - XhoI - 6XHis any nucleotide repeats the tree to the lower part (downstream) of the translation termination codon (stop codon) of the clone that corresponds to the (clone # 6)
  • TAA MK 6 -GFP-Stop
  • XhoI translation termination codon
  • 6XHis any nucleotide repeats the tree to the lower part (downstream) of the translation termination codon (stop codon) of the clone that corresponds to the (clone # 6)
  • Lane 1 MK 6 -GFP-Stop (TAA) -XhoI-6XHis , control (clone # 6);
  • Lane 2 MK 6 -GFP-Stop (TAA) -4Xgaa- XhoI-6XHis (clone # 26);
  • Lane 3 MK 6 -GFP-Stop (TAA) -6Xgaa- XhoI-6XHis (clone # 27);
  • Lane 4 MK 6 -GFP-Stop (TAA) -10Xgaa- XhoI-6XHis (clone # 28);
  • Lane 5 MK 6 -GFP-Stop (TAA) -15Xgaa- XhoI-6XHis (clone # 29);
  • Lane 6 MK 6 -GFP-Stop (TAA) -6Xaaa- XhoI-6XHis (clone # 30);
  • Lane 7 MK 6 -GFP-Stop (TAA) -6Xaag- XhoI-6XHis (clone # 31);
  • Lane 8 MK 6 -GFP-Stop (TAA) -6Xcaa- XhoI-6XHis (clone # 32);
  • Lane 9 MK 6 -GFP-Stop (TAA) -6Xtaa- XhoI-6XHis ( clone # 33);
  • Lane 10 MK 6 -GFP-Stop (TAA) -6Xtag- XhoI-6XHis (clone # 34);
  • Lane 11 MK 6 -GFP-Stop (TAA) -6Xcag- XhoI-6XHis (clone # 35);
  • Lane 12 MK 6 -GFP-Stop (TAA) -6Xggg- XhoI-6XHis (clone # 36);
  • Lane 13 MK 6 -GFP-Stop (TAA) -6Xttt- XhoI-6XHis ( clone # 37);
  • Lane 14 MK 6 -GFP-Stop (TAA) -6Xcca- XhoI-6XHis (clone # 38);
  • Lane 15 MK 6 -GFP-Stop (TAA) -6Xgat- XhoI-6XHis (clone # 39);
  • Lane 16 MK 6 -GFP-Stop (TAA) -6Xgac- XhoI-6XHis (clone # 40);
  • Lane 17 MK 6 -GFP-Stop (TAA) -6Xaat- XhoI-6XHis (clone # 41);
  • Lane 18 MK 6 -GFP-Stop (TAA) -6Xaac- XhoI-6XHis (clone # 42);
  • Lane 19 MK 6 -GFP-Stop (TAA) -6Xtga- XhoI-6XHis (clone # 43);
  • Lane 20 MK 6 -GFP-Stop (TAA) -6Xaga- XhoI-6XHis (clone # 44);
  • Lane 21 MK 6 -GFP-Stop (TAA) -6Xtac- XhoI-6XHis (clone # 45); And
  • Lane 22 MK 6 -GFP-Stop (TAA) -6Xctg- XhoI-6XHis (clone # 46);
  • Figure 4 shows the downstream portion of the translation codon of the clone corresponding to ME 6 -GFP-Stop (TAA) -XhoI-6XHis showing high water-soluble expression in Figure 3 MK 6 -GFP-Stop (TAA) -XhoI
  • the clones were inserted into a repeating trinucleotide (inducer) that restored full protein expression in -6XHis (clone # 6) or a trinucleotide (inhibitor, reducer) that expressed the whole protein lower than or similar to the control, and then clones This is the result of confirming the fluorescence of the total protein fraction (about 50 ⁇ g) expressed in.
  • the fluorescence is expressed as an average value comparing the results obtained from three different colonies, the description of the 1-12 line and bar graph of Figure 4 is as follows:
  • Lane 1 ME 6 -GFP-Stop (TAA) -XhoI-6XHis , control (clone # 4);
  • Lane 2 ME 6 -GFP-Stop (TAA) -6Xgaa- XhoI-6XHis (clone # 62);
  • Lane 3 ME 6 -GFP-Stop (TAA) -10Xgaa- XhoI-6XHis (clone # 63);
  • Lane 4 ME 6 -GFP-Stop (TAA) -6Xgag- XhoI-6XHis (clone # 64);
  • Lane 5 ME 6 -GFP-Stop (TAA) -6Xaaa- XhoI-6XHis (clone # 65);
  • Lane 6 ME 6 -GFP-Stop (TAA) -6Xaag- XhoI-6XHis (clone # 66);
  • Lane 7 ME 6 -GFP-Stop (TAA) -6Xcaa- XhoI-6XHis (clone # 67);
  • Lane 8 ME 6 -GFP-Stop (TAA) -6Xtaa- XhoI-6XHis (clone # 68);
  • Lane 9 ME 6 -GFP-Stop (TAA) -6Xtag- XhoI-6XHis (clone # 69);
  • Lane 10 ME 6 -GFP-Stop (TAA) -6Xcag- XhoI-6XHis (clone # 70);
  • Lane 11 ME 6 -GFP-Stop (TAA) -6Xtga- XhoI-6XHis (clone # 71); and
  • Line 12 ME 6 -GFP-Stop (TAA) -6Xaga- XhoI-6XHis (clone # 72).
  • MK 6 -GFP-Stop exhibit low water solubility expression - XhoI - a lower part (downstream) of the translation termination codon (stop codon) of the clone that corresponds to the 6XHis (clone # 6) recovering the entire protein Whole protein expressed in a mutant clone prepared by inserting a hexanucleotide repeat that connects a repeating trinucleotide (inducer) sequence with a trinucleotide (repressor) sequence that expresses the whole protein lower than or similar to a control group. Results of confirming the fluorescence of the fraction (about 50 ⁇ g), the description of the 1-16 line and bar graph of Figure 5 is as follows:
  • Lane 1 MK 6 -GFP-Stop (TAA) -XhoI-6XHis , control (clone # 6);
  • Lane 2 MK 6 -GFP-Stop (TAA) -1Xgaa aaa- XhoI-6XHis (clone # 47);
  • Lane 3 MK 6 -GFP-Stop (TAA) -2Xgaa aaa- XhoI-6XHis (clone # 48);
  • Lane 4 MK 6 -GFP-Stop (TAA) -3Xgaa aaa- XhoI-6XHis (clone # 49);
  • Lane 5 MK 6 -GFP-Stop (TAA) -1Xgaa aag- XhoI-6XHis (clone # 50);
  • Lane 7 MK 6 -GFP-Stop (TAA) -3Xgaa aag- XhoI-6XHis (clone # 52);
  • Lane 8 MK 6 -GFP-Stop (TAA) -1Xgaa gag- XhoI-6XHis (clone # 53);
  • Lane 9 MK 6 -GFP-Stop (TAA) -2Xgaa gag- XhoI-6XHis (clone # 54);
  • Lane 10 MK 6 -GFP-Stop (TAA) -3Xgaa gag- XhoI-6XHis (clone # 55);
  • Lane 11 MK 6 -GFP-Stop (TAA) -1Xgaa tga- XhoI-6XHis (clone # 56);
  • Lane 12 MK 6 -GFP-Stop (TAA) -2Xgaa tga- XhoI-6XHis (clone # 57);
  • Lane 13 MK 6 -GFP-Stop (TAA) -3Xgaa tga- XhoI-6XHis (clone # 58);
  • Lane 14 MK 6 -GFP-Stop (TAA) -1Xgaa aga- XhoI-6XHis (clone # 59);
  • Lane 15 MK 6 -GFP-Stop (TAA) -2Xgaa aga- XhoI-6XHis (clone # 60);
  • an "expression vector” is a linear or circular DNA molecule consisting of fragments encoding a polypeptide of interest operably linked to additional fragments provided for transcription of the expression vector. Such additional fragments include promoter and termination code sequences. Expression vectors also include one or more replication initiation points, one or more selection markers, enhancers, polyadenylation signals, and the like. Expression vectors are generally derived from plasmid or viral DNA, or contain elements of both.
  • operably linked indicates that fragments are arranged so that they all act in concert for their intended purpose, e.g., transcription starts at the promoter and proceeds through the code fragment to the end code.
  • the term "foreign protein” refers to a protein produced in a transformant transformed with an expression vector containing a gene encoding the same, but not a protein inherent in the host cell.
  • C-terminal polypeptide means a polypeptide corresponding to the C-terminus of a foreign protein, and includes a polypeptide located at the C-terminus of an inherent , additional, deleted or mutated, specifically translation termination codon It may be 1-40 amino acids from upstream.
  • “synonymous codons of translational codons and translational termination codons” refers to codons or translational termination codons that correspond to specific amino acids, but that have different nucleic acid sequences, for example TAA.
  • the homologous replacement codon is TAG or TGA
  • the homologous replacement codon of TAG is TGA or TAA
  • the homologous replacement codon of TGA is TAA or TAG.
  • the term "repetition of a trinucleotide” means a polynucleotide in which a trinucleotide sequence is continuously repeated after a translation stop codon.
  • the term "repeat of hexanucleotide” refers to a polynucleotide in which a hexanucleotide sequence is continuously repeated after a translation termination codon.
  • an "expression regulator” refers to a C-terminal translational codon upstream, or downstream of a translational codon, that may increase or decrease the expression of a foreign protein. Refers to a repeat or translational codon of a trinucleotide to be inserted and a homologous replacement codon of a translation termination codon.
  • an "expression inducer” refers to the translational codons of the C-terminal translation codon and the translational codons above or below the foreign protein C-terminus to perform the function of increasing the overall expression of the foreign protein. Homologous replacement codons or inserted nucleotides.
  • the trinucleotide of the nucleotides may be inserted 2 to 30 times, and may be inserted 2 to 5 times in a row.
  • the trinucleotide having any of the nucleic acid sequences set forth in SEQ ID NOs: 61-86, which increases the overall expression of the protein may increase the expression of the active foreign protein.
  • Hexanucleotides in the nucleotides may be inserted 1 to 3 times, and may be inserted 2 to 10 times in succession.
  • the hexanucleotide having any of the nucleic acid sequences described in SEQ ID NOs: 87-101, which increase the overall expression of the protein can appropriately regulate the expression of the active foreign protein.
  • an "expression reducer” is a trinucleotide inserted above or below the translational stop codon of the foreign protein C-terminus to function to reduce or rarely express the overall expression of the foreign protein. Or C-terminal translation codon and homologous replacement codon of translation termination codon.
  • the nucleotide may be a trinucleotide having a nucleic acid sequence set forth in SEQ ID NO: 64, 70, 71, 83 or 84.
  • the hexanucleotide repeat may have a nucleic acid sequence set forth in SEQ ID NO: 88, 90, 93 or 99.
  • the "screening method” refers to 1) C-terminal translation termination codon of a foreign protein that can increase or decrease the total expression of a foreign protein identified through an embodiment of the present invention. 2) mutation in the C-terminal stop codon to homologous replacement codon, 3) mutation in the C-terminal stop codon upstream to homologous replacement codon, or 4) downstream codon Means a method of inserting a trinucleotide into).
  • the translational regulator that can control the overall expression of the screened protein through an embodiment of the present invention, by applying this principle it can be easily screened translation regulators to increase or decrease the expression of various foreign proteins. Therefore, this method can be usefully applied to the basic research of diseases caused by abnormal expression of genes at the molecular level and the development of therapeutic agents.
  • therapeutic protein means a protein or polypeptide having therapeutic activity, eg, insulin; Growth hormones including human growth hormone or bovine growth hormone; Growth hormone-releasing factor; Parathyroid hormone; Thyroid-stimulating hormone; Follicle stimulating hormone; Luteinising hormone; Interferon alpha, interferon-beta and interferon-gamma; Vascular endothelial growth factor; Receptors for hormone receptors or growth factors; Integrin; A or D protein; Rheumatoid factors; Neurotrophic factors such as bone-derive neutrophic factor (BDNF); Nerve growth factors such as neurotrophin and NGF-beta; Platelet-derived growth factor; Fibroblast growth factor such as FGF or bFGF; Epidermal growth factor; Transformation growth factors such as TGF-alpha and TGF-beta; Insulin or insulin like growth factor; Keratinocyte growth factor; Insulin-like growth factor-binding proteins resembling insulin; CD proteins such as CD-3 CD-4,
  • hydrophilicity or hydrophilicity refers to the degree to which hydrogen bonds can be easily formed with water molecules, and unless specifically stated herein, hydrophilicity values are DNASIS TM (Hitachi, Japan). ) Is calculated on the Hop & Woods scale (window size: 6, threshold value: 0.00). When the hydrophilicity value is positive, the peptide is hydrophilic, and when the negative number is hydrophobic, the greater the absolute value, the higher the degree of hydrophilicity or hydrophobicity.
  • fusion protein refers to a protein in which another polypeptide is linked or another amino acid sequence is added to the N-terminus or C-terminus of the sequence of the original protein of interest.
  • folding refers to a process that has a unique tertiary structure in which one-dimensional polypeptide chains that have not yet been structured function through structural modification.
  • folding active foreign protein is used to fold the tertiary structure by folding the protein in the cytoplasm after transcription and translation of the mRNA, before it is released into the cytoplasm or before being secreted into periplasm. It means a protein to form.
  • a "signal sequence” is used to allow foreign proteins to pass through intracellular membranes to secrete foreign proteins expressed in viruses, prokaryotic or eukaryotic cells to periplasm or extracellular cells. It means an efficient sequence that helps.
  • the signal sequence consists of a positively charged N-region at the N-terminus, a central characteristic hydrophobic region and a C-region with a cleavage site. Consists of.
  • the signal sequence fragment used in the present invention means all or part of a positively charged region at the N-terminus, a central characteristic hydrophobic region and a C-terminal cleavage region.
  • leader polypeptide refers to an amino acid sequence that is added before the N-terminus of the target protein.
  • N-terminus of the leading polypeptide means 1 to 10 amino acids located at the N-terminus of the leading polypeptide.
  • fragment refers to a sequence having a minimum length or more size while maintaining function. Unless specifically stated herein, the total length is not included therein.
  • the signal sequence fragment referred to in the present specification means a shortened signal sequence that functions as a signal sequence among the signal sequences, and the entire signal sequence is not included therein.
  • polynucleotide refers to a polymer molecule in which two or more nucleic acid molecules are linked by diphosphate ester bonds, including DNA and RNA.
  • transmembrane domain refers to a region in which a hydrophilic and hydrophobic region is mixed and has a structure similar to that of an amphipathic domain. Therefore, it is used herein in the same sense as “transmembrane-like domain.”
  • transmembrane-like domain refers to a site predicted to have a structure similar to the membrane potential domain of a membrane protein upon amino acid sequence analysis of a polypeptide (Brasseur et al. , Biochim. Biophys. Acta 1029 (2): 267-273, 1990).
  • the membrane potential-like domain can be easily predicted through various computer software for predicting the membrane potential domain. Examples of the computer software include TMpred, HMMTOP, TBBpred, DAS-TMfilter (www.enzim.hu/DAS/DAS.html), and the like.
  • the "membrane potential-like domain” also includes a "transmembrane domain” which has been found to have actual membrane potential properties.
  • Figure 1 shows the C-terminal Le ⁇ glu (XhoI recognition site, hereinafter referred to as XhoI) -6XHis (His tag, 6aa, hy -0.28) peptide (hereinafter referred to as XhoI) derived from a vector in several GFP clones with different N-terminal ends.
  • XhoI C-terminal Le ⁇ glu
  • -6XHis His tag, 6aa, hy -0.28 peptide
  • the clones used first correspond to ME 6 -GFP-XhoI-6XHis and MK 6 -GFP-XhoI-6XHis with high hydrophilicity without an anchor sequence at the N-terminus in the study, the clones being N-terminus Regardless of the acidic and basic pI values, it has high hydrophilicity and high water-soluble expression was confirmed by the Tat channel (Korean Patent No. 10-1184011). Therefore, to determine whether the hydrophilic C-terminus also increases the water-soluble expression through the Tat channel, after removing the vector-derived XhoI-6XHis peptide located at the C-terminus of the clone, MDELYK (SEQ ID NO: Clones were prepared in Example 1.
  • MK 6 -GFP-Stop exhibit low total and soluble protein expression - or to the mutant codon (5 codons) corresponding to the C- terminus of the clone that corresponds to the XhoI-6XHis the same type similar codon, translation Ctc , gag, and cac alone selected from the trinucleotides that replace the stop codons with synonymous codons or constitute the ctcgag (XhoI) -6Xcac (6XHis) downstream of the translation stop codons.
  • Figure 3 is an arbitrary repeat tree of the downstream of the stop codon of the clone corresponding to MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) showing low total protein expression.
  • the fluorescence of the entire protein fraction (about 50 ⁇ g) expressed in the mutant clone prepared by replacing nucleotides was confirmed.
  • the fluorescence is expressed as an average value comparing the results obtained from three different colonies.
  • 6Xaaa (clone # 30) and 6Xaag (clone # 31) were expressed much lower than the control, while 6Xtga (clone # 43) and 6Xaga (clone # 44) were expressed at low levels of water soluble proteins.
  • Figure 4 shows the downstream portion of the translation codon of the clone corresponding to ME 6 -GFP-Stop (TAA) -XhoI-6XHis showing high total protein expression in Figure 3 MK 6 -GFP-Stop (TAA)- In XhoI-6XHis (clone # 6), the expression of the entire protein was restored with a repeating trinucleotide (inducer) and a trinucleotide (inhibitor reducer) that expressed the whole protein lower or similarly than the control group. The fluorescence of the entire protein fraction (about 50 ⁇ g) expressed in the clones was confirmed.
  • 6Xgaa (clone # 62), 10Xgaa (clone # 63), 6Xcaa inserted into MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) and derivatized in Experimental Example ⁇ 3-1> (Clone # 67), 6Xtaa (Clone # 68), 6Xtag (Clone # 69), 6Xcag (Clone # 70) nucleotides when inserted into ME 6 -GFP-Stop (TAA) -XhoI-6XHis (Clone # 4) , All showed expression similar to the control and did not inhibit expression.
  • 6Xgag (clone # 64), 6Xaaa (clone # 65), 6Xaag (clone # 66), 6Xtga (clone # 6) served as inhibitors in MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6).
  • gaa is selected from the repeating trinucleotide (derivative, inducer) sequence that restored the expression of the entire protein in MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) in Figure 3, Repetitions of hexanucleotides linked together by selecting aaa, aag, gag, tga and aga from the trinucleotide (repressor) sequences that expressed low or similar whole proteins were combined with MK 6 -GFP-Stop ( After insertion after the stop codon in the form of TAA)-(xxx xxx) -XhoI-6XHis clones, the fluorescence of the entire protein fraction (about 50 ⁇ g) expressed in each clone was checked.
  • the high hydrophilic clones of the leading sequence is not a problem that the whole protein translated and folded in the cytoplasm is secreted into the periplasm through the Tat channel to be expressed as a water-soluble protein Therefore, the expression efficiency was very high by inducing high overall and water-soluble expression.
  • XhoI-6XHis peptide derived from the pET22b (+) vector was attached to the C-terminus in the process of constructing the recombinant protein expression vector from such clones, thereby expressing the recombinant protein having the original C-terminus.
  • XhoI polypeptide LeuGlu (XhoI recognition site, hereinafter referred to as XhoI) -6XHis (His tag additionally linked to the C-terminus during the preparation of the GFP clone (Korean Patent No. 10-1184011) prepared in the prior application of the present inventors was investigated. , hy -0.28) were removed to investigate the expression of total and water-soluble proteins with the hydrophilic C-terminus of GFP (MDELYK, hy +0.35, SEQ ID NO: 60) and the translational termination codon (TAA) of the original form.
  • both clones can express recombinant proteins having the original C-terminus slightly more than the control group, so that the hydrophilic C-terminus can be expressed in water-soluble expression like the hydrophilic N-terminus (Korea Patent No. 10-1184011). It was possible to increase but one clone showed significantly reduced total and water soluble expression (see FIG. 1). Therefore, in the case of poor expression of total and water soluble proteins, the nucleotides corresponding to the C-terminal codon and the stop codon are replaced with synonymous codons, or the linkage of any single and repeating trinucleotides after the translational codon.
  • nucleotide sequences below the codon, translation termination codon, and translation termination codon corresponding to the C-terminal region were examined for the expression of the entire protein by connecting hexanucleotide repeats linking derivatives and inhibitors. Investigate.
  • GFP expression vector is used to express ORF of GFP.
  • Nde I- Xho By cloning to the I site, pET-22b (+) ( N-terminal-gfp ) Expression vectors were obtained (see Table 3).
  • Striped CAT Extended to preserve Nde I positions.
  • General letter represents the polynucleotide of the part corresponding to the N-terminal leader sequence of the clones.
  • CTCGAG Extended to preserve XhoI site.
  • TTA, CTA, TCA complementary codons of stop codon TAA, TAG, and TGA.
  • LeGlu XhoI recognition site, hereinafter referred to as XhoI
  • XhoI -6XHis (His tag) peptide of the GFP expression vector
  • pET-22b (+) N-terminal-gfp-XhoI-His tag
  • PCR was performed (see Tables 1 and 2).
  • the reverse primer may be used to 1) allow the codon (5 'codon) corresponding to the original GFP C-terminus (MDELYK, hy +0.35, SEQ ID NO: 60) to have a unique codon, or 2) a codon corresponding to the C-terminal region ( 5 'codon) and the nucleotides corresponding to the stop codon (TAA) of the original form of GFP by a similar codon, or 3) in ctcgag (XhoI) -6Xcac (His) followed by the translational codon (TAA ) .
  • TAA translation termination codon
  • the PCR product was first cloned into the TA cloning vector (Promega), and then the insert was isolated by NdeI-XhoI .
  • the insert was cloned into the NdeI-XhoI site of pET-22b (+) to obtain an expression vector (see Table 3).
  • the attached XhoI-6XHis peptide may be removed to express ME 6 -GFP and MK 6 -GFP having the C-terminus (MDELYK, 6aa, hy +0.35) and translation termination codon (TAA). Clones were constructed (see Table 3).
  • the expression vector prepared in Example 1 was transformed into E. coli BL21 (DE3) by a conventional method, LB medium (tryptone 20 g, yeast extract 5.0 g, NaCl 0.5 g, KCl After incubating overnight at 30 with 100 ⁇ g ampicillin at 1.86 mg /] at 30, the culture was diluted 100-fold using LB medium and re-incubated to an OD600 of 0.3. Incubated for 3 hours for GFP expression. Thereafter, 1 mM IPTG (isopropyl-1-thio--D-galactopyranoside) was added to the culture, and the culture solution 1 was centrifuged at 4,000xg and 4 for 30 minutes to recover pellets.
  • IPTG isopropyl-1-thio--D-galactopyranoside
  • the pellet wetweight was then measured to quantify the fluorescence of GFP and resuspended in Tris buffer (50 mM Tris, pH 8.0).
  • Tris buffer 50 mM Tris, pH 8.0.
  • the suspension was pulverized in 15X 2-s cycle pulses (at 30% power output) conditions using an ultrasonic sonicator to separate proteins and used as a total fraction. Thereafter, centrifugation was performed at 16,000 rpm, 30 minutes, and 4 conditions to recover the supernatant as an soluble fraction.
  • the fluorescence was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm by using Perkin Elmer Victor3.
  • MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) showed much more suppressed overall expression and subsequent water-soluble expression than the control group, despite the same change in C-terminus as other clones.
  • TAA MK 6 -GFP-Stop
  • XhoI-6XHis (clone # 6)
  • mutation of the nucleotide sequence corresponding to the C-terminal region, position and type of translation termination codon, and below stop codon It can be seen that the reconstituted mutation at the nucleotide sequence level corresponding to XhoI-6XHis of reduced overall protein expression.
  • MK 6 -GFP-Stop (TAA) - XhoI- 6X His ( clone # 6) has the nucleotide sequence corresponding to the control clones MK 6 -GFP-XhoI-6XHis- Stop (TGA) ( clone # 5) and the XhoI-6XHis There were only differences in location shift and translation codons. Thus, in the MK 6 -GFP-Stop (TAA) -XhoI-6XHis clone, the position before the stop codon (5 'codon) -stop codon-stop codon (3' UTR) to have the C-terminal polypeptide sequence in its original form.
  • clones # 7 to # 25 prepared in Example 1 were used as experimental groups.
  • Clone # 7 ⁇ # 25 is -1 position at -32 (-1L at -32L) -Stop (TAA) -XhoI (ctc gag) -6XHis (cac cac cac cac cac) C-terminal codon (5 'codon) variation in the nucleotide sequence of (clones # 7 to # 18), 2) translation termination codon to similar translation termination codon (clone # 19 to # 20), 3) XhoI-6XHis It is a clone (clone # 21 ⁇ # 25) prepared to connect the lowercase ctc, gag, cac, which is a trinucleotide selected from, to the lower portion of the translation termination codon alone and repeatedly (see Table 3).
  • Clones # 6 to # 25 were transformed into Escherichia coli BL21 (DE3), respectively, and the expression level of GFP was measured.
  • the molecular weight of ribonucleotide triphosphates is GTP, 523.2; ATP, 507.2; UTP, 484.2; CTP, 483.2).
  • the C-terminal 5 codon was analyzed up to the -32 position, but the expression was increased to about 60 nt at the -19 position.
  • clones # 7-# 18 are MK 6 Translation with XORI-6XHis polypeptide derived from -GFP-XhoI-6XHis-Stop (TGA) (clone # 5) removed and only homozygous codon mutations for one amino acid TRNA is not expected to be affected, and this is due to the transcription of DNA from transcription, as this overall increase in protein expression is driven by subtle changes or additions of RNA ribonucleotide sequences centered on stop codons. The amount of transcription is determined by the mechanism of generating transcript, and the total protein amount seems to be determined by the translation of this amount of transcription.
  • a stop codon and XhoI ctcgag
  • -6XHis cac
  • Expressions of 1Xgag and 3Xgag in clones # 22 and # 23 increased the expression of total protein in gag, which is a part of the trinucleotide of.
  • MK 6 -GFP-XhoI-6XHis-Stop (TGA) clone (clone # 5) in Figure 1 was excellent in overall expression, there was no problem in transcription, translation, Tat channel secretion, but the polypeptide XhoI-6XHis was deleted Overall expression of MK 6 -GFP-Stop (TAA) -XhoI-6XHis clone # 6 was significantly reduced.
  • codon mutations corresponding to the C-terminus of clone # 6 (clones # 7 to # 16), stop codon mutations (clones # 19 to # 20), and clones that mutated the nucleotides behind the stop codon (clones # 21 ⁇ # 23, # 25) significantly increased overall expression. All of the clones # 7 to # 25 except ribonucleotide mutations (clone # 7 to # 18) of the codon corresponding to the C-terminus and ribonucleotide variations corresponding to the stop codon (clone # 19, 20). Since mutations (clones # 21-25) occurred outside the ORF (protein coding region and stop codon), they have no correlation with translation by tRNA.
  • the trinucleotide added to the 3 'UTR below the stop codon influences transcription and regulates mRNA production, or the mRNA is believed to affect the increase and decrease of the total protein amount through translation.
  • nucleotides added below these stop codons acted as expression inducers and expression reducers, which are expression regulators that regulate total protein levels.
  • expression inducers and expression reducers which are expression regulators that regulate total protein levels.
  • the length of the trinucleotide inserted after the stop codon affects the overall protein expression, starting at the minimum length of 3 nt and stabilizing at about 18 nt.
  • MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) prepared in ⁇ Example 1> was used as a control, and clones # 26 to # 46 prepared in Example 1 were used as experimental groups. (See Table 3).
  • the target protein GFP expressed in the clones had the hydrophilic C-terminal amino acid MDELYK (SEQ ID NO: 60) of the original GFP instead of the XhoI-6XHis peptide at the C-terminus.
  • the # 6 and # 26 to # 46 clones were transformed into Escherichia coli BL21 (DE3), respectively, and the expression level of GFP was measured.
  • 6Xaaa (clone # 30) and 6Xaag (clone # 31) were expressed much lower than the control, while 6Xtga (clone # 43) and 6Xaga (clone # 44) were expressed similarly to the control.
  • the trinucleotide repeats inserted after the stop codons not only efficiently produce these recombinant proteins but also modify the expression of genes with excessive or low expression in vivo, without modifying the ORF at all, and through submutation of the stop codons. It can be applied to control the expression amount of.
  • the inventors have expressed the derivative (expression inducer) and suppressor (expression reducer) the expression of high ME 6 -GFP-Stop (TAA) - XhoI-6XHis clone # 4 translation termination codon (TAA) and the XhoI-6XHis
  • TAA ME 6 -GFP-Stop
  • TAA XhoI-6XHis clone # 4 translation termination codon
  • XhoI-6XHis The effect on the total protein expression when the trinucleotide was inserted in between was confirmed.
  • 6Xgaa SEQ ID NO: 67
  • 10Xgaa SEQ ID NO: 68
  • 6Xcaa SEQ ID NO: 72
  • 6Xtaa SEQ ID NO: 73
  • 6Xtag SEQ ID NO: 74
  • 6Xcag SEQ ID NO: 75
  • 6Xgag (SEQ ID NO: 64), 6Xaaa (SEQ ID NO: 70), 6Xaag (SEQ ID NO: 71), 6Xtga (SEQ ID NO: 83), and 6Xaga (SEQ ID NO: 84) were used.
  • ME 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 4) prepared in ⁇ Example 1> was used as a control, and clones # 62 to # 72 prepared in ⁇ Example 1> were experimental groups. (See Table 3). As a result, the target protein GFP expressed in these clones all had the hydrophilic C-terminal amino acid MDELYK (hy +0.35) of the original form GFP instead of the XhoI-6XHis peptide at the C-terminus.
  • Clones # 4 and clones # 62 to # 72 were transformed into Escherichia coli BL21 (DE3), respectively, and the expression level of GFP was measured.
  • 6Xgaa SEQ ID NO: 67
  • 10Xgaa SEQ ID NO: 68
  • 6Xcaa SEQ ID NO: 72
  • 6Xtaa SEQ ID NO: 73
  • 6Xtag SEQ ID NO: 74
  • 6Xcag (SEQ ID NO: 75) nucleotides are stop codons of ME 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 4)
  • TAA MK 6 -GFP-Stop
  • 6Xtag SEQ ID NO: 74
  • 6Xcag SEQ ID NO: 75
  • 6Xgag, 6Xaaa, 6Xaag, 6Xtga, 6Xaga that acted as inhibitors in MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) were ME 6 -GFP-Stop (TAA) -XhoI-6XHis (clone)
  • TAA MK 6 -GFP-Stop
  • 6Xaaa clone # 65
  • 6Xtga clone # 71
  • 6Xaga clone # 72
  • 6Xgag (clone # 64) was very inhibited
  • 6Xaag Little expression (clone # 66) (see FIG. 4).
  • the present inventors select gaa from the total protein expression derivative trinucleotides sequence thus separated, and select aaa, aag, gag, tga and aga from the protein expression inhibitor trinucleotides sequence to inhibit derivative-inhibition.
  • MK 6 -GFP-Stop (TAA) -XhoI-6XHis (clone # 6) prepared in ⁇ Example 1> was used as a control, and clones # 47 to # 61 prepared in ⁇ Example 1> were experimental groups. (See Table 3). As a result, the target protein GFP expressed in these clones all had the hydrophilic C-terminal amino acid MDELYK (hy +0.35) of the original form GFP instead of the XhoI-6XHis peptide at the C-terminus.
  • Clones # 6 and clones # 47 to # 61 were transformed into Escherichia coli BL21 (DE3), respectively, and the expression level of GFP was measured.
  • the hexanucleotide repeat inserted after the stop codon can not only efficiently produce these recombinant proteins but also modify the expression level of the gene with excessive or low expression in vivo without modifying the ORF at all. It was confirmed that the mutation can be applied to properly control the amount of expression of the entire protein.
  • the present invention relates to a method for regulating the overall expression of a protein, and provides an effect of increasing or decreasing the total expression of an active foreign protein by using a gene construct in which trinucleotide or hexanucleotide repeats are sequentially connected to the 3 'end of the active foreign protein. can do.
  • SEQ ID NO: 1 to 59 means the forward or reverse primer sequence used for cloning the GFP expression vector according to an embodiment of the present invention.
  • SEQ ID NO: 60 refers to the C-terminal sequence of the GFP clone.
  • SEQ ID NO: 61 to 101 refers to a trinucleotide or hexanucleotide sequence according to an embodiment of the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 단백질의 발현을 조절하기 위하여, 1) 프로모터; 2) 번역종결코돈을 포함하는 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위; 및 3) 트리뉴클레오티드 및 헥사뉴클레오티드의 반복체가 순차적으로 연결된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현을 조절하기 위한 발현벡터를 제공한다.

