WO2011041790A1 - Piscine reovirus diagnostic compositions - Google Patents

Piscine reovirus diagnostic compositions Download PDF

Info

Publication number
WO2011041790A1
WO2011041790A1 PCT/US2010/051348 US2010051348W WO2011041790A1 WO 2011041790 A1 WO2011041790 A1 WO 2011041790A1 US 2010051348 W US2010051348 W US 2010051348W WO 2011041790 A1 WO2011041790 A1 WO 2011041790A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
prv
sequence
isolated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/051348
Other languages
English (en)
French (fr)
Inventor
W. Ian Lipkin
Gustavo Palacios
Ruth Toril Kongtorp
Edgar Brun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University in the City of New York
Original Assignee
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43826692&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011041790(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Columbia University in the City of New York filed Critical Columbia University in the City of New York
Priority to EP10821408.1A priority Critical patent/EP2482825B1/en
Priority to US13/499,867 priority patent/US9366667B2/en
Priority to CA2776534A priority patent/CA2776534A1/en
Publication of WO2011041790A1 publication Critical patent/WO2011041790A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/15Reoviridae, e.g. calf diarrhea virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5252Virus inactivated (killed)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011Details
    • C12N2720/12011Reoviridae
    • C12N2720/12022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011Details
    • C12N2720/12011Reoviridae
    • C12N2720/12034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011Details
    • C12N2720/12011Reoviridae
    • C12N2720/12211Orthoreovirus, e.g. mammalian orthoreovirus
    • C12N2720/12222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011Details
    • C12N2720/12011Reoviridae
    • C12N2720/12211Orthoreovirus, e.g. mammalian orthoreovirus
    • C12N2720/12234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • HSMI Heart and skeletal muscle inflammation
  • HSMI is transmissible but the causal agent has not been previously isolated. HSMI is an important disease that threatens aquaculture. Identification of the causative agent of this disease can enable diagnosis of infection, containment of infection and development of vaccines to prevent disease.
  • the invention relates to Piscine reovirus (PRV), a novel orthoreovirus-like virus associated with Salmon HSMI, and isolated nucleic acids sequences and peptides thereof.
  • PRV Piscine reovirus
  • the invention is also related to antibodies against antigens derived from PRV and method for generating such antibodies.
  • the invention is also related to
  • immunogenic compositions for inducing an immune response against PRV in an animal.
  • the invention provides an isolated nucleic acid having a sequence selected from the group consisting of: SEQ ID NOs: 1-10.
  • the invention provides an isolated nucleic acid comprising 10 consecutive nucleotides having a sequence selected from the group consisting of: SEQ ID NOs: 1-10.
  • the invention provides an isolated nucleic acid which is a variant of any one of SEQ ID NOs: 1-10 and has at least about 85% identity to SEQ ID NO: 1-10.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NO: 1-10.
  • the identity is determined by analysis with a sequence comparison algorithm.
  • the sequence comparison algorithm is FASTA version 3.0t78 using default parameters.
  • the invention provides an isolated nucleic acid complementary to a sequence selected from the group consisting of: SEQ ID NOs: 1-10.
  • the invention provides an isolated nucleic acid comprising 10 consecutive nucleotides complementary to a sequence selected from the group consisting of: SEQ ID NOs: 1-10
  • the invention provides an isolated nucleic acid which is a complementary to a variant of any one of SEQ ID NOs: 1-10 and wherein the variant has at least about 85% identity to SEQ ID NO: 1-10.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NO: 1-10.
  • the identity is determined by analysis with a sequence comparison algorithm.
  • the sequence comparison algorithm is FASTA version 3.0t78 using default parameters.
  • the invention provides an isolated polypeptide having a sequence selected from the group consisting of: SEQ ID NOs: 29-40.
  • the invention provides an isolated polypeptide comprising 8 consecutive amino acids having a sequence selected from the group consisting of: SEQ ID NOs: 29-40.
  • the invention provides an isolated polypeptide which is a variant of any one of SEQ ID NOs: 29-40 and has at least about 85% identity to SEQ ID NO: 29-40.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NO: 29-40.
  • the identity is determined by analysis with a sequence comparison algorithm.
  • the sequence comparison algorithm is FASTA version 3.0t78 using default parameters.
  • the invention provides an isolated diagnostic antibody that specifically binds to a polypeptide encoded by the nucleotide sequence shown in any one of SEQ ID NO: 1-10.
  • the invention provides an isolated diagnostic antibody that specifically binds to a polypeptide having the sequence of any of SEQ ID NO: 29- 40.
  • the diagnostic antibody is a polyclonal antibody.
  • the diagnostic antibody is a monoclonal antibody.
  • the invention provides an oligonucleotide probe comprising from about 10 nucleotides to about 50 nucleotides, wherein at least about 10 contiguous nucleotides are at least 95 % complementary to a nucleic acid target region within a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 1-10.
  • the probe is at least about 95.5%, about 96%, about 96.5%>, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% complementary to SEQ ID NO: 1-10.
  • the oligonucleotide probe consists essentially of from about 10 to about 50 nucleotides.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence selected from the group consisting of : SEQ ID NOS: 1-10.
  • the invention provides a method for determining the presence or absence of PRV in a biological sample, the method comprising: a) contacting nucleic acid from a biological sample with at least one primer which is a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence selected from the group consisting of : SEQ ID NOS: 1-10, b) subjecting the nucleic acid and the primer to amplification conditions, and c) determining the presence or absence of amplification product, wherein the presence of amplification product indicates the presence of RNA associated with PRV in the sample.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a method for determining the presence or absence of PRV in a biological sample, the method comprising: a) contacting nucleic acid from a biological sample with at least one primer which is a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence selected from the group consisting of : SEQ ID NOS: 1-10, b) subjecting the nucleic acid and the primer to amplification conditions, and c) determining the presence or absence of amplification product, wherein the presence of amplification product indicates the presence of RNA associated with PRV in the sample.
  • the invention provides a primer set for determining the presence or absence of PRV in a biological sample, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of: a) a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence selected from the group of sequences consisting of SEQ ID NO: 1-10, and b) a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a method for determining whether or not a sample contains PRV, the method comprising: a) contacting a biological sample with an antibody that specifically binds a polypeptide encoded by the nucleic sequence acid of any one of SEQ ID NO: 1-10, and b) determining whether or not the antibody binds to an antigen in the biological sample, wherein binding indicates that the biological sample contains PRV.
  • the determining comprises use of a lateral flow assay or ELISA.
  • the invention provides a method for determining whether or not a biological sample has been infected by PRV, the method comprising: a) determining whether or not a biological sample contains antibody that specifically binds a polypeptide encoded by the nucleic sequence acid of any one of SEQ ID NO: 1-10.
  • the invention provides an interfering RNA (iRNA) comprising a sense strand having at least 15 contiguous nucleotides complementary to the anti-sense strand of a gene from a virus comprising a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • iRNA interfering RNA
  • the invention provides an interfering RNA (iRNA) comprising an anti-sense strand having at least 15 contiguous nucleotides complementary to the sense strand of gene from a virus comprising a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • iRNA interfering RNA
  • the invention provides a method for reducing the levels of a viral protein, viral mRNA or viral titer in a cell in an animal comprising:
  • the method further comprises co-administering a second iRNA agent to the animal, wherein the second iRNA agent comprises a sense strand having at least 15 or more contiguous nucleotides
  • nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10 and an antisense strand having at least 15 or more contiguous nucleotides complementary to the sense strand.
  • the invention provides a method of reducing the levels of a viral protein from at least one gene of a PRV in a cell in an animal, the method comprising administering an iRNA agent to an animal, wherein the iRNA agent comprises a sense strand having at least 15 or more contiguous nucleotides selected from the group of sequences consisting of SEQ ID NO: 1-10 complementary to a gene from a PRV and an antisense strand having at least 15 or more contiguous nucleotides complementary to the sense strand of a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the sample used in conjunction with any of the methods described herein is from a teleost.
  • the sample used in conjunction with any of the methods described herein is from a salmon.
  • the invention provides an isolated virus comprising any one of the nucleic acid sequences of SEQ ID NOS: 1-10.
  • the invention provides an isolated virus comprising a polypeptide encoded by the nucleic sequence acid of any one of SEQ ID NO: 1-10.
  • FIG. 1 Piscine reovirus (PRV) sequence obtained by pyrosequencing.
  • Genomic regions identified by BLASTN, BLASTX, FASTX, and FASD are shown in red, blue, green, and orange respectively.
  • FIG. 1 Phylogenetic analysis of the RNA-dependent RNA-polymerase of Reoviridae. Full length amino acid sequences were aligned using the ClustalX14 implemented on MEGA software (Tamura et al, Mol Biol Evol 24, 1596-1599 (2007)) and refined using T-Coffee (Notredame et al, J Mol Biol 302, 205-217 (2000)) to incorporate protein structure data. Phylogenetic analysis was performed using p- distance as model of amino acid substitution as implemented by ICTV for analysis of the Reoviridae family (Mertens et al., T. Family Reoviridae. 447-454 (Elsevier Academic Press, 2005)). MEGA was used to produce phylogenetic trees, reconstructed through the Neighbor Joining (NJ) method. The statistical significance of a particular tree topology was evaluated by bootstrap re-sampling of the sequences 1000 times.
  • NJ Neighbor Joining
  • Figure 3 Graphical representation of group differences in the log ratio of virus load normalized to a salmon host gene. Nonparametric approaches were used to determine statistical significance for comparisons of the relative viral load among healthy and HSMI-affected farmed fish. Log transformations, which did not normalize log ratio distributions, were nonetheless performed for all samples after calculating LI (virus) / EF1A (housekeeping) ratios to aid in graphical representation.
  • Figure 3 A shows a comparison of adjusted log ratio in mixed heart and kidney samples from healthy farmed fish and farmed fish with HSMI; *, p ⁇ 0.0001 (Mann- Whitney U).
  • Figure 3B shows a comparison of adjusted log ratios in farmed fish without HSMI (healthy farmed fish), in the early phase of an HSMI outbreak, in the middle of an HSMI outbreak, and during the peak of an HSMI outbreak; **, p ⁇ 0.0005; *, p ⁇ 0.01 (individual Mann- Whitney U). Adjusted log ratios also differed significantly across all four farmed fish groups (p ⁇ 0.0001; Kruskal-Wallis).
  • Figure 4 In situ hybridization was performed using locked nucleic acid (LNA) probes targeting the L2 segment of the Piscine reovirus. Sections were permeabilized using proteinase K followed by hybridization with digoxigenin (DIG)-labeled LNA probes. Sections were incubated with a mouse monoclonal anti-DIG-horse radish peroxidase and stained using a Tyramide Signal Amplification System. Sections were counterstained with Meyer's hematoxylin solution.
  • Figure 4A shows heart from HSMI- infected fish (lOx).
  • Figure 4B shows heart from HSMI-infected fish (40x).
  • Figure 4C shows heart from non-infected fish (40x).
  • Figure 4D shows heart from a fish infected with salmon pancreas disease virus.
  • FIG. 5 Phylogenetic analysis of the Lambda- 1 ORF of the Aquareovirus and Orthoreo virus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • FIG. 6 Phylogenetic analysis of the Lambda-2 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • FIG. 7 Phylogenetic analysis of the Lambda-3 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • FIG. 8 Phylogenetic analysis of the Mu-1 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • FIG. 9 Phylogenetic analysis of the Mu-2 ORF of the Aquareovirus and Orthoreovirus.
  • Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • FIG. 10 Phylogenetic analysis of the Mu-3 ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets. Final data analyses included MCMC chain lengths of 5,000,000 - 30,000,000 generations, with sampling every 1000 states. Colored boxes indicate representatives of different reo virus genera or species.
  • Green, Aquareovirus genus blue, species I (mammalian orthoreovirus); red, species II (avian orthoreovirus); purple, species III (Nelson Bay orthoreovirus); orange, species IV (reptilian orthoreovirus) and light blue, species V (Baboon orthoreovirus).
