WO2013003350A2 - Microrna biomarkers indicative of alzheimer's disease - Google Patents
Microrna biomarkers indicative of alzheimer's disease Download PDFInfo
- Publication number
- WO2013003350A2 WO2013003350A2 PCT/US2012/044202 US2012044202W WO2013003350A2 WO 2013003350 A2 WO2013003350 A2 WO 2013003350A2 US 2012044202 W US2012044202 W US 2012044202W WO 2013003350 A2 WO2013003350 A2 WO 2013003350A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- mirna
- subject
- alzheimer
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- Alzheimer's Disease is a progressive disease of the human central nervous system. It is manifested by dementia, typically in the elderly, and symptoms include disorientation, loss of memory, difficulty with language, calculation, or visual- spatial skills, and by psychiatric manifestations. Alzheimer's Disease is associated with degenerating neurons in several regions of the brain. The neuropathology of Alzheimer's Disease is characterized by the presence of amyloid plaques, neurofibrillary tangles, synaptic loss and selective neuronal cell death. Amyloid plaques result from abnormal levels of extracellular amyloid beta peptide, while neurofibrillary tangles are associated with the presence of intracellular hyperphosphorylated tau protein.
- Symptoms typically first manifest clinically with a decline in memory followed by deterioration in other cognitive functions, and by abnormal behavior. Approximately 24 million people worldwide have dementia, of which the majority (-60%) is due to Alzheimer's Disease (Ferri CP. et al. (2005) Lancet 366(9503):2112-2117). More than 5 million Americans are estimated to have Alzheimer's Disease, and it is projected that this number will increase to 14.3 million by mid-century, representing a 350 percent increase from 2000. The increasing number of dementia patients in the developed world will place an enormous burden on society and the health care system.
- Early diagnosis is an essential step in the treatment of Alzheimer's Disease, as early diagnosis allows subjects to receive drugs that may slow disease progression.
- Alzheimer's Disease is currently diagnosed using a combination of clinical criteria, which may include a neurological exam, mental status tests, and brain imaging.
- a diagnosis of Alzheimer's Disease is often made by eliminating other dementias. Based on these criteria, an accurate diagnosis can be difficult, especially for patients having mild or early-stage Alzheimer's Disease.
- An unambiguous diagnosis may be made by examining the pathology of brain tissue, but this is only feasible posthumously.
- the present invention provides novel miRNA biomarkers which are indicative of Alzheimer's Disease, and which may be used to accurately diagnose Alzheimer' s Disease in a subject.
- biomarkers include miR- 191, miR- 15b, miR- 142-3p, Let-7g, Let-7d, miR-301a and miR-545.
- the methods entail detection of extracellular, circulating miRNAs in a suitable sample, preferably blood, plasma, serum, urine, or saliva.
- the invention provides a method of diagnosing Alzheimer's Disease in a subject by determining the level of at least one miRNA in a sample containing circulating miRNA derived from the subject, wherein the at least one miRNA is miR- 191, miR- 15b, miR- 142-3p, Let-7g, Let-7d, or combinations thereof, and wherein a difference in the level of the at least one miRNA versus that in a normal subject as determined relative to a suitable control is indicative of Alzheimer's Disease in the subject.
- the method includes determining the level of at least one miRNA in a sample containing circulating miRNA derived from the subject, wherein the at least one miRNA is miR- 191, miR- 15b, miR- 142-3p, Let-7g, Let- 7d, or combinations thereof, and wherein a decrease in the level of the at least one miRNA relative to a control is indicative of Alzheimer's Disease in the subject.
- the method may further comprise providing a diagnosis that the subject has or does not have Alzheimer' s Disease based on the level of at least one miRNA in the sample.
- the method may further comprise correlating a difference in the level or levels of at least one miRNA relative to a suitable control with a diagnosis of Alzheimer's Disease in the subject.
- the method comprises determining the level of one miRNA, e.g. , miR- 191, miR- 15b, miR- 142-3p, Let-7g or Let-7d, in the sample, wherein the difference in the level of the miRNA versus that in a normal subject is a decrease.
- the method comprises determining the level of two or more miRNAs in the sample.
- the method may further comprise determining the level of miR-301a, miR-545, or miR-301a and miR-545 in the sample.
- At least one miRNA can be selected from miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d, or combinations thereof, and optionally, at least one mRNA can be selected from miR-301a, miR-545, or miR-301a and miR-545.
- the method involves determining the level of one of the following combinations of miRNAs: miR-545, let7g, and miR-15b; miR-15b and miR-545; miR-301a, miR-545, let-7g and miR-15b; miR-191 and miR-15b; Let-7g and miR-15b; miR-191, miR-301a, and miR- 545; miR-301a, let-7g, and miR-15b; and miR-191, miR-301a, miR-545, and miR-15b.
- the method may comprise determining the levels of two or more miRNAs in a sample containing circulating miRNA from the subject, comparing the levels of the two or more miRNAs in the sample to a set of data representing levels of the same miRNAs present in normal subjects and subjects having Alzheimer's Disease, and diagnosing the subject as having or not having Alzheimer's
- the two or more miRNAs may include the following combinations: miR-545, let7g, and miR-15b; miR-15b and miR- 545; miR-301a, miR-545, let-7g and miR-15b; miR-191 and miR-15b; Let-7g and miR- 15b; miR-191, miR-301a, and miR-545; miR-301a, let-7g, and miR-15b; and miR-191, miR-301a, miR-545, and miR-15b.
- the method may optionally include performing at least one additional test to facilitate the diagnosis of Alzheimer's Disease.
- the additional test may be one or more of the mini-mental state examination (MMSE), the mini-cog test, the ADAS -cog test, and the clock-drawing test.
- additional testing may include detecting or assessing at least one additional biomarker for
- the method may optionally include administering a therapeutically effective amount of at least one Alzheimer's therapeutic to the subject.
- the Alzheimer's therapeutic may be Razadyne ® (galantamine), Exelon ® (rivastigmine), or Aricept ® (donepezil).
- the Alzheimer's therapeutic is donepezil or a pharmaceutically acceptable salt or ester thereof (e.g., donepezil hydrochloride).
- the level of a miRNA may be detected by any suitable method.
- a miRNA may be detected using an agent which specifically hybridizes to the miRNA.
- the level of a miRNA may be detected using amplification methods, hybridization methods, and/or sequencing methods.
- the level of miRNA is detected using quantitative PCR.
- the invention provides a method of diagnosing Alzheimer's Disease in a subject, comprising measuring the level of at least one miRNA in a blood- derived sample from the subject, wherein the at least one miRNA is miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d, or combinations thereof, and correlating a difference in the level or levels in the subject relative to a suitable control with a diagnosis of Alzheimer's Disease in the subject.
- the method may further comprise measuring the level of miR-301a, miR-545, or miR-301a and miR-545, in the sample.
- the invention provides a method of monitoring the course of
- the method may further comprise measuring the level of miR-301a, miR-545, or miR-301a and miR-545, in the samples.
- the invention provides a method of treating Alzheimer' s
- the at least one miRNA is miR- 191, miR- 15b, miR-142-3p, Let-7g, Let-7d, or combinations thereof.
- the method may optionally further include determining the level of miR-301a, miR-545, or miR-301a and miR-545, in the sample.
- the invention provides a method of treating a subject having Alzheimer's Disease, by identifying a subject having Alzheimer' s Disease in which the level of at least one miRNA in a sample containing circulating miRNA from the subject is different (e.g. , decreased) relative to a suitable control, and administering a
- the at least one miRNA is miR- 191, miR- 15b, miR-142-3p, Let-7g, Let-7d, or combinations thereof.
- the method may optionally include identifying a subject in which the level of miR-301a, miR-545, or miR-301a and miR-545, is also different (e.g. , decreased) in the sample relative to a suitable control.
- the Alzheimer' s therapeutic may be Razadyne ® (galantamine), Exelon ® (rivastigmine), or Aricept ® (donepezil).
- the Alzheimer' s therapeutic is donepezil or a pharmaceutically acceptable salt or ester thereof (e.g., donepezil hydrochloride).
- the invention provides a kit for diagnosing Alzheimer' s Disease in a subject, containing an agent that selectively detects the presence of at least one miRNA in a sample containing circulating miRNAs from a subject, wherein the at least one miRNA is miR-191, miR- 15b, miR- 142-3p, Let-7g, Let-7d, or combinations thereof, and instructions for determining the level of said at least one miRNA, wherein a difference in the level of the at least one miRNA versus that in a normal subject as determined relative to a suitable control is indicative of Alzheimer' s Disease in the subject.
- kit may optionally contain an agent that selectively detects the presence of at least one additional miRNA in the sample, wherein the additional miRNA is miR- 301a, miR-545, or miR-301a and miR-545.
- the agent specifically hybridizes to a miRNA.
- the subject may be a mammal, for example, a human.
- the difference in the level of at least one miRNA relative to a suitable control may be determined by executing a software classification algorithm.
- the sample may be a bodily fluid, for example, blood, lymph, urine, or saliva.
- the sample may be a cell-free sample and/or a microvesicle-free sample.
- the sample is plasma.
- the sample is serum.
- said miRNA is (a) an miRNA other than miR-191, (b) an miRNA other than miR-15b, (c) an miRNA other than miR-142-3p, (d) an miRNA other than Let-7g, and/or (e) an miRNA other than Let-7d.
- the miRNA is (a) an miRNA other than miR-15b, and/or (b) an miRNA other than miR-191.
- Figures 1A and IB Scatter plots of normalized miRNA expression from Cohort 1 (20 Alzheimer's Disease (AD) or Mild Cognitive Impairment (MCI) patients (11 AD; 9 MCI) and 20 Normal Control (NC) patients) using nCounter miRNA assay.
- AD Alzheimer's Disease
- MCI Mild Cognitive Impairment
- NC Normal Control
- Figure 2 Scatter plots of linear fold change values, normalized to the average NC values of the individual candidate miRNA biomarkers from Cohort 1 (20 AD or MCI patients and 20 NC patients) using TaqMan RT-qPCR.
- Figure 3 Scatter plots of linear fold change values, normalized to the average control values of the individual candidate miRNA biomarkers from Cohort 2 (20 AD and 17 NC patients) using TaqMan RT-qPCR.
- Table 1 Available details of patients in Cohort 1, including diagnosis, age, sex, MMSE scores and visit numbers, as obtained from PrecisionMed, Inc.
- Table 2 Sequence and miRBASE accession numbers of miRNA biomarkers and miRNAs used for normalization.
- Table 3 Correlation of average fold-change values for candidate miRNA biomarkers between Nanostring and TaqMan platforms for Cohort 1 samples (20 AD or MCI (11 AD; 9 MCI) and 20 NC).
- Table 4 Relative Ct value data derived from TaqMan qPCR using a subset of Cohort 1 samples (11 AD and 20 NC); data was used to generate signature patterns of candidate miRNA biomarkers to differentiate between AD and NC patients.
- Table 5 Available details of patients in Cohort 2, including diagnosis, age, sex, MMSE scores and visit numbers, as obtained from PrecisionMed, Inc.
- Table 6 Correlation of average fold-change values (normalized to average Control values) for candidate miRNA biomarkers between Cohort 1 and Cohort 2 using TaqMan RT-qPCR miRNA assay.
- Table 7 Relative Ct value data derived from TaqMan qPCR using Cohort 2 samples (20 AD and 17 NC), which was used as input for the algorithm to predict AD and NC patient status using signatures derived from Cohort 1 data (Table 4).
- Table 8A-8C Candidate miRNA biomarker signatures indicative of Alzheimer's
- Table 9A-9B Accuracy, Specificity, Sensitivity and AUC (Area Under the Curve) for miRNA biomarker signatures having an accuracy of >75 .
- Table 10 Accuracy, Specificity, Sensitivity and AUC (Area Under the Curve) for selected 8 miRNA signature combinations using Cohort 2 samples for prediction.
- the present invention provides novel miRNA biomarkers which are indicative of Alzheimer's Disease, and which may be used to accurately diagnose Alzheimer' s Disease in a subject.
- methods for monitoring the course of Alzheimer' s Disease, methods of treating a subject having Alzheimer' s Disease, and kits for diagnosing Alzheimer's Disease are provided.
- the methods entail detection of extracellular, circulating miRNAs in a suitable sample, preferably blood, plasma, serum, urine, or saliva.
- subject is intended to include animals which are capable of suffering from or afflicted with dementia associated with a CNS disorder, including
- neurodegenerative diseases such as Alzheimer's Disease, or any disorder involving, directly or indirectly, Alzheimer' s Disease.
- subjects include mammals, e.g. , humans, non-human primates, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals.
- the subject is a human, e.g. , a human suffering from, at risk of suffering from, or potentially capable of suffering from Alzheimer' s Disease or Alzheimer's Disease-associated dementia.
- the term "treat” is used herein to mean to relieve, reduce or alleviate at least one symptom of a disease in a subject.
