WO2012097012A1 - Use of toll-like receptor agonist for treating cancer - Google Patents
Use of toll-like receptor agonist for treating cancer Download PDFInfo
- Publication number
- WO2012097012A1 WO2012097012A1 PCT/US2012/020844 US2012020844W WO2012097012A1 WO 2012097012 A1 WO2012097012 A1 WO 2012097012A1 US 2012020844 W US2012020844 W US 2012020844W WO 2012097012 A1 WO2012097012 A1 WO 2012097012A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- tlr
- cblb502
- mammal
- liver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/255—Salmonella (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
- A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
- A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/025—Enterobacteriales, e.g. Enterobacter
- A61K39/0275—Salmonella
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- This invention relates to methods of treating cancer in Toll- Like Receptor-expressing tissues, and to methods of protecting the liver from the effects of a liver toxicity, using a TLR agonist.
- Fas ligand is a 40 kDa physiological agonist of Fas signaling expressed on activated lymphocytes and many tumor cells which can also be secreted through metalloproteinase-mediated cleavage and kill the sensitive cells in autocrine and paracrine manner.
- Fas is a transmembrane receptor expressed on activated lymphocytes, variety of tissues and tumor cells. Fas signaling plays crucial role in regulation of the immune system by triggering autocrine suicide or paracrine death (apoptosis), suppressing immune reaction by eliminating activated lymphocytes. Upon binding, it induces p53 independent cell death through extrinsic pathway of apoptosis engaging DISC formation, caspase-8 and 10, and intrinsic (mitochondrial) apoptosis activating caspase-8 and Bid cleavage, and cytochrome release. Both apoptotic pathways lead to activation of caspase-3 and 7.
- Mitochondrial apoptosis is regulated by pro- and anti-apoptotic Bcl2 family members.
- Fas signaling is often found deregulated either by absence of Fas receptor, or by constitutive activation of NF-kB resulting in the expression of anti-apoptotic genes, such as c-Flip, Bcl-2, Bcl-xL.
- C-Flip an NF- kB responsive gene, has been demonstrated to inhibit caspase-8 and Fas mediated apoptosis in tumors (REFs, Kataoka et al 2000).
- TLRs are found to be expressed on both epithelial and endothelial cells as well as immunocytes. At present, thirteen TLRs have been identified in mammals. Upon receptor stimulation, several common signaling pathways get activated such as NF-kB, AP-1, PI3K/AKT and mitogen-activated protein kinases (MAPK) leading to increased survival, stimulation of cell proliferation and the secretion of many cytokines with chemotactic and pro-inflammatory functions. Induction of TLR in cancer cells can be used to treat cancer, however, the distribution of different TLRs varies significantly among the various organs and cell types. This affects the cytokine profile and extent of the inflammatory response of cells. Accordingly, there is a need in the art for cancer immunotherapeutic methods that do not depend on the presence of TLR5 expression.
- a method of treating cancer in a mammal which may comprise administering to a mammal in need thereof of Toll-Like Receptor (TLR) agonist.
- TLR Toll-Like Receptor
- a method of reducing cancer recurrence in a mammal which may comprise administering to a mammal in need thereof a TLR agonist.
- the cancer may be present in a tissue that expresses TLR.
- the cancer may be a metastasis or tumor regrowth.
- the TLR agonist may be flagellin.
- the cancer may not express TLR, which may be TLR5.
- the tissue may be liver, lung, bladder, or intestinal.
- the cancer may be metastatic.
- the cancer may be melanoma, colon, breast, prostate, or a hematological malignancy, which may be lymphoma.
- the cancer may be tumor.
- the agent may be administered as a monotherapy.
- the mammal may not be receiving a combination therapy.
- the mammal may also not be receiving chemotherapy or radiation therapy, but may be treated surgically.
- the mammal may have sufficient innate immunity, which may be at a level that is equivalent to the level required for eligibility for a first or subsequent round of chemotherapy.
- the mammal may have a white blood cell count within the range of normal, or may have a white blood cell count indicative of mild-immunosuppression.
- the TLR agonist may be administered to the mammal before, after or concurrent with removal of a tumor.
- the TLR agonist may be administered during tumor removal.
- a method of treating cancer in a mammal which may comprise administering to a mammal in need thereof a FAS agonist and a TLR agonist, which may be flagellin.
- the FAS agonist may be a FAS agonist antibody.
- the cancer may be metastatic, and may be a tumor.
- the cancer may not express a TLR.
- the cancer may have metastasized to an invaded tissue that expresses TLR.
- the invaded tissue may be liver, bladder, lung, or intestinal.
- a method of protecting liver tissue in a mammal from the effects of a liver toxicity which may comprise administering to a mammal in need thereof a TLR agonist.
- the toxicity may be a FAS ligand, a FAS agonistic antibody, TNFa, acetaminophen, alcohol, a viral infection of the liver, or a chemotherapeutic agent.
- the toxicity may also be a Salmonella infection, which may be from Salmonella typhimurium.
- the TLR agonist may be flagellin.
- Figure 1 shows the domain structure of bacterial flagellin.
- Side-chain atoms are color coded: Ala, yellow; Leu, He or Val, orange; Phe and Tyr, purple (carbon atoms) and red (oxygen atoms), c, Position and region of various structural features in the amino-acid sequence of flagellin.
- Figure 2 shows a schematic of Salmonella flagellin domains, its fragments, and its interaction with TLR5. Dark bars denote regions of the flagellin gene used to construct fragments comprising A, B, C, A' and B'.
- Figure 3 depicts flagellin derivatives. The domain structure and approximate boundaries (amino acid coordinates) of selected flagellin derivatives (listed on the right). FliC flagellin of Salmonella dublin is encoded within 505 amino acids (aa).
- Figure 4 shows the nucleotide and amino acid sequence for the following flagellin variants: AA' (SEQ ID NO: 7-8), AB' (SEQ ID NO: 9-10), BA' (SEQ ID NO: 11-12), BB' (SEQ ID NO: 13-14), CA' (SEQ ID NO: 15-16), CB' (SEQ ID NO: 17-18), A (SEQ ID NO: 19- 20), B (SEQ ID NO: 21-22), C (SEQ ID NO: 23-24), GST-A' (SEQ ID NO: 25-26), GST-B' (SEQ ID NO: 27-28), AA'nl-170 (SEQ ID NO: 29-30), AA'nl-163 (SEQ ID NO: 33-34), AA'n54-170 (SEQ ID NO: 31-32), AA'n54-163 (SEQ ID NO: 335-36), AB'nl-170 (SEQ ID NO: 37-38), AB'nl-163 (SEQ ID NO: 39-40
- the pRSETb leader sequence is shown in Italic (leader includes Met, which is also amino acid 1 of FliC).
- the N terminal constant domain is underlined.
- the amino acid linker sequence is in Bold.
- the C terminal constant domain is underlined. GST, if present, is highlighted.
- Figure 5 shows a comparison of amino acid sequences of the conserved amino (Fig. 5A) and carboxy (Fig. 5B) terminus from 21 species of bacteria.
- the 13 conserved amino acids important for TLR5 activity are shown with shading.
- Figure 6 shows the sequence of human TLR5.
- Figure 7 NF-kB activation in vivo in response to CBLB502 and LPS injections.
- NF-kB nuclear translocation indicative of the bioactivity of agonists LPS and CBLB502 in liver from NIH-Swiss mice injected s.c either with CBLB502 or LPS.
- Control mice were injected with PBS. Tissue samples were obtained 20, 40 and 60 min after the treatments, processed into paraffin blocks.
- P65 was stained with green fluorescence, cytokeratin-8 with red fluorescence and nuclei with non-specific Dapi blue staining. Pictures are taken at x20 magnification. Arrows indicate Kupffer and endothelial cells determined based on morphological criteria.
- FIG. 8 shows CBLB502 protection from Fas mediated hepatotoxicity.
- A Survival of NIH-Swiss mice after i.p. injection of 4 ⁇ g of anti-Fas antibodies alone or in combination with CBLB502 (1 ⁇ g/ mouse) injected 30 min, 2 hours and 6 hours prior antibodies. In parenthesis are the numbers of mice per each treatment.
- B Protection of livers from anti- Fas antibody toxicity. Apoptosis in livers 5 hours after injections of anti-Fas antibodies was detected using TUNEL technique.
- C Tissue morphology with H&E staining revealed necrotic damge to livers by anti- Fas antibody injections and protection by CBLB502.
- D Tissue morphology with H&E staining revealed necrotic damge to livers by anti- Fas antibody injections and protection by CBLB502.
- erythrocyte autofluorescence rhodamine channel, red
- mouse IgG control Cy5-conjugated anti- mouse IgG antibody, pceudocolored in purple
- DAPI nuclei blue
- E. Caspase-3/7 activity in liver samples of NIH-Swiss mice was determined in tissue protein lysates 5 hours after injection of 3 ⁇ g anti- Fas antibody with or without CBLB502 thirty minute pre-treatment. N 3. Bars represent average +/- s.d.
- ALT Alanine aminotransferase
- Figure 9 shows regulation of apopto sis-related factors by CBLB502 in liver and its effect on Fas-mediated antitumor activity in CT-26 tumor model.
- C. RNA expression of Bcl2AlB, Bcl2AlD, IER-3, Fos, Jun and JunB genes in livers of intact mice and treated with CBLB502 for 30 min and 2 hours was detected by RT-PCR.
- GAPDH was used as a control to monitor the induction of gene expression.
- Tumor growth in livers was determined using Xenogen IVIS Imaging System on the days 10, 15, 17, 22, 28 and 40 after tumor cell inoculation. Images of 3 mice from each group taken on day 15 are presented. The difference between proportions of mice with tumor- free livers in CBLB502-treated and control groups reaches statistical significance (p ⁇ 0.05) on days indicated by asterisks.
- Figure 10 Dynamics of NF-kB activation in different organs after injections with CBLB502 (5 ⁇ g, s.c.) or LPS (20 ⁇ g, s.c). Mice were euthanized 2, 6, 24 and 48 hours later by C02 inhalation. Luciferase activity in protein extracts from liver, large intestine, kidneys and lungs was normalized per ⁇ g of the protein extract and average values were calculated per organ. Luciferase fold induction was calculated as ratio between average luciferase activity in protein extract from organs of the TLR agonist treated mice and that obtained in the extracts from the corresponding organs of the PBS injected control mice (3 mice/ group). Bars represent fold induction as average + s.e.
- FIG. 11 NF-kB dependent luciferase expression in primary culture of mouse hepatocytes isolated from luciferase reporter mice and treated in vitro for 3 hours with CBLB502 (100 ng/ml), LPS (5 ⁇ g/ml) or PBS control. Then hepatocytes were rinsed with PBS and collected in cell lysis buffer (Pro mega). Luciferase activity in the protein supernatants was determined by Promega reporter system and normalized per ⁇ g of the protein extract. Bars represent luciferase units (mean + s.d.).
