Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
  • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
  • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
  • A61P35/04—Antineoplastic agents specific for metastasis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/475—Growth factors; Growth regulators
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
  • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

• the present invention relates to novel antitumor drugs. Specifically, the present invention provides a mutant of endostatin which has reduced ATPase activity and increased neovascularization inhibitory activity. The present invention also provides the use of the mutant in the treatment of a neovascular related disease such as a tumor. Background technique
• ES endogenous vascular inhibitor
• collagen XVIII having a carboxyl terminal molecular weight of 20 kDa, which has an activity of inhibiting endothelial cell migration, proliferation, and formation of a lumen.
• Recombinant endostatin can inhibit or even cure a variety of mouse tumors without drug resistance (Folkman J. et al. Cell 1997; 88:277-285; Folkman J. et al. Nature 1997; 390:404-407 ).
• Endo human endostatin expressed in E. coli (trade name: Endo) has become an anti-tumor drug, and its efficacy has been extensively proven in clinical trials with non-small cell lung cancer as the main indication.
• Endo is an ES variant with an additional amino acid sequence (MGGSHHHHH) at the N-terminus, which has better thermodynamic stability and biological activity than the native human ES expressed by yeast (Fu Y. et Al. Biochemistry 2010; 49:6420-6429).
• Multi-site PEG modification of oES is usually achieved by modifying the Lys side chain ⁇ -amino group, although prolonging the pharmacogen half-life but the biology of ES The activity was significantly reduced ( ⁇ , Shandong University PhD thesis, CNKL 2005).
• the ⁇ -end single point PEG Modification not only enhances the in vivo stability of ES, but also enhances the biological activity of ES (ZL200610011247.9), and its related products have entered the clinical trial stage.
• ES endothelial cell activity
• endothelial cell migration including inhibition of endothelial cell migration, proliferation and formation of lumens, and induction of endothelial cell apoptosis.
• Nucleolin on the cell membrane surface acts as a functional receptor for ES, which mediates ES endocytosis and downstream signaling pathways in endothelial cells (Shi HB, et al., Blood, 2007). , 110:2899-2906).
• nucleolin is also expressed on the surface of MDA-MB-435 membrane, a highly proliferating breast cancer cell, and can mediate the endocytosis of its ligand protein in MDA-MB-435 (Sven Christian, et al ., JCB, 2003, 163(4): 871-878).
• ES-binding proteins that can serve as potential ES receptors including integrins, tropomyosin, glypicans, laminin, and matrix metalloproteinase 2 (MMP-2) (Sudhakar, A., et al., 2003, Proc. Natl Acad. Sci.
• the classical ES biological activity assay is based on its inhibition of endothelial cell activity, including experiments that inhibit endothelial cell migration, proliferation, and lumen formation.
• the endothelial cells used mainly include human microvascular endothelial cells (HMEC) and human umbilical vein endothelial cells (HUVEC).
• HMEC human microvascular endothelial cells
• HAVEC human umbilical vein endothelial cells
• these methods are high in requirements for cell culture, complex in operation and subjective, accurate and reproducible. Poor (Li YH, et aL, 2011, Chin J Biologicals March, Vol. 24 No. 3: 320-323). Therefore, finding and improving the biological activity evaluation methods of ES and its variants is of great significance for ES drug development and quality monitoring.
• Adipic acid adenosine is the most basic energy substance in living organisms. Participating in various physiological and biochemical reactions in living organisms is of great significance for maintaining normal life activities. ATP can be produced by a variety of cellular metabolic pathways: The most typical eukaryotic organisms are synthesized by tribasic adenosine synthase in the main mitochondria under normal physiological conditions by oxidation, or by photosynthesis in the chloroplast of plants. . The main energy source for ATP synthesis is glucose and fatty acids. Under normal physiological conditions, the molar concentrations of ATP in cells and blood are 1-10 mM and 100 ⁇ , respectively.
• ATPase also known as triuretic adenosine
• ADP diuretic adenosine
• Pi pity chloride
• the energy produced by the reaction can be used to drive another chemical reaction that requires energy by transfer, a process that is widely used by all known life forms.
• high-energy bonds contained in GTP can also provide energy for protein biosynthesis.
• ATPases Although various ATPases differ in sequence and tertiary structure, they usually contain a P-loop structure as a binding motif for binding to ATP (Andrea T. Deyrup, et al, 1998, JBC, 273(16): 9450 -9456), and this P-loop structure has the following typical sequences: GXXGXXK (Driscoll, WJ, et al., 1995, Proc. Natl. Acad. Sci.
• cancer cells and proliferative phase including endothelial cells need to consume large amounts of ATP; on the other hand, cancer cells and proliferating cells use glucose to produce ATP with low efficiency. This is due to the fact that most cancer cells and proliferating cells produce ATP by the Warburg effect. Although the efficiency of ATP production in this way is very low, there are a large number of stacked units that can be used for cell structure assembly in the process. Blocks), but more conducive to cell proliferation (Matthew G., et al., 2009, Science, 324: 1029-1033). Summary of invention