- the term “treat” includes relieving, reducing, or alleviating cognitive impairment (such as impairment of memory and/or orientation) or impairment of global functioning (overall functioning, including activities of daily living) and/or slowing down or reversing the progressive deterioration in global or cognitive impairment. Accordingly, the term “treat” also encompasses delaying or preventing onset prior to clinical manifestation of a disease or symptom of a disease and/or reducing the risk of developing or worsening of a symptom of a disease.
- cognitive impairment such as impairment of memory and/or orientation
- global functioning overall functioning, including activities of daily living
- a “therapeutically effective amount” of a therapeutic agent, or combinations thereof, is an amount sufficient to treat disease in a subject. For example, for an
- a therapeutically effective amount can be an amount that has been shown to provide an observable therapeutic benefit compared to baseline clinically observable signs and symptoms of Alzheimer's disease.
- the invention relates to microRNA (“miRNA”) biomarkers found to be differentially present in biological samples derived from subjects having Alzheimer's Disease (AD), as compared with subjects who are "normal," i.e., subjects who do not have Alzheimer's Disease.
- An miRNA biomarker or set of miRNA biomarkers is differentially present between samples if the difference between the levels of expression of the miRNA biomarker or set of miRNA biomarkers in the samples is determined to be statistically significant. Common tests for statistical significance include, but are not limited to, t-test, ANOVA, Kniskal-Wallis, Wilcoxon, Mann- Whitney, and odds ratio.
- miRNA biomarkers, alone or in combination can be used to provide a measure of the relative risk that a subject has or does not have Alzheimer's Disease.
- miRNAs are small, non-coding RNAs that are involved in regulating gene expression through different mechanisms, including translational repression. miRNAs are initially transcribed from DNA as lengthy primary miRNA transcripts ("pri- miRNAs"), ranging in size from hundreds to thousands of nucleotides. Pri-miRNA is processed in the nucleus by the enzyme complex Drosha-DGCR8 to form stem-loop precursor miRNA ("pre-miRNA"). Pre-miRNA is transported to the cytoplasm by the protein exportin 5, where it is cleaved by the enzyme Dicer to generate mature
- miRNA expression has been reported in a wide array of cell and tissue types, and extracellularly, e.g., in biological fluids.
- miRNA biomarkers of Alzheimer' s Disease were discovered by comparing the level of expression of miRNAs in biological samples derived from subjects having
- Alzheimer's Disease with samples derived from subjects who are "normal,” i.e., subjects who do not have AD, and identifying miRNAs that are differentially present. Seven differentially present miRNA biomarkers were identified in this manner, which surprisingly were found to be indicative of Alzheimer's Disease when measured in plasma: miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a, and miR-545 (see
- These miRNA biomarkers can now be used to determine the Alzheimer's Disease status of a subject, for example, a subject whose Alzheimer's Disease status was previously unknown or who is suspected to be suffering from Alzheimer's disease. This may be accomplished by determining the level of one or more of miR-191, miR-15b, let- 7d, let-7g, miR-142-3p, miR-301a, and miR-545, or combinations thereof, in a biological sample derived from the subject. A difference in the level of one or more of these miRNA biomarkers as compared to that in a biological sample derived from a normal subject is an indication that the subject has Alzheimer's Disease.
- a subject having a difference in the level of one or more miRNA biomarkers as compared to a normal subject may have Alzheimer's Disease, including early-stage
- the level of one or more miRNA biomarkers may be used to diagnose Alzheimer's disease in a subject having symptoms characteristic of early-stage Alzheimer's Disease, also known as prodromal Alzheimer's Disease.
- Subjects having early-stage Alzheimer's Disease typically have MMSE scores of 24-30. Complaints regarding mild memory loss and a declining ability to perform complex tasks are often self-reported or reported by partners and/or caregivers.
- the level of one or more miRNA biomarkers may be used to diagnose Alzheimer' s Disease in a subject having symptoms characteristic of
- Moderately severe cognitive decline also referred to as “moderate” or “mid-stage” Alzheimer's disease.
- Moderately severe cognitive decline is characterized by major gaps in memory and the emergence of deficits in cognitive function. At this stage, some assistance with day-to-day activities is indicated.
- the level of one or more miRNA biomarkers may be used to diagnose Alzheimer' s Disease in a subject having symptoms characteristic of "severe cognitive decline,” also referred to as “moderate” or “mid-stage” Alzheimer' s disease.
- severe cognitive decline memory difficulties continue to worsen, significant personality changes may emerge, and affected individuals typically need extensive help with customary daily activities.
- the level of one or more miRNA biomarkers may be used to diagnose Alzheimer' s Disease in a subject having symptoms characteristic of "very severe cognitive decline,” also referred to as “severe” or “late-stage” Alzheimer' s disease. Late stage Alzheimer's disease or very severe cognitive decline is the final stage of the disease. Individuals typically lose the ability to respond to their environment, the ability to speak and, ultimately, the ability to control movement. (See, for example, http : //www . alz . or g) .
- the level of one or more miRNA biomarkers may be used to diagnose Alzheimer' s Disease in a subject having an MMSE score between 0 and 26, e.g. , an MMSE score of 0-10, an MMSE score of 0-20, an MMSE score of 0-26, etc.
- MMSE refers to the Mini-Mental State Examination used in the cognitive assessment community. During the MMSE, a physician or other medical professional asks a patient a series of questions that are designed to test a range of everyday mental skills.
- Questions commonly asked include, for example, remembering and repeating the names of three common objects, stating the year, date, season, and day of the week, counting backwards from 100 in increments of 7, spelling the word "world” backwards, naming familiar objects as the examiner points to them, identifying the location of the examiner's office, repeating a common phrase after it is stated by the Examiner, copying a picture of two interlocking shapes, and following a three-part series of instructions (e.g., pick up a piece of paper, fold it in half, and place it on the floor).
- the maximum score on the MMSE examination is 30 points.
- a patient with an MMSE score of 27-30 is considered to have no cognitive impairment
- a patient with an MMSE score of 21-26 is considered to have mild cognitive impairment
- a patient with an MMSE score of 11-20 is considered to have moderate cognitive impairment
- a patient with an MMSE score of 0-10 is considered to have severe cognitive impairment.
- a patient with an MMSE score of 0-16 is considered to have advanced (moderately severe to severe) Alzheimer's disease.
- the level of one or more miRNA biomarkers may be used to monitor the course of Alzheimer' s Disease in a subject.
- the Alzheimer's Disease status of a subject can change over time.
- the disease may worsen or improve over time.
- the level of one or more miRNA biomarkers may change, as detected in samples derived from the subject.
- the level of one or more of miR- 191, miR- 15b, let-7d, let-7g, miR- 142-3p, miR-301a, and/or miR- 545 decrease with the development of Alzheimer' s Disease.
- Alzheimer's Disease in a subject can be monitored by determining the level of one or more miRNA biomarkers in a first sample derived from a subject, and determining the level of one or more miRNA biomarkers in a second sample derived from a subject, where the second sample is obtained after the first sample.
- the levels in the second sample relative to the levels in the first sample are indicative of disease progression. For example, a decrease in the level of one or more of miR- 191, miR- 15b, let-7d, let-7g, miR- 142-3p, miR-301a, and/or miR-545 from the first sample to the second sample is indicative that the subject has developed Alzheimer' s Disease, or that the disease has worsened.
- the one or more miRNA biomarkers are miR- 191, miR- 15b, let-7d, let-7g, miR- 142-3p, and combinations thereof. Whether or not the level of a miRNA biomarker in a biological sample derived from a test subject is different from the level of the miRNA biomarker present in a normal subject may be ascertained by comparing the level of the miRNA biomarker in the sample from the test subject with a suitable control.
- a suitable control may be a biological sample derived from a known subject, e.g., a subject known to be a normal subject, or a subject known to have Alzheimer's Disease. If a suitable control is obtained from a normal subject, a statistically significant difference in the level of a miRNA biomarker in a test subject relative to the suitable control is indicative that the subject has Alzheimer's Disease. If a suitable control is obtained from a subject known to have
- Alzheimer's Disease levels comparable to or lower than such a control are indicative of Alzheimer's disease, reflective of a difference in the levels present in a sample from a normal subject.
- the difference in the level of a miRNA biomarker is a decrease.
- a suitable control may also be a reference standard.
- a reference standard serves as a reference level for comparison, such that test samples can be compared to the reference standard in order to infer the Alzheimer' s Disease status of a subject.
- a reference standard may be representative of the level of one or more miRNA biomarkers in a known subject, e.g. , a subject known to be a normal subject, or a subject known to have Alzheimer' s Disease.
- a reference standard may be representative of the level of one or more miRNA biomarkers in a population of known subjects, e.g., a population of subjects known to be normal subjects, or a population of subjects known to have Alzheimer' s Disease.
- the reference standard may be obtained, for example, by pooling samples from a plurality of individuals and determining the level of a miRNA biomarker in the pooled samples, to thereby produce a standard over an averaged population.
- Such a reference standard represents an average level of a miRNA biomarker among a population of individuals.
- a reference standard may also be obtained, for example, by averaging the level of a miRNA biomarker determined to be present in individual samples obtained from a plurality of individuals.
- Such a standard is also representative of an average level of a miRNA biomarker among a population of individuals.
- a reference standard may also be a collection of values each representing the level of a miRNA biomarker in a known subject in a population of individuals.
- test samples may be compared against such a collection of values in order to infer the Alzheimer's Disease status of a subject.
- the reference standard is an absolute value.
- test samples may be compared against the absolute value in order to infer the Alzheimer's Disease status of a subject.
- a comparison between the level of one or more miRNAs in a sample relative to a suitable control is made by executing a software classification algorithm.
- the skilled person can readily envision additional suitable controls that may be appropriate depending on the assay in question. The aforementioned suitable controls are exemplary, and are not intended to be limiting.
- a decrease in the level of one or more of miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a, and/or miR-545 in a biological sample derived from a test subject relative to a suitable control representative of the level of one or more of miR- 191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a, and/or miR-545, respectively in a normal subject will indicate that the test subject has Alzheimer's Disease.
- the suitable control is representative of the level of the miRNA biomarkers in a subject having Alzheimer's Disease
- generally levels of one or more of miR-191, miR-15b, let- 7d, let-7g, miR-142-3p, miR-301a, and/or miR-545 comparable to or lower than those of such a control are indicative of Alzheimer's Disease.
- the levels of two or more miRNA biomarkers are determined in a test subject, there may be a decrease in the level of one or more miRNA biomarkers, and no change or an increase in the level of one or more additional miRNA biomarkers, relative to a suitable control.
- a difference in the level of one or more of the miRNA biomarkers relative to a suitable control representative of the level of the miRNA biomarkers in a normal subject indicates that the test subject has Alzheimer's Disease. Determination of such a difference may be aided by the execution of a software classification algorithm, as described herein.
- the expression level of one or more miRNA biomarkers may be determined in a biological sample derived from a subject.
- a sample derived from a subject is one that originates from a subject. Such a sample may be further processed after it is obtained from the subject.
- RNA may be isolated from a sample.
- the RNA isolated from the sample is also a sample derived from a subject.
- a biological sample useful for determining the level of one or more miRNA biomarkers may be obtained from essentially any source, as miRNA expression has been reported in cells, tissues, and fluids throughout the body.
- levels of one or more biomarkers indicative of Alzheimer's Disease may be detected in a sample obtained from a subject non-invasively. Existing biomarkers for Alzheimer' s Disease (e.g., ⁇ 1-42 , p-tau, etc.) are often measured in a sample derived from
- CSF cerebrospinal fluid
- brain tissue cerebrospinal fluid
- lumbar puncture which is a painful procedure associated with risk factors including bleeding into the spinal canal, spinal headache, and infection.
- Biomarker detection on samples of brain tissue is currently impractical for diagnosis of Alzheimer' s Disease in a living subject, and is used primarily to posthumously confirm a diagnosis made by other means. Accordingly, it is preferred that the sample be obtained from a source other than brain tissue.
- the miRNA biomarkers described herein are indicative of Alzheimer's
- the biological sample used for determining the level of one or more miRNA biomarkers is a sample containing circulating miRNAs, e.g. , extracellular miRNAs.
- Extracellular miRNAs freely circulate in a wide range of biological material, including bodily fluids, , such as fluids from the circulatory system, e.g. , a blood sample or a lymph sample, or from another bodily fluid such as CSF, urine or saliva.
- the biological sample used for determining the level of one or more miRNA biomarkers is a bodily fluid, for example, blood, fractions thereof, serum, plasma, urine, saliva, tears, sweat, semen, vaginal secretions, lymph, bronchial secretions, CSF, etc.
- the sample is a sample that is obtained non-invasively.
- the sample is obtained from a bodily fluid other than CSF.
- Circulating miRNAs include miRNAs in cells (cellular miRNA), extracellular miRNAs in microvesicles (microvesicle-associated miRNA), and extracellular miRNAs that are not associated with cells or microvesicles (extracellular, non-vesicular miRNA).