Description

３’영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법
본 발명은 단백질의 발현을 조절하는 방법에 관한 것으로서, 더 상세하게는 3' 영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법에 관한 것이다.
현대의 생명공학에 있어서 핵심은 재조합 단백질의 생산이며 그 중에서도 중요한 것은 재조합 단백질의 양을 많이 생산하는 것이다. 많이 생산된 재조합 단백질은 활성 외래 단백질의 생산 및 회수, 기능 연구를 위한 결정화, 산업화 등에 매우 중요하다. 현재까지 대장균을 이용한 많은 재조합 단백질 생산 연구가 진행되어 왔는데, 이는 대장균이 조작이 쉽고, 짧은 성장시간, 안전한 발현, 저비용과 규모를 쉽게 바꿀 수 있는 장점이 있기 때문이다.
그러나 대장균(E. coli)에서 생산된 외래 기원의 재조합 단백질은 적절한 전사 후 샤페론(post-translational chaperons)"이나 "전사 후 과정(posttranslational processing)"이 없기 때문에, 생산된 재조합 단백질의 적절한 폴딩(folding)이 일어나지 않거나 또는 불가용성 단백질 응집체(inclusion body)로 형성된다(Baneyx, Curr. Opin. Biotechnol. 10:411-421, 1999).
이러한 문제들을 해결하기 위해, 신호서열(signal sequence)이 단백질을 페리플라즘(periplasm) 밖으로 분비하도록 한다는 사실을 기반으로, 신호서열(signal sequence)의 구조 및 기능에 대한 연구가 아미노 말단(N-terminal) 염기성 지역(amino terminal basic region, Lehnhardt, et al., J. Biol. Chem. 263:10300-10303, 1988), 소수성 지역(hydrophobic region, Goldstein et al., J. Bacteriol. 172:1225-1231, 1990), 절단 지역(cleavage region, Duffaud and Inouye, J. Biol. Chem. 263:10224-10228, 1988)을 대상으로 하여 진행되었다. 동시에 수용성 단백질을 생산하기 위해 여러 가지 신호서열(signal sequence)을 이용한 벡터들이 개발되었다(ompA: Ghrayeb et al., EMBO J. 3:2437-2442, 1984; Duffaud et al.,Methods Enzymol. 153:492-507, 1987; phoA: Dodt et al., FEBS Lett. 202:373-377, 1986; Kohl et al., Nucleic Acids Res. 18:1069, 1990; eltA: Morika-Fujimoto et al., J. Biol. Chem. 266:1728-1732, 1991; bla: Oka et al., Agric. Biol. Chem. 51:1099-1104, 1987; eltIIb-B: Jobling et al., Plasmid, 38:158-173, 1997). 그러나 지금까지의 신호서열(signal sequence)을 이용한 벡터들은 수용성 단백질을 발현시키는데 한계가 있고, 또한 발현된 단백질조차도 재조합 융합(fusion) 단백질로 생산되기 때문에 신호서열 절단효소(signal peptidase) 및 단백질 절단 효소의 절단부위를 가져 원래 형태의 아미노 말단을 가진 재조합 단백질을 얻기는 매우 어려운 실정이다. 신호서열(signal sequence)을 이용한 재조합 단백질 생산이 어려운 원인으로는 1) 수용성 단백질의 생산에 대한 예측이 불가능하여 많은 연구자들이 재조합 단백질의 수용성은 전체 단백질의 아미노산 서열의 특성에 달렸다고 추측하고 있으며, 2) 신호서열(signal sequence)로 작용하는 다른서열(sequence)이 너무 많고, 신호 펩티드(signal peptides)의 상호작용을 직접적으로 조사할 수 있는 분석방법이 개발되지 못하였기 때문이다(Triplett et al.,J. Biol. Chem. 276:19648-19655, 2001).
본 발명자들은 대한민국 등록특허 제0981356호 및 등록특허 제1049859에서 신호서열(directional signal)의 N-영역 및/또는 N-영역을 포함하는 신호서열의 소수성 단편을 포함하는 변이된 신호서열 및/또는 친수성 폴리펩티드로 구성된 분비증강자를 포함하는 변이된 신호서열을 코딩하는 폴리뉴클레오티드로 구성된 유전자 컨스트럭트를 포함하는 발현벡터를 제공하고, 상기 신호서열의 N-영역의 단편의 길이에 따른 pI 값이 접착성 단백질의 수용성 발현에 중요한 영향을 주는 것을 확인하였고, 넙치 헵시딘 I과 같이 내부에 막전위유사 도메인이 있는 경우는 분비증강자 서열이 수용성 발현에 중요한 역할을 한다는 것을 밝혔다.
또한, 본 연구자들은 대한민국 등록특허 제 10-1184011호에서 발현시키고자 하는 목적 단백질이 세포질에서 폴딩되어 활성을 나타내는 부피가 큰 활성 단백질일 때 단백질의 수용성 발현을 연구한 바 있다. 이때, 1) 목적 단백질에 산성의 pI 값, 앵커서열 및 높은 친수도 값을 가지는 선도 폴리펩티드를 연결하거나, 2) 목적 단백질의 N-말단에 존재하는 다수의 아미노산을 산성 pI값과 높은 친수도를 갖는 아미노산으로 대체시키거나, 또는 3) 염기성의 pI 값 및 높은 친수도 값을 가지는 선도 폴리펩티드에 해당하는 폴리뉴클레오티드의 GRNA 값을 낮춘 경우에 전체 단백질의 발현 및 수용성 분비가 향상되는 것을 확인하였다. 이러한 결과를 통하여 N-말단이 Tat 채널을 통한 폴딩된 단백질의 수용성 발현에 크게 영향을 미친다는 것을 확인한 바 있다.
따라서 본 연구에서는 앞선 연구인 대한민국 등록특허 제 10-1184011호에서 선도서열로서 N-말단에 높은 친수성을 가져 수용성 발현이 잘 되는 클론들은 벡터 제조과정에서 C-말단에 벡터에서 유래한 폴리펩티드가 융합되어 있었다. 따라서 외래 단백질의 친수성 C-말단을 보유한, 원래 형태의 C-말단을 갖는 재조합 단백질을 발현시키고자 벡터 유래 폴리펩티드가 결실된 클론을 제조하여 단백질을 발현시켰다. 그 결과 전체 및 수용성 발현이 대조군보다 약간 발현이 증가한 경우는 별 문제가 없으나 발현이 현저히 감소한 경우가 있었다. 이 경우 1) 목적 유전자 자체의 ORF에 해당하는 정지 코돈 앞의 C-말단에 해당하는 코돈(5' 코돈)을 동형유사(synonmyous) 코돈으로 변경시키거나, 2) 정지코돈을 다른 동형유사 코돈으로 대체시키거나, 3) 정지코돈의 뒷부분에 특정 또는 임의의 반복된 트리뉴클리오티드를 외래 단백질의 C-말단 뒤에 추가하였다. 이에 따라, 벡터에 삽입된 외래 단백질의 전체 단백질 발현이 향상 또는 감소되는 것을 확인하였고, 단백질 발현을 향상 또는 감소시키는 트리뉴클리오티드 서열을 발현(expression) 유도체(inducer) 및 억제체(reducer)로 명명함으로써 본 발명을 완성하였다. 또한 트리뉴클레오티드 유도체와 억제체를 연결한 헥사뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 적절히 조절할 수 있다.
그러나 이러한 종래의 폴딩되는 큰 활성 외래 단백질의 수용성 발현 방법은 막전위 도메인을 포함하는 단백질의 경우 상기 신호서열의 N-영역의 단편만으로는 수용성 발현에 한계가 있었으며, 발현시키고자 하는 목적 단백질이 GFP(green fluorescent protein)와 같이 내부에 다이설파이드 결합을 갖거나, 또는 막전위 도메인을 포함하는 것으로서 폴딩되어 활성을 나타내는 부피가 큰 활성 외래 단백질(bulky folded active protein)인 경우, 그 수용성 발현이 쉽지 않음이 당업계의 현실이었다. 본 발명은 상기와 같은 문제점을 포함하여 여러 문제점들을 해결하기 위한 것이다. 또한, 본 발명은 외래 단백질의 C-말단의 정지코돈을 포함하는 상위(upstream) 또는 하위(downstream)의 아미노산 및 염기를 변이 또는 삽입함으로써, 폴딩되는 큰 활성 외래 단백질의 전체 단백질 발현을 향상 및 감소시키는 방법을 제공하는 것을 목적으로 한다. 그러나 이러한 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 한정되는 것은 아니다.
본 발명의 일 관점에 따르면, 1) 프로모터; 2) 번역종결코돈을 포함하는 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위; 및 3) 트리뉴클레오티드의 반복체 또는 헥사뉴클레오티드가 순차적으로 연결된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현을 조절하기 위한 발현벡터가 제공된다.
상기 발현벡터에 있어서, 상기 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈일 수 있고, 그의 동형유사 대체코돈일 수 있다. 예를 들어 상기 외래 단백질 고유의 번역종결코돈이 TGA일 경우 상기 동형유사 대체코돈은 TAA일 수 있다. 한편, 상기 트리뉴클레오티드 또는 헥사뉴클레오티드는 1 내지 30회 삽입될 수 있으며, 연속하여 2 내지 30 회 또는 2 내지 15회 삽입될 수 있다., 상기 트리뉴클레오티드의 반복체는 서열번호 61-86로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 삽입된 단백질의 발현을 조절할 수 있으며, 예를 들어 서열번호 61-63, 65-69, 72-82, 또는 85-86로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 증가시킬 수 있다. 한편, 상기 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 감소시킬 수 있다. 또한 트리뉴클레오티드 유도체와 억제체를 연결한 헥사뉴클레오티드의 반복체는 바람직하게는 1 내지 10회 삽입될 수 있으며, 연속하여 2 내지 10회 삽입될 수 있고, 상기 헥사뉴클레오타드 반복체는 서열번호 87-101로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 활성 외래 단백질의 전체 발현을 높게, 중간, 낮게 조절할 수 있다. 예를 들어, 서열번호 87, 91, 92, 94, 97, 98, 및 101로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 증가시킬 수 있으며, 서열번호 89, 95, 96 및 100으로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 중간 수준으로 조절할 수 있으며, 서열번호 88, 90, 93 및 99로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 발현을 감소시킬 수 있다.
또한, 상기 발현벡터에 있어서, 상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질일 수 있으며, 상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)일 수 있다. 또한, 상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)일 수 있으나, 이에 한정되지 않는다. 특히 치료용 단백질을 암호화하는 폴리뉴클레오티드를 본 발명의 발현벡터에 삽입하여 발현시킬 경우, in vivo 또는 ex vivo 유전자 치료법에 활용할 수 있다. 아울러, 그 외의 다양한 단백질을 본 발명에 따른 발현벡터에 삽입함으로써, 전체 단백질의 발현을 조절에 이용할 수 있다.
본 발명의 다른 일 관점에 따르면, 1) 프로모터; 2) 번역종결코돈이 제거된 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 3) 상기 번역종결코돈의 동형유사 대체코돈이 순차적으로 포함된 유전자 컨스트럭트를 포함하는, 상기 활성 외래 단백질의 전체 발현 조절을 위한 발현벡터가 제공된다.
상기 발현벡터에 있어서, 상기 활성 외래 단백질은 고유의 C-말단 폴리펩티드를 가질 수 있다.
또한, 상기 유전자 컨스트럭트는 상기 동형유사 대체코돈의 바로 하위에 트리뉴클레오티드의 반복체를 추가적으로 포함할 수 있고, 이 때 상기 트리뉴클레오티드 는 1 내지 30회 삽입될 수 있으며, 연속하여 2 내지 30회 또는 2 내지 15회 삽입될 수 있고, 상기 트리뉴클레오티드의 반복체는 서열번호 61-86로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 삽입된 단백질의 발현을 조절할 수 있으며, 예를 들어 서열번호 61-63, 65-69, 72-82, 또는 85-86로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 증가시킬 수 있다. 한편, 상기 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 감소시킬 수 있다. 또한 트리뉴클레오티드 유도체와 억제체를 연결한 헥사뉴클레오티드의 반복체는 바람직하게는 1 내지 10회 삽입될 수 있으며, 연속하여 2 내지 10회 삽입될 수 있고, 상기 헥사뉴클레오티드 반복체는 서열번호 87-101로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 활성 외래 단백질의 전체 발현을 높게, 중간, 낮게 조절할 수 있다. 예를 들어, 서열번호 87, 91, 92, 94, 97, 98, 및 101로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 증가시킬 수 있으며, 서열번호 89, 95, 96 및 100으로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 중간 수준으로 조절할 수 있으며, 서열번호 88, 90, 93 및 99로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 발현을 감소시킬 수 있다.
또한, 상기 발현벡터에 있어서, 상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질일 수 있으며, 상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)일 수 있다. 또한, 상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)일 수 있으나, 이에 한정되지 않는다. 특히 치료용 단백질을 암호화하는 폴리뉴클레오티드를 본 발명의 발현벡터에 삽입하여 발현시킬 경우, in vivo 또는 ex vivo 유전자 치료법에 활용할 수 있다. 아울러, 그 외의 다양한 단백질을 본 발명에 따른 발현벡터에 삽입함으로써, 전체 단백질의 발현을 조절에 이용할 수 있다.
본 발명의 다른 일 관점에 따르면, 1) 프로모터; 2) 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 3) 상기 번역종결코돈 하위에 바로 연결되는 트리뉴클레오티드 및 헥사뉴클레오티드의 반복체가 순차적으로 포함되는 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현 조절하기 위한 발현벡터가 제공된다.
상기 발현벡터에 있어서, 상기 활성 외래 단백질은 고유의 C-말단 폴리펩티드를 가질 수 있다.
상기 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈일 수 있고, 그의 동형유사 대체코돈일 수 있다. 예를 들어 상기 외래 단백질 고유의 번역종결코돈이 TGA일 경우 상기 동형유사 대체코돈은 TAA일 수 있다. 상기 트리뉴클레오티드는 1 내지 30회 삽입될 수 있으며, 연속하여 2 내지 30회 또는 2 내지 15회 삽입될 수 있고, 상기 트리뉴클레오티드의 반복체는 서열번호 61-86로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 삽입된 단백질의 발현을 조절할 수 있으며, 예를 들어 서열번호 61-63, 65-69, 72-82, 또는 85-86로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 증가시킬 수 있다. 한편, 상기 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 감소시킬 수 있다. 또한 트리뉴클레오티드 유도체와 억제체를 연결한 헥사뉴클레오티드의 반복체는 바람직하게는 1 내지 10회 삽입될 수 있으며, 연속하여 2 내지 10회 삽입될 수 있고, 상기 헥사뉴클레오티드 반복체는 서열번호 87-101로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 활성 외래 단백질의 전체 발현을 높게, 중간, 낮게 조절할 수 있다. 예를 들어, 서열번호 87, 91, 92, 94, 97, 98, 및 101로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 증가시킬 수 있으며, 서열번호 89, 95, 96 및 100으로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 중간 수준으로 조절할 수 있으며, 서열번호 88, 90, 93 및 99로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 발현을 감소시킬 수 있다.
또한, 상기 발현벡터에 있어서, 상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질일 수 있으며, 상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)일 수 있다. 또한, 상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)일 수 있으나, 이에 한정되지 않는다. 다양한 단백질을 본 발명에 따른 발현벡터에 삽입함으로써, 전체 단백질의 발현을 조절에 이용할 수 있다.
본 발명의 또 다른 관점에 따르면, 프로모터; 및 상기 프로모터에 작동 가능하도록 연결된 것으로서, 번역종결코돈(stop codon)이 동형유사 대체코돈으로 치환되거나 상기 번역종결코돈 및 상기 번역종결코돈으로부터 1 내지 120 뉴클레오티드 상위 내에 존재하는 적어도 하나 이상의 코돈이 동형유사 대체코돈으로 치환된 활성 외래 단백질을 암호화하는 폴리뉴클레오티드로 구성된 유전자 컨스트럭트를 포함하는 재조합 발현벡터를 제조하는 단계; 상기 재조합 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 및 상기 형질전환체를 배양하여 상기 활성 외래단백질의 발현을 유도하는 단계를 포함하는, 상기 활성 외래 단백질의 전체 발현을 조절하는 방법이 제공된다.
상기 활성 외래 단백질의 전체 발현을 조절하는 방법에 있어서, 상기 동형유사 대체코돈은 동일한 아미노산을 암호화하되 코돈의 핵산서열이 상이한 것을 의미한다.
상기 방법에 있어서, 상기 번역종결코돈은 TAA, TAG, 또는 TGA일 수 있다. 또한, 상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질일 수 있으며, 상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)일 수 있다. 또한 상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)일 수 있으나, 이에 한정되지 않는다. 특히 치료용 단백질을 암호화하는 폴리뉴클레오티드를 본 발명의 발현벡터에 삽입하여 발현시킬 경우, in vivo 또는 ex vivo 유전자 치료법에 활용할 수 있다. 아울러, 그 외의 다양한 단백질을 본 발명에 따른 발현벡터에 삽입함으로써, 전체 단백질의 발현을 조절할 수 있다.
본 발명의 다른 관점에 따르면, 프로모터; 상기 프로모터에 작동 가능하도록 연결된 것으로서, 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및, 상기 폴리뉴클레오티드의 번역종결 코돈 하위(downstream)에 연결된 트리뉴클레오티드(trinucleotide) 및 헥사뉴클레오티드의 반복체로 구성된 유전자 컨스트럭트를 포함하는 발현벡터를 제조하는 단계; 상기 발현벡터로 숙주 세포를 형질전환하여 형질전환체를 제조하는 단계; 및 상기 형질전환체를 배양하여 상기 활성 외래 단백질의 발현을 유도하는 단계를 포함하는, 상기 활성 외래 단백질의 전체 발현을 조절하는 방법이 제공된다.
상기 방법에 있어서, 상기 트리뉴클레오티드는 1 내지 30회 삽입될 수 있으며, 연속하여 2 내지 30회 또는 2 내지 15회 삽입될 수 있고, 상기 트리뉴클레오티드의 반복체는 서열번호 61-86로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 삽입된 단백질의 발현을 조절할 수 있으며, 예를 들어 서열번호 61-63, 65-69, 72-82, 또는 85-86로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 증가시킬 수 있다. 한편, 상기 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 갖는 트리뉴클레오티드 반복체는 활성 외래 단백질의 전체 발현을 감소시킬 수 있다. 또한 트리뉴클레오티드 유도체와 억제체를 연결한 헥사뉴클레오티드의 반복체는 바람직하게는 1 내지 10회 삽입될 수 있으며, 연속하여 2 내지 10회 삽입될 수 있고, 상기 헥사뉴클레오티드 반복체는 서열번호 87-101로 기재되는 핵산서열을 가질 수 있다. 상기 핵산 서열은 활성 외래 단백질의 전체 발현을 높게, 중간, 낮게 조절할 수 있다. 예를 들어, 서열번호 87, 91, 92, 94, 97, 98, 및 101로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 증가시킬 수 있으며, 서열번호 89, 95, 96 및 100으로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 활성 외래 단백질의 수용성 발현 및 분비를 중간 수준으로 조절할 수 있으며, 서열번호 88, 90, 93 및 99로 기재되는 핵산서열을 갖는 헥사뉴클레오티드 반복체는 발현을 감소시킬 수 있다.
또한, 상기 방법에 있어서, 상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질일 수 있으며, 상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)일 수 있다. 또한, 상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)일 수 있으나, 이에 한정되지 않는다. 특히 치료용 단백질을 암호화하는 폴리뉴클레오티드를 본 발명의 발현벡터에 삽입하여 발현시킬 경우, in vivo 또는 ex vivo 유전자 치료법에 활용할 수 있다. 아울러, 그 외의 다양한 단백질을 본 발명에 따른 발현벡터에 삽입함으로써, 전체 단백질의 발현을 조절에 이용할 수 있다.
본 발명의 다른 관점에 따르면, 프로모터, 번역종결코돈이 제거된 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위; 및 발현 조절체로서 번역종결코돈을 순차적으로 포함하는 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 상기 형질전환체를 배양하는 단계; 상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및 발현 유도체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법이 제공된다.
상기 스크리닝 방법에 있어서, 외래 단백질의 발현 수준을 증가시키는 번역 종결코돈은 발현 유도체일 수 있으며, 반대로 외래 단백질의 발현 수준을 감소시키는 종결코돈은 발현 억제체일 수 있다.
상기 스크리닝 방법에 있어서, 상기 발현 유도체로서 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈일 수 있고, 그의 동형유사 대체코돈일 수 있다. 예를 들어 상기 외래 단백질 고유의 번역종결코돈이 TGA일 경우 상기 동형유사 대체코돈은 TAA일 수 있다.
본 발명의 다른 관점에 따르면, 프로모터, 번역종결코돈을 포함하는 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위, 및 발현 조절체로서 트리뉴클레오티드 및 헥사뉴클레오티드 반복체가 순차적으로 연결된 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 상기 형질전환체를 배양하는 단계; 상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및 발현 유도체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법이 제공된다.