• the present invention relates to a novel activity of protein ES, i.e., ATPase activity, i.e., ATPase activity. New uses and ES drug designs based on this new activity were also announced.
• ES has a strong ATPase activity.
• Myosin pig heart extraction
• the present invention discloses a novel method for detecting and evaluating ES biological activity, which can determine the conformation and organism of recombinantly prepared ES by biochemical means such as extracellular detection of ATPase activity of ES. Learning activity.
• biochemical means such as extracellular detection of ATPase activity of ES. Learning activity.
• the enzyme activity detection method is sensitive, accurate, quick and reproducible, and can be widely applied to the biological activity and quality evaluation of ES and its variants.
• the invention provides a method of detecting the biological activity of endostatin, or a variant thereof, a mutant or a PEG-modified product, the step comprising detecting the endostatin, or a variant thereof, a mutant or a PEG modification ATPase activity of the product.
• the ATPase activity of a product such as endostatin, or a variant thereof, a mutant or a PEG-modified product can be detected by a malachite green acid salt detection method or an ATP bioluminescence detection method, thereby determining the conformation of the recombinantly prepared ES product.
• biological activity for example, the ATPase activity of a product such as endostatin, or a variant thereof, a mutant or a PEG-modified product can be detected by a malachite green acid salt detection method or an ATP bioluminescence detection method, thereby determining the conformation of the recombinantly prepared ES product. And biological activity.
• ES can be endocytosed into vascular endothelial cells by nucleolin.
• nucleolin To test whether ES can exert ATPase activity in cells, one embodiment of the present invention detects ES ATPase activity in an in vivo environment such as endothelium cell lysate. The results indicate that ES can also exert ATPase activity in endothelial cell lysates.
• the present inventors have found that the amino acid sequence Gly-Ser-Glu-Gly-Pro-Leu-Lys at position 89-95 in the native ES sequence (SEQ ID NO. 1) has a conserved amino acid sequence GXXGXXK of the ATP-binding motif. (Driscoll, W. J" et al, 1995, Proc. Natl. Acad. Sci. USA, 92: 12328-12332). Among them, three amino acid residues (2 G and 1 K) in various genera It is highly conserved. The ATPase activity of ES can be altered by site-directed mutagenesis of the amino acid in the ATP-binding motif.
• the present invention compares in one embodiment for ES variant proteins having different N-terminal sequences. It was found that ES (N-4) with 4 amino acid residues deleted at the N-terminus has significantly higher ATPase activity than full-length ES, while N-4 has significantly lower cytological activity than ES and inhibits tumors in animals in previous reports. Activity (Fu Y. et al. Biochemistry 2010; 49: 6420-6429).
• mouse ES can completely cure mouse tumors (Folkman J. et al. Nature 1997; 390:404-407).
• mouse ES(MM) does not contain the classical ATP-binding motif in human ES (Fig. 1). Therefore, we first tested the ATPase activity of MM and found that the ATPase activity of MM was significantly lower than that of human ES. Only about one-fifth of the activity of human ES was observed, but the activity of inhibiting tumor was higher than that of human ES.
• ES mutants having the sequences set forth in SEQ ID NOS. 6-11, 13, 14, 15-27, and 30-31 all exhibit lower ATPase activity than ES and are equivalent or significant Higher than ES activity to inhibit endothelial cell migration.
• ES is an angiogenesis inhibitor protein whose basic function is to inhibit neovascularization by inhibiting endothelial cell activity, thereby treating diseases associated with neovascularization (such as tumor, macular degeneration, obesity). And diabetes, etc.), we believe that these ES mutants can have a stronger activity in inhibiting neovascularization-related diseases such as tumors.
• molecular cloning can be used to further design (eg, reduce) ATPase activity to design ES mutants, thereby achieving better inhibition of tumor and neovascular related diseases.
• ES drug eg, a compound having a high phospholipase activity.
• the present invention also provides a method of increasing the biological activity of endostatin, which comprises reducing ATPase activity of endostatin or a variant thereof. Specifically, it can be passed through genetic workers.
• the method comprises mutating the ATP-binding motif GXXGXXK of endostatin or a variant thereof, thereby obtaining an endostatin mutant having reduced ATPase activity, the endostatin mutant having enhanced biological activity, For example, an increased activity of inhibiting endothelial cell migration and an increased activity of inhibiting tumors.
• the present invention also provides an endostatin mutant having increased anti-angiogenic activity, wherein the mutant comprises a mutation at its ATP-binding site, and is associated with a corresponding wild-type endostatin or The mutant has a reduced ATPase activity compared to its variant.
• the mutant has a decrease in ATPase activity of at least about 30%, such as a decrease of at least about 50%, a decrease of at least about 70%, or a decrease of at least about 90, compared to the corresponding wild-type endostatin or a variant thereof. %.