- the biological sample used for determining the level of one or more miRNA biomarkers may contain cells.
- the biological sample may be free or substantially free of cells (e.g., a serum sample).
- the sample may likewise be free or substantially free of micro vesicles.
- a sample that is free or substantially free of microvesicles is one in which the microvesicle content of the sample is sufficiently low to avoid interfering with the ability to accurately determine the level of non- vesicular miRNAs in the sample.
- a sample containing circulating miRNAs e.g. , extracellular miRNAs, is a blood-derived sample.
- Exemplary blood-derived sample types include, e.g. , a plasma sample, a serum sample, a blood sample, etc.
- a sample containing circulating miRNAs is a lymph sample. Circulating miRNAs are also found in urine and saliva, and biological samples derived from these sources are likewise suitable for determining the level of one or more miRNA
- the level of one or more miRNA biomarkers in a biological sample may be determined by any suitable method. Any reliable method for measuring the level or amount of miRNA in a sample may be used.
- miRNA can be detected and quantified from a sample (including fractions thereof), such as samples of isolated RNA by various methods known for mRNA, including, for example, amplification-based methods (e.g., Polymerase Chain Reaction (PCR), Real-Time Polymerase Chain Reaction (RT-PCR), Quantitative Polymerase Chain Reaction (qPCR), rolling circle amplification, etc.), hybridization-based methods (e.g. , hybridization arrays (e.g. , microarrays), NanoString analysis, Northern Blot analysis, branched DNA (bDNA) signal
- amplification-based methods e.g., Polymerase Chain Reaction (PCR), Real-Time Polymerase Chain Reaction (RT-PCR), Quantitative Polymerase Chain Reaction (qPCR), rolling circle amplification, etc.
- hybridization-based methods
- exemplary techniques include ribonuclease protection assay (RPA) and mass spectroscopy.
- RPA ribonuclease protection assay
- RNA is converted to DNA (cDNA) prior to analysis.
- cDNA can be generated by reverse transcription of isolated miRNA using conventional techniques.
- miRNA reverse transcription kits are known and commercially available. Examples of suitable kits include, but are not limited to the mirVana TaqMan® miRNA transcription kit (Ambion, Austin, TX), and the TaqMan® miRNA transcription kit (Applied Biosystems, Foster City, CA). Universal primers, or specific primers, including miRNA- specific stem-loop primers, are known and commercially available, for example, from Applied Biosystems.
- miRNA is amplified prior to measurement. In other embodiments, the level of miRNA is measured during the amplification process.
- the level of miRNA is not amplified prior to measurement.
- amplification-based methods exist for detecting the level of miRNA nucleic acid sequences, including, but not limited to, PCR, RT-PCR, qPCR, and rolling circle amplification.
- Other amplification-based techniques include, for example, ligase chain reaction, multiplex ligatable probe amplification, in vitro transcription (IVT), strand displacement amplification, transcription-mediated amplification, RNA
- a typical PCR reaction includes multiple steps, or cycles, that selectively amplify target nucleic acid species: a denaturing step, in which a target nucleic acid is denatured; an annealing step, in which a set of PCR primers (i.e., forward and reverse primers) anneal to complementary DNA strands, and an elongation step, in which a thermostable DNA polymerase elongates the primers. By repeating these steps multiple times, a DNA fragment is amplified to produce an amplicon, corresponding to the target sequence.
- Typical PCR reactions include 20 or more cycles of denaturation, annealing, and elongation.
- a reverse transcription reaction (which produces a cDNA sequence having complementarity to a miRNA) may be performed prior to PCR amplification.
- Reverse transcription reactions include the use of, e.g., a RNA -based DNA polymerase (reverse transcriptase) and a primer.
- Kits for quantitative real time PCR of miRNA are known, and are commercially available. Examples of suitable kits include, but are not limited to, the TaqMan® miRNA Assay (Applied Biosystems) and the mirVanaTM qRT-PCR miRNA detection kit (Ambion).
- the miRNA can be ligated to a single stranded oligonucleotide containing universal primer sequences, a polyadenylated sequence, or adaptor sequence prior to reverse transcriptase and amplified using a primer complementary to the universal primer sequence, poly(T) primer, or primer comprising a sequence that is complementary to the adaptor sequence.
- custom qRT-PCR assays can be developed for determination of miRNA levels.
- Custom qRT-PCR assays to measure miRNAs in a biological sample e.g., a body fluid
- Custom miRNA assays can be tested by running the assay on a dilution series of chemically synthesized miRNA corresponding to the target sequence. This permits determination of the limit of detection and linear range of quantitation of each assay. Furthermore, when used as a standard curve, these data permit an estimate of the absolute abundance of miRNAs measured in biological samples.
- Amplification curves may optionally be checked to verify that Ct values are assessed in the linear range of each amplification plot.
- the linear range spans several orders of magnitude.
- a chemically synthesized version of the miRNA can be obtained and analyzed in a dilution series to determine the limit of sensitivity of the assay, and the linear range of quantitation.
- Relative expression levels may be determined, for example, according to the 2(- ⁇ C(T)) Method, as described by Livak et ah, Analysis of relative gene expression data using real-time quantitative PCR and the 2(- ⁇ C(T)) Method. Methods (2001) Dec;25(4):402-
- two or more miRNAs are amplified in a single reaction volume.
- multiplex q-PCR such as qRT-PCR, enables simultaneous amplification and quantification of at least two miRNAs of interest in one reaction volume by using more than one pair of primers and/or more than one probe.
- the primer pairs comprise at least one amplification primer that specifically binds each miRNA, and the probes are labeled such that they are distinguishable from one another, thus allowing simultaneous quantification of multiple miRNAs.
- Rolling circle amplification is a DNA-polymerase driven reaction that can replicate circularized oligonucleotide probes with either linear or geometric kinetics under isothermal conditions (see, for example, Lizardi et al., Nat. Gen. (1998) 19(3):225-
- Tandemly linked copies of a closed circle DNA molecule may be formed by using a single primer. The process can also be performed using a matrix- associated DNA. The template used for rolling circle amplification may be reverse transcribed. This method can be used as a highly sensitive indicator of miRNA sequence and expression level at very low miRNA concentrations (see, for example, Cheng et al., Angew Chem. Int. Ed. Engl. (2009) 48(18):3268-72; Neubacher et al, Chembiochem.
- miRNA may be detected using hybridization-based methods, including but not limited to hybridization arrays (e.g., microarrays), NanoString analysis, Northern Blot analysis, branched DNA (bDNA) signal amplification, and in situ hybridization.
- hybridization arrays e.g., microarrays
- NanoString analysis e.g., NanoString analysis
- Northern Blot analysis e.g., Northern Blot analysis
- branched DNA (bDNA) signal amplification e.g., branched DNA (bDNA) signal amplification
- in situ hybridization e.g., in situ hybridization.
- Microarrays can be used to measure the expression levels of large numbers of miRNAs simultaneously.
- Microarrays can be fabricated using a variety of technologies, including printing with fine-pointed pins onto glass slides, photolithography using pre- made masks, photolithography using dynamic micromirror devices, ink-jet printing, or electrochemistry on microelectrode arrays. Also useful are microfluidic TaqMan Low-
- Density Arrays which are based on an array of microfluidic qRT-PCR reactions, as well as related microfluidic qRT-PCR based methods.
- oligonucleotides e.g., 200+ 5'- amino- modified-C6 oligos
- human sense miRNA sequences are spotted on three- dimensional CodeLink slides (GE Health/ Amersham Biosciences) at a final concentration of about 20 ⁇ Mand processed according to manufacturer's recommendations.
- First strand cDNA synthesized from 20 ⁇ g TRIzol-purified total RNA is labeled with biotinylated ddUTP using the Enzo BioArray end labeling kit (Enzo Life Sciences Inc.).
- Hybridization, staining, and washing can be performed according to a modified Affymetrix Antisense genome array protocol.
- Axon B-4000 scanner and Gene-Pix Pro 4.0 software or other suitable software can be used to scan images. Non-positive spots after background subtraction, and outliers detected by the ESD procedure, are removed. The resulting signal intensity values are normalized to per-chip median values and then used to obtain geometric means and standard errors for each miRNA. Each miRNA signal can be transformed to log base 2, and a one-sample t test can be conducted. Independent hybridizations for each sample can be performed on chips with each miRNA spotted multiple times to increase the robustness of the data.
- Microarrays can be used for the expression profiling of miRNAs in diseases.
- RNA can be extracted from a sample and, optionally, the miRNAs are size- selected from total RNA.
- Oligonucleotide linkers can be attached to the 5' and 3' ends of the miRNAs and the resulting ligation products are used as templates for an RT-PCR reaction.
- the sense strand PCR primer can have a fluorophore attached to its 5' end, thereby labeling the sense strand of the PCR product.
- the PCR product is denatured and then hybridized to the microarray.
- a PCR product referred to as the target nucleic acid that is complementary to the corresponding miRNA capture probe sequence on the array will hybridize, via base pairing, to the spot at which the, capture probes are affixed. The spot will then fluoresce when excited using a microarray laser scanner.
- the fluorescence intensity of each spot is then evaluated in terms of the number of copies of a particular miRNA, using a number of positive and negative controls and array data normalization methods, which will result in assessment of the level of expression of a particular miRNA.
- Total RNA containing the miRNA extracted from a body fluid sample can also be used directly without size-selection of the miRNAs.
- the RNA can be 3' end labeled using T4 RNA ligase and a fiuorophore-labeled short RNA linker.
- Fluorophore- labeled miRNAs complementary to the corresponding miRNA capture probe sequences on the array hybridize, via base pairing, to the spot at which the capture probes are affixed. The fluorescence intensity of each spot is then evaluated in terms of the number of copies of a particular miRNA, using a number of positive and negative controls and array data normalization methods, which will result in assessment of the level of expression of a particular miRNA.
- microarrays can be employed including, but not limited to, spotted oligonucleotide microarrays, pre-fabricated oligonucleotide microarrays or spotted long oligonucleotide arrays.
- miRNAs can also be detected without amplification using the nCounter Analysis System (NanoString Technologies, Seattle, WA). This technology employs two nucleic acid-based probes that hybridize in solution (e.g., a reporter probe and a capture probe). After hybridization, excess probes are removed, and probe/target complexes are analyzed in accordance with the manufacturer's protocol. nCounter miRNA assay kits are available from NanoString Technologies, which are capable of distinguishing between highly similar miRNAs with great specificity.
- miRNAs can also be detected using branched DNA (bDNA) signal amplification (see, for example, Urdea, Nature Biotechnology (1994), 12:926-928). miRNA assays based on bDNA signal amplification are commercially available. One such assay is the QuantiGene ® 2.0 miRNA Assay (Affymetrix, Santa Clara, CA).
- Northern Blot and in situ hybridization may also be used to detect miRNAs. Suitable methods for performing Northern Blot and in situ hybridization are known in the art.
- miRNAs can be detected using Illumina ® Next Generation Sequencing (e.g., Illumina ® Next Generation Sequencing (e.g., Illumina ® Next Generation Sequencing (e.g., Illumina ® Next Generation Sequencing
- RNA sequencing-By-Synthesis or TruSeq methods using, for example, the HiSeq, HiScan, GenomeAnalyzer, or MiSeq systems (Illumina, Inc., San Diego, CA)). miRNAs can also be detected using Ion Torrent Sequencing (Ion Torrent Systems, Inc., Gulliford, CT), or other suitable methods of semiconductor sequencing.
- Mass spectroscopy can be used to quantify miRNA using RNase mapping.
- RNA endonucleases RNases
- RNase Tl RNA endonucleases having high specificity
- MS/MS tandem MS
- the first approach developed utilized the on-line chromatographic separation of endonuclease digests by reversed phase HPLC coupled directly to ESTMS. The presence of posttranscriptional modifications can be revealed by mass shifts from those expected based upon the RNA sequence. Ions of anomalous mass/charge values can then be isolated for tandem MS sequencing to locate the sequence placement of the
- MALDI-MS Matrix-assisted laser desorption/ionization mass spectrometry
- MALDI-based approaches can be
- the mass spectrometer is used to separate the miRNA.
- a system of capillary LC coupled with nanoESI-MS can be employed, by using a linear ion trap-orbitrap hybrid mass spectrometer (LTQ Orbitrap XL, Thermo Fisher Scientific) or a tandem-quadrupole time- of-flight mass spectrometer (QSTAR® XL, Applied Biosystems) equipped with a custom-made nanospray ion source, a Nanovolume Valve (Valco Instruments), and a splitless nano HPLC system (DiNa, KYA Technologies). Analyte/TEAA is loaded onto a nano-LC trap column, desalted, and then concentrated.
- LTQ Orbitrap XL linear ion trap-orbitrap hybrid mass spectrometer
- QSTAR® XL tandem-quadrupole time- of-flight mass spectrometer
- Analyte/TEAA is loaded onto a nano-LC trap column, desalted, and then concentrated.