상기 스크리닝 방법에 있어서, 외래 단백질의 발현 수준을 증가시키는 트리뉴클레오티드 반복체는 발현 유도체일 수 있으며, 반대로 외래 단백질의 발현 수준을 감소시키는 트리뉴클레오티드 반복체는 발현 억제체일 수 있다.
상기 스크리닝 방법에 있어서, 상기 발현 조절체로서 트리뉴클레오티드 반복체는 1 내지 30회 반복하여 삽입될 수 있으며, 이에 한정되지 않는다.
상기 스크리닝 방법에 있어서, 외래 단백질의 발현 수준을 증가시키는 헥사뉴클레오티드 반복체는 발현 유도체일 수 있으며, 반대로 외래 단백질의 발현 수준을 감소시키는 헥사뉴클레오티드 반복체는 발현 억제체일 수 있다.
상기 스크리닝 방법에 있어서, 상기 발현 조절체로서 헥사뉴클레오티드 반복체는 1 내지 10회 반복하여 삽입될 수 있으며, 이에 한정되지 않는다.
본 발명의 다른 관점에 따르면, 프로모터, 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 발현 조절체로서 상기 번역종결코돈의 동형유사 대체코돈이 순차적으로 포함된 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 상기 형질전환체를 배양하는 단계; 상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및 발현 유도체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법이 제공된다.
상기 스크리닝 방법에 있어서, 상기 발현 유도체로서 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈일 수 있고, 그의 동형유사 대체코돈일 수 있다. 예를 들어 상기 외래 단백질 고유의 번역종결코돈이 TGA일 경우 상기 동형유사 대체코돈은 TAA일 수 있다.
본 발명의 다른 관점에 따르면, 프로모터, 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 상기 번역종결코돈 하위에 바로 연결되는 트리뉴클레오티드의 반복체 또는 헥사뉴클레오티드의 반복체가 순차적으로 포함되는 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 상기 형질전환체를 배양하는 단계; 상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및 발현 유도체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법이 제공된다.
상기 스크리닝 방법에 있어서, 외래 단백질의 발현 수준을 증가시키는 트리뉴클레오티드는 발현 유도체일 수 있으며, 반대로 외래 단백질의 발현 수준을 감소시키는 트리뉴클레오티드는 발현 억제체일 수 있다.
상기 스크리닝 방법에 있어서, 상기 트리뉴클리오타이드 서열은 1회 내지 30회 반복하여 삽입될 수 있으며, 이에 한정되지 않는다.
상기 스크리닝 방법에 있어서, 외래 단백질의 발현 수준을 증가시키는 헥사뉴클레오티드 반복체는 발현 유도체일 수 있으며, 반대로 외래 단백질의 발현 수준을 감소시키는 헥사뉴클레오티드 반복체는 발현 억제체일 수 있다.
상기 스크리닝 방법에 있어서, 상기 발현 조절체로서 헥사뉴클레오티드 반복체는 1 내지 10회 반복하여 삽입될 수 있으며, 이에 한정되지 않는다.
본 발명의 다른 관점에 따르면, 본 발명의 일 실시예에 따른 발현벡터로 형질전환된 약독화된 세포주 또는 바이러스가 제공된다. 상기 세포주는 세균, 진균 또는 암세포일 수 있다. 특히 본 발명의 일 실시예에 따른 번역종결코돈 뒤에 트리뉴클레오티드 및 헥사뉴클레오티드 반복체가 포함되는 발현벡터의 경우, 해당 세포주 또는 바이러스의 증식 또는 생존에는 필수적이면서 병원성과 상관관계가 있는 유전자의 발현을 완전히 저해하지는 않은 채 약화시킴으로써, 해당 세포주 또는 바이러스의 생존에는 영향을 미치지 않으면서도 병원성을 제거함으로써 약독화를 달성할 수 있다. 상기 약독화는 본 발명의 일 실시예에 따른 벡터를 형질전환시켜, 원래 야생형 세포주 또는 균주가 가지고 있는 병원성 유전자를 본 발명의 일시예에 따른 번역 조절체를 포함한 유전자로 치환시킴으로써 달성될 수 있다. 상기 유전자 치환 방법은 loxP-Cre 시스템과 같은 당업계에 잘 알려진 방법을 이용하여 달성될 수 있다.
상기 트리뉴클레오티드 반복체는 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 가질 수 있다.
상기 헥사뉴클레오티드 반복체는 서열번호 88, 90, 93 또는 99로 기재되는 핵산서열을 가질 수 있다.
본 발명의 다른 관점에 따르면, 1) 프로모터; 및, 2) 상기 프로모터에 작동 가능하도록 연결된 것으로서, C-말단의 친수도 값이 0.35 내지 2.00으로 조절된 폴리펩타이드를 코딩하는 폴리뉴클레오타이드로 구성된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현을 조절하기 위한 발현벡터가 제공된다.
본 발명의 일 실시예를 통하여 C-말단이 친수성을 갖는 경우도 Tat 채널을 통한 수용성 발현을 증가시켜, 본 발명의 일 실시예에 따른 발현벡터에 연결된 활성 단백질의 발현을 증가시킬 수 있음을 입증하였다.
상기한 바와 같이 이루어진 본 발명의 일 실시예에 따르면, 단백질의 전체 발현을 증가 또는 감소시킬 수 있다. 물론 이러한 효과에 의해 본 발명의 범위가 한정되는 것은 아니다.
도 1은 N-말단이 다른 여러 GFP 클론들에서 C-말단의 Le㎍lu(XhoI 인식부위, 이하, XhoI으로 표시)-6XHis(His tag, 6aa, hy -0.28) 펩티드(이하, XhoI-6XHis로 표시)를 제거한 후 원래 GFP의 친수성 C-말단(MDELYK, 6aa, hy +0.35)을 갖도록 클론을 구성한 후 단백질의 전체 및 수용성 발현 분획(약 50㎍)의 형광도를 조사한 결과이며, 도 1의 1~6 라인 및 막대 그래프에 관한 설명은 하기와 같다:
■ 형광도: 전체 분획;
□ 형광도: 수용성 분획;
라인 1: GFP-Le㎍lu(XhoI)-6XHis-Stop(TGA), 대조군(클론 #1);
라인 2: GFP-Stop(TAA)-ctcgag(XhoI)-6Xcac(6XHis)(클론 #2);
라인 3: ME6-GFP-XhoI-6XHis-Stop(TGA) 대조군(클론 #3);
라인 4: ME6-GFP-Stop(TAA)-XhoI-6XHis (클론 #4);
라인 5: MK6-GFP-XhoI-6XHis-Stop(TGA) 대조군(클론 #5); 및
라인 6: MK6-GFP-Stop(TAA)-XhoI-6XHis (클론 #6).
도 2는 낮은 수용성 발현을 보이는 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 해당하는 클론의 C-말단에 해당하는 코돈(5 코돈) 및 번역종결코돈을 동형유사(synonymous) 코돈으로 대체시키거나 또는 번역종결코돈의 하위 부분(downstream)의 ctcgag(XhoI)-6Xcac(6XHis)를 구성하는 트리뉴클레오티드(trinucleotide, 일반 소문자) ctc, gag 및 cac의 단독 또는 반복을 MK6-GFP-Stop(TAA)-XhoI-6XHis 클론 #6의 번역종결코돈과 XhoI-6XHis 사이에 삽입시킨 후, 각 클론들에서 발현된 전체 단백질 분획(약 50㎍)의 형광도를 확인한 결과이며, 도 2의 1~20 라인 및 막대 그래프에 관한 설명은 하기와 같다:
■ 형광도: 전체 분획;
라인 1: MK6-GFP(C-terminal: MDELYK)-Stop(TAA)-XhoI-6XHis, 대조군(클론 #6);
라인 2: MK6-GFP[C-terminal -1 K(AAG→AAA)]-Stop(TAA)-XhoI-6XHis(클론 #7);
라인 3: MK6-GFP[C-terminal -2 Y(TAC→TAT)]-Stop(TAA)-XhoI-6XHis(클론 #8);
라인 4: MK6-GFP[C-terminal -3 L(CTG→CTA)]-Stop(TAA)-XhoI-6XHis(클론 #9);
라인 5: MK6-GFP[C-terminal -3 L(CTG→CTT)]-Stop(TAA)-XhoI-6XHis(클론 #10);
라인 6: MK6-GFP[C-terminal -3 L(CTG→CTC)]-Stop(TAA)-XhoI-6XHis(클론 #11);
라인 7: MK6-GFP[C-terminal -4 E(GAG→GAA)]-Stop(TAA)-XhoI-6XHis (클론 #12);
라인 8: MK6-GFP[C-terminal -5 D(GAC→GAT)]-Stop(TAA)-XhoI-6XHis (클론 #13);
라인 9: MK6-GFP[C-terminal -11 G(GGG→GGC))]-Stop(TAA)-XhoI-6XHis (클론 #14);
라인 10: MK6-GFP[C-terminal -15 V(GTG→GTC))]-Stop(TAA)-XhoI-6XHis (클론 #15);
라인 11: MK6-GFP[C-terminal -19 L(CTG→CTC))]-Stop(TAA)-XhoI-6XHis (클론 #16);
라인 12: MK6-GFP[C-terminal -25 K(AAG→AAA))]-Stop(TAA)-XhoI-6XHis (클론 #17);
라인 13: MK6-GFP[C-terminal -32 L(CTG→CTC))]-Stop(TAA)-XhoI-6XHis (클론 #18);
라인 14: MK6-GFP-Stop(TAG)-XhoI-6XHis (클론 #19);
라인 15: MK6-GFP-Stop(TGA)-XhoI-6XHis (클론 #20);
라인 16: MK6-GFP-Stop(TAA)-6Xctc-XhoI-6XHis (클론 #21);
라인 17: MK6-GFP-Stop(TAA)-1Xgag-XhoI-6XHis (클론 #22);
라인 18: MK6-GFP-Stop(TAA)-3Xgag-XhoI-6XHis (클론 #23);
라인 19: MK6-GFP-Stop(TAA)-6Xgag-XhoI-6XHis (클론 #24); 및
라인 20: MK6-GFP-Stop(TAA)-6Xcac-XhoI-6XHis (클론 #25).
도 3은 낮은 수용성 발현을 보이는 MK6-GFP-Stop(TAA)-XhoI-6XHis (클론 #6)에 해당하는 클론의 번역종결코돈(stop codon)의 하위 부분(downstream)을 임의의 반복 트리뉴클레오티드로 삽입하여 제조한 변이체 클론에서 발현된 전체 단백질 분획(약 50㎍)의 형광도를 확인한 결과이며, 도 3의 1~22 라인 및 막대 그래프에 관한 설명은 하기와 같다:
■ 형광도: 전체 분획;
라인 1: MK6-GFP-Stop(TAA)-XhoI-6XHis, 대조군(클론 #6);
라인 2: MK6-GFP-Stop(TAA)-4Xgaa-XhoI-6XHis (클론 #26);
라인 3: MK6-GFP-Stop(TAA)-6Xgaa-XhoI-6XHis (클론 #27);
라인 4: MK6-GFP-Stop(TAA)-10Xgaa-XhoI-6XHis (클론 #28);
라인 5: MK6-GFP-Stop(TAA)-15Xgaa-XhoI-6XHis (클론 #29);
라인 6: MK6-GFP-Stop(TAA)-6Xaaa-XhoI-6XHis (클론 #30);
라인 7: MK6-GFP-Stop(TAA)-6Xaag-XhoI-6XHis (클론 #31);
라인 8: MK6-GFP-Stop(TAA)-6Xcaa-XhoI-6XHis (클론 #32);
라인 9: MK6-GFP-Stop(TAA)-6Xtaa-XhoI-6XHis (클론 #33);
라인 10: MK6-GFP-Stop(TAA)-6Xtag-XhoI-6XHis (클론 #34);
라인 11: MK6-GFP-Stop(TAA)-6Xcag-XhoI-6XHis (클론 #35);
라인 12: MK6-GFP-Stop(TAA)-6Xggg-XhoI-6XHis (클론 #36);
라인 13: MK6-GFP-Stop(TAA)-6Xttt-XhoI-6XHis (클론 #37);
라인 14: MK6-GFP-Stop(TAA)-6Xcca-XhoI-6XHis (클론 #38);
라인 15: MK6-GFP-Stop(TAA)-6Xgat-XhoI-6XHis (클론 #39);
라인 16: MK6-GFP-Stop(TAA)-6Xgac-XhoI-6XHis (클론 #40);
라인 17: MK6-GFP-Stop(TAA)-6Xaat-XhoI-6XHis (클론 #41);
라인 18: MK6-GFP-Stop(TAA)-6Xaac-XhoI-6XHis (클론 #42);
라인 19: MK6-GFP-Stop(TAA)-6Xtga-XhoI-6XHis (클론 #43);
라인 20: MK6-GFP-Stop(TAA)-6Xaga-XhoI-6XHis (클론 #44);
라인 21: MK6-GFP-Stop(TAA)-6Xtac-XhoI-6XHis (클론 #45); 및
라인 22: MK6-GFP-Stop(TAA)-6Xctg-XhoI-6XHis (클론 #46);
도 4는 높은 수용성 발현을 보이는 ME6-GFP-Stop(TAA)-XhoI-6XHis에 해당하는 클론의 번역종결코돈의 하위 부분(downstream)을 도 3에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서 전체 단백질 발현을 회복시킨 반복 트리뉴클레오티드(유도체, inducer) 또는 대조군보다 낮거나 유사하게 전체 단백질을 발현시킨 트리뉴클레오티드(억제체, reducer)로 삽입시킨 후, 각 클론들에서 발현된 전체 단백질 분획(약 50 ㎍)의 형광도를 확인한 결과이다. 상기 형광도는 3개의 서로 다른 콜로니로부터 얻어진 결과를 비교한 평균값으로 나타냈으며, 도 4의 1~12 라인 및 막대 그래프에 관한 설명은 하기와 같다:
■ 형광도: 전체 분획;
라인 1: ME6-GFP-Stop(TAA)-XhoI-6XHis, control(클론 #4);
라인 2: ME6-GFP-Stop(TAA)-6Xgaa-XhoI-6XHis(클론 #62);
라인 3: ME6-GFP-Stop(TAA)-10Xgaa-XhoI-6XHis(클론 #63);
라인 4: ME6-GFP-Stop(TAA)-6Xgag-XhoI-6XHis(클론 #64);
라인 5: ME6-GFP-Stop(TAA)-6Xaaa-XhoI-6XHis(클론 #65);
라인 6: ME6-GFP-Stop(TAA)-6Xaag-XhoI-6XHis(클론 #66);
라인 7: ME6-GFP-Stop(TAA)-6Xcaa-XhoI-6XHis(클론 #67);
라인 8: ME6-GFP-Stop(TAA)-6Xtaa-XhoI-6XHis(클론 #68);
라인 9: ME6-GFP-Stop(TAA)-6Xtag-XhoI-6XHis(클론 #69);
라인 10: ME6-GFP-Stop(TAA)-6Xcag-XhoI-6XHis(클론 #70);
라인 11: ME6-GFP-Stop(TAA)-6Xtga-XhoI-6XHis(클론 #71);및
라인 12: ME6-GFP-Stop(TAA)-6Xaga-XhoI-6XHis(클론 #72).
도 5는 낮은 수용성 발현을 보이는 MK6-GFP-Stop(TAA)-XhoI-6XHis (클론 #6)에 해당하는 클론의 번역종결코돈(stop codon)의 하위 부분(downstream)을 전체 단백질 발현을 회복시킨 반복 트리뉴클레오티드(유도체, inducer) 서열과 대조군보다 낮거나 유사하게 전체 단백질을 발현시킨 트리뉴클레오티드(억제체, reducer) 서열을 연결한 헥사뉴클레오티드 반복체를 삽입하여 제조한 변이체 클론에서 발현된 전체 단백질 분획(약 50 ㎍)의 형광도를 확인한 결과이며, 도 5의 1~16 라인 및 막대 그래프에 관한 설명은 하기와 같다:
■ 형광도: 전체 분획;
라인 1: MK6-GFP-Stop(TAA)-XhoI-6XHis, 대조군(클론 #6);
라인 2: MK6-GFP-Stop(TAA)-1Xgaa aaa-XhoI-6XHis (클론 #47);
라인 3: MK6-GFP-Stop(TAA)-2Xgaa aaa-XhoI-6XHis (클론 #48);
라인 4: MK6-GFP-Stop(TAA)-3Xgaa aaa-XhoI-6XHis (클론 #49);
라인 5: MK6-GFP-Stop(TAA)-1Xgaa aag-XhoI-6XHis (클론 #50);
라인 6 MK6-GFP-Stop(TAA)-2Xgaa aag-XhoI-6XHis (클론 #51);
라인 7: MK6-GFP-Stop(TAA)-3Xgaa aag-XhoI-6XHis (클론 #52);
라인 8: MK6-GFP-Stop(TAA)-1Xgaa gag-XhoI-6XHis (클론 #53);
라인 9: MK6-GFP-Stop(TAA)-2Xgaa gag-XhoI-6XHis (클론 #54);
라인 10: MK6-GFP-Stop(TAA)-3Xgaa gag-XhoI-6XHis (클론 #55);
라인 11: MK6-GFP-Stop(TAA)-1Xgaa tga-XhoI-6XHis (클론 #56);
라인 12: MK6-GFP-Stop(TAA)-2Xgaa tga-XhoI-6XHis (클론 #57);
라인 13: MK6-GFP-Stop(TAA)-3Xgaa tga-XhoI-6XHis (클론 #58);
라인 14: MK6-GFP-Stop(TAA)-1Xgaa aga-XhoI-6XHis (클론 #59);
라인 15: MK6-GFP-Stop(TAA)-2Xgaa aga-XhoI-6XHis (클론 #60);
라인 16: MK6-GFP-Stop(TAA)-3Xgaa aga-XhoI-6XHis (클론 #61)
본 문서에서 사용되는 용어를 정의하면 하기와 같다.
본 문서에서 사용되는 "발현벡터"는 발현벡터의 전사에 제공되는 추가단편에 작동가능하게 연결된 관심의 폴리펩티드를 암호화하는 단편으로 구성되는 선형 또는 원형의 DNA 분자이다. 그와 같은 추가단편은 프로모터 및 종료암호 서열을 포함한다. 발현벡터는 하나 이상의 복제 개시점, 하나 이상의 선택마커, 증폭제(enhancer), 폴리아데닐화 신호, 기타 등을 또한 포함한다. 발현벡터는 일반적으로 플라스미드 또는 바이러스 DNA로부터 유도되거나, 또는 둘 다의 요소를 함유한다.
본 문서에서 사용되는 "작동 가능하게 연결된"은 단편은 배열되어서 그들은 일제히 그들의 의도한 목적, 예를 들면, 전사는 프로모터에서 개시하고 암호화 단편을 통해 종료암호로 진행하는데 작용하는 것을 나타낸다.
본 문서에서 사용되는 "외래 단백질"은 숙주세포 내재적으로 존재하는 단백질이 아닌 외부에서 이를 암호화하는 유전자를 포함하는 발현벡터로 형질전환된 형질전환체에서 생성되는 단백질을 의미한다.
본 문서에서 사용되는 "C-말단 폴리펩티드"는 외래 단백질의 C-말단에 해당하는 폴리펩티드를 의미하며, 고유, 추가, 결실 또는 변이된 C-말단에 위치하는 폴리펩티드를 포함하며, 구체적으로 번역종결코돈 상위(upstream)로부터 1-40개의 아미노산일 수 있다.
본 문서에서 사용되는 "번역 코돈 및 번역종결코돈의 동형유사 대체코돈(synonymous codon)"은 특정 아미노산에 상응하는 코돈 또는 번역종결코돈에 상응하되 핵산서열이 다른 코돈을 의미하며, 예를 들어 TAA의 동형유사 대체코돈은 TAG 또는 TGA이고, TAG의 동형유사 대체코돈은 TGA 또는 TAA이고, TGA의 동형유사 대체코돈은 TAA 또는 TAG이다.
본 문서에서 사용되는 "트리뉴클레오티드의 반복체"는 번역종결코돈 뒤에 트리뉴클레오티드(trinucleotide) 서열이 연속적으로 반복된 폴리뉴클레오티드를 의미한다.
본 문서에서 사용되는 "헥사뉴클레오티드의 반복체"는 번역종결코돈 뒤에 헥사뉴클레오티드(hexanucleotide) 서열이 연속적으로 반복된 폴리뉴클레오티드를 의미한다.
본 문서에서 사용되는 "발현 조절체(expression regulator)" 는 외래 단백질의 발현을 증가 또는 감소시킬 수 있는 외래 단백질의 C-말단의 번역종결코돈 상위(upstream), 또는 번역종결코돈 하위(downstream)에 삽입되는 트리뉴클레오티드의 반복체 또는 번역 코돈 및 번역종결코돈의 동형유사 대체코돈을 의미한다.
본 문서에서 사용되는 "발현 유도체(expression inducer)" 는 외래 단백질의 전체 발현을 증가시키는 기능을 수행하도록 외래 단백질 C-말단의 번역종결코돈 상위 또는 하위에 C-말단의 번역 코돈 및 번역종결코돈의 동형유사 대체코돈 또는 삽입된 뉴클레오티드를 의미한다. 상기 뉴클레오티드 중 트리뉴클레오티드는 2 내지 30회 삽입될 수 있으며, 연속하여 2 내지 5회 삽입될 수 있다. 예를 들어, 본 발명의 일 실시예에서 단백질의 전체 발현을 증가시킨 서열번호 61~86로 기재되는 핵산서열 중 어느 하나를 갖는 트리뉴클레오티드는 활성 외래 단백질의 발현을 증가시킬 수 있다. 상기 뉴클레오티드 중 헥사뉴클레오티드는 1 내지 3회 삽입될 수 있으며, 연속하여 2 내지 10회 삽입될 수 있다. 예를 들어, 본 발명의 일 실시예에서 단백질의 전체 발현을 증가시킨 서열번호 87~101로 기재되는 핵산서열 중 어느 하나를 갖는 헥사뉴클레오티드는 활성 외래 단백질의 발현을 적절히 조절할 수 있다.
본 문서에서 사용되는 "발현 억제체(expression reducer)" 는 외래 단백질의 전체 발현을 감소시키거나 거의 발현시키지 못하는 기능을 수행하도록, 외래 단백질 C-말단의 번역종결코돈 상위 또는 하위에 삽입된 트리뉴클레오티드 또는 C-말단의 번역코돈 및 번역종결코돈의 동형유사 대체코돈을 의미한다. 예를 들어, 상기 뉴클레오티드는 서열번호 64, 70, 71, 83 또는 84로 기재되는 핵산서열을 갖는 트리뉴클레오티드일 수 있다.
상기 헥사뉴클레오티드 반복체는 서열번호 88, 90, 93 또는 99로 기재되는 핵산서열을 가질 수 있다.
본 문서에서 사용되는 "스크리닝 방법"은 본 발명의 일 실시예를 통하여 확인된 외래 단백질의 전체 발현을 증가 또는 감소시킬 수 있는 외래 단백질의 1) C-말단의 번역종결코돈을 외래 단백질 고유의 코돈으로 변이, 2) C-말단의 번역종결코돈을 동형유사 대체코돈으로 변이, 3) C-말단의 종결코돈 상위 부분(upstream)을 동형유사 대체코돈으로 변이, 또는 4) 종결코돈 하위 부분(downstream)에 트리뉴클레오티드를 삽입하는 방법을 이용하는 방법을 의미한다. 본 발명의 일 실시예를 통하여 스크리닝 된 단백질의 전체 발현을 조절할 수 있는 번역 조절체 이외에도, 이러한 원리를 적용하여 다양한 외래 단백질의 발현을 증가 또는 감소시키는 번역 조절체를 용이하게 스크리닝 할 수 있다. 따라서, 이러한 방법을 이용하여 분자 수준에서 유전자의 이상발현에 의하여 유발되는 질병의 기초연구, 치료제 개발에 유용하게 적용할 수 있다.
본 문서에서 사용되는 "치료용 단백질(therapeutic protein)"은 치료 활성을 가진 단백질 또는 폴리펩티드를 의미하며, 예를 들어, 인슐린; 인간 성장 호르몬(human growth hormone) 또는 소 성장 호르몬(bovine growth hormone)을 포함하는 성장 호르몬; 성장 호르몬방출 인자(growth hormone-releasing factor); 부갑상선 호르몬(parathyroid hormone); 갑상선 자극하는 호르몬(thyroid-stimulating hormone); 여포자극호르몬(follicle stimulating hormone); 황체 형성 호르몬(luteinising hormone); 인터페론 알파, 인터페론-베타 및 인터페론-감마; 혈관내피성장인자(vascular endothelial growth factor); 호르몬 수용체 또는 성장 인자를 위한 수용체; 인테그린(integrin); A 또는 D 단백질; 류머티스성 인자(rheumatoid factors); 골 유래 신경 영양 인자(bone-derive neutrophic factor; BDNF)와 같은 신경영양인자(neutrophic factor); 뉴로트로핀(neurotrophin), NGF-베타와 같은 신경성장인자(nerve growth factor); 혈소판-유래 성장인자(Platelet-derived growth factor); FGF 또는 bFGF와 같은 섬유아세포 성장인자(fibroblast growth factor); 상피세로 성장인자(epidermal growth factor); TGF-알파 및 TGF-베타와 같은 형질전환 성장인자(transformation growth factor); 인슐린 또는 인슐린 유사성장인자; 각질세포성장인자(keratinocyte growth factor); 인슐린유사 성장인자-결합단백질(growth factor-binding proteins resembling insulin); CD-3 CD-4, CD-8, 또는 CD-19와 같은 CD 단백질; 에리스로포이에틴(erythropoietin); 골 유도 인자(bone-inducing factors); 항체독소(immunotoxins); 골형성단백질(bone morphogenetic protein; BMP); M-CSF, GM-CSF 또는 G-CSF 등과 같은 콜로니자극인자(colony stimulating factor); 노화 가속 인자(ageing accelerating factors); 위 리파아제(gastric lipases), 췌장 리파아제(pancreatic lipases) 또는 담즙 리파아제(biliary lipases), 엘라스타아제(elastases), 알파-1 항 트립신과 같은 항단백분해효소(anti-proteases); 프로테아제; 옥시다아제; 파이타아제(phytases); 키티나아제 (chitinases); 인베르타제(invertase); 셀룰라아제(cellulases); 자일라나제(xylanases); 콜라겐과 같은 구조 단백질; 락토페린과 같은 트랜스페린; 헤모글로빈 또는 인간 알부민과 같은 혈액 단백질; 혈액 보조인자(blood cofactors), 인자 , 인자 , 인자 , 인자 , 조직 인자(tissue factor), 폰 빌레브란트 인자(von Willebrands Factor)와 같은 응고 인자; 단백질 C와 같은 항응고인자(anti-coagulation factors); 심방 나트륨 배출 인자(atrial natriuretic factor); 레닌(renin); 칼시토닌(calcitonin); 글루카곤(glucagon); 폐표면 활성제(pulmonary surfactant); 유로키나아제(urokinase) 또는 조직특이성 플라스미노겐 활성제(tissuespecific plasminogen activator)와 같은 플라스미노겐 활성제; 트롬빈(thrombin); 트롬보포이에틴(thrombopoietin); 혈액 성장 인자(haematopoietic growth factor), 알파- 또는 베타-종양괴사인자(alpha- or beta-tumour necrosis factor); 엔케팔리나제(encephalinase); MIP-1(human macrophage inflammatory protein-1); 인간 혈청 알부민(human serum albumin)과 같은 혈청 알부민; 릴랙신(relaxin); DNase; 사이토카인(cytokine);케모카인(chemokines); IL-1 내지 IL-10과 같은 인터류킨(interleukins); 수퍼옥시드 디스무타아제 (superoxide dismutase), 항체, 항체 및 항원의 단편과 같은 항산화제(antioxidant)등 일 수 있다.