• the ATPase activity of the mutant is retained only up to about 60-70%, such as up to about 50-60%, and up to about 40-50%, compared to the corresponding wild-type endostatin or a variant thereof. , retain up to approximately 30-40%, retain up to approximately 20-30%, retain up to approximately 10-20%, or retain less than 10% or less.
• the mutant does not have ATPase activity.
• the mutant comprises a mutation in its ATP binding motif as compared to the corresponding wild type endostatin or a variant thereof.
• the mutant comprises a mutation in a sequence corresponding to a Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues 89-95 of SEQ ID NO. 1, wherein The mutation is selected from the group consisting of a substitution, deletion or addition of one or several amino acid residues or a combination thereof, wherein the mutation results in a decrease or elimination of the ATPase activity of the mutant.
• the sequence of the mutant corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues 89-95 of SEQ ID NO. 1 is partially or
• the endostatin mutant of the invention comprises the following mutations: (a) the Gly amino acid residue corresponding to position 89 of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of an uncharged amino acid or an aromatic Or deleted; or (b) the Gly amino acid residue corresponding to position 92 of SEQ ID NO. 1 is substituted or deleted from an uncharged amino acid; or (c) corresponds to the first of SEQ ID NO.
• the Lys amino acid residue at position 95 is substituted or deleted by an amino acid selected from a positively charged or uncharged amino acid; or (d) any combination of (a) to (c).
• the endostatin mutant of the present invention comprises the following mutations: (a) the Gly amino acid residue corresponding to position 89 of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of Ala and Pro Or deleted; or (b) the Gly amino acid residue corresponding to position 92 of SEQ ID NO. 1 is substituted or deleted by Ala; or (c) the Lys amino acid residue corresponding to position 95 of SEQ ID NO. The group is substituted or deleted by an amino acid selected from Arg and Gin; or (d) any combination of (a)-(c).
• substituted amino acid can also be selected for the above substitution without affecting the charge distribution and conformation of the mutant protein molecule.
• the endostatin mutant of the invention comprises a sequence selected from the group consisting of SEQ ID NO. 6 - IK 13, 14, 15-27 and 30-31.
• the endostatin mutant of the present invention comprises a sequence selected from the group consisting of SEQ ID N0.6, SEQ ID ⁇ 10, 8 ( ⁇ 10 27 and 8 ( ⁇ 10 30).
• the above-described endostatin mutant of the present invention is a mutant of human endostatin.
• the present invention also provides a pharmaceutical composition comprising the endostatin mutant of the present invention as described above.
• the endostatin may be covalently linked to a PEG molecule.
• the molecular weight of the PEG molecule is, for example, 5-40 kD, such as 5-20 kD, or 20-40 kD, preferably the molecular weight of the PEG molecule is 20 kD, for example 20 kD monomethoxy polyethylene glycol For example, monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD).
• the PEG molecule is covalently linked to the N-terminal alpha amino group of the endostatin.
• the present invention also provides a method of treating a tumor comprising administering to a tumor patient an endostatin mutant of the present invention as described above or a pharmaceutical composition of the present invention as described above.
• the present invention also relates to the use of an endostatin mutant as described above for the preparation of a medicament for treating a neovascular related disease.
• the neovascular related disease is a tumor.
• Figure 1 Sequence alignment of human and murine ES.
• Figure 2 Preparation of ES, ES mutants, ES variants and their mPEG modified products.
• FIG. 3 ES, ES variants and their mPEG modified products have ATPase activity.
• Figure 4 ES, ES variants and their mPEG-modified products in endothelial cell whole cell lysates It has ATPase activity.
• ATPase activity assay can be used to quickly and accurately determine the biological activity of ES, ES variants and their mPEG modified products.
• Figure 7 Comparison of the activity of ATP in whole cell lysates of endothelial cells degraded by ES mutants.
• Figure 8 Comparison of ES mutants inhibiting endothelial cell migration activity.
• Figure 9 Comparison of ATPase activity and inhibition of endothelial cell migration activity of Endu mutants.
• Figure 10 Natural human ES sequence.
• Figure 11 Human ES sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 12 Human N-4 sequence recombinantly expressed in E. coli, where the first amino acid at the N-terminus and the last amino acid K at the C-terminus are randomly deleted during recombinant expression.
• Figure 13 Endu sequence recombinantly expressed in E. coli, in which the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 14 ES001 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 15 ES003 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 16 ES004 sequence recombinantly expressed in E. coli, in which the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 17 ES005 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 18 ES006 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted upon recombinant expression. Can be randomly deleted during recombinant expression.