- Intact miRNAs are eluted from the trap column and directly injected into a CI 8 capillary column, and chromatographed by RP-HPLC using a gradient of solvents of increasing polarity.
- the chromatographic eluent is sprayed from a sprayer tip attached to the capillary column, using an ionization voltage that allows ions to be scanned in the negative polarity mode.
- Additional methods for miRNA detection and measurement include, for example, strand invasion assay (Third Wave Technologies, Inc.), surface plasmon resonance (SPR), cDNA, MTDNA (metallic DNA; Advance Technologies, Saskatoon, SK), and single-molecule methods such as the one developed by US Genomics.
- Multiple miRNAs can be detected in a microarray format using a novel approach that combines a surface enzyme reaction with nanoparticle- amplified SPR imaging (SPRI).
- SPRI nanoparticle- amplified SPR imaging
- the surface reaction of poly(A) polymerase creates poly(A) tails on miRNAs hybridized onto locked nucleic acid (LNA) microarrays. DNA-modified nanoparticles are then adsorbed onto the poly(A) tails and detected with SPRI.
- This ultrasensitive nanoparticle-amplified SPRI methodology can be used for miRNA profiling at attamole levels.
- labels, dyes, or labeled probes and/or primers are used to detect amplified or unamplified miRNAs.
- detection methods are appropriate based on the sensitivity of the detection method and the abundance of the target.
- amplification may or may not be required prior to detection.
- miRNA amplification is preferred.
- a probe or primer may include standard (A, T or U, G and C) bases, or modified bases.
- Modified bases include, but are not limited to, the AEGIS bases (from Eragen Biosciences), which have been described, e.g., in U.S. Pat. Nos. 5,432,272, 5,965,364, and 6,001,983.
- bases are joined by a natural phosphodiester bond or a different chemical linkage.
- Different chemical linkages include, but are not limited to, a peptide bond or a Locked Nucleic Acid (LNA) linkage, which is described, e.g., in U.S. Pat. No. 7,060,809.
- LNA Locked Nucleic Acid
- oligonucleotide probes or primers present in an amplification reaction are suitable for monitoring the amount of amplification product produced as a function of time.
- probes having different single stranded versus double stranded character are used to detect the nucleic acid.
- Probes include, but are not limited to, the 5'-exonuclease assay ⁇ e.g., TaqManTM) probes (see U.S. Pat. No.
- stemless or linear beacons see, e.g., WO 9921881, U.S. Pat. Nos. 6,485,901 and 6,649,349), peptide nucleic acid (PNA) Molecular Beacons (see, e.g., U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (see, e.g. U.S. Pat. No. 6,329,144), non- FRET probes (see, e.g., U.S. Pat. No. 6,150,097), SunriseTM/AmplifluorBTM probes (see, e.g., U.S. Pat. No.
- one or more of the primers in an amplification reaction can include a label.
- different probes or primers comprise detectable labels that are distinguishable from one another.
- a nucleic acid, such as the probe or primer may be labeled with two or more
- a label is attached to one or more probes and has one or more of the following properties: (i) provides a detectable signal; (ii) interacts with a second label to modify the detectable signal provided by the second label, e.g., FRET (Fluorescent Resonance Energy Transfer); (iii) stabilizes hybridization, e.g., duplex formation; and (iv) provides a member of a binding complex or affinity set, e.g. , affinity, antibody- antigen, ionic complexes, hapten-ligand (e.g. , biotin-avidin).
- use of labels can be accomplished using any one of a large number of known techniques employing known labels, linkages, linking groups, reagents, reaction conditions, and analysis and purification methods.
- miRNAs can be detected by direct or indirect methods.
- a direct detection method one or more miRNAs are detected by a detectable label that is linked to a nucleic acid molecule.
- the miRNAs may be labeled prior to binding to the probe. Therefore, binding is detected by screening for the labeled miRNA that is bound to the probe.
- the probe is optionally linked to a bead in the reaction volume.
- nucleic acids are detected by direct binding with a labeled probe, and the probe is subsequently detected.
- the nucleic acids such as amplified miRNAs, are detected using FlexMAP Microspheres (Luminex) conjugated with probes to capture the desired nucleic acids.
- FlexMAP Microspheres Luminex
- Some methods may involve detection with polynucleotide probes modified with fluorescent labels or branched DNA (bDNA) detection, for example.
- nucleic acids are detected by indirect detection methods.
- a biotinylated probe may be combined with a streptavidin-conjugated dye to detect the bound nucleic acid.
- the streptavidin molecule binds a biotin label on amplified miRNA, and the bound miRNA is detected by detecting the dye molecule attached to the streptavidin molecule.
- the streptavidin-conjugated dye molecule comprises Phycolink® Streptavidin R-Phycoerythrin (PROzyme). Other conjugated dye molecules are known to persons skilled in the art.
- Labels include, but are not limited to: light-emitting, light-scattering, and light- absorbing compounds which generate or quench a detectable fluorescent,
- a dual labeled fluorescent probe that includes a reporter fluorophore and a quencher fluorophore is used in some embodiments. It will be appreciated that pairs of fluorophores are chosen that have distinct emission spectra so that they can be easily distinguished.
- labels are hybridization- stabilizing moieties which serve to enhance, stabilize, or influence hybridization of duplexes, e.g. , intercalators and intercalating dyes (including, but not limited to, ethidium bromide and SYBR-Green), minor-groove binders, and cross-linking functional groups (see, e.g. , Blackburn et al., eds. "DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996)).
- intercalators and intercalating dyes including, but not limited to, ethidium bromide and SYBR-Green
- minor-groove binders include, but not limited to, ethidium bromide and SYBR-Green
- cross-linking functional groups see, e.g. , Blackburn et al., eds. "DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996)).
- methods relying on hybridization and/or ligation to quantify miRNAs may be used, including oligonucleotide ligation (OLA) methods and methods that allow a distinguishable probe that hybridizes to the target nucleic acid sequence to be separated from an unbound probe.
- OLA oligonucleotide ligation
- HARP-like probes as disclosed in U.S. Publication No. 2006/0078894 may be used to measure the quantity of miRNAs.
- the probe after hybridization between a probe and the targeted nucleic acid, the probe is modified to distinguish the hybridized probe from the unhybridized probe. Thereafter, the probe may be amplified and/or detected.
- a probe inactivation region comprises a subset of nucleotides within the target hybridization region of the probe.
- a post-hybridization probe inactivation step is carried out using an agent which is able to distinguish between a HARP probe that is hybridized to its targeted nucleic acid sequence and the corresponding unhybridized HARP probe.
- the agent is able to inactivate or modify the unhybridized HARP probe such that it cannot be amplified.
- a probe ligation reaction may also be used to quantify miRNAs.
- MLPA Multiplex Ligation-dependent Probe Amplification
- MLPA probes have flanking PCR primer binding sites. MLPA probes are specifically amplified when ligated, thus allowing for detection and quantification of miRNA biomarkers.
- the miRNA biomarkers described herein can be used individually or in combination in diagnostic tests to assess the Alzheimer's Disease status of a subject.
- Disease status includes the presence or absence of Alzheimer's Disease.
- Disease status may also include monitoring the course of Alzheimer's Disease, for example, monitoring disease progression.
- additional procedures may be indicated, including, for example, additional diagnostic tests or therapeutic procedures.
- the power of a diagnostic test to correctly predict disease status is commonly measured in terms of the accuracy of the assay, the sensitivity of the assay, the specificity of the assay, or the "Area Under a Curve” (AUC), for example, the area under a Receiver Operating Characteristic (ROC) curve.
- accuracy is a measure of the fraction of misclassified samples. Accuracy may be calculated as the total number of correctly classified samples divided by the total number of samples, e.g., in a test population.
- Sensitivity is a measure of the "true positives” that are predicted by a test to be positive, and may be calculated as the number of correctly identified Alzheimer's Disease samples divided by the total number of Alzheimer's Disease samples.
- Specificity is a measure of the "true negatives” that are predicted by a test to be negative, and may be calculated as the number of correctly identified normal samples divided by the total number of normal samples.
- AUC is a measure of the area under a Receiver Operating Characteristic curve, which is a plot of sensitivity vs. the false positive rate (1- specificity). The greater the AUC, the more powerful the predictive value of the test.
- Other useful measures of the utility of a test include the "positive predictive value,” which is the percentage of actual positives who test as positives, and the "negative predictive value,” which is the percentage of actual negatives who test as negatives.
- the level of one or more miRNA biomarkers in samples derived from subjects having different Alzheimer's Disease statuses show a statistically significant difference of at least p ⁇ 0.05, e.g. , p ⁇ 0.05, p ⁇ 0.01, p ⁇ 0.005, p ⁇ 0.001, etc. relative to normal subjects, as determined relative to a suitable control.
- diagnostic tests that use miRNA biomarkers described herein individually or in combination show an accuracy of at least about 75%, e.g. , an accuracy of at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 99% or about 100%.
- diagnostic tests that use miRNA biomarkers described herein individually or in combination show a specificity of at least about 75%, e.g. , a specificity of at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 99% or about 100%.
- diagnostic tests that use miRNA biomarkers described herein individually or in combination show a sensitivity of at least about 75%, e.g., a sensitivity of at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 99% or about 100%.
- diagnostic tests that use miRNA biomarkers described herein individually or in combination show a specificity and sensitivity of at least about 75% each, e.g. , a specificity and sensitivity of at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 99% or about 100% (for example, a specificity of at least about 80% and sensitivity of at least about 80%, or for example, a specificity of at least about 80% and sensitivity of at least about 95%).
- Each biomarker listed in Table 2 is differentially present in biological samples derived from subjects having Alzheimer's Disease as compared with normal subjects, and thus each is individually useful in facilitating the determination of Alzheimer's Disease in a test subject.
- Such a method involves determining the level of the biomarker in a sample derived from the subject. Determining the level of the biomarker in a sample may include measuring, detecting, or assaying the level of the biomarker in the sample using any suitable method, for example, the methods set forth herein. Determining the level of the biomarker in a sample may also include examining the results of an assay that measured, detected, or assayed the level of the biomarker in the sample.
- the method may also involve comparing the level of the biomarker in a sample with a suitable control.
- a change in the level of the biomarker relative to that in a normal subject as assessed using a suitable control is indicative of the Alzheimer's Disease status of the subject.
- a diagnostic amount of a biomarker that represents an amount of the biomarker above or below which a subject is classified as having a particular Alzheimer's Disease status can be used. For example, if the biomarker is downregulated in samples derived from an individual having Alzheimer's Disease as compared to a normal individual, a measured amount below the diagnostic cutoff provides a diagnosis of Alzheimer's Disease.
- the individual miRNA biomarkers in Table 2 are downregulated in Alzheimer's Disease samples relative to samples obtained from normal individuals.
- adjusting the particular diagnostic cut-off used in an assay allows one to adjust the sensitivity and/or specificity of the diagnostic assay as desired.
- the particular diagnostic cut-off can be determined, for example, by measuring the amount of the biomarker in a statistically significant number of samples from subjects with different Alzheimer's Disease statuses, and drawing the cut-off at the desired level of accuracy, sensitivity, and/or specificity.
- the diagnostic cut-off can be determined with the assistance of a classification algorithm, as described herein.
- methods for diagnosing Alzheimer's Disease in a subject, by determining the level of at least one miRNA in a sample containing circulating miRNA from the subject, wherein a difference in the level of the at least one miRNA versus that in a normal subject (as determined relative to a suitable control) is indicative of Alzheimer's Disease in the subject.
- the at least one miRNA preferably includes one or more of miR-191, miR-15b, miR-142-3p, Let-7g, and Let-7d, and may optionally include miR-301a, miR-545, or miR-301a and miR-545.
- the present invention provides a method of determining the level of at least one miRNA in a sample containing circulating miRNA derived from the subject, wherein a decrease in the level of the at least one miRNA relative to a control is indicative of Alzheimer's Disease in the subject.
- the method may further comprise providing a diagnosis that the subject has or does not have Alzheimer's Disease based on the level of at least one miRNA in the sample.
- the method may further comprise correlating a difference in the level or levels of at least one miRNA relative to a suitable control with a diagnosis of Alzheimer's Disease in the subject.
- such a diagnosis may be provided directly to the subject, or it may be provided to another party involved in the subject's care.
- miRNA biomarkers While individual miRNA biomarkers are useful in diagnostic applications for Alzheimer's Disease, as shown herein, a combination of miRNA biomarkers may provide greater predictive value of Alzheimer's Disease status than the miRNA biomarkers when used alone. Specifically, the detection of a plurality of miRNA biomarkers can increase the accuracy, sensitivity, and/or specificity of a diagnostic test. Exemplary miRNA biomarkers and biomarker combinations are shown in Table 8A-8C. miRNA biomarkers and biomarker combinations demonstrating an overall accuracy of 75% are shown in Table 9A-9B. The invention includes the individual biomarkers and biomarker combinations as set forth in these tables, and their use in methods and kits described herein.