- FIG. 12 H&E staining of liver samples from NIH-Swiss mice treated with CBLB502, anti-Fas antibodies (3 ⁇ g) or their combination obtained at different time-points after the treatment. Samples of livers were obtained 5, 12 and 26 hours after injections of anti-Fas antibodies, fixed in 10% formalin, embedded in paraffin and stained for tissue morphology with hematoxilin and eosin.
- FIG. 13 TLR5 expression on B16 and CT-26 cells.
- B NF-kB activation in B16 and CT-26 tumor cells in response to CBLB502, mouse TNFa and LPS was tested using luciferase reporter assay. Data represent luciferase units (mean + s.d).
- FIG. 14 Shows TLR5 expresion in CT-26 tumor cells and A20 lymphoma cells.
- Figs. 14A and C total RNA was extracted from CT-26 and B16 tumor cells (Fig. 14A) and CT- 26 and A20 cells (Fig. 14C) using TRIzol reagent as described in the main text of the manuscript.
- the primers for TLR5 were designed using LaserGene software (DNASTAR, Inc., Madison, WI).
- a region of mouse TLR5 mRNA GenBank Accession No.
- NM_016928.2 was amplified using primers specific for the mouse TLR5 gene: forward (5'- AGTCCCCCAGCTCCAGTTTC-3') and reverse (5 ' -GG AGCCCCCTAGC AGTG AGT-3 ' ) .
- GAPDH was used as a control to monitor the induction of gene expression.
- cDNAs were synthesized using SuperscriptTM II Reverse Transcriptase and oligo(dT)12-18 primer
- Antitumor activity of colon HCT116 adenocarcinoma s.c. Grown as a xenograft in athymic mice.
- HCT116 were injected s.c. into 2 flanks of 8 athymic nude mice (0.5x106 /100 ml of PBS) to induce tumors.
- tumors became of about 3-5 mm in diameter (by day 6 after injections) mice were randomly distributed into 2 groups, 5 mice for CBLB502 treated group and 3 mice in PBS control group.
- Right figure represents the amount of days needed for tumors to reach 400 mm3 volume with and without treatment with CBLB502.
- FIG. 19 Fischer rats with s.c. growing syngeneic Ward colon tumors were treated with CBLB502 (0.2 mg/kg) was administered by i.p. once a day for three days.
- Right figure demonstrates IL-8 production in response to CBLB502 treatment as indicative of TLR5 function in H1299-TLR5 cells.
- FIG. 22 shows that the bladder strongly responds to CBLB502.
- FIG 23 shows that CBLB502 treatment delays tumor appearance and growth in livers, even in tumors that do not express TLR5.
- Figure 24 shows CBLB502 protection from Fas mediated hepatotoxicity.
- Figure 25 shows that the liver is protected from TNFa and LPS toxicity by CBLB502.
- Figure 26 shows that CBLB502 protects the lungs from TNF and LPS toxicity.
- Figure 27 shows that CBLB502 protects mice from legal oral administration of Salmonella.
- Figure 28 shows that irinotecan abrogates the antitumor effect of flagellin (CBLB502).
- TLR Toll- Like Receptor
- the TLR agonist may be particularly useful in treating liver, bladder, lung, and intestinal cancers, whether primary or metastatic, as well as cancer affecting other TLR5-positive tissues.
- the TLR agonist can also be used to treat cancers that originate in tissues other than the liver, bladder, lung, intestinal, and other TLR5-positive tissues, but metastasize to these tissues.
- TLR5 Even though the metastatic cancer cells do not express TLR5, the cancer may nonetheless be treatable with the TLR agonist when the cancer has metastasized to TLR5-expressing tissues such as the liver.
- TLR agonists effectively reduce or kill cancer cells affecting a tissue that has a strong innate immunity system, thereby obviating the need for any pre-existing expression of TLR5 in the cancer cells.
- the innate immune system is sufficiently triggered so as to treat cancers that are devoid of TLR5 expression.
- TLR5 does not need to be provided to the cancer cells in order for the TLR agonist to effectively reduce or kill cancer cells.
- TLR agonist can protect the liver from a liver toxicity.
- death ligands and activators of FAS-mediated apoptosis such as FAS ligand and anti-FAS agonistic antibodies, can induce does-dependent
- TLR agonists can protect the liver against such toxicities. This unexpected property of TLR agonists allows it be combined with FAS agonists or TNF for cancer treatment, such that the adverse of effects of the FAS agonist or TNF are reduced or prevented.
- each intervening number there between with the same degree of precision is explicitly contemplated.
- the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6,9, and 7.0 are explicitly contemplated.
- administering may mean a single dose or multiple doses of an agent or agent.
- Analog may mean, in the context of a peptide or polypeptide, a peptide or polypeptide comprising one or more non-standard amino acids or other structural variations from the conventional set of amino acids.
- Antibody may mean an antibody of classes IgG, IgM, IgA, IgD or IgE, or fragments, or derivatives thereof, including Fab, F(ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof.
- the antibody may be a monoclonal antibody, polyclonal antibody, affinity purified antibody, or mixtures thereof which exhibits sufficient binding specificity to a desired epitope or a sequence derived therefrom.
- the antibody may also be a chimeric antibody.
- the antibody may be derivatized by the attachment of one or more chemical, peptide, or polypeptide moieties known in the art.
- the antibody may be conjugated with a chemical moiety.
- a “derivative” may mean a peptide or polypeptide different other than in primary structure (amino acids and amino acid analogs). Derivatives may differ by being glycosylated, one form of post-translational modification. For example, peptides or polypeptides may exhibit glycosylation patterns due to expression in heterologous systems. If at least one biological activity is retained, then these peptides or polypeptides are derivatives according to the invention.
- Other derivatives may include fusion peptides or fusion polypeptides having a covalently modified N- or C-terminus, PEGylated peptides or polypeptides, peptides or polypeptides associated with lipid moieties, alkylated peptides or polypeptides, peptides or polypeptides linked via an amino acid side-chain functional group to other peptides, polypeptides or chemicals, and additional modifications as would be understood in the art.
- a "fragment” may mean a portion of a reference peptide or polypeptide.
- a “homo log” may mean a peptide or polypeptide sharing a common evolutionary ancestor.
- a "leader sequence” may be a nucleic acid encoding any peptide sequence that is linked and translated with a peptide or polypeptide of interest to allow the peptide or polypeptide of interest be properly routed through a eukaryotic cell' s endoplasmic reticulum and Golgi complexes for the purposed of extracellular secretion from the cell's membrane.
- the leader peptide sequence may be derived from alkaline phosphatase.
- the leader sequence may have a DNA sequence comprising atgctgctgctgctgctgctgctgggcctgaggctacagctct ccctgggc.
- a liposome may mean a tiny bubble (vesicle) made out of the same material as a cell membrane.
- a liposome be filled with drugs and used to deliver drugs for cancer and other diseases.
- a liposome may be filled with a vector.
- a liposome membrane may be made of phospholipids, which are molecules that have a head group and a tail group. The head of the liposome may be attracted to water, and the tail, which is made of a long hydrocarbon chain, is repelled by water. The tails may be repelled by water, and line up to form a surface away from the water.
- the lipids in the plasma membrane may be chiefly phospholipids like
- Liposomes may be composed of naturally- derived phospholipids with mixed lipid chains (like egg phosphatidylethanolamine), or of pure surfactant components like DOPE (dioleoylphosphatidylethanolamine).
- a "peptide” or “polypeptide” may mean a linked sequence of amino acids and may be natural, synthetic, or a modification or combination of natural and synthetic.
- substantially identical may mean that a first and second amino acid sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,or 99% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids .
- Treating each may mean to alleviate, suppress, repress, eliminate, prevent or slow the appearance of symptoms, clinical signs, or underlying pathology of a condition or disorder on a temporary or permanent basis.
- Preventing a condition or disorder involves administering a agent of the present invention to a subject prior to onset of the disease.
- Suppressing a condition or disorder involves administering a agent of the present invention to a subject after induction of the condition or disorder but before its clinical appearance.
- Repressing the condition or disorder involves administering a agent of the present invention to a subject after clinical appearance of the disease.
- a “variant” may mean means a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity.
- Representative examples of "biological activity” include the ability to bind to a toll- like receptor and to be bound by a specific antibody.
- Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity.
- a conservative substitution of an amino acid i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change.
- hydrophobicity and charge It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of +2 are substituted.
- the hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity.
- U.S. Patent No. 4,554,101 incorporated fully herein by reference.
- Substitution of amino acids having similar hydrophilicity values can result in peptides retaining biological activity, for example immunogenicity, as is understood in the art. Substitutions may be performed with amino acids having hydrophilicity values within +2 of each other. Both the hyrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties.
- a "vector” may mean a nucleic acid sequence containing an origin of replication.
- a vector may be a plasmid, a yeast or a mammalian artificial chromosome.
- a vector may be a RNA or DNA vector.
- a vector may be either a self-replicating extrachromosomal vector or a vector which integrates into a host genome. 2. Toll-like Receptor Agonist
- the TLR agonist may be a PAMP, which may be conserved molecular product derived from a pathogen.
- the pathogen may be a Gram-positive bacterium, Gram-negative bacterium,, fungus, or virus.
- the TLR agonist may be a damage- associated molecular pattern (DAMP) ligand, which may be an endogenous molecule released from injured or dying cells.
- DAMP or PAMP may initiate an immune response through TLR signals and recruit adapter molecules within the cytoplasm of cells in order to propagate a signal.
- the TLR agonist may be an agonist for the TLR, which may be a ligand from the following in Table 1:
- the TLR agonist may be a fragment, variant, analog, homology or derivative of a PAMP or DAMP that binds a TLR and induces TLR-mediated activity, such as activation of NF-KB activity.
- the TLR agonsist fragment, variant, analog, homolog, or derivative may be at least 30- 99% identical to amino acids of a TLR-agonist and induce TLR-mediated activity.
- the TLR agonist may target a TLR such as TLR-5.
- the TLR agonist may be an agonist of TLR-5 and stimulate TLR-5 activity.
- the TLR agonist may be an anti-TLR5 antibody or other small molecule.
- the TLR agonist may be flagellin.
- the flagellin may also be a flagellin or flagellin-related polypeptide.
- the flagellin may be from any source, including a variety of Gram-positive and Gram-negative bacterial species.
- the flagellin may be a flagellin polypeptide from any Gram-positive or Gram-negative bacterial species including, but not limited to, a flagellin polypeptide disclosed in U.S. Pat. Pub. No. 2003/000044429, the contents of which are fully incorporated herein by reference.