• Figure 35 Z009 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 36 Z101 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 37 Z103 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 38 Z104 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 39 ZN1 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 40 ZN2 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 41 ZN3 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 42 ZN4 sequence recombinantly expressed in E. coli, wherein the first amino acid M at the N-terminus can be randomly deleted during recombinant expression.
• Figure 43 Comparison of ES mutants, ES01 ES012, inhibiting endothelial cell migration activity.
• Figure 44 Comparison of ES mutants S01, S02, S09, S10 inhibiting endothelial cell migration activity.
• Figure 45 Comparison of ES mutant S12 inhibition of endothelial cell migration activity.
• Figure 46 Comparison of ES mutant Z005, Z006, Z008, Z009 inhibiting endothelial cell migration activity.
• Figure 47 Comparison of ES mutant Z101, Z103, Z104, ZN1, ZN2, ZN3, ZN4 inhibiting endothelial cell migration activity.
• Figure 48 Inhibitory effect of ES mutants on tumor growth in non-small cell lung cancer A549 at the animal level, (A) tumor volume, (B) tumor weight.
• ES refers to a natural endostatin, such as human endostatin having the sequence of SEQ ID NO. 1 (Fig. 10).
• An ES variant refers to a form of addition or deletion of 1-15 amino acids at the N-terminus or C-terminus based on the native ES sequence.
• the ES variant may be naturally produced, for example, when human ES is recombinantly expressed in E. coli, its first amino acid M can be randomly deleted, resulting in an ES variant having the sequence of SEQ ID NO. 2 (Fig. 11) .
• an ES variant (N-4) having a N-terminal deletion of 4 amino acids can be produced due to random cleavage at the N-terminus, having the sequence shown in SEQ ID NO. ⁇ lj (; Fig. 12), further, wherein the K at the C-terminus can also be randomly deleted.
• ES variants can also be artificially produced, for example, to promote protein expression and improve stability, Endu adds 9 additional amino acid residues of the sequence MGGSHHHHH at the N-terminus of the native ES, the variant has The sequence shown in SEQ ID NO. 4 (Fig. 13), wherein the first amino acid M can be randomly deleted upon recombinant expression.
• an ES variant refers to a naturally occurring one that has the same or similar activity of inhibiting neovascularization as the corresponding native ES, and has the same ATP-binding motif and the same or similar ATPase activity as the corresponding native ES. Or artificially produced ES variants.
• a mutant of ES refers to a mutant protein obtained by modifying an ATP-binding site of a native ES or ES variant, such as an amino acid site-directed mutation of an ATP-binding motif.
• ES, ES variants and ES mutant proteins used in the present invention were purchased from Xiansheng Maidjin Company except for Endu, and the rest were supplied by Beijing Proji Company.
• Polyethylene glycol (PEG) modified ES, Endu and N-4 were named mPEG-ES, mPEG-Endu and mPEG-N-4, respectively, which were a monomethoxy polyethylene glycol with a molecular weight of 20 kDa.
• Propionaldehyde (mPEG-ALD) is a product obtained by modifying an ES, Endu or N-4 molecule. The site of coupling is the activated mPEG-ALD aldehyde group and the N-terminal ⁇ -amino group of ES, Endu or N-4.
• ATPase activity This is a widely accepted and used method for detecting ATPase activity.
• the principle is that under acidic conditions, malachite green, molybdate and inorganic pity acid react to form a green substance, which can be detected in the wavelength range of 600-660 nm, and its absorbance and pitiate content are linear in a certain range. relationship.
• ATPase releases ADP and pity acid (Pi) during the hydrolysis of ATP, and the activity of ATPase is calculated by the amount of pity acid measured by the kit.
• This method is convenient and rapid, and is widely used in the analysis of Phosphatase activity, lipase activity, Nucleoside Triphosphatase activity and Phosphate content. Large flux drug screen Selected.
• the ATP binding motif usually has a P-loop structure.
• the P-loop structure has the following typical sequences: GXXGXXK, (G/A) XXXXGK (T/S), GXXXXGKS and GXXGXGKS.
• the ATP binding motif refers to the sequence of GXXGXXK. Among them, amino acid residues not substituted with X are more conservative in comparison. Typically, these ATP binding motifs can also bind to GTP.
• ATPase-binding protein molecule that binds to ATP, including the classical ATP-binding motif and the ATP-binding amino acid site other than the ATP-binding motif. These amino acids may be distant from the above ATP-binding motifs in the primary sequence of the protein, but amino acids involved in the interaction of ES with ATP/GTP in the tertiary structure, or substitutions or deletions of these amino acid positions may indirectly affect the conformation of the protein. ES interacts with ATP/GTP to alter the ATPase activity of ES.
• the present invention is based on the discovery of ES new activity (ATPase activity), and discloses a new method for evaluating the biological activity of ES, which is more convenient, accurate and reproducible than the existing method using endothelial cell migration measurement.
• ES new activity ATPase activity
• This provides an important research method for ES and its variants, mechanism studies of mutants, drug development and quality control.
• the invention provides a method of detecting the biological activity of endostatin, or a variant thereof, a mutant or a PEG-modified product, the step comprising detecting the endostatin, or a variant thereof, a mutant or a PEG modification ATPase activity of the product.