- RNAs preferably include one or more of miR-191, miR-15b, miR-142-3p, Let-7g, and Let-7d, and may optionally include miR- 301a, miR-545, or miR-301a and miR-545.
- Exemplary combinations of two or more miRNA biomarkers include, for example, miR-545, let7g, and miR-15b; miR-15b and miR-545; miR-301a, miR-545, let-7g and miR-15b; miR-191 and miR-15b; Let-7g and miR-15b; miR-191, miR-301a, and miR-545; miR-301a, let-7g, and miR-15b; and miR- 191, miR-301a, miR-545, and miR-15b.
- the set of data serves as a suitable control or reference standard for comparison with the sample from the subject.
- Comparison of the sample from the subject with the set of data may be assisted by a classification algorithm, which computes whether or not a statistically significant difference exists between the collective levels of the two or more miRNAs in the sample, and the levels of the same miRNAs present in normal subjects or subjects having
- data that are generated using samples can then be used to "train” a classification model.
- a "known sample” is a sample that has been pre-classified, e.g., classified as being derived from a normal subject, or from a subject having Alzheimer's Disease.
- the data that are derived from the spectra and are used to form the classification model can be referred to as a "training data set.”
- the classification model can recognize patterns in data derived from spectra generated using unknown samples.
- the classification model can then be used to classify the unknown samples into classes. This can be useful, for example, in predicting whether or not a particular biological sample is associated with a certain biological condition (e.g., diseased versus non-diseased).
- data for the training data set that is used to form the classification model can be obtained directly from quantitative PCR (for example, Ct values obtained using the AACt method), or from high-throughput expression profiling, such as microarray analysis (for example, total counts or normalized counts from a miRNA expression assay, e.g. , the nCounter miRNA expression assay).
- quantitative PCR for example, Ct values obtained using the AACt method
- high-throughput expression profiling such as microarray analysis (for example, total counts or normalized counts from a miRNA expression assay, e.g. , the nCounter miRNA expression assay).
- Classification models can be formed using any suitable statistical classification (or "learning") method that attempts to segregate bodies of data into classes based on objective parameters present in the data.
- Classification methods may be either supervised or unsupervised. Examples of supervised and unsupervised classification processes are described in Jain, "Statistical Pattern Recognition: A Review", IEEE Transactions on Pattern Analysis and Machine Intelligence, Vol. 22, No. 1, January 2000, the teachings of which are incorporated by reference.
- supervised classification training data containing examples of known categories are presented to a learning mechanism, which learns one or more sets of relationships that define each of the known classes. New data may then be applied to the learning mechanism, which then classifies the new data using the learned relationships.
- supervised classification processes include linear regression processes (e.g. , multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)), binary decision trees (e.g. , recursive partitioning processes such as CART— classification and regression trees), artificial neural networks such as back propagation networks, discriminant analyses (e.g., Bayesian classifier or Fischer analysis), logistic classifiers, and support vector classifiers (support vector machines).
- linear regression processes e.g. , multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)
- binary decision trees e.g. , recursive partitioning processes such as CART— classification and regression trees
- artificial neural networks such as back propagation networks
- discriminant analyses e.g
- the classification models that are created can be formed using unsupervised learning methods.
- Unsupervised classification attempts to learn classifications based on similarities in the training data set, without pre-classifying the spectra from which the training data set was derived.
- Unsupervised learning methods include cluster analyses. A cluster analysis attempts to divide the data into "clusters" or groups that ideally should have members that are very similar to each other, and very dissimilar to members of other clusters. Similarity is then measured using some distance metric, which measures the distance between data items, and clusters together data items that are closer to each other.
- Clustering techniques include the MacQueen's K-means algorithm and the Kohonen's Self-Organizing Map algorithm.
- the classification models can be formed on and used on any suitable digital computer.
- Suitable digital computers include micro, mini, or large computers using any standard or specialized operating system, such as a Unix, WindowsTM or LinuxTM based operating system.
- the training data set(s) and the classification models can be embodied by computer code that is executed or used by a digital computer.
- the computer code can be stored on any suitable computer readable media including optical or magnetic disks, sticks, tapes, etc., and can be written in any suitable computer programming language including C, C++, visual basic, etc.
- the learning algorithms described above can be used for developing classification algorithms for miRNA biomarkers for Alzheimer's disease.
- the classification algorithms can, in turn, be used in diagnostic tests by providing diagnostic values (e.g. , cut-off points) for biomarkers used singly or in combination.
- the level of miRNA biomarkers indicative of Alzheimer's Disease may be used as a stand-alone diagnostic indicator of Alzheimer' s Disease in a subject.
- the methods may include the performance of at least one additional test to facilitate the diagnosis of Alzheimer's Disease.
- other tests in addition to determining the level of one or more miRNA biomarkers in order to facilitate a diagnosis of Alzheimer' s Disease may be performed. Any other test or combination of tests used in clinical practice to facilitate a diagnosis of Alzheimer' s Disease may be used in conjunction with the miRNA biomarkers described herein.
- a clinician may perform mental status tests on a subject, in addition to determining the level of one or more miRNA biomarkers in a sample derived from the subject.
- Such tests may include, but are not limited to, the mini-mental state examination (MMSE), the mini-cog test, the ADAS-cog test, and/or a clock-drawing test. These tests are routinely used in clinical practice to facilitate a diagnosis of Alzheimer' s Disease.
- brain imaging tests may be performed on the subject, for example, an MRI or a CT scan. These tests are performed primarily to rule out other conditions that may cause symptoms similar to Alzheimer's Disease, such as tumors, strokes, or fluid in the brain.
- a neurological exam may be performed on the subject, in which conditions such as the subject's reflexes, coordination, muscle strength, eye movement, speech, and/or sensation are tested.
- the subject may also be screened for genetic factors indicating that a subject may have a heightened risk for developing Alzheimer's Disease.
- the subject may likewise be screened for the presence, absence, or level of at least one other biomarker indicative of
- the present invention further provides methods of treating such subjects identified to have Alzheimer's Disease. Accordingly, in one embodiment, the invention relates to a method of treating Alzheimer's Disease in a subject, comprising determining the level of at least one miRNA biomarker in a sample derived from the subject, wherein a difference in the level of at least one miRNA biomarker versus that in a normal subject as determined relative to a suitable control is indicative of Alzheimer's
- the invention relates to a method of treating a subject having Alzheimer's Disease, comprising identifying a subject having Alzheimer' s Disease in which the level of at least one miRNA biomarker in a sample derived from the subject is different (e.g., decreased) versus that in a normal subject as determined relative to a suitable control, and administering a therapeutically effective amount of an Alzheimer's therapeutic to the subject.
- Alzheimer's therapeutic includes, for example, substances approved by the U.S. Food and Drug Administration for the treatment of Alzheimer' s Disease. Such substances include, for example, Razadyne ® (galantamine), Exelon ® (rivastigmine), and Aricept ® (donepezil).
- the Alzheimer' s therapeutic is donepezil or a pharmaceutically acceptable salt or ester thereof (e.g., donepezil hydrochloride).
- the Alzheimer's therapeutics may be administered to a subject using a pharmaceutical composition.
- Suitable pharmaceutical compositions comprise an Alzheimer's therapeutic (or a pharmaceutically acceptable salt or ester thereof), and optionally comprise a pharmaceutically acceptable carrier, such as a pharmaceutical composition comprising galantamine, rivastigmine, donepezil or a pharmaceutically acceptable salt or ester of any of the foregoing (e.g., galantamine hydrobromide, rivastigmine tartrate, donepezil hydrochloride).
- these compositions optionally further comprise one or more additional therapeutic agents.
- the term "pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
- salts of amines, carboxylic acids, and other types of compounds are well known in the art.
- S.M. Berge, et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977), incorporated herein by reference.
- the salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or separately by reacting a free base or free acid function with a suitable reagent.
- a free base function can be reacted with a suitable acid.
- suitable pharmaceutically acceptable salts thereof may, include metal salts such as alkali metal salts, e.g. sodium or potassium salts; and alkaline earth metal salts, e.g. calcium or magnesium salts.
- ester refers to esters that hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof.
- Suitable ester groups include, for example, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl or alkenyl moiety advantageously has not more than 6 carbon atoms.
- the pharmaceutical compositions may additionally comprise a pharmaceutically acceptable carrier.
- carrier includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, suitable for preparing the particular dosage form desired.
- solvents diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, suitable for preparing the particular dosage form desired.
- compositions discloses various carriers used in formulating pharmaceutical compositions and known techniques for the preparation thereof.
- materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch;
- cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatine; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil, sesame oil; olive oil; corn oil and soybean oil; glycols; such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogenfree water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other nontoxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and
- compositions for use in the present invention may be formulated to have any concentration of the Alzheimer's therapeutic desired.
- the composition is formulated such that it comprises a therapeutically effective amount of the Alzheimer's therapeutic.
- kits for diagnosing Alzheimer's Disease status in a subject which kits are useful for determining the level of one or more of miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a, and miR-545, and combinations thereof.
- the one or more miRNAs are selected from the group consisting of miR-191, miR-15b, let-7d, let-7g, miR-142-3p.
- Kits may include materials and reagents adapted to selectively detect the presence of a miRNA or group of miRNAs diagnostic for Alzheimer's Disease in a sample derived from a subject.
- the kit may include a reagent that specifically hybridizes to a miRNA.
- Such a reagent may be a nucleic acid molecule in a form suitable for detecting the miRNA, for example, a probe or a primer.
- the kit may include reagents useful for performing an assay to detect one or more miRNAs, for example, reagents which may be used to detect one or more miRNAs in a qPCR reaction.
- the kit may likewise include a microarray useful for detecting one or more miRNAs.
- the kit may contain instructions for suitable operational parameters in the form of a label or product insert.
- the instructions may include information or directions regarding how to collect a sample, how to determine the level of one or more miRNA biomarkers in a sample, or how to correlate the level of one or more miRNA biomarkers in a sample with the Alzheimer's Disease status of a subject.
- the kit can contain one or more containers with miRNA biomarker samples, to be used as reference standards, suitable controls, or for calibration of an assay to detect the miRNA biomarkers in a test sample.
- the aim of this study was to generate miRNA profiles from the plasma fraction of human blood, and determine if there are significant differences in miRNA content and expression level between patients diagnosed with Alzheimer's (AD) and normal controls (NC).
- RNA samples were purchased from PrecisionMed, Inc. (Solano Beach, CA-USA). Cohort 1 contained samples from 11 AD patients, 9 Mild Cognitive Impairment (MCI) patients, and 20 NC patients. Age, sex, diagnosis, and mini-mental state examination (MMSE) scores for patients in Cohort 1 are provided in Table 1.
- Total RNA was extracted from plasma samples (1 mL), and spike-in synthetic miRNAs (Ath- 159a and Neg-A) were added to control for extraction efficiency and normalization, as described below.
- nCounter miRNA expression assay Novart Technologies, Seattle, WA-USA
- Post normalization and back-ground correction final linear counts were averaged for both AD/MCI and NC samples, and fold change values were determined.
- Candidate miRNAs were chosen which had at least a 1.5 fold difference between average expression values in AD/MCI and NC samples, and which had average normalized counts >200.
- miRNA 106a Hsa-miR-106a was identified as a potential endogenous control which showed minimum variation across all AD/MCI and NC samples.
- hsa-let-7d hsa-let- 7g, hsa-miR-15b, hsa- miR -126, hsa- miR -142-3p, hsa- miR -191, hsa- miR -301a, hsa- miR -453, hsa- miR -545, hsa- miR -563, hsa- miR -600, hsa- miR -1274a and hsa- miR -
- Candidate miRNA biomarkers identified using the high-throughput Nanostring platform were then validated using the stem-loop TaqMan RT-qPCR miRNA assay (Life Technologies).
- hsa- miR - 126 hsa- miR -453, hsa- miR -563, hsa- miR -600, hsa- miR -1274a and hsa- miR -1975.
- miRNA sequences and miRBase accession numbers are provided in Table 2.
- miR-191 was down-regulated in AD samples by -3.1 fold according to Nanostring analysis, while it was found to be down-regulated -3.7 fold by TaqMan analysis (see Table 3). This close trend was observed across all remaining miRNAs (miR-15b, let-7d, let-7g, miR-142-3p, miR- 301a and miR-545). All fold change values had a p-value ⁇ 0.005.
- 105(30): 10513-8 1 mL of human plasma was added to an equal amount of 2x denaturing buffer and then spiked with 10 ⁇ of 0.05 ⁇ Ath-159a and 40 pM of Neg-A (UUGUGGCGAGCGGAAUGGAAU) (synthetic miRNAs used for normalization and extraction efficiency Control). Phenol extraction was performed twice, and total RNA was finally eluted in 70 ⁇ of water following protocol recommendation (AM 1556). High-Throughput Expression Profiling of miRNAs
- RNA 45 ⁇ of purified total RNA was concentrated down to 9 ⁇ and used as template for the nCounter miRNA expression assay (Nanostring Technology, Seattle, WA-USA).