  • FIG. 12 Phylogenetic analysis of the Sigma-NS ORF of the Aquareovirus and Orthoreovirus. Bayesian phylogenetic analyses of sequence differences among segments ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS ( ⁇ and ⁇ 3 of aquareovirus and orthoreovirus had different genomic organizations) were conducted using BEAST, BEAUti and Tracer analysis software packages. Preliminary analyses were run for 10,000,000 generations with the Dayhoff amino acid substitution model to select the clock and demographic models most appropriate for each ORF. An analysis of the marginal likelihoods indicated that the relaxed lognormal molecular clock and constant population size model was chosen for all datasets.
  • HP hydrophobic region
  • TM transmembrane domain
  • BR basic region
  • the pathology of PRV infection can include liver discoloration, heamopericardium, congestion in fatty tissue and swollen spleen.
  • Figure 17 Diagnosis of HSMI showing infiltration of the epicardium as well as severe inflammation of the myocardium.
  • Figure 18 A schematic illustration for a method for generating antibodies against ⁇ , ⁇ 3 and ⁇ .
  • Figure 18A shows outer capsid proteins ⁇ , ⁇ 3, ⁇ 2, ⁇ and inner capsid proteins ⁇ , ⁇ 2, ⁇ 2, and ⁇ 3.
  • Figure 18B shows amplification of ⁇ , ⁇ 3 and full length segments by PCR.
  • Figure 18C shows that the amplified segments can be cloned into an expression vector to make an expression construct. The expression can be used to express antigens in an expression system (e.g. E. coli). The antigens can then be purified and used to immunize rabbits.
  • an expression system e.g. E. coli
  • Figure 19 shows FAST (fusion-associated small transmembrane protein encoded by S4.
  • Figure 19B shows the variation of the antigenic index as a function of amino acid position. The higher the antigenic index, the more likely should be that antibodies would "see" those groups of residues.
  • Figure 20 The antiserum recognizes the protein as found in Western blots of E.coli His-tag fusion protein. Lines 11-13, eluates of purified protein; L14-15, dilutions of pellet of induced bacteria, L16-L17 pellet of non-induced bacteria
  • Figure 21 The antiserum recognizes the ⁇ 2 protein as found in western blots of E.coli His-tag fusion protein and different negative controls. Lines 2-4, eluates of purified protein; L5-6, dilutions of pellet of induced bacteria, L7-L8 pellet of non- induced bacteria.
  • PRV refers to isolates of the Piscine reoviruses described herein.
  • animal refers to a vertebrate, including, but not limited to a teleost (e.g. salmon).
  • a teleost e.g. salmon
  • PRV polypeptide includes a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide.
  • the term "antibody” refers to a diagnostic antibody that binds to a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and does not inhibit, neutralize or reduce the activity or function of a PRV polypeptide or a PRV.
  • the term antibody specifically excludes antibodies which bind a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and which inhibit, neutralize or reduce the activity or function of the polypeptide or the PRV.
  • HSMI appears 5 to 9 months after fish are transferred from fresh water to ocean pens (Kongtorp et al., J Fish Dis 27, 351- 358 (2004)), but outbreaks have been recorded as early as 14 days following seawater transfer.
  • Affected fish are anorexic and display abnormal swimming behavior.
  • Autopsy findings typically include a pale heart, yellow liver, ascites, swollen spleen and petechiae in the perivisceral fat.
  • the pathology is further characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis and necrosis of red skeletal muscle, and up to 20% mortality (Kongtorp et al, Dis Aquat Organ 59, 217-224 (2004)). While mortality is variable (up to 20%), morbidity may be very high in affected cages. HSMI is diagnosed on the basis of histopathology. The major pathological changes occur in the myocardium and red skeletal muscle, where extensive inflammation and multifocal necrosis of myocytes are evident.
  • the present invention shows that HSMI is associated with infection with a novel reo virus termed Piscine reo virus (PRV).
  • PRV was identified through high-throughput pyrosequencing of serum and heart tissue of experimentally infected fish using novel frequency analysis methods as well as standard alignment methods.
  • the present invention provides PRV nucleic acid sequences.
  • the invention is directed to expression constructs, for example plasmids and vectors, and isolated nucleic acids which comprise PRV nucleic acid sequences of SEQ ID NOs: 1-10, fragments, complementary sequences, and/or variants thereof.
  • nucleic acid sequences and polypeptides described herein may be useful for multiple applications, including, but not limited to, generation of diagnostic antibodies and diagnostic nucleic acids.
  • the invention is directed to a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 29-40.
  • the invention provides an isolated PRV nucleic acid having the sequence of any of SEQ ID NOs: 1-10, or a fragment thereof. [070] In another aspect, the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides having a sequence selected from the group consisting of any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides having a sequence selected from a variant of any of SEQ ID NOs: 1-10 or a fragment thereof.
  • the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV nucleic acid
  • the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV nucleic acid which comprises consecutive nucleotides complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV nucleic acid having a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV nucleic acid having a sequence substantially identical to a sequence complementary to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an oligonucleotide probe which comprises from about 10 nucleotides to about 50 nucleotides, wherein at least about 10 contiguous nucleotides are at least 95 % complementary to a nucleic acid target region within a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, wherein the oligonucleotide probe hybridizes to the nucleic acid target region under moderate to highly stringent conditions to form a detectable nucleic acid targe oligonucleotide probe duplex.
  • the oligonucleotide probe is at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% complementary to SEQ ID NOs: 1-10.
  • the oligonucleotide probe consists essentially of from about 10 to about 50 nucleotides.
  • Polynucleotides homologous to the sequences illustrated in the SEQ ID NOs 1- 10 can be identified, e.g., by hybridization to each other under stringent or under highly stringent conditions. Single stranded polynucleotides hybridize when they associate based on a variety of well characterized physical-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like.
  • the stringency of a hybridization reflects the degree of sequence identity of the nucleic acids involved, such that the higher the stringency, the more similar are the two polynucleotide strands. Stringency is influenced by a variety of factors, including temperature, salt concentration and composition, organic and non-organic additives, solvents, etc. present in both the hybridization and wash solutions and incubations.
  • the invention is directed to primer sets comprising isolated nucleic acids as described herein, which primer set are suitable for amplification of nucleic acids from samples which comprises Piscine reoviruses represented by any one of SEQ ID NO: 1-10, or variants thereof.
  • Primer sets can comprise any suitable combination of primers which would allow amplification of a target nucleic acid sequences in a sample which comprises Piscine reoviruses represented by any one of SEQ ID NO: 1-10, or variants thereof.
  • Amplification can be performed by any suitable method known in the art, for example but not limited to PCR, RT-PCR, transcription mediated amplification (TMA).
  • Hybridization conditions refers to conditions under which a probe, primer or oligonucleotide will hybridize to its target sequence, and can hybridize, for example but not limited to, variants of the disclosed polynucleotide sequences, including allelic or splice variants, or sequences that encode orthologs or paralogs of presently disclosed polypeptides.
  • the precise conditions for stringent hybridization are typically sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences.
  • stringent conditions are selected to be about 5°C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C. for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60°C. for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • stringency is determined by the temperature, ionic strength, and concentration of denaturing agents (e.g., formamide) used in a hybridization and washing procedure.
  • denaturing agents e.g., formamide
  • the degree to which two nucleic acids hybridize under various conditions of stringency is correlated with the extent of their similarity. Numerous variations are possible in the conditions and means by which nucleic acid hybridization can be performed to isolate nucleic sequences having similarity to the nucleic acid sequences known in the art and are not limited to those explicitly disclosed herein.
  • nucleic acid sequences having various degrees of similarity such as, for example, nucleic acid sequences having 60% identity, or about 70%> identity, or about 80%> or greater identity with disclosed nucleic acid sequences.
  • a non-limiting example of stringent hybridization conditions is hybridization in a high salt buffer comprising 6X sodium chloride/sodium citrate (SSC), 50 mM Tris-HCl (pH 7.5), 1 nM EDTA, 0.02% PVP, 0.02% FicoU, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65°C. This hybridization is followed by one or more washes in 0.2X SSC, 0.01% BSA at 50°C.
  • Another non-limiting example of stringent hybridization conditions are hybridization in 6X sodium
  • SSC chloride/sodium citrate
  • Tm melting temperature
  • Hybridization experiments are generally conducted in a buffer of pH between 6.8 to 7.4, although the rate of hybridization is nearly independent of pH at ionic strengths likely to be used in the hybridization buffer (Anderson et al. (1985) supra).
  • one or more of the following may be used to reduce non-specific
  • sonicated salmon sperm DNA or another non-complementary DNA bovine serum albumin, sodium pyrophosphate, sodium dodecylsulfate (SDS), polyvinylpyrrolidone, ficoll and Denhardt's solution.
  • SDS sodium dodecylsulfate
  • polyvinylpyrrolidone ficoll and Denhardt's solution.
  • Dextran sulfate and polyethylene glycol 6000 act to exclude DNA from solution, thus raising the effective probe DNA concentration and the hybridization signal within a given unit of time.
  • conditions of even greater stringency may be desirable or required to reduce non-specific and/or background hybridization. These conditions may be created with the use of higher temperature, lower ionic strength and higher concentration of a denaturing agent such as formamide.
  • Stringency conditions can be adjusted to screen for moderately similar fragments such as homologous sequences from distantly related organisms, or to highly similar fragments.
  • the stringency can be adjusted either during the hybridization step or in the post-hybridization washes.
  • Salt concentration, formamide concentration, hybridization temperature and probe lengths are variables that can be used to alter stringency. As a general guidelines high stringency is typically performed at Tm-5°C to Tm -20°C, moderate stringency at Tm-20°C to Tm-35°C and low stringency at Tm- 35°SC to Tm-50°C for duplex>150 base pairs.
  • Hybridization may be performed at low to moderate stringency (25-50°C below Tm), followed by post-hybridization washes at increasing stringencies. Maximum rates of hybridization in solution are determined empirically to occur at Tm-25°C for DNA-DNA duplex and Tm -15°C for RNA-DNA duplex. Optionally, the degree of dissociation may be assessed after each wash step to determine the need for subsequent, higher stringency wash steps.
  • High stringency conditions may be used to select for nucleic acid sequences with high degrees of identity to the disclosed sequences.
  • An example of stringent hybridization conditions obtained in a filter-based method such as a Southern or northern blot for hybridization of complementary nucleic acids that have more than 100 complementary residues is about 5°C. to 20°C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Conditions used for hybridization may include about 0.02 M to about 0.15 M sodium chloride, about 0.5% to about 5% casein, about 0.02%> SDS or about 0.1 % N-laurylsarcosine, about 0.001 M to about 0.03 M sodium citrate, at hybridization temperatures between about 50°C and about 70°C.
  • high stringency conditions are about 0.02 M sodium chloride, about 0.5%> casein, about 0.02%> SDS, about 0.001 M sodium citrate, at a temperature of about 50°C.
  • Nucleic acid molecules that hybridize under stringent conditions will typically hybridize to a probe based on either the entire DNA molecule or selected portions, e.g., to a unique subsequence, of the DNA.
  • Stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate. Increasingly stringent conditions may be obtained with less than about 500 mM NaCl and 50 mM trisodium citrate, to even greater stringency with less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency
  • hybridization can be obtained in the absence of organic solvent, e.g., formamide, whereas in certain embodiments high stringency hybridization may be obtained in the presence of at least about 35% formamide, and in other embodiments in the presence of at least about 50% formamide.
  • stringent temperature conditions will ordinarily include temperatures of at least about 30°C, and in other embodiment at least about 37°C, and in other embodiments at least about 42°C with formamide present. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS) and ionic strength, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed.