• the ATPase activity of a product such as endostatin, or a variant thereof, a mutant or a PEG-modified product can be detected by a malachite green acid salt detection method or an ATP bioluminescence detection method, thereby determining the conformation of the recombinantly prepared ES product.
• biological activity for example, the ATPase activity of a product such as endostatin, or a variant thereof, a mutant or a PEG-modified product can be detected by a malachite green acid salt detection method or an ATP bioluminescence detection method, thereby determining the conformation of the recombinantly prepared ES product. And biological activity.
• the N-terminal ⁇ -amino group of ES and Endu was significantly modified by mPEG single-point modification, and the activity of inhibiting endothelial cell migration was significantly enhanced (ZL200610011247.9). Therefore, in one embodiment of the present invention, the ATPase activities of mPEG-ES, mPEG-Endu and mPEG-N-4 were simultaneously detected and found to be significantly lower than before the modification (Fig. 3).
• the present invention also provides a method of increasing the biological activity of endostatin, which comprises reducing ATPase activity of endostatin or a variant thereof.
• the ATP-binding motif GXXGXXK of endostatin or a variant thereof can be mutated by genetic engineering means to obtain an endostatin mutant having reduced ATPase activity, and the endostatin mutant has Increased biological activity, such as increased activity of inhibiting endothelial cell migration and increased tumor suppressor activity.
• ES can be endocytosed by endothelial cells, thereby degrading ATP in cells, living cells can quickly compensate for the consumption of ATP.
• the prior art usually detects ATP content in living cells by detecting ATP degradation of whole cell lysates. .
• the ATPase activities of the mutants ES003, ES006, ES007 and ES008 were still significantly lower than ES (Fig. 7A).
• the ATPase activities of the mutants ES001, ES004 and ES005 were comparable to those of ES (Fig. 7B). This may be due to the interaction of the P-loop structure caused by the mutation affecting the interaction of the entire protein with ATP.
• the present invention also provides an endostatin mutant having enhanced anti-angiogenic activity, wherein the mutant comprises a mutation at its ATP-binding site, and is associated with a corresponding wild-type vascular endothelial inhibition ATPase activity of the mutant compared to its variant or its variant Lower.
• the mutant has a decrease in ATPase activity of at least about 30%, such as a decrease of at least about 50%, a decrease of at least about 70%, or a decrease of at least about 90, compared to the corresponding wild-type endostatin or a variant thereof. %.
• the ATPase activity of the mutant is retained only up to about 60-70%, such as up to about 50-60%, and up to about 40-50%, compared to the corresponding wild-type endostatin or a variant thereof. , retain up to approximately 30-40%, retain up to approximately 20-30%, retain up to approximately 10-20%, or retain less than 10% or less.
• the mutant does not have ATPase activity.
• the mutant comprises a mutation in its ATP binding motif as compared to the corresponding wild type endostatin or a variant thereof.
• the mutant comprises a mutation in a sequence corresponding to a Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues 89-95 of SEQ ID NO. 1, wherein The mutation is selected from the group consisting of a substitution, deletion or addition of one or several amino acid residues or a combination thereof, wherein the mutation results in a decrease or elimination of the ATPase activity of the mutant.
• the sequence of the mutant corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues 89-95 of SEQ ID NO. 1 is partially or
• the endostatin mutant of the invention comprises the following mutations: (a) the Gly amino acid residue corresponding to position 89 of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of an uncharged amino acid or an aromatic Or deleted; or (b) the Gly amino acid residue corresponding to position 92 of SEQ ID NO. 1 is substituted or deleted from an uncharged amino acid; or (c) corresponds to the first of SEQ ID NO.
• the Lys amino acid residue at position 95 is substituted or deleted by an amino acid selected from a positively charged or uncharged amino acid; or (d) any combination of (a) to (c).
• the endostatin mutant of the present invention comprises the following mutations: (a) the Gly amino acid residue corresponding to position 89 of SEQ ID NO. 1 is substituted or deleted by an amino acid selected from Ala and Pro; (b) a Gly amino acid residue corresponding to position 92 of SEQ ID NO. 1 is substituted or deleted by Ala; or (c) a Lys amino acid residue corresponding to position 95 of SEQ ID NO. 1 is selected from Arg And amino acid substitutions or deletions of Gin; or (d) any combination of (a)-(c).
• the endostatin mutant of the invention comprises a sequence selected from the group consisting of SEQ ID NO. 6 - IK 13, 14, 15-27 and 30-31.
• the endostatin mutant of the invention comprises a sequence selected from the group consisting of: SEQ ID N0.6, SEQ ID ⁇ 10, SEQ ID N0.27 and SEQ ID NO.
• the above-described endostatin mutant of the present invention is a mutant of human endostatin.
• the present invention also provides a pharmaceutical composition comprising the endostatin mutant of the present invention as described above.
• the endostatin may be covalently linked to a PEG molecule.
• the molecular weight of the PEG molecule is, for example, 5-40 kD, such as 5-20 kD, or 20-40 kD, preferably the molecular weight of the PEG molecule is 20 kD, for example 20 kD monomethoxy polyethylene glycol For example, monomethoxy polyethylene glycol propionaldehyde (mPEG-ALD).