- the sample preparation was set up as recommended (Nanostring; C-0009-02) using 3 ⁇ of concentrated total RNA as the starting amount for all samples in triplicate. Since the amount of total RNA recovered was not enough to be reliably detected using standard spectra-based instruments such as the Nanodrop, an equal volume approach was adopted in which 3 ⁇ of concentrated total RNA was used as starting material for all Nanostring based assays (also utilized in Mitchell, P.S. et al. PNAS. 2008 Jul 29;105(30): 10513-8).
- the reactions were set up for an overnight hybridization for 16 hours at 65°C.
- the samples were processed through the nCounter Prep Station (Nanostring Technology, Seattle, WA-USA, v.20081003) as recommended by the manufacturer's protocol, followed by processing through the nCounter Digital Analyzer (Nanostring Technology, Seattle, WA-USA, v.20081009).
- the analyzer resolution was set at 600 FOVs.
- Data was downloaded and analyzed on Excel as recommended (nCounter Data Analysis guidelines). Briefly, the data was first normalized for lane to lane variation using the provided positive assay controls. This was followed by a global mean normalization by using the counts of the highest 100 miRNA expressers. Each normalized value was then checked to ensure that it was at least 2 SDs higher than the average of background signal recorded for that lane. Any value below that was converted to zero. Fold change values were calculated by taking the average of all AD/MCI and
- RNA-301a miRNA RT primers
- miR-301a miRNA RT primers
- miR-1975 miR-191, miR-15b
- miR-126 let-7g
- let-7d miR-545
- miR-1274 miR-142-3p
- miR-600 miR-453
- miR-563 miR-106a and ath-159a
- miRNA-specific primers and probes were purchased from Life Technologies.
- a 15 ⁇ RT reaction was set up containing 6 ⁇ of the RT primer pool, 0.3 ⁇ , dNTPS (100 mM), 3 ⁇ of Multiscribe RT (50 ⁇ / ⁇ 1), 1.5 ⁇ of the lOx
- RNAseIN 20 ⁇ / ⁇ 1 and water. All Reverse Transcription components were contained in the miRNA RT kit (Life Technologies; # 4366596). Three ⁇ of total RNA (1: 10 dilution) was added as template for each sample and the reaction was incubated on ice for 5 min followed by 30 min at 16°C, 30 min at 42°C, and 5 min at 85°C for enzyme inactivation. The reaction was then stored at 4°C. A second pool of pre-amplification primers was then created with each PCR primer probe (20x) for the same assays mixed at a final concentration of 0.2x in lx TE.
- a pre- amplification reaction was set up containing 2x Pre-amplification master mix (Life Technologies; # 4391128), 3.75 ⁇ of the custom pre-amplification primer pool and water (making up the reaction volume to 22.5 ⁇ ).
- 2.5 ⁇ of the RT product was then added and cycled through the pre-amplification program [95°C for 10 min, 55°C for 2 min, and 72°C for 2 min followed by 12 cycles of 95°C for 15 sec and 60°C for 4 min]. This was followed by a 99.9°C incubation for 10 min, and then the reaction was diluted by adding 175 ⁇ of O.lx TE (pH 8.0) and mixed by inversion.
- RT and pre- amplification primer pools were prepared using only the signature and normalization control specific primers (miR-301a, miR-191, miR-15b, let-7g, let-7d, miR-545, miR- 142-3p, miR-106a and ath-159a).
- miRN A- specific primers and probes were purchased from Applied Biosystems, under Cat. Nos. 000464 (miR-142-3p), 001289 (miR-545),
- the miRNAs identified and validated as having significantly different expression between AD and NC samples in Cohort 1 were selected for predictive model building.
- a sample code and description of the input files used to calculate the prediction accuracy, sensitivity, specificity and AUC numbers is set forth below.
- This code shows how to classify unknown samples as AD or Normal using a representative signature of three miRNAs ("miR-545",”let-7g”,”miR-15b").
- the code for performing a classification based on any combination of the 7 validated miRNAs would be similar, and it should be understood that signatures based on any combination of these 7 miRNAs may be used.
- the model based on Cohort 1 we can predict for any new sample if the individual from whom the sample was obtained is an AD individual, or a normal individual. In order to make a prediction for a new sample we need to determine the miRNA expression levels for each individual miRNA in the signature. Based on these values, the model will return the ("posteriori") probability that the new sample is from an individual having AD. The cutoff value of this probability determines the sensitivity and specificity of the model. For our predictions we determined accuracy, sensitivity and specificity at a threshold of 0.5 (that is, if the probability of a sample being AD is larger than 0.5, our model classified it as AD).
- Exemplary input files may be in the form of train.txt, validation.txt, train_an.txt and validation_an.txt.
- Train.txt is the file which contains the expression profile for Cohort 1 in a form of a matrix, where the rows are the samples and the columns are the miRNAs. The first row contains the names of the miRNAs and the first column the names of the samples.
- the "train_an.txt” file contains the annotation of the samples. There are two columns, where the first column contains the name of the sample and the second column the annotation of the samples ("normal” and "AD” in this case).
- the files "validation.txt” and “validation_an.txt” contains the data and annotation for Cohort 2 in exactly the same format.
- the variables prediction$class and prediction$posteri contains the predicted annotation and the corresponding probability of the samples from Cohort 2.
- Exemplary code which may be used to calculate the prediction accuracy, sensitivity, specificity and AUC numbers is as follows: read.file ⁇ - function(file,inv)
- train_an read . table (" train_an . txt " )
- validation_an as . factor (validation_an [ , 1 ] )
- train_an as . f actor(train_an [ , 1 ] )
- train_sp train [ , set]
- ldatrain lda((train_sp),train_an)
- validation_sp validation [ , set]
- sample code similar to that shown above may be used.
- other software code useful for prediction, or for calculating prediction accuracy, sensitivity, specificity and AUC from a data set may be used in place of the sample code described above.
- Example 3 miRNA Biomarkers Predict the Status of Subjects as Normal or as having Alzheimer's Disease
- the performance of a predictive model using all non-zero subsets of the 7 validated miRNAs (let-7d, let-7g, miR-15b, miR-142-3p, miR-191, miR-301a and miR- 545) as described in Example 2 was evaluated based on the classification results of human plasma samples from a second cohort containing 20 AD and 17 NC patients ("Cohort 2") obtained from PrecisionMed, Inc. Age, sex, diagnosis, and MMSE scores for patients in Cohort 2 are provided in Table 5. The performance of the predictive model was evaluated based on accuracy, specificity, sensitivity and area under curve (AUC) numbers.
- AUC area under curve
- RNA extraction was carried out using only 500 ⁇ of plasma from each Cohort 2 sample as described in Example 1, followed by TaqMan RT-qPCR analysis. We achieved significant correlation with average fold changes between the two cohorts for the signature miRNAs being very closely replicated, and with excellent p-values (Figure 3, Table 6).
- the sensitivity characterizes the predictive models' ability to identify true positives, which in this study was calculated as the number of correctly identified AD samples divided by the total number of AD samples. On the other hand, the specificity was the number of correctly classified NC samples (true negatives) divided by the total number of
- the AUC was calculated as the area under the receiver operating characteristic (ROC) curve, which is a plot of the sensitivity vs. the false positive rate (1- specificity).
- ROC curve was generated by varying the threshold for the prediction probability.
- miR-545, let-7g and miR- 15b resulted in the highest specificity (94.1%), sensitivity (95%) and AUC (0.953).
- Signature combinations ranged from just two miRNAs (e.g. miR-15b and miR-545) up to 7 miRNAs (e.g. miR-191, miR-301a, miR-545, let-7g, let-7d, miR-15b and miR- 142-3p) (see Table 8A-8C).
- Each signature had different combinations of the candidate miRNA biomarkers and resulted in varying specificity and sensitivity (see Table 9A-9B).
- Table 11 we also examined the signature accuracy for individual miRNAs (Table 11). The signature accuracy was lower for individual miRNAs in comparison to combination signatures.
- miR-142-3p and miR-301a The best stand-alone miRNAs in terms of specificity were miR-142-3p and miR-301a, with both having 100% specificity. But miR- 142-3p had better sensitivity (65%) as compared to 25% sensitivity for miR-301a. Let-7g and miR- 191 had the best sensitivity at 95%, but only miR- 191 had enriched specificity of 76%. miR- 191, miR- 15b and let-7d had the best overall accuracy of the stand-alone miRNAs.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- General Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2014518915A JP6154809B2 (ja) | 2011-06-27 | 2012-06-26 | アルツハイマー病を示すマイクロrnaバイオマーカー |
| RU2014102357A RU2639509C2 (ru) | 2011-06-27 | 2012-06-26 | МикроРНК - БИОМАРКЕРЫ, УКАЗЫВАЮЩИЕ НА БОЛЕЗНЬ АЛЬЦГЕЙМЕРА |
| MX2013015392A MX341840B (es) | 2011-06-27 | 2012-06-26 | Biomarcadores de microarn indicativos de la enfermedad de alzheimer. |
| KR1020147001923A KR102082016B1 (ko) | 2011-06-27 | 2012-06-26 | 알츠하이머병을 나타내는 마이크로rna 바이오마커들 |
| CN201280041358.8A CN103781919B9 (zh) | 2011-06-27 | 2012-06-26 | 指示阿尔茨海默氏病的微rna生物标志物 |
| EP12750628.5A EP2723894B1 (en) | 2011-06-27 | 2012-06-26 | Microrna biomarkers indicative of alzheimer's disease |
| US14/128,888 US9771617B2 (en) | 2011-06-27 | 2012-06-26 | Microrna biomarkers indicative of alzheimer's disease |
| CA2840196A CA2840196C (en) | 2011-06-27 | 2012-06-26 | Microrna biomarkers indicative of alzheimer's disease |
| AU2012275556A AU2012275556B2 (en) | 2011-06-27 | 2012-06-26 | MicroRNA biomarkers indicative of Alzheimer's Disease |
| BR112013033488A BR112013033488B8 (pt) | 2011-06-27 | 2012-06-26 | Métodos para facilitar o diagnóstico do comprometimento cognitivo devido a doença de alzheimer ou comprometimento cognitivo leve (mci)e kit |
| ES12750628.5T ES2580379T3 (es) | 2011-06-27 | 2012-06-26 | Biomarcadores de microARN indicativos de la enfermedad de Alzheimer |
| IL230034A IL230034B (en) | 2011-06-27 | 2013-12-19 | MicroRNA biomarkers that indicate Alzheimer's disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161501720P | 2011-06-27 | 2011-06-27 | |
| US61/501,720 | 2011-06-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013003350A2 true WO2013003350A2 (en) | 2013-01-03 |
| WO2013003350A3 WO2013003350A3 (en) | 2013-04-11 |
Family
ID=46724591
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/044202 Ceased WO2013003350A2 (en) | 2011-06-27 | 2012-06-26 | Microrna biomarkers indicative of alzheimer's disease |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US9771617B2 (https=) |
| EP (1) | EP2723894B1 (https=) |
| JP (2) | JP6154809B2 (https=) |
| KR (1) | KR102082016B1 (https=) |
| CN (1) | CN103781919B9 (https=) |
| AU (1) | AU2012275556B2 (https=) |
| BR (1) | BR112013033488B8 (https=) |
| CA (1) | CA2840196C (https=) |