  • SDS sodium dodecyl sulfate
  • hybridization will occur at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In another embodiment, hybridization will occur at 37°C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide. In another embodiment, hybridization will occur at 42C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide. Useful variations on these conditions will be readily apparent to those skilled in the art.
  • the washing steps that follow hybridization may also vary in stringency; the post-hybridization wash steps primarily determine hybridization specificity, with the most critical factors being temperature and the ionic strength of the final wash solution. Wash stringency can be increased by decreasing salt concentration or by increasing temperature. Stringent salt concentration for the wash steps can be less than about 30 mM NaCl and 3 mM trisodium citrate, and in certain embodiments less than about 15 mM NaCl and 1.5 mM trisodium citrate.
  • the wash conditions may be under conditions of 0.1XSSC to 2.0XSSC and 0.1% SDS at 50-65°C, with, for example, two steps of 10-30 min.
  • stringent wash conditions includes about 2.0XSSC, 0.1% SDS at 65°C and washing twice, each wash step being about 30 min.
  • the temperature for the wash solutions will ordinarily be at least about 25°C, and for greater stringency at least about 42°C.
  • Hybridization stringency may be increased further by using the same conditions as in the hybridization steps, with the wash temperature raised about 3°C to about 5°C, and stringency may be increased even further by using the same conditions except the wash temperature is raised about 6°C to about 9°C.
  • wash steps may be performed at a lower temperature, e.g., 50°C.
  • An example of a low stringency wash step employs a solution and conditions of at least 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS over 30 min. Greater stringency may be obtained at 42° C in 15 mM NaCl, with 1.5 mM trisodium citrate, and 0.1% SDS over 30 min. Even higher stringency wash conditions are obtained at 65°C-68°C in a solution of 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1%) SDS. Wash procedures will generally employ at least two final wash steps.
  • Stringency conditions can be selected such that an oligonucleotide that is perfectly complementary to the coding oligonucleotide hybridizes to the coding oligonucleotide with at least about a 5-1 OX higher signal to noise ratio than the ratio for hybridization of the perfectly complementary oligonucleotide to a nucleic acid. It may be desirable to select conditions for a particular assay such that a higher signal to noise ratio, that is, about 15X or more, is obtained.
  • an animal nucleic acid will hybridize to a unique coding oligonucleotide with at least a 2X or greater signal to noise ratio as compared to hybridization of the coding oligonucleotide to a nucleic acid encoding known polypeptide.
  • the particular signal will depend on the label used in the relevant assay, e.g., a fluorescent label, a calorimetric label, a radioactive label, or the like.
  • Labeled hybridization or PCR probes for detecting related polynucleotide sequences may be produced by oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • polynucleotide sequences that are capable of hybridizing to the claimed polynucleotide sequences, including any of the nucleic acid sequences disclosed herein, and fragments thereof under various conditions of stringency (See, for example, Wahl and Berger (1987) Methods Enzymol. 152: 399- 407; and Kimmel (1987) Methods Enzymol. 152: 507-511).
  • stringency See, for example, Wahl and Berger (1987) Methods Enzymol. 152: 399- 407; and Kimmel (1987) Methods Enzymol. 152: 507-511).
  • the isolated nucleic acid of the invention which can be used as primers and/or probes can comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 consecutive nucleotides from any one of SEQ ID NO: 1-10, or sequences complementary to any one of SEQ ID NO: 1-10.
  • the isolated nucleic acid of the invention which can be used as primers and/or probes can comprise from about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 and up to about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 and 100 consecutive nucleotides from any one of SEQ ID NO: 1-10, or sequences complementary to any one of SEQ ID NO: 1-10.
  • the invention is also directed to primer and/or probes which can be labeled by any suitable molecule and/or label known in the art, for example but not limited to fluorescent tags suitable for use in Real Time PCR amplification, for example TaqMan, cybergreen, TAMRA and/or FAM probes; radiolabels, and so forth.
  • the oligonucleotide primers and/or probe further comprises a detectable non-isotopic label selected from the group consisting of: a fluorescent molecule, a chemiluminescent molecule, an enzyme, a cofactor, an enzyme substrate, and a hapten.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid consisting of consecutive nucleotides having a sequence which is a variant of any one of SEQ ID NOS 1-10 having at least about 95% identity to SEQ ID NO: 1- 10.
  • the variant has at least about 95.5%, about 96%, about 96.5%>, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to SEQ ID NO: 1-10.
  • the invention provides a composition comprising one or more nucleic acids having a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a composition comprising one or more nucleic acids having a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid consisting of consecutive nucleotides having a sequence which is a variant of any one of SEQ ID NOS 1-10 having at least about 95% identity to SEQ ID NO: 1-10.
  • the variant has at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to SEQ ID NO: 1-10.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides complementary to a nucleic acid consisting of consecutive nucleotides having a sequence which is a variant of any one of SEQ ID NOS 1-10 having at least about 95% identity to SEQ ID NO: 1-10.
  • the variant has at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to SEQ ID NO: 1-10.
  • composition comprising one or more synthetic nucleic acids which have a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acid sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the invention provides a composition comprising one or more synthetic nucleic acids which have a sequence consisting of from about 10 to about 30 consecutive nucleotides complementary to a nucleic acid consisting of consecutive nucleotides having a sequence which is a variant of any one of SEQ ID NOS 1-10 having at least about 95% identity to SEQ ID NO: 1-10.
  • the variant has at least about 95.5%, about 96%>, about 96.5%>, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to SEQ ID NO: 1-10.
  • the invention is directed to isolated nucleic acid sequences such as primers and probes, comprising nucleic acid sequences derived from any one of SEQ ID NO: 1-10.
  • primers and probes may be useful for detecting the presence of the PRV of the invention, for example in samples of bodily fluids such as blood, saliva, or urine from an animal, and thus may be useful in the diagnosis of PRV infection.
  • probes can detect polynucleotides of SEQ ID NO: 1-10 in samples which comprise PRV represented by SEQ ID NO: 1-10.
  • the isolated nucleic acids which can be used as primer and/probes are of sufficient length to allow hybridization with, i.e. formation of duplex with a corresponding target nucleic acid sequence, a nucleic acid sequences of any one of SEQ ID NO: 1-10, or a variant thereof.
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 50 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 100 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 200 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10.
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 300 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 400 consecutive nucleotides from SEQ ID NO: 1 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 500 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10.
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 600 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 700 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 800 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10.
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 900 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 1000 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 1500 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 2000 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence complementary to any one of SEQ ID NO: 1-10. In one embodiment, the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 2500 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 3000 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 3500 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 3600 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention is directed to an isolated nucleic acid sequence comprising from about 10 to about 3621 consecutive nucleotides from any one of SEQ ID NO: 1-10 or a sequence
  • the invention provides a primer set for determining the presence or absence of the PRV in a biological sample, wherein the primer set comprises at least one synthetic nucleic acid sequence selected from the group consisting of: a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence selected from the group of sequences consisting of SEQ ID NO: 1-10, a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10.
  • the biological sample is derived from an animal suspected of having the PRV.
  • the invention provides a method for determining the presence or absence of a PRV in a biological sample, the method comprising: a) contacting nucleic acid from a biological sample with at least one primer which is a nucleic acid sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence which is complementary to a nucleic acid sequence selected from the group of sequences consisting of SEQ ID NO: 1-10, b) subjecting the nucleic acid and the primer to amplification conditions, and c) determining the presence or absence of amplification product, wherein the presence of amplification product indicates the presence of R A associated with PRV in the sample.
  • the biological sample is derived from a animal suspected of having a PRV.
  • the invention provides a method for determining the presence or absence of the PRV in a biological sample, the method comprising: a) contacting nucleic acid from a biological sample with at least one primer which is a synthetic nucleic acid which has a sequence consisting of from about 10 to about 30 consecutive nucleotides from a nucleic acids sequence selected from the group of sequences consisting of SEQ ID NO: 1-10, b) subjecting the nucleic acid and the primer to amplification conditions, and c) determining the presence or absence of amplification product, wherein the presence of amplification product indicates the presence of RNA associated with PRV in the sample.
  • the invention provides for an interfering RNA (iRNA) comprising a sense strand having at least 15 contiguous nucleotides complementary to a nucleic acid sequence of any of SEQ ID NO: 1-10.
  • iRNA interfering RNA
  • the invention provides a method of reducing the levels of a viral protein, viral mRNA or viral titer in a cell in an animal comprising:
  • the iRNA agent comprising a sense strand having at least 15 contiguous nucleotides complementary to gene from a PRV comprising any of SEQ ID NO: 1-10 and an antisense strand having at least 15 contiguous nucleotides complementary to the sense strand.
  • the iRNA agent is administered to an animal.
  • the iRNA agent is administered via nebulization to an animal.
  • the method further comprises co -administering a second iRNA agent to the animal, wherein the second iRNA agent comprising a sense strand having at least 15 or more contiguous nucleotides complementary to second gene from the PRV, and an antisense strand having at least 15 or more contiguous nucleotides complementary to the sense strand.
  • the invention provides a method of reducing the levels of a viral protein in a cell in an animal comprising the step of administering an iRNA agent to an animal, wherein the iRNA agent comprises a sense strand having at least 15 or more contiguous nucleotides complementary to a gene from a PRV comprising SEQ ID NO: 1-10 and an antisense strand having at least 15 or more contiguous nucleotides complementary to the sense strand.
  • the invention is directed to iRNA molecules which target nucleic acids from PRV, for example but not limited to SEQ ID NO: 1-10, and variants thereof, and silence a target gene.
  • RNA agent (abbreviation for "interfering RNA agent”) as used herein, is an RNA agent, which can down-regulate the expression of a target gene, e.g. a PRV gene.
  • An iRNA agent may act by one or more of a number of mechanisms, including post-transcriptional cleavage of a target mRNA sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms.
  • An iRNA agent can be a double stranded (ds) iRNA agent.
  • a "ds iRNA agent” (abbreviation for "double stranded iRNA agent”), as used herein, is an iRNA agent which includes more than one, and in certain embodiments two, strands in which interchain hybridization can form a region of duplex structure.
  • a "strand” herein refers to a contiguous sequence of nucleotides (including non-naturally occurring or modified nucleotides). The two or more strands may be, or each form a part of, separate molecules, or they may be covalently interconnected, e.g. by a linker, e.g. a polyethyleneglycol linker, to form but one molecule.
  • At least one strand can include a region which is sufficiently complementary to a target RNA. Such strand is termed the "antisense strand”.
  • a second strand comprised in the dsRNA agent which comprises a region complementary to the antisense strand is termed the "sense strand”.
  • a ds iRNA agent can also be formed from a single RNA molecule which is, at least partly; self-complementary, forming, e.g., a hairpin or panhandle structure, including a duplex region.