본 문서에서 사용되는 "친수도 또는 친수성 값(hydrophilicity)"은 물 분자와 쉽게 수소결합을 형성할 수 있는 정도를 말하며, 본 명세서에서 특별히 언급하지 않는 한, 친수도 값은 DNASISTM(Hitachi, Japan)에 의해 호프 앤 우드 스케일(Hopp & Woods scale, 창 크기: 6, 역치값: 0.00)로 계산된다. 상기 친수도 값이 양수가 될 경우 펩티드는 친수성을 띄며, 음수가 될 경우 소수성을 띄며, 절대값이 클수록 친수성 또는 소수성의 정도가 높음을 의미한다.
본 문서에서 사용되는 "융합 단백질(fusion protein)"은 원래의 목적 단백질의 서열의 N-말단 또는 C-말단에 다른 폴리펩티드가 연결되거나 다른 아미노산 서열이 부가된 단백질을 의미한다.
본 문서에서 사용되는 "폴딩(folding)"은 아직 구조형성이 안된 1차원적인 폴리펩티드 사슬이 구조변형을 통해 기능을 발휘하게 되는 독특한 3차 구조를 갖는 과정을 의미한다.
본 문서에서 사용되는 "폴딩(folding)되는 활성 외래 단백질"은 mRNA의 전사 및 번역 후, 세포질 밖 또는 페리플라즘으로 분비되기 전에 세포질 내에서 단백질이 고유의 활성을 가지도록 폴딩되어 3차 구조를 형성하는 단백질을 의미한다.
본 문서에서 사용되는 "신호서열(signal sequence)"은 바이러스, 원핵생물세포 또는 진핵생물세포에서 발현되는 외래 단백질을 페리플라즘 또는 세포 외부로 분비하기 위해 상기 외래 단백질이 세포내막을 통과할 수 있도록 도와주는 효율적인 서열을 의미한다. 신호서열은 N-말단에 양전하가 충전된 N-영역(positively charged N-region), 중앙의 특이적인 소수성 영역(central characteristic hydrophobic region) 및 C-말단 절단 영역(C-region with a cleavage site)으로 구성되어 있다. 본 발명에서 사용한 신호서열 단편은 N-말단에 양전하가 충전된 영역(positively charged region)과 중앙의 특이적인 소수성 영역(central characteristic hydrophobic region) 및 C-말단 절단 영역의 전체 또는 일부를 의미한다.
본 문서에서 사용되는 "선도 폴리펩티드(leader polypeptide)"는 목적 단백질의 N-말단의 앞에 부가되는 아미노산 서열을 의미한다.
본 문서에서 사용되는 "선도 폴리펩티드의 N-말단"은 선도 폴리펩티드의 N-말단에 위치한 1 내지 10개의 아미노산을 의미한다.
본 문서에서 사용되는 "단편(fragment)"은 기능을 유지하면서 최소 길이 또는 그 이상의 크기를 갖는 서열을 의미한다. 본 명세서에서 특별히 언급하지 않는 한, 전체 길이는 이에 포함되지 않는다. 예를 들어, 본 명세서에서 언급하고 있는 신호서열 단편은 신호서열 중 신호서열로 기능 하는 단축된 신호서열을 의미하며, 전체 신호서열은 이에 포함되지 않는다.
본 문서에서 사용되는 "폴리뉴클레오티드"는 두 개 이상의 핵산분자가 이인산에스테르 결합으로 연결된 중합체 분자를 의미하며, DNA 및 RNA가 이에 포함된다.
본 문서에서 사용되는 "막전위 도메인(transmembrane domain)"은 친수성 및 소수성 지역이 혼재하고 있는 도메인으로서, 양친매성 도메인(amphipathic domain)과 유사한 구조를 갖는 단백질 내부의 영역을 의미한다. 따라서 본 명세서에서는 "막전위-유사 도메인(transmembrane-like domain)"과 동일한 의미로 사용된다.
본 문서에서 사용되는 "막전위-유사 도메인(transmembrane-like domain)"은 폴리펩티드의 아미노산 서열 분석 시, 막단백질의 막전위 도메인과 유사한 구조를 가질 것으로 예측되는 부위를 의미한다(Brasseur et al., Biochim. Biophys. Acta 1029(2):267-273, 1990). 통상적으로 상기 막전위-유사 도메인은 막전위 도메인을 예측하는 다양한 컴퓨터 소프트웨어를 통해 용이하게 예측이 가능하다. 상기 컴퓨터 소프트웨어의 예로는 TMpred, HMMTOP, TBBpred, DAS-TMfilter(www.enzim.hu/DAS/DAS.html) 등이 존재한다. 상기 "막전위-유사 도메인"은 실제 막전위 특성을 가진 것으로 규명된 "막전위 도메인(transmembrane domain)"도 포함한다.
이하, 첨부된 도면들을 참조하여 본 발명의 실시예를 설명하면 다음과 같다. 그러나 본 발명은 이하에서 개시되는 도면에 도시된 실시예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있는 것으로, 이하의 도면에 도시된 실시예는 본 발명의 개시가 완전하도록 하며, 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이다. 또한 설명의 편의를 위하여 도면에서는 구성 요소들이 그 크기가 과장 또는 축소될 수 있다.
도 1은 N-말단이 다른 여러 GFP 클론들에서 벡터에서 유래한 C-말단의 Le㎍lu(XhoI 인식부위, 이하 XhoI으로 표시)-6XHis(His tag, 6aa, hy -0.28) 펩티드(이하 XhoI-6XHis로 표시)를 제거한 후 원래 형태의 GFP의 친수성 C-말단(MDELYK, 6aa, hy +0.35)과 원래 형태의 번역종결코돈(TAA)을 갖도록 클론닝한 후 전체 및 수용성 단백질의 발현을 조사한 결과이다. 본 발명자의 이전 발명에서 제조한 N-말단이 상이한 GFP 클론들(대한민국 등록특허 제 10-1184011호)에서 C-말단의 XhoI-6XHis 펩티드를 제거한 후 원래 형태의 GFP의 C-말단인 MDELYK(pI 4.11, hy +0.35)(서열번호: 60)을 갖도록 전체 단백질의 발현을 조사하였다. 사용된 클론들은 먼저 연구에서 N-말단에 앵커(anchor) 서열이 없이 높은 친수성을 갖는 ME6-GFP-XhoI-6XHis와 MK6-GFP-XhoI-6XHis에 해당하며, 상기 클론들은 N-말단의 산성 및 염기성 pI 값에 관계없이 높은 친수성을 가져 Tat 채널로 높은 수용성 발현이 확인되었다(대한민국 등록특허 제 10-1184011호). 따라서 친수성 C-말단도 Tat 채널을 통한 수용성 발현을 증가시키는 가를 알아보기 위해, 상기 클론의 C-말단에 위치한 벡터 유래 XhoI-6XHis 펩티드를 제거한 후, 원래 GFP의 친수성 C-말단인 MDELYK(서열번호: 60)을 갖는 클론들을 실시예 1에서 제조하였다. 이때, 펩티드 XhoI-6XHis에 해당하는 뉴클레오티드가 정지 코돈 이하에 위치할 때, 그 서열들을 ctcgag(XhoI)-6Xcac(6XHis)(이하 XhoI-6XHis)로 표시하였다. 이렇게 제조된 클론들에서 발현된 전체 단백질 분획(약 50 ㎍) 및 그에 대응하는 수용성 발현 분획의 형광도를 확인한 결과, 클론 #2 및 #4에서는 원래 형태의 친수성 C-말단을 가질 경우 전체 및 수용성 단백질의 발현이 대조군보다 증가하여 친수성 C-말단도 대한민국 등록특허 제 10-1184011호의 친수성 N-말단처럼 Tat 채널을 통한 수용성 발현을 향상시키는 것을 확인하였다. 그러나 클론 #6에서는 원래 형태의 친수성 C-말단을 가진 경우 전체 및 수용성 단백질의 발현이 대조군에 비해 현저히 감소하였다. 이러한 결과는 원래 형태의 친수성 C-말단을 발현시키기 위해 재구성된 벡터에 의해 전체 단백질의 발현양에 변화가 초래되었고, 그에 따라 수용성 발현도 조절되고 있음을 알 수 있다.
도 2는 낮은 전체 및 수용성 단백질 발현을 보이는 MK6-GFP-Stop(TAA)-XhoI-6XHis 에 해당하는 클론의 C-말단에 해당하는 코돈(5 코돈)을 동형유사 코돈으로 변이시키거나, 번역종결코돈을 동형유사(synonymous) 코돈으로 대체시키거나 또는 번역종결코돈의 하위 부분(downstream)의 ctcgag(XhoI)-6Xcac(6XHis)를 구성하는 트리뉴클레오티드(trinucleotide)로부터 선택된 ctc, gag 및 cac의 단독 및 반복을 MK6-GFP-Stop(TAA)-XhoI-6XHis 클론 #6의 번역종결코돈과 XhoI-6XHis 사이에 삽입시키는 변이를 수행하였다. 그 후, 각 클론들에서 발현된 전체 단백질 분획(약 50 ㎍)의 형광도를 확인하였다. 그 결과, 1) GFP의 C-말단 5코돈들을 동형유사 대체코돈으로 변이시킨 결과, 대부분 대조군보다 높은 전체 단백질의 발현을 나타냈다. 또한, 2) GFP의 TAA 번역종결코돈을 유사한 TAG(클론 #19) 또는 TGA(클론 #20)로 변이한 클론에서도 전체 단백질의 발현이 현저하게 증가하였다. 아울러, 3) 정지 코돈과 XhoI(ctcgag)-6XHis(cac) 사이에 트리뉴클레오티드를 삽입한 클론가운데, 6Xctc, 1Xgag, 3Xgag, 6Xcac를 삽입한 클론 #21, #22, #23, #25들은 전체 단백질의 발현이 증가하였으나, 6Xgag를 삽입한 클론 #24의 경우 전체 단백질이 거의 발현되지 않았다. 이러한 결과는 삽입되는 트리뉴클레오티드의 서열 및 길이에 따라 전체 단백질의 발현을 증가 또는 감소시킬 수 있음을 입증하는 것이다.
도 3은 낮은 전체 단백질 발현을 보이는 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 해당하는 클론의 번역종결코돈(stop codon)의 하위 부분(downstream)을 임의의 반복 트리뉴클레오티드로 대체하여 제조한 변이체 클론에서 발현된 전체 단백질 분획(약 50㎍)의 형광도를 확인한 결과이다. 상기 형광도는 3개의 서로 다른 콜로니로부터 얻어진 결과를 비교한 평균값으로 나타냈다. 그 결과, 4Xgaa(클론 #26), 6Xgaa(클론 #27), 10Xgaa(클론 #28), 15Xgaa(클론 #29), 6Xcaa(클론 #32), 6Xtaa(클론 #33), 6Xtag(클론 #34), 6Xcag(클론 #35), 6Xggg(클론 #36), 6Xttt(클론 #37), 6Xcca(클론 #38), 6Xgat(클론 #39), 6Xgac(클론 #40), 6Xaat(클론 #41), 6Xaac(클론 #42), 6Xtac(클론 #45), 6Xctg(클론 #46) 클론에서는 전체 단백질의 발현이 매우 높게 발현되었다. 하지만 6Xaaa(클론 #30) 및 6Xaag(클론 #31)는 대조군보다 매우 낮게 발현되었으며, 6Xtga(클론 #43) 및 6Xaga(클론 #44)는 대조군과 유사한 수준으로 수용성 단백질이 낮게 발현되었다.
도 4는 높은 전체 단백질 발현을 보이는 ME6-GFP-Stop(TAA)-XhoI-6XHis에 해당하는 클론의 번역종결코돈의 하위 부분(downstream)을 도 3에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서 전체 단백질의 발현을 회복시킨 반복 트리뉴클레오티드(유도체, inducer)와 대조군보다 낮거나 유사하게 전체 단백질을 발현시킨 트리뉴클레오티드(억제체, reducer)로 대체시킨 후, 각 클론들에서 발현된 전체 단백질 분획(약 50㎍)의 형광도를 확인하였다. 그 결과, 실험예 <3-1>에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 삽입되어 유도체 작용한 6Xgaa(클론 #62), 10Xgaa(클론 #63), 6Xcaa(클론 #67), 6Xtaa(클론 #68), 6Xtag(클론 #69), 6Xcag(클론 #70) 뉴클레오티드는 ME6-GFP-Stop(TAA)-XhoI-6XHis(클론 #4)에 삽입되었을 때, 모두 대조군과 유사한 발현을 나타냈고, 발현을 저해하지 않았다. 또한, MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서 억제체로 작용한 6Xgag(클론 #64), 6Xaaa(클론 #65), 6Xaag(클론 #66), 6Xtga(클론 #71), 6Xaga(클론 #72)가 ME6-GFP-Stop(TAA)-XhoI-6XHis(클론 #4)에 삽입되었을 때, 6Xaaa(클론 #65), 6Xtga(클론 #71), 6Xaga(클론 #72)의 수용성 단백질의 발현은 대조군과 유사하였으며, 발현이 저해되지 않았으나, 6Xgag가 삽입된 클론 #64과 6Xaag가 삽입된 클론 #66에서는 전체 단백질의 발현을 매우 저해되었다. 특히, 클론 #66에서는 전체 단백질이 거의 발현되지 않았다.
또한 도 5에서는 도 3에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서 전체 단백질의 발현을 회복시킨 반복 트리뉴클레오티드(유도체, inducer) 서열에서 gaa를 선택하고, 대조군보다 낮거나 유사하게 전체 단백질을 발현시킨 트리뉴클레오티드(억제체, reducer) 서열에서 aaa, aag, gag, tga 및 aga를 선택하여 동시에 연결한 헥사뉴클레오티드(hexanucleotides)의 반복체들을 MK6-GFP-Stop(TAA)-(xxx xxx)-XhoI-6XHis 클론의 형태로 정지 코돈 뒤에 삽입한 후, 각 클론들에서 발현된 전체 단백질 분획(약 50㎍)의 형광도를 확인하였다. 그 결과, 실험예 4에서 1Xgaa aaa(클론 #47), 2Xgaa aag(클론 #51), 3Xgaa aag(클론 #52), 2Xgaa gag(클론 #54), 2Xgaa tga(클론 #57), 3Xgaa tga(클론 #58) 및 3Xgaa aga(클론 #61)에서는 매우 높은 발현을 보였고, 3Xgaa aaa(클론 #49), 3Xgaa gag(클론 #55), 1Xgaa tga(클론 #56) 및 2Xgaa aga(클론 #60)에서는 중간 정도의 발현을 보였고, 2Xgaa aaa(클론 #48), 1Xgaa aag(클론 #50), 1Xgaa gag(클론 #53) 및 1Xgaa aga(클론 #59)에서는 대조군과 비슷하게 낮은 발현을 보이거나 또는 대조군 보다도 훨씬 낮은 발현을 보여, #47-61 클론들은 높음, 중간, 낮음의 다양한 전체 단백질 발현 양을 보여, 전체 단백질 발현 양을 적절히 조절하는 데 매우 유용하게 사용될 수 있음을 확인하였다.
이하, 실시예 및 실험예를 통하여 본 발명을 더 상세히 설명한다. 그러나 본 발명은 이하에서 개시되는 실시예 및 실험예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있는 것으로, 이하의 실시예 및 실험예는 본 발명의 개시가 완전하도록 하며, 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이다.
실시예 1: GFP 발현 벡터의 제조
본 발명자들은 대한민국 등록특허 제10-1184011호에서 선도서열의 친수도가 높은 클론들은 세포질에서 번역되어 폴딩된 전체 단백질이 Tat 채널을 통해 페리플라즘으로 분비되어 수용성 단백질로 발현되는 데 문제가 없었으며, 이에 따라 높은 전체 및 수용성 발현을 유도하여 발현 효율이 매우 높았다. 하지만 이러한 클론으로부터 재조합 단백질 발현 벡터를 구성하는 과정에 pET22b(+) 벡터에서 유래된 XhoI-6XHis 펩티드가 C-말단에 부착되어 있어, 원래 형태의 C-말단을 갖는 재조합 단백질을 발현시키고자 하였다.
이를 조사하기 위해 본 발명자의 이전 출원시 제조된 GFP 클론(대한민국 등록특허 제10-1184011호) 제조 과정에서 C-말단에 추가적으로 연결된 폴리펩티드 LeuGlu(XhoI 인식부위, 이하 XhoI으로 표시)-6XHis(His tag, hy -0.28)를 제거하여 GFP가 갖는 원래 형태의 친수성 C-말단(MDELYK, hy +0.35, 서열번호 60)과 원래 형태의 번역종결코돈(TAA)을 갖는 전체 및 수용성 단백질 발현을 조사하였다. 그 결과 두 클론들에서는 원래 형태의 C-말단을 갖는 재조합 단백질들을 대조군보다 모두 약간 증가되게 발현시킬 수 있어 친수성 C-말단도 친수성 N-말단(대한민국 등록특허 제 10-1184011호)처럼 수용성 발현을 증가시킬 수 있었으나 한 클론에서는 현저히 감소된 전체 및 수용성 발현을 보였다(도 1 참조). 따라서 전체 및 수용성 단백질 발현이 저조한 경우는 C-말단에 해당하는 코돈과 번역종결코돈(stop codon)에 해당하는 뉴클레오티드를 synonymous 코돈으로 바꾸거나 또는 번역종결코돈 뒤에 임의의 단독 및 반복 트리뉴클레오티드를 연결하거나 또는 유도체와 억제체를 연결한 헥사뉴클레오티드 반복체를 연결하여 전체 단백질의 발현을 조사하여 C-말단 영역에 해당하는 코돈, 번역종결코돈 및 번역종결코돈 이하의 뉴클레오티드 서열들이 전체 단백질 발현에 미치는 영향을 조사하였다.
1-1: GFP 발현벡터의 제조
GFP 발현벡터는 GFP의 ORF를 NdeI 인식부위(CAT)를 포함하는 서열번호 1 내지 3번으로 기재되는 정방향 프라이머(표 1), 전사 종료 TAA, TAG, TGA 코돈을 갖는 XhoI 인식부위(CTC GAG)를 결합하는 서열번호 4 내지 59번으로 기재되는 역방향 프라이머(표 2), 및 pEGFP-N2 vector (Clontech)을 주형으로 이용하여 PCR을 수행한 후, 상기 PCR 산물을 pET-22b(+) 벡터(pEGFP-N2 vector, Clontech)의 NdeI-XhoI 부위에 클로닝함으로써 pET-22b(+)(N-terminal-gfp) 발현벡터를 수득하였다(표 3 참조).
표 1 표 3의 GFP 클론 제작에 사용된 정방향 프라이머
서열번호 GFP 클론 제작에 사용된 대조군 클론들 대조군 클론들의 정방향 프라이머
1* GFP-XhoI-6XHis-Stop(TGA) CAT ATGGTGAGCAAGGGCGAGGAG
2* ME6-GFP-XhoI-6XHis-Stop(TGA) CAT ATG GAA GAA GAA GAA GAA GAA ATGGTGAGCAAG GGC GAG GAG
3* MK6-GFP-XhoI-6XHis-Stop(TGA) CAT ATG AAA AAA AAA AAA AAA AAA ATGGTGAGCAAG GGC GAG GAG
*: 대한민국 등록특허 제 10-1184011호에서 보고된 클론들 및 정방향 프라이머들이며, 이 클론들을 대조군으로 사용하였고, 이로부터 유도된 클론들을 제조하기 위해서 정방향 프라이머들을 사용하였다.
줄친 CAT: NdeI 자리를 보존하기 위하여 연장되었다.
일반 문자: 클론들의 N-말단 선도서열에 해당하는 부분의 폴리뉴클레오티드를 나타낸다.
이탤릭 문자: GFP 부분의 폴리뉴클레오티드를 나타낸다(pEGFP-N2 vector(Clontech)).
표 2 표 3의 GFP 클론 제작에 사용된 역방향 프라이머
서열번호 GFP 클론들의 C-말단, 번역종결코돈 및 번역종결코돈 이하의 형태 (aa and nt) GFP 클론들의 역방향 프라이머
4 C-terminal(MDELYK)-Stop(TAA) CTCGAG TTACTTGTACAGCTCGTCCATGCC
5 C-terminal -1 K(AAG->AAA)-TAA CTCGAG TTATTTGTACAGCTCGTCCATGCCGAGAGTGATCCC
6 C-terminal -2 Y(TAC->TAT)-TAA CTCGAG TTACTTATACAGCTCGTCCATGCCGAGAGTGATCCC
7 C-terminal -3 L(CTG->CTA)-TAA CTCGAG TTACTTGTATAGCTCGTCCATGCCGAGAGTGATCCC
8 C-terminal -3 L(CTG->CTT)-TAA CTCGAG TTACTTGTAAAGCTCGTCCATGCCGAGAGTGATCCC
9 C-terminal -3 L(CTG->CTC)-TAA CTCGAG TTACTTGTAGAGCTCGTCCATGCCGAGAGTGATCCC
10 C-terminal -4 E(GAG->GAA)-TAA CTCGAG TTACTTGTACAGTTCGTCCATGCCGAGAGTGATCCC
11 C-terminal -5 D(GAC->GAT)-TAA CTCGAG TTACTTGTACAGCTCATCCATGCCGAGAGTGATCCC
12 C-terminal -11 G(GGG->GGC)-TAA CTCGAG TTACTTGTACAGCTCGTCCATGCCGAGAGTGATGCCGGCGGCGGTCACGAACTCCAG
13 C-terminal -15 V(GTG->GTC)-TAA CTCGAG TTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTGACGAACTCCAGCAGGACCATGTG
14 C-terminal -19 L(CTG->CTC)-TAA CTCGAG TTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGGAGGACCATGTGATCGCGCTTCTC
15 C-terminal -25 K(AAG->AAA)-TAA CTCGAG TTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGTTTCTCGTTGGGGTCTTTGCTCAG
16 C-terminal -32 L(CTG->CTC)-TAA CTCGAG TTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTGAGGGCGGACTGGGTGCTCAGGTA
17 C-terminal-Stop(TAG) CTCGAG CTACTTGTACAGCTCGTCCATGCC
18 C-terminal-Stop(TGA) CTCGAG TCACTTGTACAGCTCGTCCATGCC
19 C-terminal-Stop(TAA)-6Xctc- CTCGAGgaggaggaggaggaggagTTACTTGTACAGCTCGTCCATGCC
20 C-terminal-TAA-1Xgag- CTCGAGctcTTACTTGTACAGCTCGTCCATGCC
21 C-terminal-TAA-3Xgag- CTCGAGctcctcctcTTACTTGTACAGCTCGTCCATGCC
22 C-terminal-TAA-6Xgag- CTCGAGctcctcctcctcctcctcTTACTTGTACAGCTCGTCCATGCC
23 C-terminal-TAA-6Xcac CTCGAGgtggtggtggtggtggtgTTACTTGTACAGCTCGTCCATGCC
24 C-terminal-TAA-4Xgaa- CTCGAGttcttcttcttcTTACTTGTACAGCTCGTCCATGCC
25 C-terminal-TAA-6Xgaa- CTCGAGttcttcttcttcttcttcTTACTTGTACAGCTCGTCCATGCC
26 C-terminal-TAA-10Xgaa- CTCGAGttcttcttcttcttcttcttcttcttcttcTTACTTGTACAGCTCGTCCATGCC
27 C-terminal-TAA-15Xgaa- CTCGAGttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcTTACTTGTACAGCTCGTCCATGCC
28 C-terminal-TAA-6Xaaa- CTCGAGttttttttttttttttttTTACTTGTACAGCTCGTCCATGCC
29 C-terminal-TAA-6Xaag- CTCGAGcttcttcttcttcttcttTTACTTGTACAGCTCGTCCATGCC
30 C-terminal-TAA-6Xcaa- CTCGAGttgttgttgttgttgttgTTACTTGTACAGCTCGTCCATGCC
31 C-terminal-TAA-6Xtaa- CTCGAGttattattattattattaTTACTTGTACAGCTCGTCCATGCC
