WO2010132659A2 - Anti-human cd52 immunoglobulins - Google Patents
Anti-human cd52 immunoglobulins Download PDFInfo
- Publication number
- WO2010132659A2 WO2010132659A2 PCT/US2010/034704 US2010034704W WO2010132659A2 WO 2010132659 A2 WO2010132659 A2 WO 2010132659A2 US 2010034704 W US2010034704 W US 2010034704W WO 2010132659 A2 WO2010132659 A2 WO 2010132659A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- antibody
- nos
- light chain
- heavy chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2893—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD52
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/734—Complement-dependent cytotoxicity [CDC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
Definitions
- CD52 is a glycosylated, glycosylphosphatidylinositol (GPI)-anchored cell surface protein found in abundance (500,000 molecules/cell) on a variety of normal and malignant lymphoid cells (e g , T and B cells) See, e g , Hale et al , J Biol regul Homeost Agents 15 386- 391 (2001), Huh et al , Blood92 Abstract 4199 (1998), Eisner et al , BloodM 4684-4693 (1996), Gilleece et al , Blood 82 807-812 (1993), Rodig et al , Clin Cancer Res 12 7174-7179 (2006), Ginaldi et al , LeukRes 22 185-191 (1998) CD52 is expressed at lower levels on myeloid cells such as monocytes, macrophages, and dendritic cells, with little expression found on mature natural killer (NK) cells, neutrophils, and hematological stem cells Id CD52 is expressed
- the invention relates to humanized immunoglobulins that have binding specificity for human CD52 (huCD52) They may comprise the complementarity determining regions (CDRs) of mouse anti-human CD52 antibodies
- the humanized immunoglobulins of the invention have amino acid sequences that are different from other humanized immunoglobulins, and m particular from other humanized immunoglobulins that comprise CDRs of murine anti-human CD52 antibodies
- the humanized immunoglobulins of the invention are different from the humanized immunoglobulin Campath® In some embodiments, they provide advantages over humanized antibodies that comprise the CDRs of Campath®
- the humanized immunoglobulins described herein can comprise a humanized heavy chain and a humanized light chain
- the humanized immunoglobulin comprises a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of
- the framework region of the humanized immunoglobulin has at least 50% homology to the framework region of the immunoglobulin from which the light chain CDRs and the heavy chain CDRs are obtained
- the framework region of the humanized immunoglobulin can be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least
- the invention also relates to a humanized light chain of a humanized immunoglobulin of the invention
- the humanized light chain comprises one or more CDRs selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48 or a combination thereof, wherein the humanized light chain is not the humanized light chain of Campath® [0011]
- the humanized light chain comprises one or more CDRs (e g , all three CDRs
- the humanized heavy chain comprises one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:
- the invention provides a humanized immunoglobulin, which binds to human CD52, and which comprises a light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 121 (e g , all three of said CDRs), or a heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO: 130 (e g , all three of said CDRs), or both such light chain and such heavy chain
- the invention provides a humanized immunoglobulin, which binds to human CD52, and which comprises a light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ ID NO: 119, and SEQ ID NO: 122 (e g , all three of said CDRs), or a heavy chain comprising one or more CDRs
- humanized immunoglobulins of the present invention are different from the humanized immunoglobulin Campath®
- K/RSSQSLL/V/IXS/TN/DGXS/TYLX (SEQ ID NO: 115) K/RSSQSLL/V/IHS/TNGXS/TYLH (SEQ ID NO: 116) RSSQSLVHTNGNS/TYLH (SEQ ID NO: 117)
- GFXFXXYW/YMX (SEQ ID NO: 124) GFTFXXYW/YMX (SEQ ID NO: 125) GFTFTDYW/YMS (SEQ ID NO: 126) Heavy Chain CDR-2 Sequences
- TRYXY/F/WFDY (SEQ ID NO: 131) TRYIF/WFDY (SEQ ID NO: 132)
- the invention also relates to a humanized light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 121 (e g , all three of said CDRs); a humanized light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ ID NO: 119, and SEQ ID NO: 122 (e g , all three of said CDRs); or a humanized light chain comprising one or more CDRs selected from the group consisting ofSEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO: 123 (e g, all three of said CDRs) [0022] The invention also relates to a humanized heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO: 130 (e g, all three of said CDRs); a