  • the term "strand” refers to one of the regions of the RNA molecule that is complementary to another region of the same RNA molecule.
  • iRNA agents as described herein can mediate silencing of a gene, e.g., by RNA degradation.
  • RNA is also referred to herein as the RNA to be silenced.
  • a gene is also referred to as a target gene.
  • the RNA to be silenced is a gene product of a PRV gene.
  • RNAi refers to the ability of an agent to silence, in a sequence specific manner, a target gene.
  • "Silencing a target gene” means the process whereby a cell containing and/or secreting a certain product of the target gene when not in contact with the agent, will contain and/or secret at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less of such gene product when contacted with the agent, as compared to a similar cell which has not been contacted with the agent.
  • product of the target gene can, for example, be a messenger RNA (mRNA), a protein, or a regulatory element.
  • silencing of a target gene can result in a reduction in "viral titer" in the cell or in the animal, wherein "reduction in viral titer” refers to a decrease in the number of viable virus produced by a cell or found in an organism undergoing the silencing of a viral target gene. Reduction in the cellular amount of virus produced can lead to a decrease in the amount of measurable virus produced in the tissues of an animal undergoing treatment and a reduction in the severity of the symptoms of the viral infection.
  • iRNA agents of the present invention are also referred to as "antiviral iRNA agents”.
  • PRV gene refers to any one of the genes identified in the PRV genome.
  • the invention provides methods for reducing viral titer in an animal, by administering to an animal, at least one iRNA which inhibits the expression of a PRV gene.
  • the invention provides methods for identifying and/or generating anti-viral drugs.
  • the invention provides methods for identifying drugs that bind to and/or inhibit the function of the PRV-encoded proteins of the invention, or that inhibit the replication or pathogenicity of the PRV of the invention.
  • Methods of identifying drugs that affect or inhibit a particular drug target such as high throughput drug screening methods, are well known in the art and can readily be applied to the proteins and viruses of the present invention.
  • the invention provides an isolated PRV polypeptide encoded by a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • PRV polypeptides and amino acid sequences described herein may be useful for, inter alia, expression of PRV -encoded proteins or fragments, variants, or derivatives thereof, generation of diagnostic antibodies against PRV proteins, generation of primers and probes for detecting PRV and/or for diagnosing PRV infection, and screening for drugs effective against Piscine reoviruses as described herein.
  • the PRV polypeptide fragment can be a polypeptide comprising about 8 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 10 consecutive amino acids of a PRV polypeptide described herein. In another
  • the fragment can be a polypeptide comprising about 14 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 16 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 18 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 20 consecutive amino acids of a PRV polypeptide described herein. In another embodiment, the fragment can be a polypeptide comprising about 21 or more consecutive amino acids of a PRV polypeptide described herein.
  • the PRV polypeptide fragment can be a polypeptide comprising from about 8 to about 50, about 8 to about 100, about 8 to about 200, about 8 to about 300, about 8 to about 400, about 8 to about 500, about 8 to about 600, about 8 to about 700, about 8 to about 800, about 8 to about 900 or more consecutive amino acids from a PRV polypeptide.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides having a sequence selected from a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides having a sequence selected from a variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10 or a fragment thereof.
  • the variant has at least about 85% identity to SEQ ID NOs: 1-10, or a fragment thereof.
  • the variant has at least about 90%>, about 95.5%, about 96%>, about 96.5%>, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid complementary a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid which comprises consecutive nucleotides a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid having a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a nucleic acid having a sequence substantially identical to a sequence
  • the invention provides an isolated PRV polypeptide having the sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from the group consisting of any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from a variant of any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the variant has at least about 85% identity to SEQ ID NOs: 29-40, or a fragment thereof.
  • the variant has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that of any one of SEQ ID NOs: 1-10, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide having a sequence substantially identical to a PRV amino acid sequence in any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide encoded by a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, or a fragment thereof.
  • the isolated PRV polypeptide fragment can be a
  • the fragment can be a polypeptide comprising about 8 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 10 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 14 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 16 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 18 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
  • the fragment can be a polypeptide comprising about 20 consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40. In another embodiment, the fragment can be a polypeptide comprising about 21 or more consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
  • the isolated PRV polypeptide fragment can be a polypeptide comprising from about 8 to about 50, about 8 to about 100, about 8 to about 200, about 8 to about 300, about 8 to about 400, about 8 to about 500, about 8 to about 600, about 8 to about 700, about 8 to about 800, about 8 to about 900 or more consecutive amino acids of a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
  • the invention provides an isolated PRV polypeptide which comprises consecutive amino acids having a sequence selected from a PRV amino acid sequence of any of SEQ ID NOs: 29-40.
  • the invention provides an isolated PRV polypeptide which comprises consecutive nucleotides having a sequence selected from a variant a PRV amino acid sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the variant has at least about 85% identity to any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the variant has at least about 90%>, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to any of SEQ ID NOs: 29-40, or a fragment thereof.
  • the invention provides an isolated PRV polypeptide substantially identical to variant a PRV amino acid sequence of any of SEQ ID NOs: 29-40, or a fragment thereof.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least of at least 98%>, at least 99% or higher nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • polypeptides that a substantially identical to the PRV polypeptides described herein can also be used to generate diagnostic antibodies that bind to the PRV polypeptides described herein.
  • Percent identity in the context of two or more nucleic acids or polypeptide sequences, refers to the percentage of nucleotides or amino acids that two or more sequences or subsequences contain which are the same.
  • a specified percentage of amino acid residues or nucleotides can have a specified identity over a specified region, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the invention provides a PRV polypeptide which is a variant of a PRV polypeptide and has at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to a PRV polypeptide shown in SEQ ID NOs 29-40.
  • PRV polypeptide shown in SEQ ID NOs 29-40.
  • Amino acid replacements between related amino 15 acids or replacements which have occurred frequently in evolution are, inter alia, Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (see Dayhof, M. D., Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington D.C., 1978, vol. 5, suppl. 3).
  • amino acid substitutions 20 include Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/ Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/ Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science, 227, 1435-1441, 1985) and determining the functional similarity between homologous proteins. Such amino acid substitutions of the exemplary embodiments of this invention, as well as variations having deletions and/or insertions are within the scope of the invention as long as the resulting proteins retain their immune reactivity.
  • the PRV polypeptides and the antibodies and antibody generation methods related thereto encompass PRV polypeptides isolated from different virus isolates that have sequence identity levels of at least about 90%, while still representing the same PRV protein with the same immunological characteristics.
  • sequence identities can be determined by analysis with a sequence comparison algorithm or by a visual inspection. Protein and/or nucleic acid sequence identities (homologies) can be evaluated using any of the variety of sequence comparison algorithms and programs known in the art.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • sequence comparison of nucleic acids and proteins the BLAST and BLAST 2.2.2. or FASTA version 3.0t78 algorithms and the default parameters discussed below can be used.
  • BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5787, 1993).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, less than about 0.01, and less than about 0.001.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360, 1987. The method used is similar to the method described by Higgins & Sharp, CABIOS 5: 151-153, 1989. The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
  • the multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments.
  • the program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters.
  • PILEUP a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
  • PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al, Nuc. Acids Res. 12:387-395, 1984.
  • the invention provides a computer readable medium having stored thereon (i) a nucleic acid sequence selected from the group consisting of: a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; a sequence variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; or (ii) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of: a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10, an amino acid sequence encoded by a sequence substantially identical to a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10; an amino acid sequence encoded by a sequence variant of a PRV nucleic acid sequence in any of SEQ ID NOs: 1-10.
  • the PRV nucleic acid sequences described herein may be useful for, inter alia, expression of PRV -encoded proteins or fragments, variants, or derivatives thereof, generation of diagnostic antibodies against PRV proteins (e.g. for determining whether an animal has been infected with PRV), generation of primers and probes for detecting PRV and/or for diagnosing PRV infection, and screening for drugs effective against Piscine reoviruses as described herein.
  • polypeptides of the present invention can be suitable for use as antigens to detect antibodies against PRV represented by SEQ ID NOs: 1-10, and variants thereof.
  • polypeptides of the present invention which comprise antigenic determinants can be used in various immunoassays to identify animals exposed to and/or samples which comprise PRV represented by SEQ ID NO: 1-10, and variants thereof.
  • the invention provides a diagnostic PRV antibody that binds a PRV, a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and wherein the antibody is an antibody that binds a PRV or a PRV polypeptide but does not inhibit, neutralize or reduce the activity or function of the polypeptide or the PRV.
  • the diagnostic antibody is a polyclonal antibody, a monoclonal antibody, a teleost antibody or a chimeric antibody. Methods for purifying immunoglobulins from teleosts are also known in the art.
  • the invention provides a method for determining whether or not a sample contains a PRV, the method comprising: (a) providing an immunoassay comprising a diagnostic antibody against a PRV derived antigen, (b) contacting the diagnostic antibody with a biological sample, (c) detecting binding between antigens in the test sample and the diagnostic antibody.
  • the immunoassay is a lateral flow assay or ELISA.
  • the biological sample is derived from an animal suspected of having a PRV.
  • the invention provides a method for determining whether or not a sample contains antibodies against PRV, the method comprising: (a) providing an immunoassay comprising an antigen from a PRV, (b) contacting the antigen with a biological sample, (c) detecting binding between antibodies in the test sample and the antigen.
  • the diagnostic antibodies of the invention can also be used to purify
  • the diagnostic antibodies of the invention can be used to identify expression and localization of a PRV polypeptide or variants or fragments thereof. Analysis of expression and localization of PRV polypeptides, or variants or fragments thereof, can be useful in diagnosing a PRV infection or for determining potential role of a PRV polypeptide.
  • the antibodies of the present invention can be used in various immunoassays to identify animals exposed to and/or samples which comprise antigens from PRV.
  • any suitable immunoassay which can lead to formation of antigen-antibody complex can also be used. Variations and different formats of immunoassays, for example but not limited to ELISA, lateral flow assays for detection of analytes in samples, immunoprecipitation, are known in the art.