- the flagellin may have an amino acid sequence from a bacterial species depicted in Figure 7 of U.S. Patent Publication No. 2003/0044429.
- the nucleotide sequences encoding the flagellin polypeptides listed in Figure 7 of U.S. 2003/0044429 are publicly available at sources including the NCBI Genbank database.
- the flagellin may also be a flagellin peptide corresponding to an Accession number listed in the BLAST results shown in Fig. 25 of U.S. Patent Pub.
- the flagellin may also be a flagellin polypeptide as disclosed in U.S. Patent Appl. Publication No. 2009/0011982, the contents of which are fully incorporated herein.
- the flagellin maybe any one of a flagellin polypeptide as disclosed in Figures 3 and 4 herein.
- the flagellin may be a fragment, variant, analog, homology or derivative of a flagellin that binds TLR5 and induces TLR5-mediated activity, such as activation of NF- ⁇ activity.
- a fragment, variant, analog, homolog, or derivative of flagellin may be at least 30-99% identical to amino acids of a flagellin that binds TLR5 and induces TLR5-mediated activity.
- the flagellin may be from a species of Salmonella, a representative example of which is S.dublin (encoded by GenBank Accession Number M84972).
- the flagellin related-polypeptide may be a fragment, variant, analog, homolog, or derivative of M84972, or combination thereof, that binds to TLR5 and induces TLR5-mediated activity, such as activation of NF-kB activity.
- a fragment, variant, analog, homolog, or derivative of flagellin may be obtained by rational-based design based on the domain structure of Flagellin and the conserved structure recognized by TLR5.
- the flagellin may comprise at least 10, 11, 12, or 13 of the 13 conserved amino acids shown in Fig. 2 (positions 89, 90, 91, 95, 98, 101, 115, 422, 423, 426, 431, 436 and 452).
- the flagellin may be at least 30-99% identical to amino acids 1 174 and 418 505 of M84972.
- the flagellin may be the major component of bacterial flagellum.
- the flagellin may be composed of three domains (Fig. 1). Domain 1 (Dl) and domain 2 (D2) may be discontinuous and may be formed when residues in the amino terminus and carboxy terminus are juxtaposed by the formation of a hairpin structure.
- the amino and carboxy terminus comprising the Dl and D2 domains may be most conserved, whereas the middle hypervariable domain (D3) may be highly variable.
- Studies with a recombinant protein containing the amino Dl and D2 and carboxyl Dl and D2 separated by an Escherichia coli hinge (ND1-2/ECH/CD2) indicate that Dl and D2 may be bioactive when coupled to an ECH element.
- This chimera may induce IkBa degradation, NF-kB activation, and NO and IL-8 production in two intestinal epithelial cell lines.
- the non-conserved D3 domain may be on the surface of the flagellar filament and may contain the major antigenic epitopes.
- the potent proinflammatory activity of flagellin may reside in the highly conserved N and C Dl and D2 regions (See Figure 1).
- the flagellin may induce NF-kB activity by binding to To 11- like receptor 5 (TLR5).
- TLR5 To 11- like receptor 5
- the TLR may recognize a conserved structure that is particular to the flagellin.
- the conserved structure may be composed of a large group of residues that are somewhat permissive to variation in amino acid content.
- Smith et al., Nat Immunol. 4: 1247-53 (2003), the contents of which are incorporated herein by reference, have identified 13 conserved amino acids in flagellin that are part of the conserved structure recognized by TLR5.
- the 13 conserved amino acids of flagellin that may be important for TLR5 activity are shown in Fig. 2.
- flagellin Numerous deletional mutants of flagellin have been made that retain at least some TLR5 stimulating activity.
- the flagellin may be such a deletional mutant, and may be a deletional mutant disclosed in the Examples herein.
- the flagellin may comprise a sequence translated from GenBank Accession number D 13689 missing amino acids 185-306 or 444-492, or from
- the flagellin may comprise transposon insertions and changes to the variable D3 domain.
- the D3 domain may be substituted in part, or in whole, with a hinge or linker polypeptide that allows the Dl and D2 domains to properly fold such that the variant stimulates TLR5 activity.
- the variant hinge elements may be found in the E.coli MukB protein and may have a sequence as set forth in International Application No. PCT/US 10/51646, filed on October 6, 2010, the contents of which are incorporated herein by reference.
- the flagellin as described above may further comprise a leader sequence.
- the flagellin further comprising a leader sequence may be CBLB502S.
- This invention also relates to an agent comprising a therapeutically effective amount of a TLR agonist.
- the agent may be a polypeptide.
- the agent may also be a vector.
- the vector may comprise a nucleic acid encoding the TLR agonist.
- the vector may be capable of transducing mammalian cells.
- the vector may be delivered into a mammalian cell by a virus or liposome related vector system.
- the virus vector system may be an adenovirus or a cytomegalovirus.
- the agent may be a liposome harboring the vector.
- the liposome maybe capable of transducing mammalian cells and delivering the vector for expression.
- the agent may be a drug formulation that activates a TLR, thereby exposing tumor or infected cells to the host immune system imitating the situation of a massive penetration through the intestinal wall.
- the agent may be delivered systematically in solution for administration such as intramuscularly.
- the agent may be a drug formulation that expresses the TLR agonist in the form of a nano-particle, which may carry a functional agonist to the cell surface of a mammalian cell.
- the agent may be a pharmaceutical agent comprising the drug formulation described above, which may be produced using methods well known in the art.
- the agent may also comprise a coagent.
- the vector may comprise a nucleic acid encoding flagellin.
- the vector may be capable of expressing flagellin using a strong promoter.
- the expression vector may further comprise a leader sequence cloned upstream of the gene encoding the TLR agonist.
- the drug formulation may be an adenovirus expressing:
- the TLR agonist delivered systematically in solution for administration, such as intramuscularly; or
- the TLR agonist expressed in the form of nano-particles carrying functional TLR agonist, such as flagellin, which may be derived from CBLB502, on their surface.
- the nano- particle may be on the basis of a bacteriophage T7, or fully formed to retain its biological activity.
- the nano-formulation may provide for dose-dependent, NF-KB-responsive reporter activation, and may result in cell internalization by endocytosis for effective immunization approach (Mobian AP-A).
- Administration of the agents using the method described herein may be systemically, orally, parenterally, sublingually, transdermally, rectally, transmuco sally, topically, via inhalation, via buccal administration, or combinations thereof.
- Parenteral administration includes, but is not limited to, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular. Administration may also be subcutaneous, intravenous, via intra-air duct, or intra-tumoral.
- the agent may be
- the agents may be administered to a human patient, cat, dog, large animal, or an avian.
- the agent may be administered as a monotherapy or simultaneously or metronomically with other treatments, which may be a surgery or removal of a tumor.
- the term "simultaneous” or “simultaneously” as used herein, means that the agent and other treatment be administered within 48 hours, preferably 24 hours, more preferably 12 hours, yet more preferably 6 hours, and most preferably 3 hours or less, of each other.
- the term “metronomically” as used herein means the administration of the agent at times different from the other treatment and at a certain frequency relative to repeat administration.
- the agent may be administered at any point prior to another treatment including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, l lO hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36
- the agent may be administered at any point prior to a second treatment of the agent including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 h
- the agent may be administered at any point after another treatment including about lmin, 2 mins., 3 mins., 4 mins., 5 mins., 6 mins., 7 mins., 8 mins., 9 mins., 10 mins., 15 mins., 20 mins., 25 mins., 30 mins., 35 mins., 40 mins., 45 mins., 50 mins., 55 mins., 1 hr, 2 hr, 3 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 14 hr, 16 hr, 18 hr, 20 hr, 22 hr, 24 hr, 26 hr, 28 hr, 30 hr, 32 hr, 34 hr, 36 hr, 38 hr, 40 hr, 42 hr, 44 hr, 46 hr, 48 hr, 50 hr, 52 hr, 54 hr
- the agent may be administered at any point prior after a second treatment of the agent including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 h
- the method may comprise administering the agent.
- Agents provided herein may be in the form of tablets or lozenges formulated in a conventional manner.
- tablets and capsules for oral administration may contain conventional excipients may be binding agents, fillers, lubricants, disintegrants and wetting agents.
- Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone.
- Fillers may be lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol.
- Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica.
- Disintegrants may be potato starch and sodium starch glycollate.
- Wetting agents may be sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.
- Agents provided herein may also be liquid formulations such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. The agents may also be formulated as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain additives such as suspending agents, emulsifying agents, nonaqueous vehicles and preservatives.
- Suspending agent may be sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydro xyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats.
- Emulsifying agents may be lecithin, sorbitan monooleate, and acacia.
- Nonaqueous vehicles may be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol.
- Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid.
- Agents provided herein may also be formulated as suppositories, which may contain suppository bases such as cocoa butter or glycerides. Agents provided herein may also be formulated for inhalation, which may be in a form such as a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. Agents provided herein may also be formulated as transdermal formulations comprising aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
- aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
- Agents provided herein may also be formulated for parenteral administration such as by injection, intratumor injection or continuous infusion.
- Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents.
- the agent may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.
- Agents provided herein may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection.
- the agents may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example), c.
- the method may comprise administering a therapeutically effective amount of the agent to a patient in need thereof.
- the therapeutically effective amount required for use in therapy varies with the nature of the condition being treated, the length of time desired to activate TLR activity, and the age/condition of the patient.
- doses employed for adult human treatment typically are in the range of 0.001 mg/kg to about 200 mg/kg per day.
- the dose may be about 1 mg/kg to about 100 mg/kg per day.
- the desired dose may be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day. Multiple doses may be desired, or required.
- the dosage may be at any dosage such as about 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1 mg/kg, 25 mg/kg, 50 mg/kg, 75 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 225 mg/kg, 250 mg/kg, 275 mg/kg, 300 mg/kg, 325 mg/kg, 350 mg/kg, 375 mg/kg, 400 mg/kg, 425 mg/kg, 450 mg/kg, 475 mg/kg, 500 mg/kg, 525 mg/kg, 550 mg/kg, 575 mg/kg, 600 mg/kg, 625 mg/kg, 650 mg/kg, 675 mg/kg, 700 mg/kg, 725 mg/kg, 750 mg/kg, 775 mg/kg, 800 mg/kg, 825 mg/kg,
- the agent may be administered as a monotherapy, under which the agent is not administered together with any other type of cancer treatment, such as chemotherapy, radiation therapy, another biological therapy, or other combination therapies; provided that "monotherapy” may include administration of the agent together with surgical treatment.
- the agent may be administered in combination with a surgery, which may be tumor removal.