32 C-terminal-TAA-6Xtag- CTCGAGctactactactactactaTTACTTGTACAGCTCGTCCATGCC
33 C-terminal-TAA-6Xcag- CTCGAGctgctgctgctgctgctgTTACTTGTACAGCTCGTCCATGCC
34 C-terminal-TAA-6Xggg- CTCGAGccccccccccccccccccTTACTTGTACAGCTCGTCCATGCC
35 C-terminal-TAA-6Xttt- CTCGAGaaaaaaaaaaaaaaaaaaTTACTTGTACAGCTCGTCCATGCC
36 C-terminal-TAA-6Xcca- CTCGAGtggtggtggtggtggtggTTACTTGTACAGCTCGTCCATGCC
37 C-terminal-TAA-6Xgat- CTCGAGatcatcatcatcatcatcTTACTTGTACAGCTCGTCCATGCC
38 C-terminal-TAA-6Xgac- CTCGAGgtcgtcgtcgtcgtcgtcTTACTTGTACAGCTCGTCCATGCC
39 C-terminal-TAA-6Xaat- CTCGAGattattattattattattTTACTTGTACAGCTCGTCCATGCC
40 C-terminal-TAA-6Xaac- CTCGAGgttgttgttgttgttgttTTACTTGTACAGCTCGTCCATGCC
41 C-terminal-TAA-6Xtga CTCGAGtcatcatcatcatcatcaTTACTTGTACAGCTCGTCCATGCC
42 C-terminal-TAA-6Xaga CTCGAGtcttcttcttcttcttctTTACTTGTACAGCTCGTCCATGCC
43 C-terminal-TAA-6Xtac CTCGAGgtagtagtagtagtagtaTTA CTTGTACAGCTCGTCCATGCC
44 C-terminal-TAA-6Xctg CTCGAGcagcagcagcagcagcagTTACTTGTACAGCTCGTCCATGCC
45 C-terminal-TAA-1Xgaaaaa- CTCGAGtttttcTTACTTGTACAGCTCGTCCATGCC
46 C-terminal-TAA-2Xgaaaaa- CTCGAGtttttctttttcTTACTTGTACAGCTCGTCCATGCC
47 C-terminal-TAA-3Xgaa-aaa CTCGAGtttttctttttctttttcTTACTTGTACAGCTCGTCCATGCC
48 C-terminal-TAA-1Xgaaaag- CTCGAGcttttcTTACTTGTACAGCTCGTCCATGCC
49 C-terminal-TAA-2Xgaaaag- CTCGAGcttttccttttcTTACTTGTACAGCTCGTCCATGCC
50 C-terminal-TAA-3Xgaaaag- CTCGAGcttttccttttccttttcTTACTTGTACAGCTCGTCCATGCC
51 C-terminal-TAA-1Xgaagag- CTCGAGctcttcTTACTTGTACAGCTCGTCCATGCC
52 C-terminal-TAA-2Xgaagag- CTCGAGctcttcctcttcTTACTTGTACAGCTCGTCCATGCC
53 C-terminal-TAA-3Xgaagag- CTCGAGctcttcctcttcctcttcTTACTTGTACAGCTCGTCCATGCC
54 C-terminal-TAA-1Xgaatga- CTCGAGtcattcTTACTTGTACAGCTCGTCCATGCC
55 C-terminal-TAA-2Xgaatga- CTCGAGtcattctcattcTTACTTGTACAGCTCGTCCATGCC
56 C-terminal-TAA-3Xgaatga- CTCGAGtcattctcattctcattcTTACTTGTACAGCTCGTCCATGCC
57 C-terminal-TAA-1Xgaaaga- CTCGAGtctttcTTACTTGTACAGCTCGTCCATGCC
58 C-terminal-TAA-2Xgaaaga- CTCGAGtctttctctttcTTACTTGTACAGCTCGTCCATGCC
59 C-terminal-TAA-3Xgaaaga- CTCGAGtctttctctttctctttcTTACTTGTACAGCTCGTCCATGCC
상기 표 2에서 모든 역방향 프라이머들은 GFP의 C-말단 및 pET-22b(+) 벡터의 XhoI(attached to His-tag)부분이 포함된 상보 서열의 폴리뉴클레오티드 서열을 나타낸다.
CTCGAG: XhoI 자리를 보존하기 위하여 연장되었다.
소문자: 정지 코돈 뒤에 추가된 임의의 단독 및 반복된 trinucleotide 서열 또는 hexanucleotide의 상보적인 폴리뉴클레오티드를 나타낸다.
TTA, CTA, TCA: 번역종결코돈(stop codon) TAA, TAG 및 TGA의 상보적인 코돈을 나타낸다.
일반 대문자: GFP 클론들의 C-말단 서열에 해당하는 부분의 상보적인 폴리뉴클레오티드를 나타낸다.
1-2: 원래 형태의 C-말단을 갖는 GFP 발현벡터의 제조
상기 GFP 발현 벡터(pET-22b(+)(N-terminal-gfp-XhoI-His tag))의 Le㎍lu(XhoI 인식부위, 이하 XhoI으로 표시)-6XHis(His tag) 펩티드를 제거하여 원래 GFP의 C-말단을 갖는 발현벡터를 제조하기 위하여, 상기 GFP 발현 벡터의 GFP의 ORF를 NdeI 인식부위(CAT)를 포함하는 정방향 프라이머(서열번호 1~3), 역방향 프라이머로 서열번호 4~59을 이용하여 PCR을 수행하였다(표 1, 2 참조).
상기 역방향 프라이머는 1) 원래의 GFP C-말단(MDELYK, hy +0.35, 서열번호 60)에 해당하는 코돈(5' 코돈)이 고유 코돈을 갖게 하거나, 2) C-말단 영역에 해당하는 코돈(5' 코돈) 및 GFP의 원래 형태의 번역종결코돈(stop codon, TAA)에 해당하는 뉴클레오티드를 유사한 코돈으로 대체시키거나, 3) 번역종결코돈 (TAA) 뒤에 ctcgag(XhoI)-6Xcac(His)에서 유래된 트리뉴클레오티드(trinucleotide, 보통의 소문자)인 ctc, gag, cac의 단독 또는 반복으로 연결하게 하거나, 또는 4) 번역종결코돈 (TAA) 뒤에 임의의 반복 트리튜클레오티드가 추가된 서열이 XhoI 인식부위(CTC GAG)와 결합하게 하였다.
상기 표 1, 및 2에 기재된 정방향 및 역방향 프라이머 쌍을 이용하여 PCR을 수행한 후, 상기 PCR 산물을 TA 클로닝 벡터(Promega)에 첫 번째 클론닝 한 후, NdeI-XhoI으로 insert를 분리한 후, 상기 insert를 pET-22b(+)의 NdeI-XhoI 부위에 클로닝함으로써 발현벡터를 수득하였다(표 3 참조).
표 3
클론No. pET-22b(+) vector에 클론된 GFP 클론들 C-말단과 번역종결코돈의 형태(aa and nt) C-말단(6 aa) 번역종결코돈 뒤에 추가된 염기서열
1* GFP-LeuGlu(XhoI, CTCGAG)-6XHis(CAC)-Stop(TGA) (대조군) XhoI-6XHis-Stop(TGA from pET22b+) HHHHHH(H6) -
2 GFP(C-terminal: MDELYK)-Stop(TAA)-ctcgag(XhoI)-6Xcac(His) C-terminal-TAA MDELYK(서열번호 60) -
3* ME6-GFP-XhoI-6XHis-Stop(TGA) (대조군) XhoI-6XHis-TGA HHHHHH(H6) -
4 ME6-GFP-Stop(TAA)-XhoI-6XHis C-terminal-TAA MDELYK(서열번호 60) -
5* MK6-GFP-XhoI-6XHis-Stop(TGA)(대조군) XhoI-6XHis-TGA HHHHHH(H6) -
6 MK6-GFP(C-terminal: MDELYK)-Stop(TAA)-XhoI-6XHis C-terminal-TAA MDELYK(서열번호 60) -
7 MK6-GFP[C-terminal -1 K(AAG->AAA)] -Stop(TAA)-XhoI-6XHis C-terminal -1 K(AAG->AAA)-TAA MDELYK -
8 MK6-GFP[C-terminal -2 Y(TAC->TAT)] -Stop(TAA)-XhoI-6XHis C-terminal -2 Y(TAC->TAT)-TAA MDELYK -
9 MK6-GFP[C-terminal -3 L(CTG->CTA)]-Stop(TAA)-XhoI-6XHis C-terminal -3 L(CTG->CTA)-TAA MDELYK -
10 MK6-GFP[C-terminal -3 L(CTG->CTT)]-Stop(TAA)-XhoI-6XHis C-terminal-3 L(CTG->CTT)-TAA MDELYK -
11 MK6-GFP[C-terminal -3 L(CTG->CTC)]-Stop(TAA)-XhoI-6XHis C-terminal-3 L(CTG->CTC)-TAA MDELYK -
12 MK6-GFP[C-terminal -4 E(GAG->GAA)]-Stop(TAA)-XhoI-6XHis C-terminal-4 E(GAG->GAA)-TAA MDELYK -
13 MK6-GFP[C-terminal -5 D(GAC->GAT)]-Stop(TAA)-XhoI-6XHis C-terminal -5 D(GAC->GAT)-TAA MDELYK -
14 MK6-GFP[C-terminal -11 G(GGG->GGC)]-Stop(TAA)-XhoI-6XHis C-terminal -11 G(GGG->GGC)-TAA MDELYK -
15 MK6-GFP[C-terminal -15 V(GTG->GTC)]-Stop(TAA)-XhoI-6XHis C-terminal -15 V(GTG->GTC)-TAA MDELYK -
16 MK6-GFP[C-terminal -19 L(CTG->CTC)]-Stop(TAA)-XhoI-6XHis C-terminal -19 L(CTG->CTC)-TAA MDELYK -
17 MK6-GFP[C-terminal -25 K(AAG->AAA)]-Stop(TAA)-XhoI-6XHis C-terminal -25 K(AAG->AAA)-TAA MDELYK -
18 MK6-GFP[C-terminal -32 L(CTG->CTC)]-Stop(TAA)-XhoI-6XHis C-terminal -32 L(CTG->CTC)-TAA MDELYK -
19 MK6-GFP-Stop(TAG)-XhoI-6XHis C-terminal-TAG MDELYK -
20 MK6-GFP-Stop(TGA)-XhoI-6XHis C-terminal-TGA MDELYK -
21 MK6-GFP-Stop(TAA)-6Xctc-XhoI-6XHis C-terminal-TAA MDELYK 6Xctc(서열번호61)
22 MK6-GFP-Stop(TAA)-1Xgag-XhoI-6XHis C-terminal-TAA MDELYK 1Xgag(서열번호62)
23 MK6-GFP-Stop(TAA)-3Xgag-XhoI-6XHis C-terminal-TAA MDELYK 3Xgag(서열번호63)
24 MK6-GFP-Stop(TAA)-6Xgag-XhoI-6XHis C-terminal-TAA MDELYK 6Xgag(서열번호64)
25 MK6-GFP-Stop(TAA)-6Xcac-XhoI-6XHis C-terminal-TAA MDELYK 6Xcac(서열번호65)
26 MK6-GFP-Stop(TAA)-4Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 4Xgaa(서열번호66)
27 MK6-GFP-Stop(TAA)-6Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xgaa(서열번호67)
28 MK6-GFP-Stop(TAA)-10Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 10Xgaa(서열번호68)
29 MK6-GFP-Stop(TAA)-15Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 15Xgaa(서열번호69)
30 MK6-GFP-Stop(TAA)-6Xaaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xaaa(서열번호70)
31 MK6-GFP-Stop(TAA)-6Xaag-XhoI-6XHis C-terminal-TAA MDELYK 6Xaag(서열번호71)
32 MK6-GFP-Stop(TAA)-6Xcaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xcaa(서열번호72)
33 MK6-GFP-Stop(TAA)-6Xtaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xtaa(서열번호73)
34 MK6-GFP-Stop(TAA)-6Xtag-XhoI-6XHis C-terminal-TAA MDELYK 6Xtag(서열번호74)
35 MK6-GFP-Stop(TAA)-6Xcag-XhoI-6XHis C-terminal-TAA MDELYK 6Xcag(서열번호75)
36 MK6-GFP-Stop(TAA)-6Xggg-XhoI-6XHis C-terminal-TAA MDELYK 6Xggg(서열번호76)
37 MK6-GFP-Stop(TAA)-6Xttt-XhoI-6XHis C-terminal-TAA MDELYK 6Xttt(서열번호77)
38 MK6-GFP-Stop(TAA)-6Xcca-XhoI-6XHis C-terminal-TAA MDELYK 6Xcca(서열번호78)
39 MK6-GFP-Stop(TAA)-6Xgat-XhoI-6XHis C-terminal-TAA MDELYK 6Xgat(서열번호79)
40 MK6-GFP-Stop(TAA)-6Xgac-XhoI-6XHis C-terminal-TAA MDELYK 6Xgac(서열번호80)
41 MK6-GFP-Stop(TAA)-6Xaat-XhoI-6XHis C-terminal-TAA MDELYK 6Xaat(서열번호81)
42 MK6-GFP-Stop(TAA)-6Xaac-XhoI-6XHis C-terminal-TAA MDELYK 6Xaac(서열번호82)
43 MK6-GFP-Stop(TAA)-6Xtga-XhoI-6XHis C-terminal-TAA MDELYK 6Xtga(서열번호83)
44 MK6-GFP-Stop(TAA)-6Xaga-XhoI-6XHis C-terminal-TAA MDELYK 6Xaga(서열번호84)
45 MK6-GFP-Stop(TAA)-6Xtac-XhoI-6XHis C-terminal-TAA MDELYK 6Xtac(서열번호85)
46 MK6-GFP-Stop(TAA)-6Xctg-XhoI-6XHis C-terminal-TAA MDELYK 6Xctg(서열번호86)
47 MK6-GFP-Stop(TAA)-1Xgaa aaa-XhoI-6XHis C-terminal-TAA MDELYK 1Xgaa aaa(서열번호87)
48 MK6-GFP-Stop(TAA)-2Xgaa aaa-XhoI-6XHis C-terminal-TAA MDELYK 2Xgaa aaa(서열번호88)
49 MK6-GFP-Stop(TAA)-3Xgaa aaa-XhoI-6XHis C-terminal-TAA MDELYK 3Xgaa aaa(서열번호89)
50 MK6-GFP-Stop(TAA)-1Xgaa aag-XhoI-6XHis C-terminal-TAA MDELYK 1Xgaa aag(서열번호90)
51 MK6-GFP-Stop(TAA)-2Xgaa aag-XhoI-6XHis C-terminal-TAA MDELYK 2Xgaa aag(서열번호91)
52 MK6-GFP-Stop(TAA)-3Xgaa aag-XhoI-6XHis C-terminal-TAA MDELYK 3Xgaa aag(서열번호92)
53 MK6-GFP-Stop(TAA)-1Xgaa gag-XhoI-6XHis C-terminal-TAA MDELYK 1Xgaa gag(서열번호93)
54 MK6-GFP-Stop(TAA)-2Xgaa gag-XhoI-6XHis C-terminal-TAA MDELYK 2Xgaa gag(서열번호94)
55 MK6-GFP-Stop(TAA)-3Xgaa gag-XhoI-6XHis C-terminal-TAA MDELYK 3Xgaa gag(서열번호95)
56 MK6-GFP-Stop(TAA)-1Xgaa tga-XhoI-6XHis C-terminal-TAA MDELYK 1Xgaa tga(서열번호96)
57 MK6-GFP-Stop(TAA)-2Xgaa tga-XhoI-6XHis C-terminal-TAA MDELYK 2Xgaa tga(서열번호97)
58 MK6-GFP-Stop(TAA)-3Xgaa tga-XhoI-6XHis C-terminal-TAA MDELYK 3Xgaa tga(서열번호98)
59 MK6-GFP-Stop(TAA)-1Xgaa aga-XhoI-6XHis C-terminal-TAA MDELYK 1Xgaa aga(서열번호99)
60 MK6-GFP-Stop(TAA)-2Xgaa aga-XhoI-6XHis C-terminal-TAA MDELYK 2Xgaa aga(서열번호100)
61 MK6-GFP-Stop(TAA)-3Xgaa aga-XhoI-6XHis C-terminal-TAA MDELYK 3Xgaa aga(서열번호101)
62 ME6-GFP-Stop(TAA)-6Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xgaa
63 ME6-GFP-Stop(TAA)-10Xgaa-XhoI-6XHis C-terminal-TAA MDELYK 10Xgaa
64 ME6-GFP-Stop(TAA)-6Xgag-XhoI-6XHis C-terminal-TAA MDELYK 6Xgag
65 ME6-GFP-Stop(TAA)-6Xaaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xaaa
66 ME6-GFP-Stop(TAA)-6Xaag-XhoI-6XHis C-terminal-TAA MDELYK 6Xaag
67 ME6-GFP-Stop(TAA)-6Xcaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xcaa
68 ME6-GFP-Stop(TAA)-6Xtaa-XhoI-6XHis C-terminal-TAA MDELYK 6Xtaa
69 ME6-GFP-Stop(TAA)-6Xtag-XhoI-6XHis C-terminal-TAA MDELYK 6Xtag
70 ME6-GFP-Stop(TAA)-6Xcag-XhoI-6XHis C-terminal-TAA MDELYK 6Xcag
71 ME6-GFP-Stop(TAA)-6Xtga-XhoI-6XHis C-terminal-TAA MDELYK 6Xtga
72 ME6-GFP-Stop(TAA)-6Xaga-XhoI-6XHis C-terminal-TAA MDELYK 6Xaga
*: 대한민국 등록특허 제 10-1184011호에서 공지된 클론들이며 대조군으로 사용되었다.
굵은 문자: Met로부터 정지 코돈까지의 ORF 부분을 나타낸다.(종결코돈까지의 부분의 의미함)
일반 소문자: 정지 코돈 뒤에 추가된 단독 및 반복 트리뉴클레오티드(trinucleotide) 또는 헥사뉴클리오티드 (hexanucleotide) 서열을 나타낸다.
이탤릭 문자: pET-22b(+)의 XhoI 및 His tag 부분의 염기서열을 나타내며 XhoI-6XHis로 표시하였다.
-: 해당사항이 없음을 의미한다.
실험예 1: 전체 및 수용성 단백질의 발현 확인
본 발명자의 종래 연구(대한민국 등록특허 제 10-1184011호)에서 선도서열로서 친수도가 높은 클론 ME6-GFP-Le㎍lu(XhoI)-6XHis-Stop(TGA) 및 MK6-GFP-Le㎍lu(XhoI)-6XHis-Stop(TGA)들은 세포질에서 번역되어 폴딩된 전체 단백질이 Tat 채널을 통해 페리플라즘으로 분비되어 수용성 단백질로 발현되는 데 문제가 없었으므로, 높은 전체 및 수용성 발현을 유도하여 발현 효율이 매우 높았다. 하지만 상기 융합 단백질은 재조합 단백질 발현 벡터를 구성하는 과정에 pET22b(+) 벡터에서 유래된 XhoI-6XHis 펩티드가 C-말단에 부착되어 있었다. 이에, 상기 부착된 XhoI-6XHis peptide를 제거하여 원래 형태의 C-말단(MDELYK, 6aa, hy +0.35)과 번역종결코돈(TAA)을 갖는 ME6-GFP 및 MK6-GFP을 발현시킬 수 있는 클론들을 구성하였다(표 3 참조).
상기 실시예 1에서 제조한 발현벡터를 E. coli BL21(DE3)에 통상의 방법으로 형질전환하여 LB 배지[트립톤(tryptone) 20 g, 효모 추출물(yeast extract) 5.0 g, NaCl 0.5 g, KCl 1.86 mg/]에 100 ㎍ 암피실린(ampicillin)과 함께 30에서 밤새 배양한 후, 배양액을 LB 배지를 사용하여 100배 희석하고, OD600값이 0.3이 되도록 다시 배양하였다. GFP 발현을 위해 3시간 동안 배양하였다. 그 후, 배양액에 1 mM IPTG(isopropyl-1-thio--D-galactopyranoside)를 첨가하고, 배양액 1 을 4,000xg, 4에서 30분간 원심 분리하여 펠렛(pellet)을 회수하였다.
그 후, GFP의 형광을 정량하기 위해서 수분이 함유된 상기 펠렛의 무게(pellet wetweight)를 측정하고, 트리스 완충액(50mM Tris, pH 8.0)에 재현탁시켰다. 상기 현탁액은 단백질을 분리하기 위하여 초음파 분쇄기(sonicator)를 사용하여 15X 2-s cycle pulses(at 30% power output) 조건에서 분쇄시킨 후, 전체 분획(total fraction)으로 사용하였다. 그 후, 16,000rpm, 30분, 4 조건에서 원심분리를 수행하여 상층액을 수용성 분획(soluble fraction)으로 회수하였다.
일정량의 전체 분획 및 이에 상응하는 수용성 분획을 펄킨 엘머 빅터3(Perkin Elmer Victor3)을 이용하여 여기(excitation) 파장 485nm, 방출(emission) 파장 535nm에서 형광도를 측정하였다.
그 결과, 폴리펩티드 XhoI-6XHis 결실 대조군 GFP-Stop(TAA)-XhoI-6XHis(클론 #2)은 대조군(클론 #1) 보다 약간 증가된 전체 및 수용성 발현을 보였으며, 원래 높은 전체 및 수용성 발현을 보인 ME6-GFP-XhoI-6XHis-Stop(TGA)(클론 #3)의 경우는 폴리펩티드 XhoI-6XHis가 결실된 후 전체 단백질도 약간 증가하고, 수용성 발현도 약간 증가하였다. 이와 같은 결과는 앞서 GFP 특허 등록(대한민국 등록특허 제 10-1184011호)에서 친수성이 높은 N-말단이 전체 및 수용성발현을 높이는 것과 유사하게 C-말단이 친수성을 갖는 경우도 Tat 채널을 통한 수용성 발현을 높임으로 이러한 추진력이 전체 단백질 발현을 높이는 것으로 보인다. 그러나 원래 높은 전체 및 수용성 발현을 보인 MK6-GFP-XhoI-6XHis-Stop(TGA)(클론 #5)에서 폴리펩티드 XhoI-6XHis가 결실된 후 GFP의 원래 형태 C-말단(MDELYK: hy +0.35)을 가진 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서는 전체 및 수용성 발현이 현저히 억제되어 특이한 결과를 보여주고 있다(도 1 참조).
본 발명자의 종래 연구 결과, 선도서열에 높은 친수성을 갖는 GFP 융합 단백질의 경우 Tat 채널을 통한 수용성 발현에는 문제가 없었다(대한민국 등록특허 제 10-1184011호). 이러한 결과를 상기 결과와 종합하여 보면, 수용성 발현을 위해서는 일차적으로 전체 단백질의 발현양이 매우 중요하며, 결국 전체 단백질의 발현양이 수용성 단백질의 발현양을 이차적으로 결정하는 중요한 요인임을 알 수 있다.
따라서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서는 C-말단에 다른 클론들과 동일한 변화를 주었음에도 불구하고 대조군보다 매우 억제된 전체 발현과 그에 따를 수용성 발현을 보여, 적어도 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서는 첫 번째로 전체 발현을 위해서는 C-말단 영역에 해당하는 뉴클레오티드 서열의 변이, 번역종결코돈의 위치와 종류 및 정지 코돈 이하의 XhoI-6XHis에 해당하는 뉴클레오티드 서열 수준에서 재구성된 위치변이가 전체 단백질 발현을 감소시켰다는 것을 알 수 있다.
하지만 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에서의 발현 저하는 폴리펩티드 XhoI-6XHis가 제거된 후 짧은 길이의 ORF를 가지고 있으나 긴 길이를 갖는 MK6-GFP-XhoI-6XHis-Stop(TGA) 대조군 클론(클론 #5)에서 보다 현저한 발현 저하가 관찰되었다. 그러나 ORF가 짧아진 경우, 원래 ORF를 갖는 대조군에 비해 tRNA나 아미노산 pool에 대해 부족할 변화는 전혀 없다고 판단된다.
따라서 근본적인 차이는 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)의 경우 원래 GFP의 C-말단에 해당하는 뉴클레오티드 서열(5 코돈)-번역종결코돈(TAA)-XhoI-6XHis의 뉴클레오티드 서열이 재구성됨으로 대조군에 비해 짧아진 ORF의 C-말단과 그에 해당하는 염기서열, TGA 대신 변이된 원래 형태의 정지 코돈(TAA) 및 변이된 정지 코돈 이하의 재구성된 염기서열의 구조적 변화에 의해서 초래되었고 판단된다. 그러므로 본 연구는 정지 코돈 주위의 염기서열의 재구성이 전체 단백질 발현에 미치는 영향에 대해서 초점을 맞추고 이를 규명하였다.