• the PEG molecule is covalently linked to the N-terminal alpha amino group of the endostatin.
• the present invention also provides a method of treating a tumor comprising administering to a tumor patient an endostatin mutant of the present invention as described above or a pharmaceutical composition of the present invention as described above.
• the present invention also relates to the use of an endostatin mutant as described above for the preparation of a medicament for treating a neovascular related disease.
• the neovascular related disease is a tumor.
• Endostatin was cloned from the cDNA of human hepatoma cell line A549 and ligated into the pET30a plasmid.
• the 5'-end primer used for gene amplification is GGAATTCCATATGCACAGCCACCGCGACTTC, and the end-end bow is CCGCTCGAGT TACTTGGAGGCAGTCATGAAGCTG.
• the endonucleases are Ndel and XhoI, respectively.
• Example 2 Construction of an ES or Endu mutant strain with ATP binding site mutation
• the ATP binding site of wild-type human ES was mutated, and the specific method and the upstream and downstream primers and transformation methods were the same as those in Example 1.
• the mutant numbers are as follows:
• ES003 is taken as an example to describe the expression and preparation method of ES and its mutant and Endu mutant as follows: ES and its mutant strains were incubated in LB medium for overnight incubation and then inoculated into 5L fermentor. Fermentation was carried out (Sartorius), and IPTG induction was added as appropriate, and the cells were collected after about 4 hours of culture (Fig. 2A). The cells were resuspended in buffer and thoroughly crushed by a high-pressure homogenizer, and repeatedly crushed three times, each time being centrifuged to leave a precipitate.
• the prepared sample or control sample was added to a final concentration of 500 ⁇ M, and placed in a 37 ° C water bath for 30 min, and then quenched in an ice bath for 5 min.
• the sample processing of the ES and its variants was performed in the same manner as the first group and in parallel with the first group.
• the two groups of samples are respectively diluted to appropriate multiples, and sequentially added to a 96-well microtiter plate, using a Malachite Green Phosphate Assay Kits (BioAssay Systems), and passed through a microplate reader (Multiskan mk3).
• ES, Endu and their mPEG modified products can significantly reduce ATP content in human vascular endothelial cell whole cell homogenate, thereby exerting ATPase activity.
• human vascular endothelial cells are first collected, and the cells are lysed into a whole cell lysis component in the form of a solution using a cell lysate, and the precipitate, impurities, and fragments of the cell homogenate are removed by centrifugation at a low temperature (the above operation is performed on ice).
• the cells were lysed into four groups and treated differently.
• the method of grouping was as follows. The first group: the negative control group, adding an equal volume of protein-free buffer; the second group, adding ES (50 g / mL) treatment; the third group, adding ES (100 g / mL) treatment; the fourth group, adding ES (200 g/mL) treatment.
• polyethylene glycol modified ES can also significantly decompose and reduce ATP levels in human vascular endothelial cell lysing fraction, only at the same dose of ES and mPEG-ES (respectively When 50, 100, 200 g/mL was added and the treatment time was the same, the activity of mPEG-ES to degrade ATP was slightly lower than that of ES (Fig. 4A).
• the ES may also be replaced with a protein having the same mechanism of action as ES or a variant thereof, Endu. Similar results were observed in a parallel comparison of Endu and its mPEG-modified product (mPEG-Endu) (i.e., mPEG-ALD, 20 kDa modified on the N-terminal with MGGSHHHHH additional amino acids).
• mPEG-Endu mPEG-modified product
• the whole cell lysate fraction of human vascular endothelial cells was obtained by the same experimental method as described in the present example, and divided into seven groups and treated differently.
• the treatment grouping method was as follows.
• the first group negative control group, no treatment; the second group, negative control group, treated with bovine serum albumin BSA (100 g/mL), BSA is a known protein without ATPase activity, often used as Negative control protein in this type of experiment; the third group, the positive control group, was treated with porcine myosin (100 g/mL), a known protein with high ATPase activity.
• the fourth group added ES (100 g / mL) treatment; the fifth group, added mPEG-ES (100 g / mL) treatment; the sixth group, added Endu (100 g / mL) treatment; Seven groups were treated with mPEG-Endu (100 g/mL).
• mPEG-ES the native sequence ES has the highest ATPase activity, close to Myosin; mPEG-ES has the second highest ATPase activity, slightly lower than ES; Endu and mPEG-Endu ATPase activity was lower (Fig. 4B).
• Example 6 Evaluation of ATPase activity is a convenient, accurate, and reproducible method for measuring the activity of ES.
• ES, Endu, mPEG-ES and mPEG-Endu were diluted with sample dilution in a bath condition to form a series of concentration gradient samples to be tested (specific concentrations are shown in Figure 5).
• the diluted sample was added to a 96-well microtiter plate, and each sample was examined for OD 63 using a Malachite Green Phosphate Assay Kits (BioAssay Systems). Absorbance value. Calculate the dilution based on the dilution factor of the sample After the sample concentration, and calculate the corresponding A OD 63 . .