- the humanized immunoglobulins of the invention (irrespective of the manner in which they might otherwise be defined, e g , regardless of whether they might also be defined m terms of the sequence of one or more of their CDRs and/or by their cross-reactivity with a mouse monoclonal antibody or another humanized immunoglobulin) (1) exhibit binding to glycosylated and de-glycosylated CD52 with no apparent preference, (2) exhibit binding specific for glycosylated CD52, (3) exhibit binding specific for de-glycosylated CD52, or (4) exhibit binding preferential for de-glycosylated over glycosylated CD52 In certain embodiments, the humanized immunoglobulins of the invention have a greater binding affinity for glycosylated human CD52 than for non-glycosylated or de- glycosylated human CD52 Indeed, in certain embodiments of the present invention, the humanized immunoglobulins of the present invention exhibit binding that is specific for glycosylated human CD
- the invention is an (one or more) isolated nucleic acid molecule encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized light chain comprises one or more CDRs (e g, all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 4 and a heavy chain comprising one or more CDRs ⁇ e g, all three CDRs) of SEQ ID NO: 17; a light chain comprising one or more CDRs ⁇ e g, all three CDRs)
- the invention is one or more isolated nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin binds to an epitope comprising at least residue 1 of mature human CD52; the humanized immunoglobulin binds to an epitope comprising at least residues 1, 3, 4 and 5 of mature human CD52; the humanized immunoglobulin binds to an epitope comprising at least residues 1, 2, 3, 4 and 5 of mature human CD52; or the humanized immunoglobulin binds to an epitope comprising at least residues 7, 8 and 9 of mature human CD52 In some embodiments, the epitope comprises at least residues 7, 8 and 11 of the mature human CD52 sequence In some embodiments, the epitope comprises at least residues 4 and 11 of the mature human CD52 sequence [0028] In other embodiments, the invention is one or more isolated nucleic acid molecules encoding a humanized heavy
- SEQ ID NO: 116, SEQ ID NO: 119, and SEQ ID NO: 122 (eg , all three of said CDRs), and/or a heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO: 131 (e g , all three of said CDRs); or a light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO: 123 (e g , all three of said CDRs), and/or a heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO: 132 (e g, all three of said CDRs)
- the invention is one or more isolated nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin comprises a light chain comprising the CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID NO: 121 and a heavy chain comprising the CDRs of SEQ ID NO: 124, SEQ ID NO: 127 and SEQ ID NO: 130; a light chain comprising the CDRs of SEQ ID NO: 116, SEQ ID NO: 119 and SEQ ID NO: 122 and a heavy chain comprising the CDRs of SEQ ID NO: 125, SEQ ID NO: 128 and SEQ ID NO: 131; or a light chain comprising the CDRs of SEQ ID NO: 117, SEQ ID NO: 120 and SEQ ID NO: 123 and a heavy chain comprising the CDRs of
- the invention is an isolated nucleic acid molecule encoding a humanized heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 137, wherein the humanized heavy chain is not the humanized heavy chain of Campath® [0034]
- the invention is an isolated nucleic acid molecule encoding a humanized light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO:
- the invention is an isolated nucleic acid molecule encoding a humanized heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 294, or a combination thereof, wherein
- the recombinant vector comprises a nucleic acid encoding a humanized heavy chain, wherein the humanized heavy chain comprises one or more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO:
- the invention provides a recombinant vector comprising a nucleic acid molecule, or a pair of recombinant vectors comprising nucleic acid molecules, encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin binds to the same epitope on human CD52 as a mouse monoclonal antibody comprising a light chain variable region of SEQ ID NO: 3 and a heavy chain variable region of SEQ ID NO: 16; a light chain variable region of SEQ ID NO: 4 and a heavy chain variable region of SEQ ID NO: 17; a light chain variable region of SEQ ID NO: 5 and a heavy chain variable region of SEQ ID NO: 18; a light chain variable region of SEQ ID NO: 6 and a heavy chain variable region of SEQ ID NO: 19; a light chain variable region of SEQ ID NO: 7 and a heavy chain variable region
- the recombinant vector comprises a nucleic acid molecule, or a pair of recombinant vectors comprise nucleic acid molecules, encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin binds to an epitope comprising at least residue 1 of mature human CD52; binds to an epitope comprising at least residues 1, 3, 4 and 5 of mature human CD52; binds to an epitope comprising at least residues 1, 2, 3, 4 and 5 of mature human CD52; or binds to an epitope comprising at least residues 7, 8 and 9 of mature human CD52
- the epitope comprises at least residues 7, 8 and 11 of the mature human CD52 sequence
- the epitope comprises at least residues 4 and 11 of the mature human CD52 sequence