실험예 2: MK 6 -GFP-Stop(TAA)- XhoI-6XHis 클론(클론 #6)의 C-말단에 해당하는 코돈(5' 코돈)의 변이, 번역종결코돈의 변이 및 번역종결코돈 하위단계(downstream) 변이에 따른 GFP 전체 단백질 발현에 미치는 영향 확인
상기 <실험예 1>에서 세 가지 클론의 C-말단에 해당하는 폴리펩티드 XhoI-6XHis 를 결실시킨 후 원래 C-말단을 갖도록 한 후, 두 가지 클론들에서 전체 및 수용성 발현이 대조군 보다 약간 증가되었지만, 오직 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)는 대조군 MK6-GFP-XhoI-6XHis-Stop(TGA)(클론 #5)보다 훨씬 감소된 전체 및 수용성 발현을 보였다. 따라서 클론 #6의 감소된 전체 단백질 발현의 원인을 C-말단에 해당하는 코돈(5' 코돈), 정지 코돈 및 XhoI-6XHis에 해당하는 뉴클레오티드 서열의 재구성에 의한 것으로 추정하고, 이를 확인고자 하였다.
MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)는 대조군 클론 MK6-GFP-XhoI-6XHis-Stop(TGA)(클론 #5)과 XhoI-6XHis에 해당하는 뉴클레오티드 서열의 위치 이동 및 번역종결코돈에 차이만이 있었다. 이에, MK6-GFP-Stop(TAA)-XhoI-6XHis 클론에서 원래 형태의 C-말단 폴리펩타이드 서열을 갖도록 정지 코돈 앞(5' 코돈)-정지 코돈-정지 코돈 이하(3' UTR)의 위치 -32, -25, -19, -15, -11, -5, -4, -3, -2, -1 (-32L, -25K, -19L, -15V, -11G, -5D, -4E, -3L(three substitutions), -2Y, -1K-Stop(TAA)-XhoI(ctc gag)-6XHis(cac cac cac cac cac cac)의 뉴클레오티드 서열을 갖도록 변이시킴으로써, 이러한 재구성된 서열들이 전체 단백질의 발현에 미치는 영향을 확인하였다.
구체적으로, MK6-GFP-Stop(TAA)-XhoI-6XHis 클론(클론 #6)을 대조군으로, 상기 실시예 1에서 제조한 클론 #7~#25를 실험군으로 이용하였다. 상기 클론 #7~#25은 원래 GFP의 C-말단 -32에서 -1 위치(-32L에서 -1K 위치)-Stop(TAA)-XhoI(ctc gag)-6XHis(cac cac cac cac cac cac)의 뉴클레오티드 서열에서 C-말단의 코돈(5' 코돈) 변이(클론 #7~#18), 2) 번역종결코돈을 유사한 번역종결코돈으로 변이(클론#19~#20), 3) XhoI-6XHis에서 선택된 트리뉴클레오티드인 일반 소문자 ctc, gag, cac를 번역종결코돈의 하위 부분에 단독 및 반복적으로 연결하도록 제조된 클론(클론 #21~#25)이다(표 3 참조). 상기 클론들에서 발현된 목적단백질 GFP는 C-말단에 XhoI-6XHis 펩티드 대신 모두 원래 GFP의 친수성 C-말단 아미노산 MDELYK이 공통적으로 위치한다.
상기 클론 #6~#25를 각각 대장균 BL21(DE3)에 형질전환하고, GFP의 발현량을 측정하였다.
C-말단의 하나의 아미노산에 해당하는 코돈을 동형유사(synonymous) 코돈으로 변이시킨 클론 #7~#18은 원래 낮은 전체 단백질 발현을 보였던 대조군 클론의 C-말단(MDELYK)에 해당하는 코돈(5' 코돈 포지션 -32에서 -1)을 -1 K(AAG→AAA), -2 Y(TAC→TAT), -3 L(CTG→CTA), -3 L(CTG→CTT), -3 L(CTG→CTC), -4 E(GAG→GAA), -5 D(GAC→GAT), -11 G(GGG→GGC), -15 V(GTG→GTC), -19 L(CTG→CTC),-25 K(AAG→AAA) 및 -32 L(CTG→CTC) 로 동형유사(synonymous) 코돈으로 대체시킨 클론(#7-18)으로, -25 K(AAG→AAA) 및 -32 L(CTG→CTC) 클론(#17-18)을 제외하고는 모두 대조군보다 높은 전체 단백질의 발현을 나타냈다(도 2 참조). 또한 정지코돈에 해당하는 코돈을 동형유사(synonymous) 코돈으로 변이시킨 클론 #19~#20은 원래 낮은 전체 단백질 발현을 보였으나 모두 대조군보다 높은 전체 단백질의 발현을 나타냈다(도 2 참조). 이러한 결과는 변이된 염기에 의해서 전사된 RNA의 경우 rNTP의 크기에 관계없이 변이된 RNA 서열의 재구성이 전사와 번역을 통해 전체 단백질량을 결정하는 데 결정적이라는 것을 의미한다. 왜냐하면 분자량이 가장 큰 rGTP를 다른 작은 분자량의 리보뉴클레오티드인 ATP, UTP, CTP로 바꾼 경우와 CTP를 거의 유사한 약간 큰 분자량의 UTP로 바꾼 경우도 대조군보다 훨씬 높은 전체 발현을 유도하였기 때문이다(참고로 Ribonucleotide triphosphates의 분자량은 GTP, 523.2; ATP, 507.2; UTP, 484.2; CTP, 483.2이다). C-말단 5 코돈 -32 위치까지 분석하였으나, 그 중 발현이 증가되는 경우는 -19 위치의 약 60 nt 까지 효율성이 높게 나타났다.
따라서 이러한 결과는 하나의 변이된 염기가 mRNA의 전사를 회복하는 데 영향을 미치거나 또는 전사된 mRNA의 염기쌍 구성에 의한 분자간 특성의 변화 (intermolecular base pairing characteristics) 또는 짧은 길이의 mRNA의 국소적 전하력 (the local charge force of the string)에 의해 mRNA의 구조적 변이에 의해 번역이 증가된 것으로 보인다.
또한, 클론 #7~#18은 MK6-GFP-XhoI-6XHis-Stop(TGA)(클론 #5)에서 유래된 XhoI-6XHis 폴리펩티드가 제거된 짧은 ORF를 갖고, 하나의 아미노산에 대한 동형 유사(synonymous) 코돈 변이만이 있으므로, 번역(translation)에 tRNA가 영향을 주지 않으리라 판단되며, 이러한 전체 단백질 발현 증가가 정지 코돈을 중심으로 한 RNA 리보염기서열의 미묘한 변이나 추가에 의해 진행되기 때문에 이것은 DNA로부터 전사(transcription)에 의해 만들어지는 mRNA transcript를 생성하는 기작에 의해 전사량이 결정되고, 이 전사량의 번역에 의해 전체 단백질량이 결정되어 지는 것으로 보인다. 따라서 단백질 암호영역(protein coding region)에 존재하는 C-말단의 아미노산에 해당하는 리보뉴클레오티드 서열(5' 코돈)의 미묘한 형태 차이가 전사량 및/또는 번역량 결정에 매우 중요한 역할을 수행함을 의미하며, 정지 코돈에서 단백질 암호영역(protein coding region) 안쪽으로 -19 코돈 위치까지의 약 60 nt 거리에서는 동형 유사(synonymous) 코돈이 전사량 조절 및 번역에 의한 전체 단백질 발현 양을 회복하는 데에 영향을 끼치는 것으로 보인다.
또한, 번역종결코돈 TAA를 유사(synonymous) 코돈인 TAG(클론 #19) 및 TGA(클론 #20)로 교체한 클론들에서도 전체 단백질의 발현이 현저하게 증가하였다. 따라서 번역종결코돈 서열의 미묘한 차이가 3' UTR 뉴클레오티드 서열과 연결되어 전체 발현에 크게 영향을 미치는 것을 알 수 있다. 이러한 결과는 정지 코돈 TAA를 TAG나 TGA로 변이시킨 경우 가장 큰 분자량을 갖는 rGTP의 삽입이 오히려 전사에 효율적으로 작용하여 어떤 특정 하나의 RNA를 구성하는 리보염기보다는 전체적인 RNA 염기서열의 구성에 의한 형태적인 구조가 전사 및/또는 번역량에 영향을 주는 것을 알 수 있다.
또한, 정지 코돈과 XhoI(ctcgag)-6XHis(cac) 사이에 XhoI 인식부위(ctcgag)의 일부 뉴클레오티드인 ctc에 대해서 6Xctc 트리뉴클레오티드를 삽입한 클론 #21 및 정지 코돈과 XhoI-6XHis 사이에 XhoI 인식부위의 일부 트리뉴클레오티드인 gag에 대해서 1Xgag, 3Xgag를 삽입한 클론 #22, #23은 전체 단백질 발현이 증가하였으나, 다만, 정지 코돈과 XhoI-6XHis 사이에 6Xgag를 삽입한 클론 #24의 경우 전체 단백질이 거의 발현되지 않았다. 이는 6Xctc, 1Xgag, 3Xgag 트리뉴클레오티드가 유도체(inducer)로 작용하며, 6Xgag 트리뉴클레오티드는 억제체(reducer)로 작용한다는 것을 입증하는 것이다. 이러한 결과는 C-말단에 해당하는 코돈과 번역종결코돈을 유사(synonymous) 코돈으로 대체된 RNA 염기 서열의 미묘한 차이 및 정지 코돈 이하 3' UTR에 추가된 트리뉴클레오티드 반복서열의 구성이 전사 및/또는 번역에 크게 영향을 미치는 것을 의미한다. 왜냐하면 도 1에서 MK6-GFP-XhoI-6XHis-Stop(TGA) 클론(클론 #5)은 전체 발현이 우수하여, 전사, 번역, Tat 채널 분비에는 문제가 없었으나, 폴리펩티드 XhoI-6XHis가 결실된 MK6-GFP-Stop(TAA)-XhoI-6XHis 클론 #6은 전체 발현이 현저히 저하되었다. 그러나, 상기 클론 #6의 C-말단에 해당하는 코돈 변이(클론 #7~#16), 정지 코돈 변이(클론 #19~#20) 및 정지 코돈 뒤쪽의 뉴클레오티드를 변이시킨 클론(클론 #21~#23, #25)은 전체 발현이 현저히 증가하였다. 상기 클론 #7~#25에서 C-말단에 해당하는 코돈의 리보뉴클레오티드 변이(클론 #7~#18) 및 정지 코돈에 해당하는 리보뉴클리오타이드 변이(클론 #19, 20)를 제외하고는 모두 ORF(단백질 암호영역 및 정지코돈) 바깥에서 변이 (클론 #21~25)가 일어났으므로, tRNA에 의한 번역과는 전혀 상관이 없다. 따라서 정지코돈 이하 3' UTR에 추가된 트리뉴클리오티드가 전사에 영향을 끼쳐 mRNA 생성을 조절하거나 또는 상기 mRNA는 번역을 통해 전체 단백질양의 증가 및 감소에 영향을 미친 것으로 판단된다. 결국 이러한 정지코돈 이하에 추가된 뉴클리오티드가 전체 단백질 양을 조절하는 발현 조절체(expression regulator)인 발현유도체(expression inducer) 및 발현억제체(expression reducer)로 작용하였다고 사료된다. 즉, 전사의 완성도 및/또는 번역이 전체 단백질 발현 양 결정에 가장 크게 작용하는 것을 알 수 있다.
종합하면, 이러한 결과는 단백질 암호 영역(protein coding region)의 C-말단에 해당하는 코돈(5' 코돈)과 정지 코돈을 동형 유사(synonymous) 코돈으로 대체하여 단백질 코딩에 전혀 영향을 주지 않으면서 하나의 뉴클레오티드 차이로 목적유전자 자체의 전사 및/또는 번역을 조절하여 전체 단백질의 발현을 매우 증가시킬 수 있음을 입증한 최초의 결과이다. 또한, 목적유전자 자체의 정지 코돈 뒤에 1Xgag 및 3Xgag 삽입한 클론 #22과 #23은 매우 높은 발현을 보인 반면, 약간 더 긴 6Xgag를 삽입한 클론 #24에서는 발현 저해가 일어났다. 따라서 정지 코돈 뒤에 삽입된 트리뉴클리오티드가 전체 단백질 발현에 영향을 주는 길이는 최소 길이 3 nt에서 시작하여 18 nt 정도에서 대부분 안정화가 일어나는 것으로 보인다. 이러한 결과는 정지 코돈 뒤에 추가된 반복적 트리뉴클레오티드의 길이에 따라 유도체(inducer) 또는 억제체(reducer)로 작용할 수 있음을 의미하는 결과로, 트리뉴클레오티드의 길이 또한 중요한 요인임을 알 수 있다.
이러한, C-말단에 해당하는 코돈(5' 코돈)과 번역종결코돈에서 동형 유사(synonymous) 코돈으로 대체하거나 ORF 바깥에서 정지 코돈 뒤에 트리뉴클레오티드를 추가하여 전체 단백질의 발현을 증가시키는 유도체(inducer)를 찾는 방법은 본 발명에서 처음 얻어진 결과로, 매우 효율적으로 다른 유전자의 발현에 적용할 수 있다고 판단된다. 또한 역으로 억제체도 찾을 수 있는 방법에 적용될 수 있을 것으로 판단된다.
실험예 3: 번역종결코돈 이하에 추가된 임의의 반복 트리뉴클레오티드가 전체 단백질의 발현에 미치는 영향 확인
3-1: MK 6 -GFP-Stop(TAA)- XhoI-6XHis (클론 #6)의 전체 단백질 발현
상기 <실험예 2>에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)의 전체 단백질 발현에서 번역종결코돈(TAA)와 XhoI-6XHis 사이에 XhoI-6XHis의 염기 서열들의 대표적인 트리뉴클레오티드를 반복적으로 삽입에 의하여 전체 단백질의 발현이 회복되고 또한 억제됨을 관찰하였다. 이어, 본 발명에서는 임의의 반복 트리뉴클레오티드를 번역종결코돈(TAA)와 XhoI-6XHis 사이에 삽입시켜 전체 단백질의 발현 형태를 조사하여 발현 증가 및 감소에 미치는 영향을 추가적으로 조사하였다.
상기 <실시예 1>에서 제작된 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)을 대조군으로 사용하였고, 상기 실시예 1에서 제조한 클론 #26~#46를 실험군으로 이용하였다(표 3 참조). 그 결과 상기 클론들에서 발현된 목적단백질 GFP는 C-말단에 XhoI-6XHis 펩티드 대신 모두 원래 GFP의 친수성 C-말단 아미노산 MDELYK(서열번호 60)을 갖게 되었다.
상기 #6, #26~#46 클론을 각각 대장균 BL21(DE3)에 형질전환하고, GFP의 발현량을 측정하였다.
원래 낮은 전체 단백질 발현을 보였던 대조군 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 해당하는 클론의 Stop(TAA)과 XhoI-6XHis 사이에 4Xgaa(클론 #26), 6Xgaa(클론 #27), 10Xgaa(클론 #28), 15Xgaa(클론 #29), 6Xcaa(클론 #32), 6Xtaa(클론 #33), 6Xtag(클론 #34), 6Xcag(클론 #35), 6Xggg(클론 #36), 6Xttt(클론 #37), 6Xcca(클론 #38), 6Xgat(클론 #39), 6Xgac(클론 #40), 6Xaat(클론 #41), 6Xaac(클론 #42), 6Xtac(클론 #45) 및 6Xctg(클론 #46)를 삽입한 클론에서는 전체 단백질 발현이 매우 높게 발현되었다. 하지만 6Xaaa(클론 #30) 및 6Xaag(클론 #31)는 대조군보다 매우 낮게 발현되었으며, 6Xtga(클론 #43) 및 6Xaga(클론 #44)는 대조군과 유사하게 낮게 발현되었다.
이러한 결과는 발현이 저조한 클론의 C-말단이 아닌 ORF 바깥의 정지 코돈 이하를 임의의 반복적 트리뉴클레오티드를 추가시키는 변이에 의하여, 전체 단백질의 발현이 대조군보다 획기적으로 향상될 수 있으며, 이에 따른 수용성 단백질 발현도 획기적으로 향상시킬 수 있음을 최초로 확립한 기술이다. 또한, 정지 코돈 이하를 임의의 반복적 트리뉴클레오티드를 추가하여 전체 단백질을 발현을 대조군보다 감소시킬 수 있음을 확인하였다. 따라서 이러한 결과는 번역종결코돈(TAA)과 XhoI-6XHis 사이에 반복적으로 삽입한 임의의 트리뉴클레오티드가 전체 단백질의 발현을 증가 또는 감소시키며, 발현 유도체(expression inducer) 또는 억제체(expression reducer)로 작용할 수 있음을 입증하는 것이다. 따라서 이러한 결과로부터 정지 코돈 뒤에 삽입된 트리뉴클레오티드 반복체가 이들 재조합 단백질의 효율적인 생산뿐만 아니라 생체 내에서 발현이 과도하거나 저조한 유전자의 발현 정도를 ORF를 전혀 변형시키지 않고, 정지코돈 이하의 변이를 통해 전체 단백질의 발현양을 최적화로 조절하는데 적용할 수 있다.
또한, 가장 큰 분자량을 갖는 rGTP를 반복적으로 삽입한 6Xggg(클론 #36)의 경우도 매우 높은 전체 단백질 발현을 보여 번역에는 문제가 없음을 확인할 수 있었다. 따라서, 어느 특정 하나의 rNTP 보다는 이러한 부위에 재구성된 리보염기서열의 전체적인 구조가 전사 및/또는 번역 조절을 통해, 전체 단백질 양을 결정하는 데 크게 작용하는 것으로 보인다.
상기 <실험예 2>에서 정지 코돈 뒤에 존재하는 서열의 트리뉴클레오티드를 삽입한 경우 발현을 조절하는 데 관여하는 뉴클레오티드는 18번째 뉴클레오티드까지로 추정하였으나, 도 3에서도 정지 코돈 뒤에 임이의 트리뉴클레오티드 삽입한 경우도 대부분 18번째 뉴클레오티드 정도에서 안정화가 일어난 것으로 보인다. 따라서 정지 코돈 이하에서 일차적으로 발현에 관여하는 길이는 3-18개의 뉴클레오티드 내외로 추정된다.
3-2: ME 6 -GFP-Stop(TAA)- XhoI-6XHis (클론 #4)의 전체 단백질 발현
상기 실험예 <3-1>에서 원래 낮은 전체 단백질 발현을 보였던 대조군 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 해당하는 클론의 번역종결코돈(TAA)과 XhoI-6XHis 사이에 임의의 반복된 트리뉴클레오티드를 삽입하여, 전체 단백질의 발현을 증가 또는 감소시키며 상기 트리뉴클레오티드가 유도체 및 억제체로 작용함을 확인하였다.
이에, 본 발명자는 상기 발현 유도체(expression inducer) 및 억제체(expression reducer)가 발현이 높은 ME6-GFP-Stop(TAA)-XhoI-6XHis 클론 #4의 번역종결코돈(TAA)과 XhoI-6XHis 사이에 트리뉴클레오티드가 삽입되었을 때의 전체 단백질 발현에 미치는 영향을 확인하였다. 유도체로는 6Xgaa(서열번호 67), 10Xgaa(서열번호 68), 6Xcaa(서열번호 72), 6Xtaa(서열번호 73), 6Xtag(서열번호 74), 6Xcag(서열번호 75)를 사용하였고, 억제체로는 6Xgag(서열번호 64), 6Xaaa(서열번호 70), 6Xaag(서열번호 71), 6Xtga(서열번호 83), 6Xaga(서열번호 84)를 사용하였다.
상기 <실시예 1>에서 제작된 ME6-GFP-Stop(TAA)-XhoI-6XHis(클론 #4)를 대조군으로 사용하였고, 상기 <실시예 1>에서 제조한 클론 #62~#72을 실험군으로 이용하였다(표 3 참조). 그 결과 이러한 클론들에서 발현된 목적단백질 GFP는 C-말단에 XhoI-6XHis 펩티드 대신 모두 원래 형태 GFP의 친수성 C-말단 아미노산 MDELYK(hy +0.35)를 가지게 되었다.
상기 클론 #4, 및 클론 #62~#72을 각각 대장균 BL21(DE3)에 형질전환하고, GFP의 발현량을 측정하였다. 그 결과, 상기 실험예 <3-1>에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)에 삽입되어 유도체 작용한 6Xgaa(서열번호 67), 10Xgaa(서열번호 68), 6Xcaa(서열번호 72), 6Xtaa(서열번호 73), 6Xtag(서열번호 74), 6Xcag(서열번호 75) 뉴클레오티드는 ME6-GFP-Stop(TAA)-XhoI-6XHis(클론 #4)의 정지코돈 이하에 삽입되었을 때, 모두 대조군과 유사한 발현을 나타내었고, 모두 발현을 저해하지 않았다. 또한, MK6-GFP-Stop(TAA)-XhoI-6XHis (클론 #6)에서 억제체로 작용한 6Xgag, 6Xaaa, 6Xaag, 6Xtga, 6Xaga가 ME6-GFP-Stop(TAA)-XhoI-6XHis(클론 #4)의 정지코돈 이하에 삽입되었을 때, 6Xaaa (클론 #65), 6Xtga(클론 #71), 6Xaga(클론 #72)에서는 대조군와 거의 유사하였고, 6Xgag(클론 #64)는 매우 저해하였고, 6Xaag(클론 #66)에서는 거의 발현되지 않았다(도 4 참조).
따라서, 이러한 결과는 발현이 잘 되는 클론에서도 C-말단이 아닌 ORF 바깥의 번역종결코돈 이하에 억제체를 추가시킨 후, 전체 발현을 감소시킬 수 있다는 것을 최초로 입증한 것이다. 이는 생체 내에서 과다 발현되는 유전자의 발현 정도를 ORF를 전혀 변형시키지 않고, 정지코돈 이하를 변이시킴으로서 전체 단백질 발현 양을 조절할 수 있음을 입증한 결과로, 발현조절 기구의 해명에 결정적인 단서라고 할 수 있다.
실험예 4: MK 6 -GFP-Stop(TAA)- XhoI-6XHis (클론 #6)의 번역종결코돈 이하에 추가된 헥사뉴클레오티드 반복체가 전체 단백질의 발현에 미치는 영향 확인
상기 <실험예 3-1>에서 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)의 전체 단백질 발현에서 번역종결코돈(TAA)과 XhoI-6XHis 사이에 반복적으로 삽입된 임의의 트리뉴클레오티드가 유도체(inducer) 또는 억제체(reducer)로서 기능을 수행하여, 전체 단백질의 발현이 회복되고 또한 억제됨을 관찰하였다.
이에, 본 발명자들은 이렇게 분리된 전체 단백질 발현 유도체 트리뉴클레오티드(trinucleotides) 서열에서 gaa를 선택하고, 단백질 발현 억제체 트리뉴클레오티드(trinucleotides) 서열에서 aaa, aag, gag, tga 및 aga를 선택하여 유도체-억제체를 동시에 결합한 헥사뉴클레오티드의 반복체인 gaa aaa, gaa aag, gaa gag, gaa tga, gaa aga가 발현이 낮은 MK6-GFP-Stop(TAA)-XhoI-6XHis 클론 #6의 번역 종결코돈(TAA)와 XhoI-6XHis 사이에 삽입되었을 때 제작된 MK6-GFP-Stop(TAA)-(xxx xxx)-XhoI-6XHis 클론에서 전체 단백질의 발현에 미치는 영향을 조사하였다.
상기 <실시예 1>에서 제작된 MK6-GFP-Stop(TAA)-XhoI-6XHis(클론 #6)를 대조군으로 사용하였고, 상기 <실시예 1>에서 제조한 클론 #47~#61을 실험군으로 이용하였다(표 3 참조). 그 결과 이러한 클론들에서 발현된 목적단백질 GFP는 C-말단에 XhoI-6XHis 펩티드 대신 모두 원래 형태 GFP의 친수성 C-말단 아미노산 MDELYK(hy +0.35)를 가지게 되었다.
상기 클론 #6, 및 클론 #47~#61을 각각 대장균 BL21(DE3)에 형질전환하고, GFP의 발현량을 측정하였다. 그 결과 MK6-GFP-Stop(TAA)-(xxx xxx)-XhoI-6XHis 클론에서는 1Xgaa aaa(클론 #47), 2Xgaa aag(클론 #51), 3Xgaa aag(클론 #52), 2Xgaa gag(클론 #54), 2Xgaa tga(클론 #57), 3Xgaa tga(클론 #58) 및 3Xgaa aga(클론 #61)에서는 매우 높은 발현을 보였고, 3Xgaa aaa(클론 #49), 3Xgaa gag(클론 #55), 1Xgaa tga(클론 #56) 및 2Xgaa aga(클론 #60)에서는 중간 정도의 발현을 보였고, 2Xgaa aaa(클론 #48), 1Xgaa aag(클론 #50), 1Xgaa gag(클론 #53) 및 1Xgaa aga(클론 #59)에서는 대조군과 비슷하게 낮은 발현을 보이거나 또는 대조군 보다도 훨씬 낮은 발현을 보였다 (도 5 참조). 따라서 이러한 결과는 클론 #47에서 #61까지, 높음, 중간, 낮음의 다양한 전체 단백질 발현 양을 보여, 이러한 hexanucleotides의 반복체가 전체 단백질 발현 양을 적절히 조절하는 데 매우 유용하게 사용될 수 있음을 확인하였다.
또한 도 5에서 트리뉴클레오티드 유도체와 억제제를 동시에 연결한 헥사뉴클레오티드 반복체의 경우도 대부분 1X, 2X, 3X 헥사뉴클레오티드 내에서 높음, 중간, 낮음의 여러 수준의 전체 단백질 발현을 보여 3X 헥사뉴클레오티드까지의 18번째 뉴클레오티드 정도에서 가능한 모든 발현 형태가 일어난 것으로 보인다. 따라서 이러한 결과로부터 정지 코돈 뒤에 삽입된 헥사뉴클레오티드 반복체가 트리뉴클레오티드 반복체와 마찬가지로 이들 재조합 단백질의 효율적인 생산뿐만 아니라 생체 내에서 발현이 과도하거나 저조한 유전자의 발현 정도를 ORF를 전혀 변형시키지 않고, 정지코돈 이하의 변이를 통해 전체 단백질의 발현양을 적절히 조절하는데 적용할 수 있음을 확인하였다.
본 발명은 도면에 도시된 실시 예를 참고로 설명되었으나 이는 예시적인 것에 불과하며, 당해 기술 분야에서 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 다른 실시예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구범위의 기술적 사상에 의하여 정해져야 할 것이다.
본 발명은 단백질의 전체 발현 조절 방법에 관한 것으로, 활성 외래 단백질의 3' 말단에 트리뉴클레오티드 또는 헥사뉴클레오티드 반복체가 순차적으로 연결된 유전자 컨스트럭를 이용하여 활성 외래 단백질의 전체 발현을 증가 또는 감소시키는 효과를 제공할 수 있다.
서열번호 1 내지 59는 본 발명의 일 실시예에 따른 GFP 발현벡터 클로닝에 이용된 정방향 또는 역방향 프라이머 서열을 의미한다.
서열번호 60은 GFP 클론의 C-말단 서열을 의미한다.
서열번호 61 내지 101은 본 발명의 일 실시예에 따른 트리뉴클레오티드 또는 헥사뉴클레오티드 서열을 의미한다.