  • the antigen and/or the antibody can be labeled by any suitable label or method known in the art. For example enzymatic immunoassays may use solid supports, or immunoprecipitation. Immunoassays which amplify the signal from the antigen- antibody immune complex can also be used with the methods described herein.
  • the invention provides methods for assaying a sample to determine the presence or absence of a PRV polypeptide, or a fragment or a variant thereof.
  • methods for assaying a sample include, but are not limited to, methods which can detect the presence of nucleic acids, methods which can detect the presence of PRV polypeptides, methods which can detect the presence of antibodies against PRV polypeptides, or any polypeptide encoded by a PRV nucleic acid.
  • the invention provides a PRV diagnostic kit comprising a PRV nucleic acid, a PRV nucleic acid fragment or a PRV nucleic acid variant, a nucleic acid substantially identical to a PRV nucleic acid, or a PRV diagnostic antibody.
  • the invention is directed to methods for generating diagnostic antibodies that bind to the PRV polypeptides described herein by generating antibodies that bind to a fragment of a polypeptide described herein.
  • the invention relates to diagnostic kits for detecting PRV infection or the presence of PRV in a sample, that comprise a PRV nucleic acid or a PRV diagnostic antibody.
  • the invention provides a nucleic acid vector comprising a PRV nucleic acid sequence, a PRV nucleic acid fragment or a PRV nucleic acid variant, or a nucleic acid substantially identical to a PRV nucleic acid.
  • the invention provides a nucleic acid vector encoding a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a
  • Non-limiting examples of vectors include, but are not limited to retroviral, adenoviral, adeno-associated viral, lentiviral, and vesiculostomatitis viral vectors.
  • the invention provides a host organism comprising a nucleic acid vector encoding a PRV polypeptide, a PRV polypeptide fragment, a PRV polypeptide variant, a polypeptide substantially identical to a PRV polypeptide or a the diagnostic PRV antibody that binds a PRV, a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and which does not inhibit, neutralize or reduce the activity or function of the polypeptide or the PRV.
  • the host organism is a prokaryote, a eukaryote, or a fungus.
  • the organism is a teleost (e.g. a salmon).
  • the PRV nucleic acid sequences of the invention can be delivered to cultured cells, for example by transfecting cultured cells with plasmids or expression vectors containing PRV nucleic acid sequences, or by infecting cultured cells with recombinant viruses containing PRV nucleic acid sequences.
  • PRV polypeptides may then be expressed in a host cell or expression system and purified.
  • a host cell may be a cell of bacterial origin, e.g.
  • Escherichia coli, Bacillus subtilis and Lactobacillus species in combination with bacteria-based plasmids as pBR322, or bacterial expression vectors as pGEX, or with bacteriophages.
  • the host cell may also be of eukaryotic origin, e.g. yeast-cells in combination with yeast-specific vector molecules, or higher eukaryotic cells like insect cells (Luckow et al; Bio-technology 6: 47-55 (1988)) in combination with vectors or recombinant baculoviruses, plant cells in combination with e.g. Ti- plasmid based vectors or plant viral vectors (Barton, K. A.
  • Plasmids and expression vectors can include a promoter for directing transcription of the nucleic acid.
  • the nucleic acid sequence encoding PRV polypeptides may also be incorporated into a suitable recombinant virus for
  • suitable viruses include, but are not limited to, vaccinia viruses, retroviruses, adenoviruses and adeno-associated viruses.
  • vaccinia viruses retroviruses
  • adenoviruses adeno-associated viruses.
  • the diagnostic PRV antibodies described herein can also be generated using live recombinant carriers capable of expressing the polypeptides described herein.
  • Live recombinant carriers are micro-organisms or viruses in which additional genetic information, e.g. a nucleic acid sequence encoding a PRV polypeptide, or a fragment thereof has been cloned. Animals infected with such live recombinant carriers will produce an immunological response not only against the immunogens of the carrier, but also against the PRV polypeptide or PRV polypeptide fragment.
  • live recombinant carriers suitable for use with the methods described herein includes Vibrio anguillarum (Singer, J. T. et al.
  • the diagnostic PRV antibodies described herein can also be generated by any other method known in the art.
  • Exemplary alternative in- vitro antibody generation technologies, transgenic animal technologies and hybridoma technologies See, e.g., Ausubel, et al, ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2001); Sambrook, et al, Molecular Cloning: A Laboratory Manual, 2 nd Edition, Cold Spring Harbor, N.Y. (1989); Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.
  • Ribosome display is a method of translating mRNAs into their cognate proteins while keeping the protein attached to the RNA.
  • the nucleic acid coding sequence is recovered by RT-PCR (Mattheakis, L. C. et al. 1994. Proc Natl Acad Sci USA 91, 9022).
  • Yeast display is based on the construction of fusion proteins of the membrane-associated alpha-agglutinin yeast adhesion receptor, agal and aga2, a part of the mating type system (Broder, et al. 1997. Nature Biotechnology, 15:553-7).
  • Bacterial display is based fusion of the target to exported bacterial proteins that associate with the cell membrane or cell wall (Chen and Georgiou 2002. Biotechnol Bioeng, 79:496-503). In comparison to hybridoma technology, phage and other antibody display methods afford the opportunity to manipulate selection against the antigen target in vitro and without the limitation of the possibility of host effects on the antigen or vice versa.
  • the diagnostic PRV antibodies described herein that bind a PRV polypeptide, a PRV polypeptide fragment or a PRV polypeptide variant, or a polypeptide substantially identical to a PRV polypeptide and which do not inhibit, neutralize or reduce the activity or function of the polypeptide or the PRV may be obtained by selecting from libraries, e.g. a phage library.
  • a phage library can be created by inserting a library of random oligonucleotides or a library of polynucleotides containing sequences of interest, such as from the B-cells of an immunized animal (Smith, G. P. 1985. Science 228: 1315-1317).
  • Antibody phage libraries contain heavy (H) and light (L) chain variable region pairs in one phage allowing the expression of single-chain Fv fragments or Fab fragments (Hoogenboom, et al. 2000, Immunol Today 21(8) 371-10).
  • the diversity of a phagemid library can be manipulated to increase and/or alter the immunospecificities of the monoclonal antibodies of the library to produce and subsequently identify additional, teleost monoclonal antibodies.
  • the heavy (H) chain and light (L) chain immunoglobulin molecule encoding genes can be randomly mixed (shuffled) to create new HL pairs in an assembled immunoglobulin molecule.
  • H and L chain encoding genes can be mutagenized in a complementarity determining region (CDR) of the variable region of the immunoglobulin polypeptide, and subsequently screened for desirable affinity and neutralization capabilities.
  • CDR complementarity determining region
  • Antibody libraries also can be created synthetically by selecting one or more framework sequences and introducing collections of CDR cassettes derived from antibody repertoires or through designed variation (Kretzschmar and von Ruden 2000, Current Opinion in Biotechnology, 13:598-602). The positions of diversity are not limited to CDRs but can also include the framework segments of the variable regions or may include other than antibody variable regions, such as peptides.
  • Other antibody generation techniques suitable for generating diagnostic PRV antibodies against the PRV polypeptides described herein include, the PEPSCAN technique described in Geysen et al (Patent Application WO 84/03564, Patent
  • Pepsin or papain digestion of whole diagnostic PRV antibodies that bind PRV polypeptides can be used to generate diagnostic PRV antibodies fragments that bind PRV polypeptides.
  • an Fab fragment consists of a monovalent antigen- binding fragment of an diagnostic antibody molecule, and can be produced by digestion of a whole diagnostic antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
  • An (Fab') 2 fragment of an diagnostic antibody can be obtained by treating a whole diagnostic antibody molecule with the enzyme pepsin, without subsequent reduction.
  • An Fab' fragment of an diagnostic antibody molecule can be obtained from (Fab') 2 by reduction with a thiol reducing agent, which yields a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per diagnostic antibody molecule treated in this manner.
  • Diagnostic PRV antibodies can be produced through chemical crosslinking of the selected molecules (which have been produced by synthetic means or by expression of nucleic acid that encode the polypeptides) or through recombinant DNA technology combined with in vitro, or cellular expression of the polypeptide, and subsequent oligomerization.
  • Antibodies can be similarly produced through recombinant technology and expression, fusion of hybridomas that produce antibodies with different epitope specificities, or expression of multiple nucleic acid encoding antibody variable chains with different epitopic specificities in a single cell.
  • the diagnostic antibodies described herein may be either joined directly or indirectly through covalent or non-covalent binding, e.g. via a multimerization domain, to produce multimers.
  • a "multimerization domain” mediates non-covalent protein- protein interactions. Specific examples include coiled-coil (e.g., leucine zipper structures) and alpha-helical protein sequences. Sequences that mediate protein-protein binding via Van der Waals' forces, hydrogen bonding or charge-charge bonds can also be used as multimerization domains. Additional examples include basic-helix-loop- helix domains and other protein sequences that mediate heteromeric or homomeric protein-protein interactions among nucleic acid binding proteins (e.g., DNA binding transcription factors, such as TAFs).
  • TAFs DNA binding transcription factors
  • multimerization domain p53 residues 319 to 360 which mediate tetramer formation.
  • human platelet factor 4 which self-assembles into tetramers.
  • extracellular protein TSP4 a member of the thrombospondin family, which can form pentamers.
  • Additional specific examples are the leucine zippers of jun, fos, and yeast protein GCN4.
  • the diagnostic antibodies described herein s may be directly linked to each other via a chemical cross linking agent or can be connected via a linker sequence (e.g., a peptide sequence) to form multimers.
  • a linker sequence e.g., a peptide sequence
  • the diagnostic antibodies described herein can be polyclonal or monoclonal.
  • the antibodies can also be chimeric (i.e., a combination of sequences from more than one species, for example, a chimeric mouse-salmon immunoglobulin).
  • chimeric i.e., a combination of sequences from more than one species, for example, a chimeric mouse-salmon immunoglobulin.
  • the presence of such protein sequences form other species can lead to the rapid clearance of the antibodies or can lead to the generation of an immune response against the antibody by an antibody.
  • the diagnostic antibodies described herein can be antibodies that bind to other molecules (antigens) via heavy and light chain variable domains, V H and V L ,
  • the antibodies described herein include, but are not limited to IgY, IgY(AFc)), IgG, IgD, IgA, IgM, IgE, and IgL.
  • the antibodies may be intact
  • immunoglobulin molecules two full length heavy chains linked by disulfide bonds to two full length light chains, as well as subsequences (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen, or subsequences thereof (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen.
  • Antibodies may comprise full length heavy and light chain variable domains, V H and V L , individually or in any combination.
  • the basic immunoglobulin (antibody) structural unit can comprise a tetramer.
  • Each tetramer can be composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kD) and one "heavy” chain (about 50-70 kD).
  • the N- terminus of each chain defines a variable region of about 100 to 1 10 or more amino acids primarily responsible for antigen recognition.
  • the terms variable light chain (Vi) and variable heavy chain (VH) refer to these light and heavy chains respectively.
  • the diagnostic antibodies described herein may exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases.
  • pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)' 2 , a dimer of Fab which itself is a light chain joined to VH-C h 1 by a disulfide bond.
  • the F(ab)' 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the F(ab)' 2 dimer into an Fab' monomer.
  • the Fab' monomer is essentially an Fab with part of the hinge region (see, Fundamental Immunology, W. E.
  • the Fab' regions may be derived from antibodies of animal origin or may be chimeric (Morrison et al, Proc Natl. Acad. Sci. USA 81 , 6851-10855 (1984) both incorporated by reference herein) (Jones et al, Nature 321 , 522-525 (1986), and published UK patent application No. 8707252, both incorporated by reference herein).
  • the diagnostic antibodies described herein can include or be derived from any mammal, such as but not limited to, a fish, a human, a mouse, a rabbit, a rat, a rodent, a primate, or any combination thereof and includes isolated fish, human, primate, rodent, mammalian, chimeric, humanized and/or CDR-grafted or CDR-adapted antibodies, immunoglobulins, cleavage products and other portions and variants thereof. In one embodiment the antibody is purified.
  • the diagnostic antibodies described herein include full length antibodies, subsequences (e.g., single chain forms), dimers, trimers, tetramers, pentamers, hexamers or any other higher order oligomer that retains at least a part of antigen binding activity of monomer.