• a OD 630 S1 (OD 630 )- S2 (OD 630 )
• Example 5 Human vascular endothelial cells were collected, and the cells were lysed into a whole cell lysis component in the form of a solution using a cell lysate, and the precipitate, impurities and fragments of the cell homogenate were removed by centrifugation at a low temperature; The lysis components are divided into arrays and processed differently.
• the processing grouping method is as follows.
• Group 1 Negative control group, no ES (addition of equal buffer solution); Group 2, ES (100 g/mL) treatment; Group 3, add mouse-derived endostatin MM (100 g /mL) treatment; the fourth group, added ES mutant ES003 (100 g / mL) treatment; the fifth group, added ES mutant ES006 (100 g / mL) treatment; the sixth group, added ES mutant ES007 (100 g/mL) treatment; Group 7, was treated with ES mutant ES008 (100 g/mL).
• the ATP content in the homogenate of each group was detected using an ATP bioluminescence assay kit Sigma-Aldrich.
• HMEC Human microvascular endothelial cells
• the same concentration of ES (20 g/mL) was added to the upper and lower layers of the basket.
• the cells were allowed to migrate by incubating for 6 hours at 37 ° C and 5% CO 2 .
• glutaraldehyde fixation and crystal violet staining 5 magnified fields of view were randomly selected for each well, and the number of cells that completely migrated through the membrane to the underlying layer was calculated and averaged, and cell migration was calculated compared with the control group.
• the number of cases decreased (ie, the inhibition rate of each histone).
• Each set was paralleled with three wells and the experiment was repeated at least twice independently.
• endothelial cell HMEC was divided into the following groups to be treated differently.
• Group 1 Negative control group, no ES (addition of equal buffer solution);
• Group 3, add mouse-derived endostatin MM (20 g /mL) treatment;
• the fourth group added ES mutant ES003 (20 g / mL) treatment;
• the fifth group added ES mutant ES006 (20 g / mL) treatment;
• the sixth group added ES mutant ES007 (20 g/mL) treatment;
• Group 7 was treated with ES mutant ES008 (20 g/mL).
• the results showed that the activity of MM, mutants ES003, ES006, ES007, and ES008 to inhibit endothelial cell migration was significantly increased compared with ES (Fig. 8A).
• Example 1 Mutating the ATP-binding motif of wild-type ES and its surrounding sequences, To mutants with reduced ATP activity
• Example 12 Effect of ES mutants on migration of HMEC cells
• the cell migration assay was evaluated using the Transwell Assay method described in Example 9. Since many mutant proteins inhibit the activity of endothelial cell migration significantly, in order to more clearly reflect the difference in activity between each mutant protein, this example can still see significant inhibition by treating cells with a reduced dose of 5 g/mL. effect.
• the experimental results are shown in Figures 43-47. In addition to the lowering of ATPase activity of Z103, Z104, ZN3 and ZN4, the activity of inhibiting endothelial cell migration was also decreased. All other mutants showed comparable or significantly increased activity of inhibiting endothelial cell migration with ES, in line with ATPase. The activity is inversely related to the activity of inhibiting endothelial cell migration.
• Example 13 Inhibitory effect of Endostatin mutant on tumor growth of non-small cell lung cancer A549 cells at the animal level
• this experiment used a reduced dose of 12 mg / kg to treat tumor-bearing mice (usually 24 mg / kg) o
• Group 1 Negative control group, no drug treatment, Only the same amount of normal saline was injected; the second group, the mPEG-ES administration group, was treated with mPEG-ES; the third group, the M003 administration group, was treated with M003; the fourth group, the M007 administration group, The M007 administration treatment was carried out; the fifth group, the MZ101 administration group, was subjected to MZ101 administration treatment.
• the results of the tumor volume growth assay showed (as shown in Figure 48A) that compared with the tumor volume of the first group of controls without drug treatment: the tumor volume inhibition rate of the second group of mPEG-ES administration was 45%; The tumor volume inhibition rate of the three groups of M003 and the fourth group of M007 was similar to that of mPEG-ES; the tumor volume inhibition rate of the fifth group of MZ101 administration was 71.2%, and the tumor volume of this group was the smallest. The drug has the highest tumor inhibition rate.
• the tumors of the tumor-bearing nude mice were taken out for weighing (as shown in Fig. 48B), and the inhibitory effect of each group of drug treatment on tumor weight was consistent with the results of the tumor volume determination experiment.
• the tumor weight inhibition rate of the second group of MS03 administration was 42%
• the tumor weight inhibition rate of the third group of M003 and the fourth group of M007 administration and mPEG-ES was 64%, and the tumor weight of this group was the smallest and the drug inhibition rate was the highest.
• the results of this example demonstrate that Endostatin mutants at a dose of 12 mg/kg/week have a good inhibitory effect on tumor growth in tumor-bearing animal experiments.
• the inhibition rate of mPEG-ES is about 40%; the inhibition rate of M003 and M007 is close to and slightly lower than that of mPEG-ES; the anti-tumor effect of MZ101 is better than that of mPEG-ES, the best effect and the highest tumor inhibition rate (about 60-70%).