Claims (48)

1) 프로모터;
2) 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위; 및
3) 트리뉴클레오티드 또는 헥사뉴클레오티드의 반복체가 순차적으로 연결된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현을 조절하기 위한 발현벡터.
제1항에 있어서,
상기 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈 또는 그의 동형유사 대체코돈인, 발현벡터.
제1항에 있어서,
상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질인, 발현벡터.
제1항에 있어서,
상기 활성 외래 단백질은 GFP(green fluorescent protein)인, 발현벡터.
제1항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 발현벡터.
제1항에 있어서,
상기 트리뉴클레오티드 또는 헥사뉴클레오티드는 1 내지 30회 연속적으로 반복되는, 발현벡터.
제1항에 있어서,
상기 트리뉴클레오티드의 반복체는 서열번호 61~86로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
제1항에 있어서,
상기 헥사뉴클레오티드의 반복체는 서열번호 87~101로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
1) 프로모터;
2) 번역종결코돈이 제거된 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및
3) 상기 번역종결코돈의 동형유사 대체코돈이 순차적으로 포함된 유전자 컨스트럭트를 포함하는, 상기 활성 외래 단백질의 전체 발현 조절을 위한 발현벡터.
제8항에 있어서,
상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질인, 발현벡터.
제8항에 있어서,
상기 활성 외래 단백질은 GFP(green fluorescent protein)인, 발현벡터.
제8항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 발현벡터.
제8항에 있어서,
상기 유전자 컨스트럭트는 상기 동형유사 대체코돈의 바로 하위에 트리뉴클레오티드의 반복체 또는 헥사뉴클레오티드의 반복체를 추가적으로 포함하는, 발현벡터.
제13항에 있어서,
상기 트리뉴클레오티드 또는 헥사뉴클레오티드는 1 내지 30회 연속적으로 반복되는, 발현벡터.
제13항에 있어서,
상기 트리뉴클레오티드의 반복체는 서열번호 61~86로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
제13항에 있어서,
상기 헥사뉴클레오티드의 반복체는 서열번호 87~101로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
1) 프로모터;
2) 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및
3) 상기 번역종결코돈 하위에 바로 연결되는 트리뉴클레오티드의 반복체 또는 헥사뉴클레오티드의 반복체가 순차적으로 포함되는 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현 조절하기 위한 발현벡터.
제17항에 있어서,
상기 활성 외래 단백질은 고유의 C-말단 폴리펩티드를 갖는, 발현벡터.
제17항에 있어서,
상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질인, 발현벡터.
제19항에 있어서,
상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)인, 발현벡터.
제17항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 발현벡터.
제17항에 있어서,
상기 번역종결코돈은 상기 외래 단백질 고유의 번역종결코돈 또는 그의 동형유사 대체코돈인, 발현벡터.
제17항에 있어서,
상기 트리뉴클레오티드 또는 헥사뉴클레오티드는 1 내지 30회 연속적으로 반복되는, 발현벡터.
제23항에 있어서,
상기 트리뉴클레오티드의 반복체는 서열번호 61~86로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
제17항에 있어서,
상기 헥사뉴클레오티드의 반복체는 서열번호 87~101로 기재되는 핵산서열 중 어느 하나를 갖는, 발현벡터.
1) 프로모터; 및
2) C-말단을 암호화하는 핵산서열 중 적어도 하나 이상의 코돈이 동형유사 대체코돈으로 변이된 활성 외래 단백질을 암호화하는 폴리뉴클레오티드로 구성된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현 조절하기 위한 발현벡터.
제26항에 있어서,
상기 C-말단은 번역종결코돈 상위(upstream)로부터 1-40개의 아미노산으로 구성되는 폴리펩티드인, 발현벡터.
제26항에 있어서,
상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질인, 발현벡터.
제26항에 있어서,
상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)인, 발현벡터.
제26항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 발현벡터.
프로모터; 및 상기 프로모터에 작동 가능하도록 연결된 것으로서, 번역종결코돈(stop codon)이 동형유사 대체코돈으로 치환되거나 상기 번역종결코돈 및 상기 번역종결코돈으로부터 1 내지 120 뉴클레오티드 상위 내에 존재하는 적어도 하나 이상의 코돈이 동형유사 대체코돈으로 치환된 활성 외래 단백질을 암호화하는 폴리뉴클레오티드로 구성된 유전자 컨스트럭트를 포함하는 재조합 발현벡터를 제조하는 단계;
상기 재조합 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계; 및
상기 형질전환체를 배양하여 상기 폴딩되는 활성 외래단백질의 발현을 유도하는 단계를 포함하는, 상기 활성 외래 단백질의 전체 발현을 조절하는 방법.
제31항에 있어서,
상기 활성 외래 단백질은 내부에 하나 이상의 막전위 도메인이 존재하고 폴딩(folding)되는 단백질인, 방법.
제31항에 있어서,
상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)인, 방법.
제31항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 방법.
프로모터; 상기 프로모터에 작동 가능하도록 연결된 것으로서, 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및, 상기 폴리뉴클레오티드의 번역종결 코돈 하위(downstream)에 연결된 트리뉴클레오티드(trinucleotide)의 반복체 또는 헥사뉴클레오티드의 반복체로 구성된 유전자 컨스트럭트를 포함하는 발현벡터를 제조하는 단계;
상기 발현벡터로 숙주 세포를 형질전환하여 형질전환체를 제조하는 단계; 및
상기 형질전환체를 배양하여 상기 활성 외래 단백질의 발현을 유도하는 단계를 포함하는, 상기 활성 외래 단백질의 전체 발현을 조절하는 방법.
제35항에 있어서,
상기 트리뉴클레오티드 또는 헥사뉴클레오티드의 반복체는 1 내지 30회 연속적으로 반복되는, 방법.
제35항에 있어서,
상기 트리뉴클레오티드의 반복체는 서열번호 61~86로 기재되는 핵산서열 중 어느 하나를 갖는, 방법.
제35항에 있어서,
상기 헥사뉴클레오티드의 반복체는 서열번호 87~101로 기재되는 핵산서열 중 어느 하나를 갖는, 방법.
제35항에 있어서,
상기 폴딩(folding)되는 활성 외래 단백질은 GFP(green fluorescent protein)인, 방법.
제35항에 있어서,
상기 활성 외래 단백질은 치료용 단백질(therapeutic protein)인, 방법.
프로모터, 번역종결코돈이 제거된 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위; 및 발현 조절체로서 번역종결코돈을 순차적으로 포함하는 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계;
상기 형질전환체를 배양하는 단계;
상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및
발현 조절체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법.
프로모터, 번역종결코돈을 포함하는 외래 단백질을 암호화하는 폴리뉴클레오티드의 삽입을 위한 제한효소 인식부위, 및 발현 조절체로서 트리뉴클레오티드 반복체 또는 헥사뉴클레오티드의 반복체가 순차적으로 연결된 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계;
상기 형질전환체를 배양하는 단계;
상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및
발현 조절체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법.
프로모터, 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 발현 조절체로서 상기 번역종결코돈의 동형유사 대체코돈이 순차적으로 포함된 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계;
상기 형질전환체를 배양하는 단계;
상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및
발현 조절체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법.
프로모터, 번역종결코돈을 포함하는 활성 외래 단백질을 암호화하는 폴리뉴클레오티드; 및 발현 조절체로서 상기 번역종결코돈 하위에 바로 연결되는 트리뉴클레오티드의 반복체 또는 헥사뉴클레오티드의 반복체가 순차적으로 포함되는 유전자 컨스트럭트를 포함하는 발현벡터로 숙주세포를 형질전환하여 형질전환체를 제조하는 단계;
상기 형질전환체를 배양하는 단계;
상기 형질전환체의 배양액에서 상기 발현벡터에 도입된 외래 단백질의 발현정도를 측정하는 단계; 및
발현 조절체가 삽입되지 않은 대조군 벡터와 비교하여 유의하게 상기 외래 단백질의 발현 수준을 증가 또는 감소시킨 발현 조절체의 스크리닝 방법.
제1항, 제9항, 또는 제17항 중 어느 한 항의 발현벡터로 형질전환된, 약독화된 세포주 또는 바이러스.
제45항에 있어서,
상기 발현벡터는 서열번호 61~86로 기재되는 핵산서열을갖는 트리뉴클레오티드 반복체를 갖는, 약독화된 세포주 또는 바이러스.
제45항에 있어서,
상기 발현벡터는 서열번호 87~101로 기재되는 헥사뉴클레오티드의 반복체를 갖는, 약독화된 세포주 또는 바이러스.
1) 프로모터; 및,
2) 상기 프로모터에 작동 가능하도록 연결된 것으로서, C-말단의 친수도 값이 0.35 내지 2.00으로 조절된 폴리펩타이드를 코딩하는 폴리뉴클레오타이드로 구성된 유전자 컨스트럭트를 포함하는, 활성 외래 단백질의 전체 발현을 조절하기 위한 발현벡터.
PCT/KR2013/004150 2012-06-04 2013-05-10 ３'영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법 WO2013183863A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0059949 2012-06-04
KR20120059949 2012-06-04