- the recombinant vector comprises
- the recombinant vector comprises a nucleic acid molecule, or a pair of recombinant vectors comprise nucleic acid molecules, encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin comprises a light chain comprising the CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID NO: 121 and a heavy chain comprising the CDRs of SEQ ID NO: 124, SEQ ID NO: 127 and SEQ ID NO: 130; a light chain comprising the CDRs of SEQ ID NO: 116, SEQ ID NO: 119 and SEQ ID NO: 122 and a heavy chain comprising the CDRs of SEQ ID
- the one or more nucleic acids m the recombinant vector or vectors of the present invention do not encode the humanized immunoglobulin Campath®
- the recombinant vector comprises a nucleic acid molecule, or a pair of recombinant vectors comprise nucleic acid molecules, encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin has a greater binding affinity for glycosylated human CD52 than for non- glycosylated or de-glycosylated human CD52, e g , exhibits binding that is specific for glycosylated human CD52
- the humanized immunoglobulin may bind to an epitope on mature human CD52 which comprises its TV-linked carbohydrate moiety This epitope may also comprise at least residue 1 of the mature human CD52 sequence, at least residue 3 of the mature human CD52 sequence, at least residues 1, 3, 4 and 5 of the mature human CD52 sequence, or at least residues 1, 2, 3, 4 and 5 of the mature human CD52 sequence [0047] In other embodiments
- the recombmant vector comprises a nucleic acid molecule encoding a humanized heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 137, wherein the humanized heavy chain is not the humanized heavy chain of Campath®
- the recombmant vector comprises a nucleic acid molecule encodmg a humanized light chain comp ⁇ smg one or more CDRs selected from the group consisting ofSEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 121 (e g, all three of said CDRs); a humanized light cham comprising one or more CDRs selected from the group consisting ofSEQ ID NO: 116, SEQ ID NO: 119, and SEQ ID NO: 122 (e g, all three of said CDRs); or a humanized light cham comprising one or more CDRs selected from the group consisting of SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO: 123 (e g, all three of said CDRs), wherein the humanized light chain is not the humanized light cham of Campath® [0050]
- the recombmant vector comprises a nucleic acid molecule encodmg a humanized light chain
- the mvention also relates to a host cell that comprises a (one or more) nucleic acid
- the host cell comprises a recombinant vector (e g , expression vector, including mammalian cell expression vectors) of the invention
- the host cell comprises a nucleic acid (one or more nucleic acids) encoding a humanized light chain and a humanized heavy chain, wherein the humanized light chain and the humanized heavy chain associate together to form a humanized immunoglobulin that has binding specificity for human CD52 and wherein the humanized immunoglobulin comprises a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 4 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 17; a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 5 and a heavy chain
- the host cell comprises one or more nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin binds to an epitope comprising at least residue 1 of mature human CD52; binds to an epitope comprising at least residues 1, 3, 4 and 5 of mature human CD52; binds to an epitope comprising at least residues 1, 2, 3, 4 and 5 of mature human CD52; or binds to an epitope comprising at least residues 7, 8 and 9 of mature human CD52
- the epitope comprises at least residues 7, 8 and 11 of the mature human CD52 sequence
- the epitope comprises at least residues 4 and 11 of the mature human CD52 sequence
- the host cell comprises one or more nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form
- the host cell comprises one or more nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin comprises a light chain comprising the CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID NO: 121 and a heavy chain comprising the CDRs of SEQ ID NO:
- the host cell comprises one or more nucleic acid molecules encoding a humanized heavy chain and a humanized light chain which associate together to form a humanized immunoglobulin that has binding specificity for human CD52, wherein the humanized immunoglobulin has a greater binding affinity for glycosylated human CD52 than for non-glycosylated or de-glycosylated human CD52, e g , exhibits binding that is specific for glycosylated human CD52
- the humanized immunoglobulin may bind to an epitope on mature human CD52 which comprises its TV-linked carbohydrate moiety This epitope may also comprise at least residue 1 of the mature human CD52 sequence, at least residue 3 of the mature human CD52 sequence, at least residues 1, 3, 4 and 5 of the mature human CD52 sequence, or at least residues 1, 2, 3, 4 and 5 of the mature human CD52 sequence