- the agent may be administered prior to, together with, or after the surgery.
- the agent may be administered during the surgery.
- a method for treating cancer which may be present in a tissue that expresses a TLR such as TLR5, by administering to a mammal in need thereof the agent.
- the cancer may be a tumor or a metastatic cancer.
- the cancer may also be present in liver, bladder, lung, or intestinal tissue, and also may have originated in another type of tissue such as colon, breast, or prostate.
- the cancer may also be melanoma or a hematological malignancy such as lymphoma.
- the cancer may also be any cancer that has metastasized to a TLR-expressing tissue, such as liver, lung, bladder, intestine, or other TLR-expressing tissue.
- the cancer may be a TLR-negative cancer, and thus lack expression of a Toll-Like Receptor.
- the cancer may lack both endogenous and exogenous expression of the Toll-Like Receptor.
- the method may comprise a step of not providing the Toll- Like Receptor to the cancer, which may include not providing the Toll- Like Receptor either exogenously or endogenously.
- the cancer may lack any and all Toll- Like Receptor expression.
- the Toll- Like Receptor may recognize molecules that are conserved molecular products derived from pathogens that include Gram-positive, Gram-negative bacteria, fungi, and viruses, but are distinguishable from host molecules, collectively referred to as pathogen- associated molecular patterns (PAMPs).
- PAMPs pathogen-associated molecular patterns
- DAMPs damage-associated molecular pattern
- a PAMP or DAMP may be a TLR agonist as further described below.
- the TLR may be a fragment, variant, analog, homo log or derivative that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal.
- the TLR may be from a human or other mammalian species such as rhesus monkey, mouse, or rat.
- the TLR may be at least 30- 99% identical to a TLR that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal.
- the TLR may be one of the between ten and fifteen types of TLR that are estimated to exist in most mammalian species.
- the TLR may be one of the 13 TLR (named simply TLR1 to TLR13) that have been identified in humans and mice together, or may be an equivalent form that has been found in other mammalian species.
- the TLR may be one of the 11 members (TLR1-TLR11) that have been identified in humans.
- the TLR may ordinarily be expressed by different types of immune cells, and may be located on the cell surface or in the cell cytoplasm.
- the TLR may ordinarily be expressed on cancer cells.
- the TLR may ordinarily be expressed by normal epithelial cells in the digestive system, normal keratinocytes in the skin, alveolar and bronchial epithelial cells, and epithelial cells of the female reproductive tract. These cells lining an organ may be the first line of defense against invasion of microorganisms, and TLRs ordinarily expressed in epithelial cells may have a crucial role in the regulation of proliferation and apoptosis.
- the TLR may not be expressed by the cancer cells.
- the TLR- negative cancer cells may not express any TLR mRNA, may not express any TLR protein, or may not express any functional TLR protein.
- the TLR protein may not function due to reduced ability to bind a TLR ligand or reduced ability to transmit downstream signals triggered by ligand binding.
- the TLR- negative cancer cells may also have reduced levels of TLR mRNA, protein, or TLR function. The reduction may be 100%, or by more than 99.9%, 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, or 50%, as compared to a normal cell from the tissue from which the cancer cell originated, or as compared to another, known TLR-expressing cell type.
- the TLR- expressing cell may be a normal cell or a tumor cell, such as a tumor cell line or tumor xenograft.
- the TLR ordinarily expressed on cancer cells may upregulate the NF- ⁇ cascade and produce anti-apoptotic proteins that contribute to carcinogenesis and cancer cell proliferation.
- TLR signaling pathways are known to be involved in signaling. These proteins are known as myeloid differentiation factor 88 (MyD88), Tirap (also called Mai), Trif, and Tram.
- MyD88 myeloid differentiation factor 88
- Tirap also called Mai
- Trif Trif
- the adapters activate other molecules within the cell, including certain protein kinases (IRAKI, IRAK4, TBK1, and IKKi) that amplify the signal, and ultimately lead to the induction or suppression of genes that orchestrate the inflammatory response.
- IRAKI, IRAK4, TBK1, and IKKi protein kinases
- TLR signaling pathways during pathogen recognition may induce immune reactions via extracellular and intracellular pathways mediated by MyD88, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-KB), and mitogen-associated protein kinase (MAPK).
- NF-KB nuclear factor kappa-light-chain-enhancer of activated B cells
- MAPK
- TLRs together with the Interleukin- 1 receptors form a receptor superfamily, known as the "Interleukin- 1 Receptor/To 11- Like Receptor Superfamily.” All members of this family have in common a so-called TIR (Toll-IL-1 receptor) domain. Three subgroups of TIR domains may exist. Proteins with subgroup I TIR domains are receptors for interleukins that are produced by macrophages, monocytes and dendritic cells and all have extracellular Immunoglobulin (Ig) domains. Proteins with subgroup II TIR domains are classical TLRs, and bind directly or indirectly to molecules of microbial origin.
- a third subgroup of proteins containing TIR domains (III) consists of adaptor proteins that are exclusively cytosolic and mediate signaling from proteins of subgroups 1 and 2.
- the TLR may be a fragment, variant, analog, homo log or derivative that retains either a subgroup I TIR domain, subgroup II TIR domain, or subgroup III TIR domain.
- the TLR may function as a dimer.
- TLR2 forms heterodimers with TLR1 or TLR6, each dimer having a different ligand specificity.
- the TLR may also depend on other co-receptors for full ligand sensitivity, such as in the case of TLR4's recognition of LPS, which requires MD-2.
- CD 14 and LPS Binding Protein (LBP) are known to facilitate the presentation of LPS to MD-2.
- the TLR may be TLR1, which recognizes PAMPs with a specificity for gram-positive bacteria. TLR1 has also been designated as CD281.
- the TLR may be Toll- Like Receptor 5.
- the protein encoded by the TLR5 may play a fundamental role in pathogen recognition and activation of innate immunity.
- TLR5 may recognize PAMPs that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity.
- TLR5 may recognize bacterial flagellin, a principal component of bacterial flagella and a virulence factor.
- the activation of the TLR5 may mobilize the nuclear factor NF- ⁇ and stimulate tumor necrosis factor-alpha production.
- the cancer may be a primary cancer or a metastatic cancer.
- the primary cancer may be an area of cancer cells at an originating site that becomes clinically detectable, and may be a primary tumor.
- the metastatic cancer may be the spread of a disease from one organ or part to another non-adjacent organ or part.
- the metastatic cancer may be caused by a cancer cell that acquires the ability to penetrate and infiltrate surrounding normal tissues in a local area, forming a new tumor, which may be a local metastasis.
- the metastatic cancer may also be caused by a cancer cell that acquires the ability to penetrate the walls of lymphatic and/or blood vessels, after which the cancer cell is able to circulate through the bloodstream (thereby being a circulating tumor cell) to other sites and tissues in the body.
- the metastatic cancer may be due to a process such as lymphatic or hematogeneous spread.
- the metastatic cancer may also be caused by a tumor cell that comes to rest at another site, re-penetrates through the vessel or walls, continues to multiply, and eventually forms another clinically detectable tumor.
- the metastatic cancer may be this new tumor, which may be a metastatic (or secondary) tumor.
- the metastatic cancer may be caused by tumor cells that have metastasized, which may be a secondary or metastatic tumor.
- the cells of the metastatic tumor may be like those in the original tumor.
- the secondary tumor while present in the liver, is made up of abnormal breast or colon cells, not of abnormal liver cells.
- the tumor in the liver may thus be a metastatic breast cancer or a metastatic colon cancer, not liver cancer.
- the metastatic cancer may have an origin from any tissue.
- the metastatic cancer may originate from melanoma, colon, breast, or prostate, and thus may be made up of cells that were originally skin, colon, breast, or prostate, respectively.
- the metastatic cancer may also be a hematological malignancy, which may be lymphoma.
- the metastatic cancer may invade a tissue such as liver, lung, bladder, or intestinal. The invaded tissue may express a TLR, while the metastatic cancer may or may not express a TLR.
- the method may also comprise co-administration of the TLR agonist with an anti-cancer therapy.
- the anti-cancer therapy may be FAS ligand, a FAS agonistic antibody, TNFa, a TNFa agonistic antibody, TRAIL, or a TRAIL agonistic antibody.
- the TLR5 agonist may be used to sensitize the cancer to the anti-cancer therapy.
- the method may also be combined with other methods for treating cancer, including use of an immuno stimulant, cytokine, or
- the immuno stimulant may be a growth hormone, prolactin or vitamin D.
- Also provided herein is a method of reducing cancer recurrence, comprising
- the cancer may be or may have been present in a tissue that either does or does not express TLR, such as TLR5.
- TLR5 tissue that either does or does not express TLR
- the cancer, tissue, TLR, mammal, and agent may be as described above.
- the method may also prevent cancer recurrence.
- the cancer may be an oncological disease.
- the cancer may be a dormant tumor, which may result from the metastasis of a cancer.
- the dormant tumor may also be left over from surgical removal of a tumor.
- the cancer recurrence may be tumor regrowth, a lung metastasis, or a liver metastasis.
- the mammal may have a fully- functional immune system, and may not be
- the mammal may also have a level of immunity that is equivalent to the level sufficient to make the mammal eligible for a first or second round a chemotherapy.
- the mammal may not have a low white blood cell count, which may be chemotherapy- induced.
- the low white blood cell count may be caused by the loss of healthy cells during chemotherapy. The loss may be an expected side effect of a chemotherapy drug.
- the low white blood cell count may be a severe immunosuppression caused by chemotherapy.
- the low white blood cell count may compromise the antitumor effect of the agent.
- the low white blood cell count may be restored 7-14 days after a chemotherapy treatment.
- the mammal may have a white blood cell count that is within a normal range.
- the mammal may also have a white blood cell count that is indicative of mild immunosuppression.
- the mammal may have not received chemotherapy treatment for 7-14 days, or at least 14 days.
- the mammal may also have total white blood cell count of at least 3000 or 3500 cells/ml of whole blood; a granulocyte count of at least 1800 or 2100 cells/ml of whole blood; or an albumin level of at least 3.0 or 3.5 g/100 ml of whole blood.
- the white blood cell count, granulocyte count, or albumin level may also fall within +/- 5%, 10%, 20%, 30%, 40%, or 50% of these levels.
- the liver toxicity may also be a Salmonella infection, which may be from Salmonella typhimurium.
- the agent may also be used to protect against liver toxicity that may be FAS- mediated.
- the toxicity may also be FAS ligand, a FAS agonistic antibody, TNFa,
- acetaminophen a compound selected from the group consisting of acetaminophen, alcohol, a viral infection of the liver, or a chemotherapeutic agent.
- the agent may be administered to the mammal.