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Medicinal Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Immunology (AREA)
• Biophysics (AREA)
• Gastroenterology & Hepatology (AREA)
• Epidemiology (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• General Engineering & Computer Science (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Analytical Chemistry (AREA)
• Physics & Mathematics (AREA)
• Toxicology (AREA)
• Biomedical Technology (AREA)
• Oncology (AREA)
• Cardiology (AREA)
• Heart & Thoracic Surgery (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Enzymes And Modification Thereof (AREA)

Priority Applications (10)

Applications Claiming Priority (2)

Publications (1)

Family

ID=47831548

Family Applications (1)

Country Status (9)

Cited By (3)

Families Citing this family (4)

Citations (5)

Family Cites Families (4)

• 2012
  • 2012-09-10 CN CN201280078261.4A patent/CN108291248B/zh active Active
  • 2012-09-10 CA CA2848118A patent/CA2848118C/en active Active
  • 2012-09-10 RU RU2014113924/10A patent/RU2014113924A/ru not_active Application Discontinuation
  • 2012-09-10 WO PCT/CN2012/081210 patent/WO2013034116A1/zh not_active Ceased
  • 2012-09-10 AU AU2012306826A patent/AU2012306826B2/en active Active
  • 2012-09-10 US US14/343,694 patent/US10647968B2/en active Active
  • 2012-09-10 JP JP2014528847A patent/JP6336389B2/ja active Active
  • 2012-09-10 EP EP12830317.9A patent/EP2754718B1/en active Active
  • 2012-09-10 CN CN202410186085.0A patent/CN117987505A/zh active Pending
• 2014
  • 2014-03-09 IL IL231419A patent/IL231419A0/en active IP Right Grant

Patent Citations (6)

Non-Patent Citations (28)

Also Published As

Similar Documents

Legal Events