| ES (1) | ES2580379T3 (https=) |
| IL (1) | IL230034B (https=) |
| MX (1) | MX341840B (https=) |
| RU (1) | RU2639509C2 (https=) |
| WO (1) | WO2013003350A2 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015050835A1 (en) * | 2013-10-01 | 2015-04-09 | Advanced Genomic Technology, Llc | Circulating biomarkers for alzheimer's disease and/or mild cognitive impairment |
| WO2015134551A1 (en) * | 2014-03-03 | 2015-09-11 | Banyan Biomarkers, Inc. | Micro rna markers for diagnosis of a neurological condition |
| EP3184646A1 (de) * | 2015-12-22 | 2017-06-28 | Siemens Healthcare GmbH | Spezifische signaturen in alzheimer durch multizentrische mirna-profile |
| WO2017186719A1 (en) * | 2016-04-25 | 2017-11-02 | Instytut Biologii Doswiadczalnej Im. Marcelego Nenckiego Polska Akademia Nauk | Microrna biomarkers in blood for diagnosis of alzheimer's disease |
| WO2018228875A1 (en) * | 2017-06-15 | 2018-12-20 | Nestec S.A. | Micro-rna biomarkers of blood-brain barrier dysfunction |
| WO2018236589A1 (en) * | 2017-06-19 | 2018-12-27 | St. John's University | CIRCULATING SERIES MICRO-RNA BIOMARKERS AND METHODS OF DIAGNOSING ALZHEIMER'S DISEASE |
| WO2019238807A1 (en) | 2018-06-15 | 2019-12-19 | Universitat Autonoma De Barcelona | CIRCULATING miRNAS AS BIOMARKERS FOR DIAGNOSIS OF MILD COGNITIVE IMPAIRMENT AND ALZHEIMER´S DISEASE |
| US10738360B2 (en) | 2015-03-13 | 2020-08-11 | Hiroshima University | Method for assisting detection of alzheimer'S disease or mild cognitive impairment |
| EP3652340A4 (en) * | 2017-07-12 | 2021-04-07 | Texas Tech University System | MICROARN-455-3P AS A PERIPHERAL BIOMARKER FOR ALZHEIMER'S DISEASE |
| US20220325359A1 (en) * | 2017-11-12 | 2022-10-13 | The Regents Of The University Of California | Non-coding rna for detection of cancer |
| US20220344052A1 (en) * | 2019-05-08 | 2022-10-27 | Kewpie Corporation | Information provision device and method for generating mirna importance table |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2838562A1 (en) * | 2011-08-08 | 2013-02-14 | Eugenia Wang | Biomarker for alzheimer's disease and/or mild cognitively impairment, and use thereof |
| KR101583450B1 (ko) * | 2014-12-01 | 2016-01-11 | 전주대학교 산학협력단 | 마이크로 rna id의 분석방법 및 이를 통해 도출한 대장암의 바이오마커 |
| US10358676B2 (en) * | 2015-04-03 | 2019-07-23 | Kaohsiung Chang Gung Memorial Hospital | Methods and kits for detecting Kawasaki disease |
| KR101734645B1 (ko) * | 2015-05-18 | 2017-05-11 | (주)에이엔티랩스 | 초기 알츠하이머 병 또는 경도 인지 장애 진단 방법 |
| CN108027376B (zh) | 2015-09-16 | 2021-04-02 | 株式会社岛津制作所 | 评价脑内的淀粉样蛋白β蓄积状态的多重生物标记物及其分析方法 |
| US10262423B2 (en) * | 2016-03-29 | 2019-04-16 | Verily Life Sciences Llc | Disease and fall risk assessment using depth mapping systems |
| KR101998457B1 (ko) * | 2016-05-10 | 2019-07-10 | 조선대학교산학협력단 | 알츠하이머 질병의 진단을 위한 바이오마커 |
| KR101992539B1 (ko) * | 2016-10-21 | 2019-09-30 | 서울대학교산학협력단 | miRNA 기반의 인지장애 질환 진단용 조성물 및 방법 |
| US11078535B2 (en) | 2017-07-18 | 2021-08-03 | The Trustees Of Indiana University | Presymptomatic micro RNA targets for treatment of neurodegeneration pathology |
| EP3701047A1 (en) * | 2017-10-25 | 2020-09-02 | Hummingbird Diagnostics GmbH | Mirnas as biomarkers for alzheimer's disease |
| US20230160010A1 (en) * | 2017-12-14 | 2023-05-25 | Hiroshima University | Method for aiding detection of alzheimer' s disease |
| CN108277271A (zh) * | 2018-02-05 | 2018-07-13 | 范瑶飞 | 一种辅助检测阿兹海默疾病的miRNA |
| EP4498086A3 (en) * | 2018-02-13 | 2025-04-02 | Toray Industries, Inc. | Kit or device and method for detecting dementia |
| KR20210038585A (ko) * | 2018-07-25 | 2021-04-07 | 에스알엔에이리틱스, 인크. | 알츠하이머병에 대한 작은 rna 예측인자 |
| BR112023000659A2 (pt) * | 2020-07-24 | 2023-01-31 | Otago Innovation Ltd | Biomarcadores para condições cognitivas |
| WO2022165205A1 (en) * | 2021-01-29 | 2022-08-04 | Arizona Board Of Regents On Behalf Of Arizona State University | Systems and methods for diagnosing neurodegenerative diseases |
Citations (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5538848A (en) | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| WO1999021881A1 (en) | 1997-10-27 | 1999-05-06 | Boston Probes, Inc. | Methods, kits and compositions pertaining to linear beacons |
| US5925517A (en) | 1993-11-12 | 1999-07-20 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled dual conformation oligonucleotide probes, assays and kits |
| US5965364A (en) | 1990-10-09 | 1999-10-12 | Benner; Steven Albert | Method for selecting functional deoxyribonucleotide derivatives |
| US6150097A (en) | 1996-04-12 | 2000-11-21 | The Public Health Research Institute Of The City Of New York, Inc. | Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes |
| WO2001031580A2 (en) | 1999-10-27 | 2001-05-03 | Biowulf Technologies, Llc | Methods and devices for identifying patterns in biological systems |
| US6329144B1 (en) | 1996-05-31 | 2001-12-11 | FORSKARPATENT I VäSTSVERIGE AB | Probe for analysis of target nucleic acids |
| US6355421B1 (en) | 1997-10-27 | 2002-03-12 | Boston Probes, Inc. | Methods, kits and compositions pertaining to PNA molecular beacons |
| US6383752B1 (en) | 1999-03-31 | 2002-05-07 | Hybridon, Inc. | Pseudo-cyclic oligonucleobases |
| US20020193950A1 (en) | 2002-02-25 | 2002-12-19 | Gavin Edward J. | Method for analyzing mass spectra |
| US20030004402A1 (en) | 2000-07-18 | 2003-01-02 | Hitt Ben A. | Process for discriminating between biological states based on hidden patterns from biological data |
| US20030055615A1 (en) | 2001-05-11 | 2003-03-20 | Zhen Zhang | System and methods for processing biological expression data |
| US6548250B1 (en) | 1999-10-29 | 2003-04-15 | Stratagene | Methods for detection of a target nucleic acid sequence |
| US6589743B2 (en) | 2000-10-11 | 2003-07-08 | Stratagene | Methods for detection of a target nucleic acid using a probe comprising secondary structure |
| US6590091B2 (en) | 1994-12-27 | 2003-07-08 | Naxcor | Nucleic acid sequence detection employing amplification probes |
| US6593091B2 (en) | 2001-09-24 | 2003-07-15 | Beckman Coulter, Inc. | Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer |
| US6596490B2 (en) | 2000-07-14 | 2003-07-22 | Applied Gene Technologies, Inc. | Nucleic acid hairpin probes and uses thereof |
| US20060078894A1 (en) | 2004-10-12 | 2006-04-13 | Winkler Matthew M | Methods and compositions for analyzing nucleic acids |
| US7060809B2 (en) | 2001-09-04 | 2006-06-13 | Exiqon A/S | LNA compositions and uses thereof |
Family Cites Families (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7964192B1 (en) | 1997-12-02 | 2011-06-21 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidgenic disease |
| US20030225031A1 (en) * | 2002-05-21 | 2003-12-04 | Quay Steven C. | Administration of acetylcholinesterase inhibitors to the cerebral spinal fluid |
| JP2004161636A (ja) * | 2002-11-11 | 2004-06-10 | Takeda Chem Ind Ltd | 軽度認知障害または注意欠陥多動性障害治療剤 |
| EP1618214A4 (en) | 2003-04-25 | 2008-02-13 | Becton Dickinson Co | DETECTION OF TYPES 1 AND 2 OF HERPES SIMPLEX VIRUS BY AMPLIFICATION OF NUCLEIC ACID |
| US9119846B2 (en) | 2003-04-29 | 2015-09-01 | Neurim Pharmaceuticals (1991) Ltd. | Method and composition for enhancing cognition in alzheimer's patients |
| CA2571642A1 (en) | 2004-07-09 | 2006-02-16 | University Of Pittsburgh - Of The Commonwealth System Of Higher Educatio N | Identification of markers in lung and breast cancer |
| JP2006176503A (ja) * | 2004-11-26 | 2006-07-06 | Tohoku Univ | 脳血管障害を伴うアルツハイマー病治療薬 |
| RU2418068C2 (ru) * | 2005-08-17 | 2011-05-10 | Сирна Терапьютикс, Инк. | Молекулы химически модифицированной короткой интерферирующей нуклеиновой кислоты, которые опосредуют интерференцию рнк |
| WO2007044937A2 (en) | 2005-10-13 | 2007-04-19 | President And Fellows Of Harvard College | Compositions and methods to modulate memory |
| EP2056876A1 (en) * | 2006-08-21 | 2009-05-13 | Novartis AG | Biomarkers for alzheimer's disease progression |
| WO2008153692A2 (en) | 2007-05-22 | 2008-12-18 | The Brigham And Women's Hospital, Inc. | Microrna expression profiling of cerebrospinal fluid |
| WO2008147837A1 (en) | 2007-05-23 | 2008-12-04 | Dharmacon, Inc. | Micro-rna scaffolds, non-naturally occurring micro-rnas, and methods for optimizing non-naturally occurring micro-rnas |
| US8613923B2 (en) | 2007-06-12 | 2013-12-24 | Ac Immune S.A. | Monoclonal antibody |
| WO2009009457A1 (en) * | 2007-07-06 | 2009-01-15 | University Of Louisville Research Foundation, Inc. | Alzheimer's disease-specific micro-rna microarray and related methods |
| US8551703B2 (en) | 2007-07-06 | 2013-10-08 | The Regents Of The University Of California | SNPs associated with fatty acid composition of bovine meat and milk |
| CA2676113C (en) * | 2007-07-25 | 2014-07-08 | University Of Louisville Research Foundation, Inc. | Exosome-associated microrna as a diagnostic marker |
| DK2182983T3 (da) | 2007-07-27 | 2014-07-14 | Janssen Alzheimer Immunotherap | Behandling af amyloidogene sygdomme med humaniserede anti-abeta antistoffer |
| HUE019019T5 (en) * | 2007-08-22 | 2017-04-28 | Trovagene Inc | Methods for Using miRNA for In vivo Cell Death Detection |
| EP2610342B1 (en) * | 2007-09-14 | 2016-05-04 | The Ohio State University Research Foundation | MiRNA Expression in Human Peripheral Blood Microvesicles and uses Thereof |
| EP2235058A2 (en) | 2007-12-21 | 2010-10-06 | Amgen, Inc | Anti-amyloid antibodies and uses thereof |
| US20110160290A1 (en) | 2008-05-21 | 2011-06-30 | Muneesh Tewari | Use of extracellular rna to measure disease |
| CN101386848A (zh) | 2008-08-12 | 2009-03-18 | 南京大学 | 细胞微粒子所载微小核糖核酸及其制备研究方法和应用 |
| WO2010056337A2 (en) * | 2008-11-12 | 2010-05-20 | Caris Mpi, Inc. | Methods and systems of using exosomes for determining phenotypes |
| US8637525B2 (en) | 2009-07-31 | 2014-01-28 | Bristol-Myers Squibb Company | Compounds for the reduction of beta-amyloid production |
| EP2287336A1 (fr) | 2009-07-31 | 2011-02-23 | Exhonit Therapeutics SA | Procédés et méthodes de diagnostic de la maladie d'Alzheimer |
| AU2010294197C9 (en) * | 2009-09-10 | 2018-09-13 | Velin-Pharma A/S | Method for the preparation of micro-RNA and its therapeutic application |
| US8648017B2 (en) | 2009-11-04 | 2014-02-11 | Diamir, Llc | Methods of using small RNA from bodily fluids for diagnosis and monitoring of neurodegenerative diseases |
| GB201011420D0 (en) | 2010-07-06 | 2010-08-18 | United Arab Emirates Universit | Method for diagnosis |
| BR112013006353A2 (pt) | 2010-09-22 | 2024-01-16 | Janssen Pharmaceutica Nv | Derivados de 4,7-di-hifro-pirazolo[1,5-a]pirazin-6-ilamina úteis como inibidores de beta-secretase (bace) |
| KR102759126B1 (ko) | 2010-12-30 | 2025-01-24 | 파운데이션 메디신 인코포레이티드 | 종양 샘플의 다유전자 분석의 최적화 |
| US8945829B2 (en) | 2011-03-22 | 2015-02-03 | Cornell University | Distinguishing benign and malignant indeterminate thyroid lesions |
| US9023359B1 (en) | 2014-07-15 | 2015-05-05 | Kymab Limited | Targeting rare human PCSK9 variants for cholesterol treatment |
-
2012
- 2012-06-26 RU RU2014102357A patent/RU2639509C2/ru active
- 2012-06-26 WO PCT/US2012/044202 patent/WO2013003350A2/en not_active Ceased
- 2012-06-26 US US14/128,888 patent/US9771617B2/en active Active
- 2012-06-26 KR KR1020147001923A patent/KR102082016B1/ko active Active
- 2012-06-26 EP EP12750628.5A patent/EP2723894B1/en active Active
- 2012-06-26 CA CA2840196A patent/CA2840196C/en active Active
- 2012-06-26 JP JP2014518915A patent/JP6154809B2/ja active Active