- TLR5 An agonist of TLR5 protects liver from hepatotoxicity
- CBLB502 which is a pharmacologically optimized TLR5 agonist, is a powerful radioprotectant due to, at least in part, inhibition of apoptosis in radiosensitive tissues.
- CBLB502 was tested for liver protection from Fas-mediated apoptosis. The following examples demonstrate that upon stimulation with CBLB502 the TLR5 pathway is active in liver hepatocytes of mice and humans leading to NF-kB -dependent induction of genes encoding anti- apoptotic proteins. Pretreatment of mice with CBLB502 protected them from lethal doses of Fas agonistic antibodies, reduced Fas-induced elevation of liver enzymes in the blood, caspase activity in liver extracts and preserved liver tissue integrity. CBLB502 did not protect tumors in syngeneic melanoma and colon carcinoma mouse models. These observations support the use of Fas agonists for cancer treatment under the protection of a TLR5 agonist, such as CBLB502.
- NF-kB response was compared in different organs after administration of TLR5 agonist CBLB502 and TLR4 agonist LPS, another known activator of NF-kB.
- CBLB502 was found to induce fast direct activation of NF-kB in hepatocytes, while LPS activation of NF-kB in hepatocytes was mediated through different types of cells. The following data thus also demonstrate that pre-treatment with CBLB502 can reduce Fas-mediated hepatotoxicity during anti-cancer therapy in mice.
- TLR5 toll- like receptor-5
- NF-kB response was investigated in different organs of mice to TLR5 agonist CBLB502 in comparison with bacterial LPS acting through TLR4.
- NF-kB dependent luciferase reporter Xenogen mouse model in which luciferase transgene is expressed under the control of NFkB- dependent natural promoter of IkBa gene (Zhang N, et al, 2005).
- NFkB- activating agents luciferase activity was increased in cells and tissues that respond to a given agent.
- detected strong activation of NF-kB in liver of mice was detected 2 hours after s.c.
- the anti-Fas antibodies can induce dose- dependent hepatotoxicity and rapidly kill mice by inducing apoptosis, liver tissue necrosis and hemorrhage (Ogasawara J et al, Nature 1993, Nishimura et al 1997).
- NF-kB activation in hepatocytes induced by TLR5 agonist CBLB502 may protect liver from Fas mediated apoptosis.
- 4 ⁇ g of anti-Fas antibodies (clone Jo2) injected i.p.
- CBLB502 injected mice had much less damage to the liver that deflected in better overall survival after injections of about than 80% of NIH-Swiss mice when injected 30 min before anti- Fas antibodies (Figure 8 A). All mice survived when CBLB502 was injected 2 hours before antibodies. The protection level then declined by 6 hours time-point of pre-treatment.
- Caspases 3 and 7 are downstream targets of both intrinsic (mitochondrial) and extrinsic (caspase) Fas-mediated apoptosis signaling. Upon activation of the receptor, first caspase-8 becomes phosphorylated and cleaved leading to activation of mitochondrial apoptotic
- caspase 8 activation was reduced to a background level, as indicated by using fluorigenic substrate assay (Fig. 8F).
- CBLB502 also quickly induced RNA expression of another anti-apoptotic protein immediate early response protein IER-3 (Figure 9C, IEX-1 is an alternative name) that was shown suppressing the production of reactive oxygen species and mitochondrial apoptotic pathway (Shen et al 2009).
- RT-PCR analysis of liver samples revealed the induction of IER-3 RNA expression by CBLB502 already 30 min after administration with significant increase by 2 hours.
- proteins of MAPK pathway were found up-regulated in livers of CBLB502 treated mice. It was demonstrated that activation of MAPK pathway in tumors mediates the resistance of these cells to Fas receptor apoptosis (REF).
- LPS is not a good candidate for clinical application, since it induces strong inflammation in many organs and can be directly cytotoxic through FADD/caspase-8 apoptotic pathway (REFs).
- CBLB502 in its turn has been tested in mice, non-human primates and human healthy volunteers and found to be a rather mild inducer of short-lasting inflammation.
- FADD/caspase-8 apoptotic pathway FADD/caspase-8 apoptotic pathway
- CBLB502 does not protect tumors from anti-Fas antibodies toxicity and can even slightly enhance Fas mediated antitumor effect against CT-26 tumors.
- the simultaneous protection of normal liver tissue from Fas mediated toxicity may allow increasing the amount of the Fas agonist reaching complete prevention of liver metastases and the therapeutic effect against s.c. growing tumors.
- mice were purchased from NCI (Frederick, MD), BALB/c and C57B1/6 female mice were purchased from Jackson Laboratory (Bar Harbor, ME). All mice were used in the experiments at the age of 10-14 weeks old.
- Balb/C-Tg(lKBa-luc)Xen mice with NF- kB inducible luciferase reporter gene were originally purchased from Xenogen (Alameda, CA) and bred in our domestic colony.
- CBLB502 a bacterial flagellin derivative, was obtained from Cleveland BioLabs, Inc.
- Bacterial lipopolysacharide (LPS) from Escherichia coli 055 :B5 was purchased from Sigma.
- samples of liver, lungs, kidney, spleen, heart and intestine from NF-kB reporter mice injected s.c. with 100 ⁇ of either PBS, CBLB502 (0.2 mg/kg) or LPS (1 mg/kg) were obtained 2, 6 and 24 h after injections (Fig. 7B, 10).
- Tissue samples were covered with lysis buffer containing proteinase inhibitor cocktail (according to manufacture's recommendation, Calbiochem) to get 100 mg tissue per 1 ml lysis buffer. This was followed by homogenization and centrifugation at 14,000 rpm for 10 min at 4C.
- Luciferase activity was measured in 20 ⁇ of samples immediately after adding 30 ⁇ of luciferin reagent (Bright-Glo Luciferase Assay System, Promega). Luciferase activity was normalized per g of the protein extract. Luciferase fold induction was calculated as ratio between average luciferase units in livers of the TLR ligand treated mice and that obtained from PBS injected control mice.
- NIH-Swiss mice were injected i.p. with 2, 3, 4, and 5 ⁇ g of anti-Fas antibodies in 200 ⁇ of PBS to determine a 100% lethal dose that was found to be 4 ⁇ g/ mouse for this mouse strain. Then CBLB502 (0.04 mg/kg, s.c.) was injected s.c. 30 min, 2 hours and 6 hours before 4 ⁇ g of anti-Fas antibodies (i.p.) (Fig. 8A). Usually death from anti-Fas hepatotoxicity occurs during first 1-2 days after antibody injections. Mouse survival was observed and recorded during 30 days.
- TUNEL indirect terminal deoxynucleotidyl transferase mediated deoxyuridine tri-phosphate nick end labeling
- liver specimens were collected from NIH-Swiss mice five hours (Fig. 2C) or in dynamics of 5, 12 and 26 hours (Fig. S3) after anti-Fas antibody injections with or without pre- treatment with CBLB502 (0.04 mg/kg) 30 minutes before antibodies. Mice that were not treated ("intact") were used as controls. Tissue specimens were fixed in 10% buffered formalin, embedded in paraffin, sectioned and processed with H&E staining.
- Livers were cut to small pieces and homogenized with a tissue grinder (Bullet Blender, NextAdvance) in the buffer (lOmM Hepes, 0.4mM EDTA, 0.2% CHAPS, 2% glycerol), supplemented with 2mM DTT. All steps were performed on ice. Liver homogenates were centrifuged for 20 min at 13,000 xg, and supernatant was stored at -20°C.
- Caspase activities were determined by incubation of liver homogenate (containing 50 ⁇ g of total protein) with 50 ⁇ of the fluorogenic substrate acetyl- Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-aminomethylcoumarin (Ac-DEVD-amc) (ENZO, LifeSciences) in 200 ⁇ cell-free system buffer containing 10 mM HEPES, 0.4mM EDTA, 0.2% CHAPS, 2% glycerol and 2 mM DTT. The release of fluorescent amc was measured after at time 0 and 2 hours of incubation at 37°C by fluorometry (Ex: 355, Em: 485) (Victor3, PerkinElmer). Data are shown as the difference between twp and zero hours ( Figure 8E).
- ALT alanine-aminotransferase
- NIH-Swiss mice (3 per group) were injected s.c. with 1 ⁇ g CBLB502 30 min before anti- Fas antibodies.
- the alanine aminotransferase (ALT) presence in mouse serum was determined using commercial enzyme assays according to the manufacturer's instructions (Stanbio
- Total protein was isolated from treated and untreated mouse liver using RIPA buffer (Sigma- Aldrich St. Louis, MO) supplemented with protease inhibitor cocktail (Sigma- Aldrich St. Louis, MO).
- the protein extracts were separated by electrophoresis in denaturing 4 to 20% polyacrylamide Novex gels (Invitrogen, Carlsbad, CA) and transferred to nylon polyvinylidene difluoride (PVDF) membranes (Immobilon-P, Millipore Billerica MA).
- PVDF nylon polyvinylidene difluoride
- the following antibodies were used: Caspase-8 antibody (Calbiochem, Darmstadt, Germany), anti-BID (AbCam,
- HRP horseradish peroxidase
- GAPDH was used as a control to monitor the induction of gene expression.
- the primers were designed using LaserGene software (DNASTAR, Inc., Madison, WI) and then UCSC Genome Browser In- Silico PCR website was used to check for locating primers.
- Primers specific for the IER3 gene GenBank Accession No. NM_133662.2
- Bcl2AlB gene GenBank Accession No.
- NM_007534.3 (sense 5 ' -TAGGTGGGCAGCAGCAGTCA-3 ' and antisense 5'- CTCCATTCCGCCGTATCCAT-3'), Bcl2AlD gene (GenBank Accession No. NM_007536.2) (sense 5 ' -TCTAGGTGGGCAGCAGCAGTC-3 ' and antisense 5'-
- CT-26 s.c. growing tumors
- experimental liver metastatic model of CT-26 tumors CT-26 cells were transduced with lentiviral vector carrying luciferase gene under CMV promoter for constitutive expression of luciferase.
- Tumors were induced by s.c. injections of CT-26 tumor cells (2.5x105/ 100 ⁇ ) in both flanks of BALB/c mice. When the tumors reached about 4-5 mm in diameter, the mice were randomly divided into three groups and treatment was initiated.
- mice One group of mice was injected i.p. with anti-Fas antibodies (4 ⁇ g/mouse), another was treated with CBLB502 (1 ⁇ g/mouse) 24 h and 1 h before anti-Fas antibody injection (4 ⁇ g/mouse).
- Control mice ('intact') received PBS injections s.c. and i.p. in replace of CBLB502 and antibodies.