- the host cell comprises a nucleic acid molecule encoding a humanized light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13
- the humanized light chain is not the humanized light chain of Campath®
- the host cell comprises a nucleic acid molecule encoding a humanized heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID
- the host cell comprises a nucleic acid encoding a humanized heavy chain, wherein the humanized heavy chain comprises one or more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73,SEQ ID NO: 74, and SEQ ID NO: 294, or
- the invention also relates to a method of preparing a humanized immunoglobulin that has binding specificity for human CD52 comprising maintaining a host cell of the invention (e g , a host cell that contains one or more recombinant nucleic acids that encode a humanized immunoglobulin of the invention (e g , a humanized light chain and a humanized heavy chain of the invention)) under conditions appropriate for expression of a humanized immunoglobulin, whereby humanized immunoglobulin chains are expressed and a humanized immunoglobulin is produced
- the method further comprises purifying or isolating the humanized immunoglobulin
- the method further comprises combining the purified or isolated humanized immunoglobulin with a physiologically acceptable vehicle or carrier to produce a pharmaceutical composition
- the invention also relates to a method of preparing a humanized light chain that has binding specificity for human CD52 comprising maintaining a host cell of the invention (e g , a host cell that contains one
- the invention further relates to a pharmaceutical composition
- a pharmaceutical composition comprising a humanized immunoglobulin of the invention (e g , comprising a humanized light chain of the invention and/or a humanized heavy chain of the invention) and a physiologically acceptable vehicle or carrier
- the pharmaceutical composition comprises a unit dose composition
- the invention also relates to a method of producing a hyb ⁇ doma that secretes a monoclonal antibody that has binding specificity for human CD52 comprising administering lymphocytes of a mouse transgenic for human CD52 to a non-transgemc mouse of the same, or of a similar, strain (e g , CDl) as the human CD52 transgenic mouse, thereby producing an immunized, non-transgemc mouse Splenocytes of the immunized, non-transgemc mouse are fused with immortalized cells, thereby producing a hyb ⁇ doma
- the hyb ⁇ doma is maintained under conditions in which it will secrete a monoclonal antibody having binding specificity for human CD52
- FACS analysis is used to detect a hyb ⁇ doma that secretes a monoclonal antibody that has binding specificity for human CD52
- the strain of the transgenic mouse and the strain of the non-transgemc mouse are identical
- an effective amount of a humanized immunoglobulin of the invention can be administered m conjunction with one or more immunosuppressive agents to prepare a patient m need thereof for a solid organ transplant (Agarwal et al , Transplant Immunol , 20 6-11 (2008)) or a CD34+ stem cell transplant (Burt et al , The Lancet, published online January 30, 2009)
- the invention also relates to a method for treating cancer m a patient m need thereof, comprising administering to the patient an effective amount of a humanized immunoglobulin of the invention [0071]
- the invention also relates to a method for treating multiple sclerosis m a patient in need thereof, comprising administering to the patient an effective amount of a humanized immunoglobulin of the invention [0072]
- the invention also relates to a method for treating chronic lymphocytic leukemia m a patient m need thereof, comprising administering to the patient an effective amount of a humanized immunoglobulin of the invention
- the administration of a humanized immunoglobulin of the present invention may comprise the administration of the humanized immunoglobulin per se (e g , in a pharmaceutical composition), the administration of one or more recombinant vectors encoding the humanized immunoglobulin, or the administration of a host cell which comprises one or more nucleic acids (e g , one or more recombinant vectors) encoding the humanized immunoglobulins and expresses the humanized immunoglobulin [0074]
- the invention also relates to a method of diagnosing a disease selected from the group consisting of autoimmune diseases (e g , multiple sclerosis, lupus, vasculitis), cancer (e g , leukemias (e g , chronic lymphocytic leukemia), and lymphomas (e g , non-Hodgkin's lymphoma)), transplant (e g , solid organ transplant (e g , kidney transplant) and stem cell transplant), 'compris