Publications (2)

Publication Number Publication Date
WO2013183863A1 true WO2013183863A1 (ko) 2013-12-12
WO2013183863A9 WO2013183863A9 (ko) 2014-01-09

Family

ID=49712222

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/004150 WO2013183863A1 (ko) 2012-06-04 2013-05-10 ３'영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법

Country Status (2)

Country Link
KR (1) KR101703540B1 (ko)
WO (1) WO2013183863A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017119576A1 (ko) * 2016-01-07 2017-07-13 이화여자대학교 산학협력단 올레산 수화효소 2를 이용한 생물전환공정

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100543063B1 (ko) * 2004-03-16 2006-01-20 (주)넥스젠 재조합 단백질의 제조 및 분리 방법
US20080064060A1 (en) * 2004-05-06 2008-03-13 Rainer Blasczyk Method For Productoin Of Soluble Mhc Proteins
KR20090102825A (ko) * 2006-12-29 2009-09-30 유니 베르시타' 데글리 스투디 디 우디네 식물에 있어서 이종유래 단백질의 발현 향상을 위하여 5'(5'-ｕｔｒ) 내에 최적화된 리더 작용기를 가진 인공 ｄｎａ 서열
KR100981356B1 (ko) * 2006-01-31 2010-09-14 대한민국 신호서열 및 변이된 신호서열로 디자인된 분비증강자에의한 원래 형태의 수용성 재조합 단백질 생산 방법
KR20110124471A (ko) * 2010-05-11 2011-11-17 대한민국(관리부서:국립수산과학원) 폴딩되는 큰 활성 단백질의 수용성 발현

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100543063B1 (ko) * 2004-03-16 2006-01-20 (주)넥스젠 재조합 단백질의 제조 및 분리 방법
US20080064060A1 (en) * 2004-05-06 2008-03-13 Rainer Blasczyk Method For Productoin Of Soluble Mhc Proteins
KR100981356B1 (ko) * 2006-01-31 2010-09-14 대한민국 신호서열 및 변이된 신호서열로 디자인된 분비증강자에의한 원래 형태의 수용성 재조합 단백질 생산 방법
KR20090102825A (ko) * 2006-12-29 2009-09-30 유니 베르시타' 데글리 스투디 디 우디네 식물에 있어서 이종유래 단백질의 발현 향상을 위하여 5'(5'-ｕｔｒ) 내에 최적화된 리더 작용기를 가진 인공 ｄｎａ 서열
KR20110124471A (ko) * 2010-05-11 2011-11-17 대한민국(관리부서:국립수산과학원) 폴딩되는 큰 활성 단백질의 수용성 발현

Also Published As

Publication number Publication date
KR101703540B1 (ko) 2017-02-08
KR20130136381A (ko) 2013-12-12
WO2013183863A9 (ko) 2014-01-09

Similar Documents

Publication Publication Date Title
AU2016317449B2 (en) Novel insulin analogs and use thereof
EP2646556A2 (en) Novel hybrid promoter and recombinant vector comprising the same
KR102022662B1 (ko) 식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터
WO2019117673A2 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
AU2018256256B2 (en) Method for producing dual function proteins and its derivatives
WO2014142453A1 (ko) 램프 기능이 포함된 범용 단백질 과발현 태그와 그 활용
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2020130300A1 (ko) 신규 면역 억제 인터루킨 2
WO2013183863A1 (ko) ３&#39;영역의 염기 변이를 통한 전체 단백질의 발현 조절 방법
WO2011025077A1 (ko) 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법
WO2021107660A1 (ko) 생체 내 지속시간이 연장된 다기능성 다중특이적 멀티머 생체분자 중합체
WO2021034101A1 (ko) 신규 인터페론 람다 변이체 및 이의 제조방법
WO2023022490A1 (ko) 폴리 a 테일을 안정적으로 유지하는 방법
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
EP1250439A1 (en) Expression and secretion vector for human interferon alpha and process for producing human interferon alpha by employing same
WO2022098191A1 (ko) 하이드로겔화 핵산을 이용한 고분자량 단백질 생산용 원형 핵산 템플릿의 제조방법 및 고분자량 단백질 생산 시스템
Denhardt et al. A survey of vectors for regulating expression of cloned DNA in E. coli
WO2024101755A1 (en) Method for preparing taq dna polymerase in pichia pastoris
KR100677828B1 (ko) ＯｍｐＦ와 목적단백질의 동시 발현을 통한 목적 단백질의세포외 분비·생산 방법
WO2020032595A1 (en) Nucleic acid molecules comprising a variant inc coding strand
WO2020204601A1 (ko) Csq-태그를 이용한 단백질의 발현 및 정제 방법
WO2024147677A1 (ko) 2차 대사산물 증가를 위한 유전자 조작된 cas9 시스템과 이를 이용한 2차 대사산물 증진 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2023214801A1 (ko) 단백질의 발현 수준 및 발현 위치 조절을 위한 utr 서열 및 이를 포함하는 mrna 서열
WO2011105841A2 (ko) 브라제인 발현용 재조합 발현벡터 및 높은 단맛을 가지는 신규한 브라제인 다중 변이체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13800207

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13800207

Country of ref document: EP

Kind code of ref document: A1