- Statistical difference between tumor volumes was estimated using ANOVA one-way analysis of variances (p ⁇ 0.05).
- liver tumor growth For the development of liver tumor growth, CT-26 tumor cells (2x105 /50 ⁇ ) were injected directly into spleen followed by splenectomy 5 min later. Mice were treated with anti-Fas antibodies and combination of CBLB502 with antibodies the same way as described for s.c. tumors starting on day 5 after tumor cell inoculation.
- Noninvasive bioluminescent imaging of mice anesthetized with isoflurane and injected with D-luciferin (3 mg/ 100 ⁇ , i.p.) was performed using Xenogen IVIS Imaging System 100 series on the days 14, 17, 22 and 28 after tumor cell injection. Mice were sacrificed when tumor growth in liver was determined. Statistical comparison of liver tumor-free curves was done using log-rank (Mantel-Cox) test (p ⁇ 0.05) (Fig. 9G).
- CBLB502 Antitumor activity of CBLB502 in Fischer rats bearing s.c. advanced Ward colorectal carcinoma.
- CBLB-502 was administered by i.p. once a day for 5 days (0.2 mg/kg x 5 doses) initiated 5 days after tumor transplantation into 4 rats.
- Control 4 rats received PBS injection as a vehicle control. Tumor weight was measured daily. Complete response (tumor complete disappearance) was observed in 3 rats treated with CBLB502 ( Figure 19). The fourth rat in this group had tumor growth similar to rats in the control group.
- A549- shTLR5 vs. A549-shV The effect of CBLB502 injections on A549 tumors differing in TLR5 expression (A549- shTLR5 vs. A549-shV).
- A549 cells expressing Firefly luciferase gene under the control of NF-kB promoter (Cellecta, Mountain View, CA) were transduced with lentiviral pLKOl-puro vector expressing shRNA specific to human TLR5 gene [CCG-GCC-TTG-CCT-ACA-ACA-AGA-TAA-ACT-CGA-GTT-TAT-CTT-GTT-GTA-GGC- AAG-GTT-TTT-G] or control empty vector (shV, Sigma- Aldrich, St.
- A549-shV and A549-shTLR5 cells were tested for NF-kB activation in response to CBLB502 treatment using luciferase reporter assay according to manufacture protocol (Promega, Cat#E4530, Madison, WI). Then A549-shV and A549-shTLR5 cells (1x106 /100 ⁇ of PBS) were injected s.c. into 2 flanks of 20 athymic nude mice to induce tumors. Mice bearing s.c.
- H1299-control vs. H1299-TLR5 The effect of CBLB502 injections on H1299 tumors differing in TLR5 expression.
- H1299 cells originally TLR5 negative
- lentriviral construct expressing human TLR5 gene.
- the functional activity of TLR5 was checked by IL-8 production in response to CBLB502 treatment.
- both tumor cell types lxlO 6 /100 ⁇ of PBS
- mice bearing were treated with either CBLB502 or PBS acting as control.
- Table 2 shows the spectrum of genes transcriptionally activated by CBLB502 in target organs of mice (bladder results are shown). Genes that are strongly upregulated in bladders of mice treated with CBLB502, 1 and 3 hrs post- injection, are clustered according to their function. The largest group consists of chemokines, cytokines and their receptors indicative of activation of innate immunity mobilizing mechanisms.
- CT-26 tumor cells which do not express TLR5
- Tumor bearing mice were treated with CBLB502 (0.04 mg/kg, s.c.) given twice 24 hour apart. The volumes of s.c. growing tumors in treated mice were compared with tumors growing in the intact mice. Pre-treatment with CBLB502 did not have any effect on tumor growth.
- CT26 tumor growth was tested in the experimental model of liver metastases induced by intrasplenic injection of luciferase expressing CT-26 tumor cells ( Figures 23B and C) and A20 lymphoma cells ( Figure 23D) followed by splenectomy.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Reproductive Health (AREA)
- Toxicology (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Dermatology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (21)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020137021035A KR20140030132A (ko) | 2011-01-10 | 2012-01-10 | 암을 치료하기 위한 톨-유사 수용체 효능제의 용도 |
| AU2012205681A AU2012205681B2 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
| US13/979,104 US9376473B2 (en) | 2011-01-10 | 2012-01-10 | Use of Toll-Like Receptor agonist for treating cancer |
| SG2013051396A SG191830A1 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
| JP2013548628A JP6041444B2 (ja) | 2011-01-10 | 2012-01-10 | 癌を治療するためのToll様受容体アゴニストの使用 |
| NZ612615A NZ612615B2 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
| CA2824438A CA2824438A1 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
| EA201390843A EA026524B1 (ru) | 2011-01-10 | 2012-01-10 | Применение агониста toll-подобного рецептора для лечения рака |
| BR112013017283A BR112013017283A2 (pt) | 2011-01-10 | 2012-01-10 | uso de agonista de receptor do tipo toll para tratamento de câncer |
| CN201280009451.0A CN103476458B (zh) | 2011-01-10 | 2012-01-10 | Toll样受体激动剂治疗癌症的用途 |
| PH1/2013/501422A PH12013501422A1 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
| MX2013007967A MX361355B (es) | 2011-01-10 | 2012-01-10 | Uso del agonista del receptor tipo toll para el tratamiento del cáncer. |
| EP12734417.4A EP2663367A4 (en) | 2011-01-10 | 2012-01-10 | USE OF GREAT-SIMILAR RECEPTOR AGONISTS FOR THE TREATMENT OF CANCER |
| ARP120102493A AR087114A1 (es) | 2012-01-10 | 2012-07-10 | Uso del agonista del receptor tipo toll para el tratamiento del cancer, metodo de tratamiento |
| IL227308A IL227308A (en) | 2011-01-10 | 2013-07-03 | Use of tlr receptor agonist to prepare a cancer treatment drug |
| US14/949,441 US20160206690A1 (en) | 2011-01-10 | 2015-11-23 | Use of toll-like receptor agonist for treating cancer |
| US15/241,757 US20170065692A1 (en) | 2011-01-10 | 2016-08-19 | Use of toll-like receptor agonist for treating cancer |
| US15/631,427 US10034926B2 (en) | 2011-01-10 | 2017-06-23 | Use of toll-like receptor agonist for treating cancer |
| US16/014,419 US10265390B2 (en) | 2011-01-10 | 2018-06-21 | Use of toll-like receptor agonist for treating cancer |
| US16/279,457 US10780152B2 (en) | 2011-01-10 | 2019-02-19 | Use of toll-like receptor agonist for treating cancer |
| US16/934,556 US11628201B2 (en) | 2011-01-10 | 2020-07-21 | Use of toll-like receptor agonist for treating cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161431313P | 2011-01-10 | 2011-01-10 | |
| US61/431,313 | 2011-01-10 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/979,104 A-371-Of-International US9376473B2 (en) | 2011-01-10 | 2012-01-10 | Use of Toll-Like Receptor agonist for treating cancer |
| US14/949,441 Continuation US20160206690A1 (en) | 2011-01-10 | 2015-11-23 | Use of toll-like receptor agonist for treating cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012097012A1 true WO2012097012A1 (en) | 2012-07-19 |
Family
ID=46507417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/020844 Ceased WO2012097012A1 (en) | 2011-01-10 | 2012-01-10 | Use of toll-like receptor agonist for treating cancer |
Country Status (15)
| Country | Link |
|---|---|
| US (7) | US9376473B2 (https=) |
| EP (1) | EP2663367A4 (https=) |
| JP (1) | JP6041444B2 (https=) |
| KR (1) | KR20140030132A (https=) |
| CN (1) | CN103476458B (https=) |
| AU (1) | AU2012205681B2 (https=) |
| BR (1) | BR112013017283A2 (https=) |
| CA (1) | CA2824438A1 (https=) |
| CL (1) | CL2013002001A1 (https=) |
| CO (1) | CO6781506A2 (https=) |
| EA (1) | EA026524B1 (https=) |
| IL (1) | IL227308A (https=) |
| MX (2) | MX361355B (https=) |
| SG (1) | SG191830A1 (https=) |
| WO (1) | WO2012097012A1 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014098649A1 (en) * | 2012-12-18 | 2014-06-26 | Obschestvo S Ogranichennoy Otvetstvennostyu "Panacela Labs" | Compositions and methods using toll-like receptor 5 and toll-like receptor agonist |
| WO2018160090A1 (ru) | 2017-02-28 | 2018-09-07 | Александр Васильевич ИВАЩЕНКО | Противовирусная композиция и способ ее применения |
| US10717767B2 (en) | 2017-07-20 | 2020-07-21 | Spogen Biotech, Inc. | Bioactive polypeptides for improvements in plant protection, growth and productivity |
| US11419931B2 (en) | 2018-03-19 | 2022-08-23 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US12178788B2 (en) | 2015-03-16 | 2024-12-31 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist |
| US12214048B2 (en) | 2016-03-16 | 2025-02-04 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for use in medicine |
| US12220387B2 (en) | 2016-09-21 | 2025-02-11 | Amal Therapeutics Sa | Fusion comprising a cell penetrating peptide, a multi epitope and a TLR peptide agonist for treatment of cancer |
| EP4620482A1 (en) * | 2024-03-18 | 2025-09-24 | Istituto Europeo di Oncologia S.r.l. | Flagellin-related peptides and uses thereof |
| WO2025196053A1 (en) | 2024-03-18 | 2025-09-25 | Istituto Europeo Di Oncologia S.R.L. | Flagellin-related peptides and uses thereof |
| US12440536B2 (en) * | 2018-05-18 | 2025-10-14 | The University Of Hong Kong | Compositions of toll-like receptor 5 (TLR5) agonist and methods of use thereof |
Families Citing this family (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080058282A1 (en) | 2005-08-30 | 2008-03-06 | Fallon Joan M | Use of lactulose in the treatment of autism |
| US8658163B2 (en) | 2008-03-13 | 2014-02-25 | Curemark Llc | Compositions and use thereof for treating symptoms of preeclampsia |
| US8084025B2 (en) | 2008-04-18 | 2011-12-27 | Curemark Llc | Method for the treatment of the symptoms of drug and alcohol addiction |