  • Multimers can comprise heteromeric or homomeric combinations of full length antibody, subsequences, unmodified or modified as set forth herein and known in the art.
  • Antibody multimers are useful for increasing antigen avidity in comparison to monomer due to the multimer having multiple antigen binding sites.
  • Antibody multimers are also useful for producing oligomeric (e.g., dimer, trimer, tertamer, etc.) combinations of different antibodies thereby producing compositions of antibodies that are multifunctional (e.g., bifunctional, trifunctional, tetrafunctional, etc.).
  • diagnostic antibody subsequences include, for example, Fab, Fab', (Fab') 2 , Fv, or single chain antibody (SCA) fragment (e.g., scFv).
  • Subsequences include portions which retain at least part of the function or activity of full length sequence.
  • an antibody subsequence will retain the ability to selectively bind to an antigen even though the binding affinity of the subsequence may be greater or less than the binding affinity of the full length antibody.
  • An Fv fragment is a fragment containing the variable region of a light chain VL and the variable region of a heavy chain VH expressed as two chains.
  • the association may be non-covalent or may be covalent, such as a chemical cross-linking agent or an intermolecular disulfide bond (Inbar et al, (1972) Proc. Natl. Acad Sci. USA 69:2659; Sandhu (1992) Crit. Rev. Biotech. 12:437).
  • subsequences of the diagnostic antibodies described herein such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, provided that the subsequences bind to the antigen to which the intact antibody binds.
  • a single chain antibody is a genetically engineered or enzymatically digested antibody containing the variable region of a light chain VL and the variable region of a heavy chain, optionally linked by a flexible linker, such as a polypeptide sequence, in either VL-linker-VH orientation or in VH-linker-VL orientation.
  • a single chain Fv fragment can be produced by linking two variable domains via a disulfide linkage between two cysteine residues.
  • Methods for producing scFv antibodies are described, for example, by Whitlow et al, (1991) In: Methods: A Companion to Methods in Enzymology 2:97; U.S. Pat. No. 4,946,778; and Pack et al, (1993) Bio/Technology 11 : 1271.
  • PRV nucleic acids and polypeptides described herein can be used to generate diagnostic antibodies that that can be used to detect the present or absence of a PRV or a PRV polypeptide in an animal or in a sample
  • diagnostic antibodies that can be used to detect the present or absence of a PRV or a PRV polypeptide in an animal or in a sample
  • a 200nt fragment that is approximately 50% homologous at the amino acid level to mammalian Orthoreoviruses was obtained through high throughput sequencing of samples obtained from farmed salmon with HSMI in Norway. Quantitative PCR assays of muscle tissue from salmon with HSMI and normal salmon reveals a higher viral load in salmon with HSMI.
  • Example 2 Heart and skeletal muscle inflammation of farmed salmon is associated with infection with a novel reovirus
  • database alignment analysis at the nucleotide level revealed no evidence of infection, the predicted amino acid sequence of one 265 nucleotide read was 49% similar to the core-spike protein ⁇ 2 of Mammalian orthoreovirus 3 (AF378009).
  • HSMI serum sample with the highest genetic load by PCR (3.0 x 106 genome copies/ ⁇ ) was selected for additional pyrosequencing yielding 120,705 reads.
  • a suite of bioinformatic tools was used to identify viral sequences.
  • BLASTN and BLASTX Altschul et al, J Mol Biol 215, 403-410 (1990) detected 1.5% and 53.9% of the predicted viral genome, respectively, enabling identification of segments LI, L2, L3, Ml, M2 and M3 ( Figure 1).
  • the genome of the PRV comprises at least 10 RNA segments (GenBank Accession numbers GU994013-GU994022).
  • Reoviruses are non-enveloped icosahedral viruses with double-stranded RNA genomes comprising 10-12 segments. Twelve genera are defined based on host range, number of genome segments, G/C content, and antigenic relationships.
  • a phylogenetic tree constructed using L gene segment sequences of known reoviruses indicate that PRV represents a distinct genetic lineage branching off the root of the aquareovirus and orthoreovirus genera, viruses of fish and shellfish, reptiles, birds and mammals (Figure 2).
  • Analysis of all ten PRV gene segments confirmed the divergence of PRV sequence with respect to other Reoviruses ( Figures 5 to 12). All PRV gene segments contained the 3' terminal nucleotides
  • the orthoreoviruses have polycistronic segments in either SI or S4. Whereas aquareovirus species C are polycistronic in the S7 (the orthoreovirus SI homolog), the other aquareovirus species are not (Attoui et al, J Gen Virol 83, 1941-1951 (2002)).
  • homologues of the ⁇ , ⁇ 2, ⁇ 3, ⁇ , ⁇ 2, ⁇ 3, ⁇ 2 and aNS sequences of PRV are found in orthoreoviruses and aquareoviruses, the ⁇ and ⁇ 3 sequences and the small putative open reading frames observed in S2 and SI appear distinctive.
  • the structure of the latter is similar to a fusion-associated small transmembrane (FAST) reovirus protein
  • Reovirus FAST proteins are nonstructural, single-pass membrane proteins that induce cell-cell fusion and syncytium formation (Shmulevitz et al, EMBO J 19, 902-912 (2000)).
  • PRV was detected in only sixteen of these samples (24.2%). Two of these sixteen samples were positive by the cutoff established for farmed salmon with relative log ratios of 6.70 and 7.58; the other fourteen had
  • PRV RNA was distributed throughout the myocardium and endocardium of salmon with HSMI ( Figure 4A, 4B) but not detected in normal salmon or salmon infected with salmon pancreas disease virus ( Figure 4C, 4D)
  • PRV has not been cultured. Furthermore, PRV has been found in farmed fish that do not show clinical signs of HSMI. Moreover, PRV has been also detected in low quantities in wild Atlantic salmon. Nonetheless, the tissue distribution and load of PRV are correlated with disease in naturally and experimentally infected salmon.
  • HSMI was experimentally-induced in normal Atlantic salmon by inoculation with heart and kidney extracts from fish with HSMI or cohabitation with fish with HSMI.
  • RNA extracted from heart tissue from Atlantic salmon with experimentally- induced HSMI was used as template for high throughput pyrosequencing. Sequences were analyzed using a suite of bioinformatic applications available at the GreenePortal website (http://tako.cpmc. Columbia edu/Tools), including FASD, a method whereby the statistical distribution of oligonucleotide frequencies within an unknown sequence set is compared to frequencies calculated for known sequence sets.
  • RNA extracts were treated with DNase I and cDNA generated by using the Superscript II system for reverse transcription primed by random octamers that were linked to an arbitrary defined 17-mer primer sequence (Palacios et al, Emerg Infect Dis 13, 73-81 (2007)).
  • the resulting cDNA was treated with RNase H and then randomly amplified by the polymerase chain reaction (PCR); applying a 9: 1 mixture of a primer corresponding to the defined 17-mer sequence and the random octamer-linked 17-mer primer, respectively (Palacios et al., Emerg Infect Dis 13, 73-81 (2007)).
  • Products >70 base pairs (bp) were selected by column purification and ligated to specific linkers for sequencing on the 454 Genome Sequencer FLX without fragmentation of the cDNA (Margulies, M. et al, Nature 437, 376-380 (2005); Palacios et al. N Engl J Med 358, 991-998 (2008); Cox-Foster et al, Science 318, 283-287 (2007)).
  • Phylogenetic analysis were performed using p-distance as model of amino acid substitution as accepted by ICTV for analysis of the Reoviridae family.
  • MEGA was used to produce phylogenetic trees, reconstructed through the Neighbor Joining (NJ) method.
  • Quantitative assays were established based upon virus specific sequences obtained from the high throughput sequencing for several reo virus segments.
  • Six different realtime assays were designed targeting genome fragment LI, L2 and M3 (SYBR green) as well as LI and S4 (MGB assays) (See Table 2 for a list of the primers).
  • Samples from different organs from experimentally infected fish were positive while samples from non-infected control fish were negative.
  • the real-time PCR for segment LI was performed using the QIAGEN OneStep kit.
  • Six ⁇ of template RNA were denatured (95°C/5 min). Reactions were performed using the following concentrations: 400 nM primer, 300 nM probe and 1.25 mM MgCl 2 .
  • Standard curves were created using RNA pooled from three fish with high viral loads. Standard curves were made in duplicates for both the MGB assay and the EFIA assay (Olsvik et al, BMC Mol Biol 6, 21 (2005)) and relative viral RNA loads for field samples were calculated by using normalization against EFIA.
  • Table 2 Primers for realtime assays for targeting genome fragment LI, L2 and M3 (SYBR green) as well as LI and S4.
  • AqureoGT70F SYBR L2 (1577- AGGATGTATGCCACTAGCTCC SEQ ID NO: 11 green 1561)
  • AquareoNS86F SYBR M3 (2119- TCAGTGCGGGGAACTCTAGTGGCA SEQ ID NO: 15 green 2096)
  • AquareoNS86R SYBR M3 (2025- GACGACCTTGAACGCACGAGCGTG SEQ ID NO: 16 green 2048)
  • Sections were incubated with a mouse monoclonal anti-DIG-HRP overnight at 4°C and stained using a Tyramide Signal Amplification System (Perkin Elmer, MA, USA) according to the manufacturer's protocol. Sections were counterstained with Meyer's hematoxylin solution. Negative controls included were samples from non- infected fish from experimental trial, head kidney samples from non-infected fish as a source of immune cells, salmon with pancreatic disease (a differential diagnosis to HSMI), and samples from material sent for diagnostics at random.
  • a Tyramide Signal Amplification System Perkin Elmer, MA, USA
  • StatView version 5.0.1 software for Windows was used for all statistical analyses. Samples without detectable LI viral gene transcripts were excluded from statistical analysis. Log transformations were performed for all other samples after calculating LI/ EF1A ratios (adjusted by a factor of 108). Log-transformed data were retained to facilitate graphical display of group differences, though distributions were not normalized by this method; thus, nonparametric analytic approaches were employed (Mann- Whitney U-test for comparison of healthy and HSMI fish; Kruskal-Wallis for comparisons of healthy and early, middle and peak phase HSMI fish). For all tests, statistical significance was assumed where p ⁇ 0.05.
  • Example 8 Propagation of virus in cell culture
  • Syncytium formation and vacuolization can be observed after infecting epithelioma paplosum cyprini (EPC) cells and fat head minnow (FHM) cells with tissue homogenate from HSMI diagnosed fish, however the cytopathic effect (CPE) is rarely seen after 2 to 4 passages.
  • EPC epithelioma paplosum cyprini
  • FHM fat head minnow
  • Virus-like particles of 60 to 80 nm diameter are been observed in necrotic cardiomyocytes diagnosed with HSMI.
  • Chloroform sensitivity analysis shows that PRV belongs to the Reoviridae family, which is a family of naked viruses.
  • Example 11 Screening of heart samples from experimental challenge
  • the open reading frame (ORF), minus the 126 first nucleotides, of the M2 genomic segment (SEQ ID NO: 5) encoding the ⁇ protein was cloned in the pETlOO plasmid and expressed as His-tag fusion protein in E.coli, purified.
  • the ⁇ protein is posttranscriptionally cleaved into ⁇ in mammalian orthoreovirus in a process wherein 42 aa are removed from the N-terminus of ⁇ .
  • the protein was used for immunization of a rabbit to obtain polyclonal, antiserum.
  • the antiserum recognizes the ⁇ protein as found in Western blots of E. coli His-tag fusion protein and different negative controls ( Figure 20).
  • the antiserum recognizes PRV, as has been shown in immunohistochemistry of hearts of fish with HSMI.
  • ORF open reading frame
  • SEQ ID NO: 2 The open reading frame (ORF), from nucleotide 29-1018 of the SI genomic segment (SEQ ID NO: 2) encoding the ⁇ 3 protein (330 amino acids long) (SEQ ID NO: 39) was cloned in the pETlOl plasmid and expressed as His-tag fusion protein in E. coli, purified and used for immunization for a rabbit to obtain polyclonal, ⁇ 3 -specific antiserum.
  • the antiserum recognizes the s3 protein as found in western blots of E. coli His-tag fusion protein and different negative controls.
  • the antiserum recognizes native PRV, as has been shown in immunohistochemistry of heart of fish with HSMI.
  • ORF open reading frame
  • SEQ ID NO: 2 The open reading frame (ORF), from the nucleotide 22-1281 of the S2 genomic segment (SEQ ID NO: 2) encoding the ⁇ protein (420 amino acids long) (SEQ ID NO: 35) was cloned in the pETlOl plasmid and expressed as a His-tag fusion protein in E. Coli, purified and used for immunization of a rabbit to obtain polyclonal, a2-specific antiserum. The antiserum recognizes the ⁇ protein as found in western blots of E. coli His-tag fusion protein ( Figure 21) and in immunohistochemistry of hearts of fish with HSMO.
  • ORF open reading frame
  • Peptides were synthesized form the amino acid sequnces of assumed antigenic region from the fusion-associated small transmembrane protein (FAST) protein (SEQ ID NO: 40) encoded by SI (SEQ ID NO: 2) (nucleotide 108-479, +1 frame relative to the ORF of ⁇ 3) and was used for immunization of a rabbit to obtain polyclonal FAST- specific antiserum.
  • FAST fusion-associated small transmembrane protein
  • SI small transmembrane protein
  • Example 13 Virus characterization and virulence studies
  • PRV virus segments were cloned and expressed in insect and fish cell lines to examine potential virulence factors virus characterization and virulence studies. The hemagglutinating properties of the virus will also be tested and samples from geographically distant areas will be sequenced to study potential differences and strain variations.
  • Example 14 Screening of wild fish and fertilized eggs