- 2012-06-26 AU AU2012275556A patent/AU2012275556B2/en active Active
- 2012-06-26 MX MX2013015392A patent/MX341840B/es active IP Right Grant
- 2012-06-26 BR BR112013033488A patent/BR112013033488B8/pt active IP Right Grant
- 2012-06-26 ES ES12750628.5T patent/ES2580379T3/es active Active
- 2012-06-26 CN CN201280041358.8A patent/CN103781919B9/zh active Active
-
2013
- 2013-12-19 IL IL230034A patent/IL230034B/en active IP Right Grant
-
2016
- 2016-08-01 JP JP2016150989A patent/JP2016214256A/ja active Pending
Patent Citations (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5965364A (en) | 1990-10-09 | 1999-10-12 | Benner; Steven Albert | Method for selecting functional deoxyribonucleotide derivatives |
| US6001983A (en) | 1990-10-09 | 1999-12-14 | Benner; Steven Albert | Oligonucleotides with non-standard bases and methods for preparing same |
| US6103476A (en) | 1993-11-12 | 2000-08-15 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled, dual conformation oligonucleotide probes, assays and kits |
| US5925517A (en) | 1993-11-12 | 1999-07-20 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled dual conformation oligonucleotide probes, assays and kits |
| US5538848A (en) | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| US6590091B2 (en) | 1994-12-27 | 2003-07-08 | Naxcor | Nucleic acid sequence detection employing amplification probes |
| US6150097A (en) | 1996-04-12 | 2000-11-21 | The Public Health Research Institute Of The City Of New York, Inc. | Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes |
| US6329144B1 (en) | 1996-05-31 | 2001-12-11 | FORSKARPATENT I VäSTSVERIGE AB | Probe for analysis of target nucleic acids |
| US6355421B1 (en) | 1997-10-27 | 2002-03-12 | Boston Probes, Inc. | Methods, kits and compositions pertaining to PNA molecular beacons |
| US6485901B1 (en) | 1997-10-27 | 2002-11-26 | Boston Probes, Inc. | Methods, kits and compositions pertaining to linear beacons |
| US6649349B2 (en) | 1997-10-27 | 2003-11-18 | Boston Probes, Inc. | In-situ methods for analyzing target sequences using linear beacons |
| WO1999021881A1 (en) | 1997-10-27 | 1999-05-06 | Boston Probes, Inc. | Methods, kits and compositions pertaining to linear beacons |
| US6383752B1 (en) | 1999-03-31 | 2002-05-07 | Hybridon, Inc. | Pseudo-cyclic oligonucleobases |
| WO2001031580A2 (en) | 1999-10-27 | 2001-05-03 | Biowulf Technologies, Llc | Methods and devices for identifying patterns in biological systems |
| US6548250B1 (en) | 1999-10-29 | 2003-04-15 | Stratagene | Methods for detection of a target nucleic acid sequence |
| US6596490B2 (en) | 2000-07-14 | 2003-07-22 | Applied Gene Technologies, Inc. | Nucleic acid hairpin probes and uses thereof |
| US20030004402A1 (en) | 2000-07-18 | 2003-01-02 | Hitt Ben A. | Process for discriminating between biological states based on hidden patterns from biological data |
| US6589743B2 (en) | 2000-10-11 | 2003-07-08 | Stratagene | Methods for detection of a target nucleic acid using a probe comprising secondary structure |
| US20030055615A1 (en) | 2001-05-11 | 2003-03-20 | Zhen Zhang | System and methods for processing biological expression data |
| US7060809B2 (en) | 2001-09-04 | 2006-06-13 | Exiqon A/S | LNA compositions and uses thereof |
| US6593091B2 (en) | 2001-09-24 | 2003-07-15 | Beckman Coulter, Inc. | Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer |
| US20020193950A1 (en) | 2002-02-25 | 2002-12-19 | Gavin Edward J. | Method for analyzing mass spectra |
| US20060078894A1 (en) | 2004-10-12 | 2006-04-13 | Winkler Matthew M | Methods and compositions for analyzing nucleic acids |
Non-Patent Citations (20)
| Title |
|---|
| BLACKBURN ET AL.: "DNA and RNA Structure", NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY, 1996 |
| CHENG ET AL., ANGEW CHEM. INT. ED. ENGL., vol. 48, no. 18, 2009, pages 3268 - 72 |
| E. W. MARTIN: "Remington's Pharmaceutical Sciences,Sixteenth Edition,", 1980, MACK PUBLISHING CO. |
| FERRI C.P. ET AL., LANCET, vol. 366, no. 9503, 2005, pages 2112 - 2117 |
| GARMAN A.: "Non-Radioactive Labeling", 1997, ACADEMIC PRESS |
| GUSEV ET AL., AM. J. PATHOL., vol. 159, no. 1, 2001, pages 63 - 69 |
| J. PHARMACEUTICAL SCIENCES, vol. 66, 1977, pages 1 - 19 |
| JAIN: "Statistical Pattern Recognition: A Review", IEEE TRANSACTIONS ON PATTERN ANALYSIS AND MACHINE INTELLIGENCE, vol. 22, no. 1, January 2000 (2000-01-01), XP000936788, DOI: doi:10.1109/34.824819 |
| KRICKA, L.: "Nonisotopic DNA Probe Techniques", 1992, ACADEMIC PRESS |
| LI ET AL., CLIN. CHEM., vol. 53, 2006, pages 624 - 633 |
| LIVAK ET AL.: "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-AA C(T)) Method", METHODS, vol. 25, no. 4, December 2001 (2001-12-01), pages 402 - 8, XP055296516, DOI: doi:10.1006/meth.2001.1262 |
| LIVAK KJ; SCHMITTGEN TD: "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-AA C(T)) Method", METHODS, vol. 25, no. 4, December 2001 (2001-12-01), pages 402 - 8, XP055296516, DOI: doi:10.1006/meth.2001.1262 |
| LIZARDI ET AL., NAT. GEN., vol. 19, no. 3, 1998, pages 225 - 232 |
| MASON, S.J.; N.E. GRAHAM: "Areas beneath the relative operating characteristics (ROC) and relative operating levels (ROL) curves: Statistical significance and interpretation", Q. J. R. METEOROL. SOC., vol. 30, 1982, pages 291 - 303 |
| MITCHELL, P.S. ET AL., PNAS, vol. 105, no. 30, 29 July 2008 (2008-07-29), pages 10513 - 8 |
| NALLUR ET AL., NUCLEIC ACIDS RES., vol. 29, no. 23, 2001, pages E118 |
| NEUBACHER ET AL., CHEMBIOCHEM., vol. 10, no. 8, 2009, pages 1289 - 91 |
| SCHOUTEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages E57 |
| URDEA, NATURE BIOTECHNOLOGY, vol. 12, 1994, pages 926 - 928 |
| VENABLES, W. N.; RIPLEY, B. D.: "Modern Applied Statistics. Fourth Edition.", 2002, SPRINGER |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015050835A1 (en) * | 2013-10-01 | 2015-04-09 | Advanced Genomic Technology, Llc | Circulating biomarkers for alzheimer's disease and/or mild cognitive impairment |
| WO2015134551A1 (en) * | 2014-03-03 | 2015-09-11 | Banyan Biomarkers, Inc. | Micro rna markers for diagnosis of a neurological condition |
| US10738360B2 (en) | 2015-03-13 | 2020-08-11 | Hiroshima University | Method for assisting detection of alzheimer'S disease or mild cognitive impairment |
| EP3184646A1 (de) * | 2015-12-22 | 2017-06-28 | Siemens Healthcare GmbH | Spezifische signaturen in alzheimer durch multizentrische mirna-profile |
| WO2017108535A1 (de) * | 2015-12-22 | 2017-06-29 | Siemens Aktiengesellschaft | Spezifische signaturen in alzheimer durch multizentrische mirna-profile |
| WO2017186719A1 (en) * | 2016-04-25 | 2017-11-02 | Instytut Biologii Doswiadczalnej Im. Marcelego Nenckiego Polska Akademia Nauk | Microrna biomarkers in blood for diagnosis of alzheimer's disease |
| WO2018228875A1 (en) * | 2017-06-15 | 2018-12-20 | Nestec S.A. | Micro-rna biomarkers of blood-brain barrier dysfunction |
| WO2018236589A1 (en) * | 2017-06-19 | 2018-12-27 | St. John's University | CIRCULATING SERIES MICRO-RNA BIOMARKERS AND METHODS OF DIAGNOSING ALZHEIMER'S DISEASE |
| US11634775B2 (en) | 2017-06-19 | 2023-04-25 | St. John's University | Circulating serum microRNA biomarkers and methods for Alzheimer's disease diagnosis |
| EP3642366B1 (en) * | 2017-06-19 | 2023-11-15 | St. John's University | Circulating serum microrna biomarkers and methods for alzheimer's disease diagnosis |
| EP4289970A3 (en) * | 2017-06-19 | 2024-03-13 | St. John's University | Circulating serum microrna biomarkers and methods for alzheimer's disease diagnosis |
| US12398427B2 (en) | 2017-06-19 | 2025-08-26 | St. John's University | Circulating serum microRNA biomarkers and methods for Alzheimer's disease diagnosis |
| EP3652340A4 (en) * | 2017-07-12 | 2021-04-07 | Texas Tech University System | MICROARN-455-3P AS A PERIPHERAL BIOMARKER FOR ALZHEIMER'S DISEASE |
| US11492669B2 (en) | 2017-07-12 | 2022-11-08 | Texas Tech University System | MicroRNA-455-3p as a peripheral biomarker for Alzheimer's disease |
| US20220325359A1 (en) * | 2017-11-12 | 2022-10-13 | The Regents Of The University Of California | Non-coding rna for detection of cancer |
| WO2019238807A1 (en) | 2018-06-15 | 2019-12-19 | Universitat Autonoma De Barcelona | CIRCULATING miRNAS AS BIOMARKERS FOR DIAGNOSIS OF MILD COGNITIVE IMPAIRMENT AND ALZHEIMER´S DISEASE |
| US12054779B2 (en) | 2018-06-15 | 2024-08-06 | Universitat Autònoma De Barcelona | Circulating miRNAs as biomarkers for diagnosis of mild cognitive impairment and Alzheimer's disease |
| US20220344052A1 (en) * | 2019-05-08 | 2022-10-27 | Kewpie Corporation | Information provision device and method for generating mirna importance table |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112013033488B1 (pt) | 2022-03-03 |
| CN103781919B9 (zh) | 2017-09-15 |
| ES2580379T3 (es) | 2016-08-23 |
| KR102082016B1 (ko) | 2020-02-26 |
| CA2840196C (en) | 2022-09-20 |
| CN103781919B (zh) | 2017-07-04 |
| IL230034B (en) | 2021-02-28 |
| BR112013033488A2 (pt) | 2017-03-01 |
| CA2840196A1 (en) | 2013-01-03 |
| US20140378439A1 (en) | 2014-12-25 |
| EP2723894B1 (en) | 2016-05-11 |
| BR112013033488B8 (pt) | 2022-11-22 |
| MX341840B (es) | 2016-09-05 |
| WO2013003350A3 (en) | 2013-04-11 |
| US9771617B2 (en) | 2017-09-26 |
| JP2014520529A (ja) | 2014-08-25 |
| EP2723894A2 (en) | 2014-04-30 |
| JP2016214256A (ja) | 2016-12-22 |
| JP6154809B2 (ja) | 2017-06-28 |
| MX2013015392A (es) | 2014-07-14 |
| AU2012275556A1 (en) | 2013-05-02 |
| RU2014102357A (ru) | 2015-08-10 |
| KR20140044375A (ko) | 2014-04-14 |
| RU2639509C2 (ru) | 2017-12-21 |
| AU2012275556B2 (en) | 2016-02-04 |
| CN103781919A (zh) | 2014-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2723894B1 (en) | Microrna biomarkers indicative of alzheimer's disease | |
| US12398429B2 (en) | Methods and systems for sequencing polynucleotides | |
| EP2733219B1 (en) | Diagnostic miRNA markers for Alzheimer | |
| US20140302068A1 (en) | MicroRNA Biomarkers for Diagnosing Parkinson's Disease | |
| US20240150829A1 (en) | System and methods of detection of oncrnas for cancer diagnosis | |
| US10718018B2 (en) | Complex sets of miRNAs as non-invasive biomarkers for dilated cardiomyopathy | |
| US20210301350A1 (en) | Lung cancer determinations using mirna | |
| AU2013204118A1 (en) | MicroRNA biomarkers indicative of Alzheimer's Disease | |
| US20170130267A1 (en) | Methods for predicting acute rejection in heart recipients | |
| US20250101510A1 (en) | Methods and systems for sequencing polynucleotides | |
| WO2025105011A1 (en) | Method for determining pancreatic cancer | |
| HK40032567A (en) | Non-coding rna for detection of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12750628 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2012275556 Country of ref document: AU Date of ref document: 20120626 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/015392 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2840196 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014518915 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20147001923 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014102357 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14128888 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013033488 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013033488 Country of ref document: BR Kind code of ref document: A2 Effective date: 20131226 |