| US10776453B2 (en) | 2008-08-04 | 2020-09-15 | Galenagen, Llc | Systems and methods employing remote data gathering and monitoring for diagnosing, staging, and treatment of Parkinsons disease, movement and neurological disorders, and chronic pain |
| CA2747611C (en) | 2009-01-06 | 2019-09-17 | Curemark Llc | Compositions and methods for the treatment or prevention of staphylococcus aureus infections and for the eradication or reduction of staphylococcus aureus on surfaces |
| WO2010080835A1 (en) | 2009-01-06 | 2010-07-15 | Curemark Llc | Compositions and methods for the treatment or the prevention oral infections by e. coli |
| US9056050B2 (en) | 2009-04-13 | 2015-06-16 | Curemark Llc | Enzyme delivery systems and methods of preparation and use |
| US9511125B2 (en) | 2009-10-21 | 2016-12-06 | Curemark Llc | Methods and compositions for the treatment of influenza |
| WO2012097012A1 (en) * | 2011-01-10 | 2012-07-19 | Cleveland Biolabs, Inc. | Use of toll-like receptor agonist for treating cancer |
| JP5976100B2 (ja) | 2011-04-21 | 2016-08-23 | キュアマーク リミテッド ライアビリティ カンパニー | 神経精神障害の処置のための化合物 |
| GB201112091D0 (en) | 2011-07-14 | 2011-08-31 | Gt Biolog Ltd | Bacterial strains isolated from pigs |
| GB201117313D0 (en) | 2011-10-07 | 2011-11-16 | Gt Biolog Ltd | Bacterium for use in medicine |
| US10350278B2 (en) | 2012-05-30 | 2019-07-16 | Curemark, Llc | Methods of treating Celiac disease |
| GB201306536D0 (en) | 2013-04-10 | 2013-05-22 | Gt Biolog Ltd | Polypeptide and immune modulation |
| CN104258375A (zh) * | 2014-09-18 | 2015-01-07 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | 辐抗肽蛋白的新用途 |
| AR103260A1 (es) | 2014-12-23 | 2017-04-26 | 4D Pharma Res Ltd | Modulación inmunitaria |
| EP3400953A1 (en) | 2014-12-23 | 2018-11-14 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| WO2016203221A1 (en) | 2015-06-15 | 2016-12-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| MA41010B1 (fr) | 2015-06-15 | 2020-01-31 | 4D Pharma Res Ltd | Compositions comprenant des souches bactériennes |
| NZ737752A (en) | 2015-06-15 | 2022-02-25 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| SMT201900588T1 (it) | 2015-06-15 | 2019-11-13 | 4D Pharma Res Limited | Blautia stercoris e wexlerae per uso nel trattamento di malattie infiammatorie ed autoimmuni |
| MA41060B1 (fr) | 2015-06-15 | 2019-11-29 | 4D Pharma Res Ltd | Compositions comprenant des souches bactériennes |
| CN108513545B (zh) | 2015-11-20 | 2020-11-03 | 4D制药研究有限公司 | 包含细菌菌株的组合物 |
| GB201520497D0 (en) | 2015-11-20 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| GB201520638D0 (en) | 2015-11-23 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| GB201520631D0 (en) | 2015-11-23 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| ME03487B (me) | 2016-03-04 | 2020-01-20 | 4D Pharma Plc | Kompozicije koje sadrže blautia bakterijske sojeve za liječenje visceralne hipersenzitivnosti |
| GB201612191D0 (en) | 2016-07-13 | 2016-08-24 | 4D Pharma Plc | Compositions comprising bacterial strains |
| TWI802545B (zh) | 2016-07-13 | 2023-05-21 | 英商4D製藥有限公司 | 包含細菌菌株之組合物 |
| WO2018106945A1 (en) | 2016-12-07 | 2018-06-14 | Progenity Inc. | Gastrointestinal tract detection methods, devices and systems |
| GB201621123D0 (en) | 2016-12-12 | 2017-01-25 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11426566B2 (en) | 2016-12-14 | 2022-08-30 | Biora Therapeutics, Inc. | Treatment of a disease of the gastrointestinal tract with a TLR modulator |
| US12226464B2 (en) | 2017-04-10 | 2025-02-18 | Curemark, Llc | Compositions for treating addiction |
| DK3630136T3 (da) | 2017-05-22 | 2021-05-25 | 4D Pharma Res Ltd | Sammensætninger, der omfatter bakteriestammer |
| EP3630942B1 (en) | 2017-05-24 | 2022-11-30 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| SMT202000695T1 (it) | 2017-06-14 | 2021-01-05 | 4D Pharma Res Limited | Composizioni comprendenti ceppi batterici |
| CA3066189A1 (en) | 2017-06-14 | 2018-12-20 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| SMT202000555T1 (it) | 2017-06-14 | 2020-11-10 | 4D Pharma Res Limited | Composizioni comprendenti un ceppo batterico del genere megaspaera e loro usi |
| CN108404113A (zh) * | 2018-05-16 | 2018-08-17 | 中国人民解放军军事科学院军事医学研究院 | 用于抗辐射损伤的口服辐抗肽药物组合物 |
| CN108478782B (zh) * | 2018-05-16 | 2021-05-18 | 中国人民解放军军事科学院军事医学研究院 | 辐抗肽在促肝细胞再生中的应用 |
| CN111109198B (zh) * | 2019-03-29 | 2021-08-20 | 成都华西海圻医药科技有限公司 | 一种葡萄膜炎动物模型构建方法 |
| WO2021041822A1 (en) * | 2019-08-30 | 2021-03-04 | Genome Protection. Inc. | Methods of increasing vaccine efficacy |
| WO2021174024A1 (en) | 2020-02-28 | 2021-09-02 | First Wave Bio, Inc. | Methods of treating iatrogenic autoimmune colitis |
| WO2021246666A1 (ko) * | 2020-06-04 | 2021-12-09 | 가톨릭대학교 산학협력단 | 플라젤린으로부터 유도된 tlr5 작용제를 유효성분으로 포함하는 항암제 조성물 |
| JP2023532717A (ja) | 2020-07-02 | 2023-07-31 | ヴィーブ ヘルスケア カンパニー | 長期作用型抗レトロウイルス剤を用いたhivウイルス寛解の達成方法 |
| US11541009B2 (en) | 2020-09-10 | 2023-01-03 | Curemark, Llc | Methods of prophylaxis of coronavirus infection and treatment of coronaviruses |
| US20240390428A1 (en) * | 2020-11-09 | 2024-11-28 | Cncure Biotech, Inc. | Salmonella strain for prevention and treatment of cancer and use thereof |
| KR102543157B1 (ko) * | 2020-11-16 | 2023-06-14 | 아주대학교산학협력단 | 톨-유사 수용체 1/2 및/또는 4 활성화 펩타이드 및 이의 용도 |
| CN114592007B (zh) * | 2022-04-29 | 2023-10-27 | 昆明理工大学 | Far1基因的新用途 |
| CN117281906A (zh) * | 2023-10-18 | 2023-12-26 | 浙江大学 | Csrnp1抑制剂在制备治疗肝脏缺血再灌注损伤药物中的应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4554101A (en) | 1981-01-09 | 1985-11-19 | New York Blood Center, Inc. | Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity |
| US20070269406A1 (en) * | 2005-12-14 | 2007-11-22 | Ichim Thomas E | Transcatheter tumor immunoembolization |
| US20090081157A1 (en) * | 2006-01-09 | 2009-03-26 | Richard Syd Kornbluth | Immunostimulatory Combinations for Vaccine Adjuvants |
| US20090123467A1 (en) * | 2007-07-31 | 2009-05-14 | The Johns Hopkins University | Polypeptide-Nucleic Acid Conjugate for Immunoprophylaxis or Immunotherapy for Neoplastic or Infectious Disorders |
| US20090175880A1 (en) * | 2007-11-07 | 2009-07-09 | Celldex Therapeutics Inc. | Antibodies that bind human dendritic and epithelial cell 205 (dec-205) |
Family Cites Families (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3007812A (en) | 1957-02-11 | 1961-11-07 | Allied Chem | Water-repellent compositions, method of water-proofing porous surfaces therewith, and resulting water-repellent surfaces |
| US5399494A (en) | 1983-03-04 | 1995-03-21 | The University Of Maryland System | Vibrio cholerae strain CVD103Hgr, method of making same, and vaccines derived therefrom |
| US6130082A (en) | 1988-05-05 | 2000-10-10 | American Cyanamid Company | Recombinant flagellin vaccines |
| JPH05502402A (ja) | 1990-09-28 | 1993-04-28 | ゲブリユーダー ズルツアー アクチエンゲゼルシヤフト | 医療用の中空針及びその製造方法 |
| DE69333110T2 (de) | 1992-03-02 | 2004-05-06 | Chiron S.P.A. | Mit dem cytotoxin von helicobacter pylori assoziiertes, immunodominantes antigen verwendbar in impfstoffen und zur diagnose |
| US5693476A (en) | 1995-02-24 | 1997-12-02 | The Board Of Trustees Of The Leland Stanford Junior University | Methods of screening for compounds capable of modulating vesicular release |
| WO2001055210A2 (en) | 2000-01-31 | 2001-08-02 | Munin Corporation | Human cyr61 |
| US20020009747A1 (en) | 1997-08-25 | 2002-01-24 | Freda Diane Miller | Methods and reagents for identifying modulators of neuronal apoptosis |
| US5994409A (en) | 1997-12-09 | 1999-11-30 | U.S. Bioscience, Inc. | Methods for treatment of neuro--and nephro--disorders and therapeutic toxicities using aminothiol compounds |
| WO2001040280A2 (en) | 1999-11-29 | 2001-06-07 | Inotek Corporation | Composition and method for treating a microbial infection |
| US7300749B2 (en) | 2000-02-17 | 2007-11-27 | Millennium Pharmaceuticals, Inc. | Molecules of the pyrin domain protein family and uses thereof |
| WO2002044363A1 (en) | 2000-11-28 | 2002-06-06 | Genesis Research And Development Corporation Limited | Methods for modulating apoptotic cell death |
| EP1379552B2 (en) | 2001-04-20 | 2014-11-19 | The Institute for Systems Biology | Toll-like receptor 5 ligands and methods of use |
| US8703146B2 (en) | 2001-04-20 | 2014-04-22 | Institute For Systems Biology | Toll-like receptor 5 ligands and methods of use |
| CA2462638A1 (en) | 2001-10-02 | 2003-04-10 | University Of Chicago | Methods and compositions for modulating apoptosis |
| US7078165B2 (en) | 2003-03-27 | 2006-07-18 | Institut Pasteur | Method for modulating Nod1 activity, use of a MTP related molecule for modulating Nod1 activity, and therapeutic applications thereof |
| SG176524A1 (en) | 2003-12-02 | 2011-12-29 | Cleveland Clinic Foundation | Methods of protecting against radiation using flagellin |
| US7638485B2 (en) | 2003-12-02 | 2009-12-29 | Cleveland Biolabs, Inc. | Modulating apoptosis |
| WO2005056041A2 (en) | 2003-12-02 | 2005-06-23 | Cleveland Clinic Foundation | METHODS OF INHIBITING APOPTOSIS USING LATENT TGFβ |
| WO2005056054A2 (en) | 2003-12-02 | 2005-06-23 | Cleveland Clinic Foundation | METHODS OF INHIBITING APOPTOSIS USING INDUCERS OF NF-κB |
| US20050266391A1 (en) | 2004-01-15 | 2005-12-01 | Bennett Brydon L | Methods for preserving tissue |