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
PCT/US2010/051348 2009-10-02 2010-10-04 Piscine reovirus diagnostic compositions Ceased WO2011041790A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP10821408.1A EP2482825B1 (en) 2009-10-02 2010-10-04 Piscine reovirus diagnostic compositions
US13/499,867 US9366667B2 (en) 2009-10-02 2010-10-04 Piscine reovirus diagnostic compositions
CA2776534A CA2776534A1 (en) 2009-10-02 2010-10-04 Piscine reovirus diagnostic compositions

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US24805809P 2009-10-02 2009-10-02
US61/248,058 2009-10-02
US32504710P 2010-04-16 2010-04-16
US61/325,047 2010-04-16
US38059410P 2010-09-07 2010-09-07
US61/380,594 2010-09-07

Publications (1)

Publication Number Publication Date
WO2011041790A1 true WO2011041790A1 (en) 2011-04-07

Family

ID=43826692

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2010/051346 Ceased WO2011041789A1 (en) 2009-10-02 2010-10-04 Piscine reovirus immunogenic compositions
PCT/US2010/051348 Ceased WO2011041790A1 (en) 2009-10-02 2010-10-04 Piscine reovirus diagnostic compositions

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2010/051346 Ceased WO2011041789A1 (en) 2009-10-02 2010-10-04 Piscine reovirus immunogenic compositions

Country Status (8)

Country Link
US (3) US9366667B2 (enExample)
EP (2) EP2482825B1 (enExample)
JP (1) JP2013506672A (enExample)
CN (1) CN102647988A (enExample)
CA (2) CA2776386C (enExample)
CL (5) CL2012000821A1 (enExample)
DK (1) DK179132B1 (enExample)
WO (2) WO2011041789A1 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015028565A1 (en) * 2013-08-30 2015-03-05 Veterinærinstituttet Method for propagating a virus
US9395356B2 (en) 2009-10-02 2016-07-19 The National Veterinary Institute Piscine reovirus immunogenic compositions
CN109971890A (zh) * 2019-04-30 2019-07-05 上海海洋大学 Ii型草鱼呼肠孤病毒的微滴式数字pcr检测试剂盒及其专用引物和探针
CN112048575A (zh) * 2020-10-26 2020-12-08 深圳市莱孚生物科技有限公司 一种用于鉴定草鱼出血热病毒的引物及探针以及检测方法

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL230970A0 (en) 2014-02-13 2014-09-30 Univ Ramot Tilapia virus vaccines
CL2015000980A1 (es) * 2014-04-18 2016-07-01 Upstartdna Co Ltd Standard Entity Métodos para detectar patógenos en peces de agua fría.
NO346439B1 (en) * 2014-06-03 2022-08-15 Veterinærinstituttet New reovirus infecting rainbow trout
WO2016075277A1 (en) 2014-11-14 2016-05-19 Patogen Analyse As Novel fish virus and method for detection
CR20210528A (es) 2014-12-15 2021-12-06 Univ Columbia VIRUS NUEVO DE TILAPIA Y USOS DEL MISMO(Divisional Exp: 2017-0322)
EP3720486A1 (en) 2017-12-06 2020-10-14 Intervet International B.V. Use of a non-structural protein from prv to protect against heart and skeletal muscle inflammation
CN111004864A (zh) * 2018-10-05 2020-04-14 福又达生物科技股份有限公司 虾病原体检测方法
US10688050B1 (en) 2018-12-21 2020-06-23 Synthon B.V. Pharmaceutical composition comprising ibrutinib
NO344967B1 (en) 2019-01-30 2020-08-03 Patogen As Piscine Orthoreovirus Virulence Markers
CN110079507B (zh) * 2019-05-06 2022-05-20 中国海洋大学 抗牙鲆黏膜免疫球蛋白IgT的单克隆抗体及其应用
CN110408637B (zh) * 2019-08-08 2020-12-25 中国水产科学研究院长江水产研究所 一种草鱼出血病酵母口服疫苗及应用
US12502426B2 (en) 2019-12-16 2025-12-23 Intervet Inc. Inactivated piscine orthoreovirus vaccine
NO346211B1 (en) 2020-07-14 2022-04-19 Patogen As Piscine Orthoreovirus Virulence Markers
CN112206317B (zh) * 2020-10-12 2023-09-22 浙江省淡水水产研究所 一种草鱼出血病二价核酸菌蜕疫苗的制备方法
CN113527475B (zh) * 2021-06-07 2022-04-29 浙江省农业科学院 一种分泌鸭新型呼肠孤病毒σC蛋白单抗的杂交瘤细胞、单抗及应用
CN114164159B (zh) * 2021-06-21 2023-10-03 湖南师范大学 一种具有防治鱼类杀鲑气和迟缓爱德华氏菌感染的二联疫苗及其制备方法与应用
KR102734012B1 (ko) * 2021-08-19 2024-11-25 성균관대학교산학협력단 바이러스성 출혈성 패혈증 바이러스에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편, 및 이들의 용도
CL2024000227A1 (es) * 2024-01-25 2024-07-12 Univ Santiago Chile Proteína de piscine orthoreovirus; composición de vacuna; y su uso.
CN118853676B (zh) * 2024-09-03 2025-03-07 中国水产科学研究院淡水渔业研究中心 一种草鱼ii型呼肠孤病毒反义rna及其重组载体、试剂盒和应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5670367A (en) * 1991-08-26 1997-09-23 Immuno Aktiengesellschaft Recombinant fowlpox virus
US20080226602A1 (en) * 2007-03-12 2008-09-18 Oncolytics Biotech Inc. Reoviruses having modified sequences
US20080256662A1 (en) * 1999-05-10 2008-10-16 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants

Family Cites Families (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
NZ207394A (en) 1983-03-08 1987-03-06 Commw Serum Lab Commission Detecting or determining sequence of amino acids
WO1986006487A1 (en) 1985-04-22 1986-11-06 Commonwealth Serum Laboratories Commission Method for determining mimotopes
NZ215865A (en) 1985-04-22 1988-10-28 Commw Serum Lab Commission Method of determining the active site of a receptor-binding analogue
US4737323A (en) 1986-02-13 1988-04-12 Liposome Technology, Inc. Liposome extrusion method
GB8607679D0 (en) 1986-03-27 1986-04-30 Winter G P Recombinant dna product
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
FR2737730B1 (fr) 1995-08-10 1997-09-05 Pasteur Merieux Serums Vacc Procede de purification de virus par chromatographie
JP4323720B2 (ja) 1998-05-08 2009-09-02 インターベツト・インターナシヨナル・ベー・ベー 魚膵臓病ウイルス構造タンパク質およびその使用
EP1206550B1 (en) 1999-08-03 2005-11-16 Akzo Nobel N.V. Proteins derived from white spot syndrome virus and uses thereof
US6919083B1 (en) 1999-08-07 2005-07-19 Novartis Ag Nucleic acid and amino acid sequences of infectious salmon anaemia virus and their uses as vaccines
ATE286507T1 (de) 1999-10-18 2005-01-15 Akzo Nobel Nv Dna kodierend für das strukturalprotein-1 vom infektiösen lachs anämie virus und ihre verwendungen
EP1282710B1 (en) 2000-03-11 2008-03-05 Novartis AG Fish vaccine against piscirickettsia salmonis
CA2325088A1 (en) * 2000-12-01 2002-06-01 Fusogenix Inc. Novel membrane fusion proteins derived from poikilothermic reovirus
EP1578987A2 (en) 2001-08-03 2005-09-28 Diversa Corporation Epoxide hydrolases, nucleic acids encoding them and methods for making and using them
US7670604B2 (en) 2002-12-13 2010-03-02 Aurelium Biopharma, Inc. Vimentin directed diagnostics and therapeutics for multidrug resistant neoplastic disease
WO2004065415A2 (en) * 2003-01-20 2004-08-05 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. L-amino acid oxidase with cytotoxic activity from aplysia punctata
GB2429711B (en) * 2004-06-11 2008-05-21 Pharmaq As Heart and skeletal muscle inflammation (HSMI) virus
US7361468B2 (en) * 2004-07-02 2008-04-22 Affymetrix, Inc. Methods for genotyping polymorphisms in humans
WO2006090863A1 (ja) 2005-02-22 2006-08-31 Ngk Insulators, Ltd. 光変調器
US8088976B2 (en) 2005-02-24 2012-01-03 Monsanto Technology Llc Methods for genetic control of plant pest infestation and compositions thereof
WO2007020983A1 (ja) * 2005-08-18 2007-02-22 Japan Science And Technology Agency オオムギest配列を利用して作製された二倍体コムギ遺伝地図を用いるコムギの育種方法
DK179025B1 (da) * 2005-09-16 2017-08-28 Intervet Int Bv Fiskevaccine
MX2009009530A (es) 2007-03-07 2010-05-19 Nventa Biopharmaceuticals Corp Composiciones de acidos nucleicos cerrados bicatenarios.
WO2010024284A1 (ja) * 2008-09-01 2010-03-04 国立大学法人 北海道大学 魚類抗ウイルスワクチン、魚類免疫賦活剤、および魚類免疫付与方法
US9366667B2 (en) 2009-10-02 2016-06-14 The Trustees Of Columbia University In The City Of New York Piscine reovirus diagnostic compositions

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5670367A (en) * 1991-08-26 1997-09-23 Immuno Aktiengesellschaft Recombinant fowlpox virus
US20080256662A1 (en) * 1999-05-10 2008-10-16 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
US20080226602A1 (en) * 2007-03-12 2008-09-18 Oncolytics Biotech Inc. Reoviruses having modified sequences

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE SWISS-PROT [online] 28 November 2006 (2006-11-28), ZENG ET AL.: "Lambda-1 protein", XP008159983, Database accession no. AOFKT9 *
See also references of EP2482825A4 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9395356B2 (en) 2009-10-02 2016-07-19 The National Veterinary Institute Piscine reovirus immunogenic compositions
EP2482825B1 (en) 2009-10-02 2016-11-23 The Trustees of Columbia University in the City of New York Piscine reovirus diagnostic compositions
WO2015028565A1 (en) * 2013-08-30 2015-03-05 Veterinærinstituttet Method for propagating a virus
CN105683367A (zh) * 2013-08-30 2016-06-15 坊玛药物公司 用于增殖病毒的方法
AU2014314140B2 (en) * 2013-08-30 2020-10-22 Pharmaq As Method for propagating a virus
CN109971890A (zh) * 2019-04-30 2019-07-05 上海海洋大学 Ii型草鱼呼肠孤病毒的微滴式数字pcr检测试剂盒及其专用引物和探针
CN112048575A (zh) * 2020-10-26 2020-12-08 深圳市莱孚生物科技有限公司 一种用于鉴定草鱼出血热病毒的引物及探针以及检测方法

Also Published As

Publication number Publication date
CL2012000821A1 (es) 2012-08-03
CA2776534A1 (en) 2011-04-07
CL2012000822A1 (es) 2012-07-20
US9366667B2 (en) 2016-06-14
EP2482824B1 (en) 2016-11-30
US20160287694A1 (en) 2016-10-06
CA2776386A1 (en) 2011-04-07
EP2482825A1 (en) 2012-08-08
JP2013506672A (ja) 2013-02-28
CN102647988A (zh) 2012-08-22
EP2482825A4 (en) 2013-06-26
US20130058968A1 (en) 2013-03-07
EP2482824A4 (en) 2013-06-19
CL2013002933A1 (es) 2014-06-27
DK179132B1 (en) 2017-11-27
US20130072542A1 (en) 2013-03-21
US9395356B2 (en) 2016-07-19
EP2482825B1 (en) 2016-11-23
EP2482824A1 (en) 2012-08-08
CL2016000240A1 (es) 2016-07-29
DK201170227A (en) 2011-05-11
CL2013002907A1 (es) 2014-03-21
WO2011041789A1 (en) 2011-04-07
CA2776386C (en) 2018-02-27

Similar Documents

Publication Publication Date Title
EP2482825B1 (en) Piscine reovirus diagnostic compositions
Savini et al. Novel putative Bluetongue virus in healthy goats from Sardinia, Italy
Maldonado et al. Evidence of the concurrent circulation of H1N2, H1N1 and H3N2 influenza A viruses in densely populated pig areas in Spain
Boujon et al. Novel encephalomyelitis-associated astrovirus in a muskox (Ovibos moschatus): a surprise from the archives
Wang et al. Laminin receptor is an interacting partner for viral outer capsid protein VP5 in grass carp reovirus infection
WO2018224516A1 (en) Detection and treatment of pmcv infection in cleaner fish
KR20190123934A (ko) 신규한 중증열성혈소판감소증후군 바이러스
Axén et al. Emergence of a new rhabdovirus associated with mass mortalities in eelpout (Zoarces viviparous) in the Baltic Sea
NO20161983A1 (en) New reovirus infecting rainbow trout
CN117866084A (zh) 一种抗新型冠状病毒的全人源单克隆抗体及其用途
Jyothi et al. Epidemiology, molecular prevalence and prevention on canine parvovirus in India: A review
Lin et al. Surveillance and genetic diversity of bovine viral diarrhea virus in dairy herds across Taiwan
Chakraborty et al. Detection of classical swine fever virus E2 gene in cattle serum samples from cattle herds of Meghalaya
Zhang et al. Identification of the structural proteins of VP1 and VP2 of a novel mud crab dicistrovirus
Moncayo et al. West Nile virus and epizootic hemorrhagic disease virus co-infection in a novel host at the Nashville Zoo
Alkan et al. The detection and genetic characterization based on the S1 gene region of BCoVs from respiratory and enteric infections in Turkey
JP5269572B2 (ja) イリドウイルスの抗原性ペプチド及びその使用
RU2798051C2 (ru) Новый totivirus рыб
US20120087932A1 (en) Diagnostic test for virus
Sharma et al. Production and characterization of biologicals for disease diagnosis and pathological evaluation of elephant endotheliotropic herpesvirus (EEHV)
Ha et al. Synthetic peptide-derived antibody-based immunohistochemistry for the detection of porcine circovirus 2 in pigs with postweaning multisystemic wasting syndrome
Kökkaya et al. Development of an In‐House Antigen ELISA Using Monoclonal and Polyclonal Antibodies Against an Isolated Canine Distemper Virus
Ma et al. Coinfection of SFTSV Genotype A with Rickettsia among Farmers in Northeast
US20150093403A1 (en) Canine circovirus sequences and uses thereof
CN116376848A (zh) 一种卤虫病毒及其检测方法和应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10821408

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2776534

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2010821408

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010821408

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13499867

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013002907

Country of ref document: CL