| WO2006039701A1 (en) * | 2004-10-01 | 2006-04-13 | University Of South Florida | Flagellin-based adjuvants and vaccines |
| EP1827489B1 (en) | 2004-12-16 | 2012-10-31 | Wake Forest University Health Sciences | Use of flagellin in tumor immunotherapy |
| EP2460534A1 (en) | 2004-12-22 | 2012-06-06 | Cleveland Clinic Foundation | Flagellin related polypeptides and uses thereof |
| EP1940419A2 (en) | 2005-09-09 | 2008-07-09 | Oregon Health and Science University | Neuroprotectants |
| EP2114427B1 (en) | 2007-01-30 | 2014-06-25 | New York University | Peptides for treatment of conditions associated with nitric oxide |
| EP2170931A4 (en) * | 2007-06-15 | 2010-06-30 | Immurx Inc | USE OF TLR AGONISTS AND / OR TYPE 1 INTERFERONS TO MITIGATE THE TOXICITY OF THERAPEUTIC REGIMES OF TNF-R AGONISTS |
| WO2009102818A1 (en) | 2008-02-11 | 2009-08-20 | Cleveland Biolabs, Inc. | Method for reducing the effects of chemotheraphy using flagellin related polypeptides |
| CN102170911B (zh) | 2008-08-01 | 2014-07-02 | 克里夫兰生物实验室公司 | 用于治疗再灌注损伤的方法 |
| AU2010250923A1 (en) | 2009-05-21 | 2011-11-17 | Astrazeneca Ab | Novel pyrimidine derivatives and their use in the treatment of cancer and further diseases |
| WO2011027222A2 (en) | 2009-09-02 | 2011-03-10 | Novartis Ag | Immunogenic compositions including tlr activity modulators |
| CA2777198C (en) | 2009-10-06 | 2018-07-24 | Panacela Labs, Inc. | Use of toll-like receptor and agonist for treating cancer |
| WO2012097012A1 (en) * | 2011-01-10 | 2012-07-19 | Cleveland Biolabs, Inc. | Use of toll-like receptor agonist for treating cancer |
-
2012
- 2012-01-10 WO PCT/US2012/020844 patent/WO2012097012A1/en not_active Ceased
- 2012-01-10 US US13/979,104 patent/US9376473B2/en not_active Expired - Fee Related
- 2012-01-10 BR BR112013017283A patent/BR112013017283A2/pt active Search and Examination
- 2012-01-10 EA EA201390843A patent/EA026524B1/ru not_active IP Right Cessation
- 2012-01-10 MX MX2013007967A patent/MX361355B/es active IP Right Grant
- 2012-01-10 CA CA2824438A patent/CA2824438A1/en not_active Abandoned
- 2012-01-10 SG SG2013051396A patent/SG191830A1/en unknown
- 2012-01-10 KR KR1020137021035A patent/KR20140030132A/ko not_active Withdrawn
- 2012-01-10 CN CN201280009451.0A patent/CN103476458B/zh not_active Expired - Fee Related
- 2012-01-10 AU AU2012205681A patent/AU2012205681B2/en not_active Ceased
- 2012-01-10 JP JP2013548628A patent/JP6041444B2/ja not_active Expired - Fee Related
- 2012-01-10 EP EP12734417.4A patent/EP2663367A4/en not_active Withdrawn
-
2013
- 2013-07-03 IL IL227308A patent/IL227308A/en active IP Right Grant
- 2013-07-08 CL CL2013002001A patent/CL2013002001A1/es unknown
- 2013-07-08 MX MX2018014998A patent/MX2018014998A/es unknown
- 2013-07-29 CO CO13178553A patent/CO6781506A2/es not_active Application Discontinuation
-
2015
- 2015-11-23 US US14/949,441 patent/US20160206690A1/en not_active Abandoned
-
2016
- 2016-08-19 US US15/241,757 patent/US20170065692A1/en not_active Abandoned
-
2017
- 2017-06-23 US US15/631,427 patent/US10034926B2/en active Active
-
2018
- 2018-06-21 US US16/014,419 patent/US10265390B2/en active Active
-
2019
- 2019-02-19 US US16/279,457 patent/US10780152B2/en not_active Expired - Fee Related
-
2020
- 2020-07-21 US US16/934,556 patent/US11628201B2/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4554101A (en) | 1981-01-09 | 1985-11-19 | New York Blood Center, Inc. | Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity |
| US20070269406A1 (en) * | 2005-12-14 | 2007-11-22 | Ichim Thomas E | Transcatheter tumor immunoembolization |
| US20090081157A1 (en) * | 2006-01-09 | 2009-03-26 | Richard Syd Kornbluth | Immunostimulatory Combinations for Vaccine Adjuvants |
| US20090123467A1 (en) * | 2007-07-31 | 2009-05-14 | The Johns Hopkins University | Polypeptide-Nucleic Acid Conjugate for Immunoprophylaxis or Immunotherapy for Neoplastic or Infectious Disorders |
| US20090175880A1 (en) * | 2007-11-07 | 2009-07-09 | Celldex Therapeutics Inc. | Antibodies that bind human dendritic and epithelial cell 205 (dec-205) |
Non-Patent Citations (8)
| Title |
|---|
| BURDELYA ET AL., SCIENCE, vol. 320, 2008, pages 226 - 230 |
| KATAOKA ET AL., REFS, 2000 |
| KYTE ET AL., J. MOL. BIOL., vol. 157, 1982, pages 105 - 132 |
| OFFRINGA R.: "Tumour immunology - Exploitation of the weapon of immune destruction for cancer therapy: taking aim before firing", CURRENT OPINION IN IMMUNOLOGY, vol. 17, 2005, pages 159 - 162, XP027787173 * |
| OGASAWARA J ET AL., NATURE, 1993 |
| RHEE ET AL., GASTROENTEROLOGY, vol. 135, 2008, pages 518 - 528 |
| See also references of EP2663367A4 |
| SMITH ET AL., NAT IMMUNOL, vol. 4, 2003, pages 1247 - 53 |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014098649A1 (en) * | 2012-12-18 | 2014-06-26 | Obschestvo S Ogranichennoy Otvetstvennostyu "Panacela Labs" | Compositions and methods using toll-like receptor 5 and toll-like receptor agonist |
| US12453762B2 (en) | 2015-03-16 | 2025-10-28 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for treatment of glioblastoma |
| US12178788B2 (en) | 2015-03-16 | 2024-12-31 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist |
| US12220450B2 (en) | 2015-03-16 | 2025-02-11 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for treatment of colorectal cancer |
| US12214048B2 (en) | 2016-03-16 | 2025-02-04 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for use in medicine |
| US12220387B2 (en) | 2016-09-21 | 2025-02-11 | Amal Therapeutics Sa | Fusion comprising a cell penetrating peptide, a multi epitope and a TLR peptide agonist for treatment of cancer |
| WO2018160090A1 (ru) | 2017-02-28 | 2018-09-07 | Александр Васильевич ИВАЩЕНКО | Противовирусная композиция и способ ее применения |
| US12268727B2 (en) | 2017-07-20 | 2025-04-08 | Spogen Biotech Inc. | Bioactive polypeptides for improvements in plant protection, growth and productivity |
| US10717767B2 (en) | 2017-07-20 | 2020-07-21 | Spogen Biotech, Inc. | Bioactive polypeptides for improvements in plant protection, growth and productivity |
| US11046735B2 (en) | 2017-07-20 | 2021-06-29 | Spogen Biotech Inc. | Bioactive polypeptides for improvements in plant protection, growth and productivity |
| US12599649B2 (en) | 2017-07-20 | 2026-04-14 | Spogen Biotech Inc. | Bioactive polypeptides for improvements in plant protection, growth and productivity |
| US11419931B2 (en) | 2018-03-19 | 2022-08-23 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11857614B2 (en) | 2018-03-19 | 2024-01-02 | Cj Bioscience, Inc. | Enterococcus gallinarum flagellin polypeptides |
| EP4046644A1 (en) | 2018-03-19 | 2022-08-24 | 4D Pharma Research Limited | Compositions of entrecoccus flagellin for use in therapy |
| US12440536B2 (en) * | 2018-05-18 | 2025-10-14 | The University Of Hong Kong | Compositions of toll-like receptor 5 (TLR5) agonist and methods of use thereof |
| EP4620482A1 (en) * | 2024-03-18 | 2025-09-24 | Istituto Europeo di Oncologia S.r.l. | Flagellin-related peptides and uses thereof |
| WO2025196053A1 (en) | 2024-03-18 | 2025-09-25 | Istituto Europeo Di Oncologia S.R.L. | Flagellin-related peptides and uses thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10265390B2 (en) | Use of toll-like receptor agonist for treating cancer | |
| CN104136614B (zh) | Toll‑样受体和激动剂用于治疗癌症的用途 | |
| US9447166B2 (en) | Compositions and methods for the intracellular disruption of VEGF and VEGFR-2 by intraceptors | |
| CN104321070A (zh) | Alk1拮抗剂及其在治疗肾细胞癌中的用途 | |
| Maio et al. | Structure, distribution, and functional role of protectin (CD59) in complement-susceptibility and in immunotherapy of human malignancies | |
| KR20220015375A (ko) | Sephb4-hsa 융합 단백질을 이용한 암의 치료 | |
| RU2682762C2 (ru) | Улучшенный вектор, экспрессирующий toll-подобный рецептор и агонист, и применение в терапии рака | |
| NZ612615B2 (en) | Use of toll-like receptor agonist for treating cancer | |
| WO2018088933A1 (en) | Anti-tumor effects of a viral vector encoding a toll-like receptor and a toll-like receptor agonist | |
| KR20250069354A (ko) | 결장 표적 s100a8/a9 유래 특이적 펩티드를 포함하는 대장염 또는 대장암 치료용 조성물 | |
| WO2024064288A1 (en) | Tlr4 inhibitors for cancer treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12734417 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2013548628 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12013501422 Country of ref document: PH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201390843 Country of ref document: EA |
|
| ENP | Entry into the national phase |
Ref document number: 2824438 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013002001 Country of ref document: CL Ref document number: MX/A/2013/007967 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 001538-2013 Country of ref document: PE |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2012205681 Country of ref document: AU Date of ref document: 20120110 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13178553 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 20137021035 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A201309873 Country of ref document: UA Ref document number: 2012734417 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013017283 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13979104 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 112013017283 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130704 |