- the invention also relates to a humanized immunoglobulin of the invention (e g , comprising a humanized light chain of the invention and/or humanized heavy chain of the invention), a recombinant vector of the invention, or a host cell of the invention, for use in medicine, such as for use m therapy and/or diagnosis of a disease such as for use in treating a disease or disorder described herein such as an autoimmune disease (e g , multiple sclerosis, rheumatoid arthritis, and lupus), cancer, a lymphocyte hyper-proliferative condition (e g , T or B cell malignancies including leukemia such as B-cell chronic lymphocytic leukemia and lymphomas such as non-Hodgkin's lymphoma) See, e g , Lundin, J , et al , Blood, 101 4267- 4272 (2003), Rodig, SJ , et al , Clinical Cancer Research, 12(23) 7174
- a humanized anti-human CD52 antibody of the invention increases the circulating level of one or more of TNFalpha, IL-6 and MCP-I in the serum of a subject
- a humanized anti-human CD52 antibody of the invention reduces lymphocyte levels m a subject for at least 30 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days or for more than 80 days [0082] In some embodiments, a humanized anti-human CD52 antibody of the invention delays the onset of disease and/or decreases the severity of disease as measured by clinical score in a mouse EAE model [0083] In some embodiments, a humanized anti-human CD52 antibody of the invention is less immunogenic than Campath-1H® in an immunogemcity assay such as the assay described in Example 69 or 70
- the invention also relates to mouse monoclonal antibodies (mouse monoclonal immunoglobulins) that have binding specificity for human CD52
- a mouse monoclonal antibody that has binding specificity for human CD52, comprising a light chain comprising SEQ ID NO: 3 and a heavy chain comprising SEQ ID NO: 16; a light chain comprising SEQ ID NO: 4 and a heavy chain comprising SEQ ID NO: 17; a light chain comprising SEQ ID NO: 5 and a heavy chain comprising SEQ ID NO: 18; a light chain comprising SEQ ID NO: 6 and a heavy chain comprising SEQ ID NO: 19; a light chain comprising SEQ ID NO: 7 and a heavy chain comprising SEQ ID NO: 20; a light chain comprising SEQ ID NO: 8 and a heavy chain comprising SEQ ID NO: 21; a light chain comprising SEQ ID NO: 9 and a heavy chain comprising SEQ ID NO:
- the invention also relates to a mouse immunoglobulin light chain comprising the variable region of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13
- the invention also relates to a mouse immunoglobulin heavy chain comprising the variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26
- the mouse monoclonal antibodies of the present invention comprise both a mouse antibody light chain of the invention and a mouse antibody heavy chain of the invention
- the invention provides a mouse monoclonal immunoglobulin which binds to the same epitope on human CD52 as a mouse monoclonal antibody comprising a light chain variable region of SEQ ID NO: 3 and a heavy chain variable region of SEQ ID NO: 16; a light chain variable region of SEQ ID NO: 4 and a heavy chain variable region of SEQ ID NO: 17; a light chain variable region of SEQ ID NO: 5 and a heavy chain variable region of SEQ ID NO: 18; a light chain variable region of SEQ ID NO: 6 and a heavy chain variable region of SEQ ID NO: 19; a light chain variable region of SEQ ID NO: 7 and a heavy chain variable region of SEQ ID NO: 20; a light chain variable region of SEQ ID NO: 8 and a heavy chain variable region of SEQ ID NO: 21; a light chain variable region of SEQ ID NO: 3
- the invention provides a mouse monoclonal immunoglobulin which binds to an epitope on human CD52 comprising at least residue 1 of the mature human CD52 sequence
- the mouse monoclonal immunoglobulin may bind to an epitope comprising at least residues 1, 3, 4 and 5 of the mature human CD52 sequence, may bind to an epitope comprising at least residues 1, 2, 3, 4 and 5 of the mature human CD52 sequence, or may bind to an epitope comprising at least residues 7, 8 and 9 of the mature human CD52 sequence
- the epitope comprises at least residues 7, 8 and 11 of the mature human CD52 sequence
- the epitope comprises at least residues 4 and 11 of the mature human CD52 sequence
- the invention also relates to isolated nucleic acid molecules that encode the mouse monoclonal immunoglobulins, mouse immunoglobulin light chains or mouse immunoglobulin heavy chains of the invention
- the invention is an isolated nucleic acid molecule encoding a mouse immunoglobulin heavy chain and a mouse immunoglobulin light chain which associate together to form a mouse monoclonal immunoglobulin that has binding specificity for human CD52, wherein the mouse immunoglobulin light chain comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, or the mouse immunoglobulin heavy chain comprises a variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:
- the isolated nucleic acid encodes a mouse immunoglobulin light chain which comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13
- the isolated nucleic acid encodes a mouse immunoglobulin heavy chain which comprises a variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26
- the invention also relates to recombinant vectors (e g , expression vectors, including mammalian cell expression vectors) that comprise a nucleic acid encoding the mouse monoclonal immunoglobulin (e g , a mouse immunoglobulin light chain and a mouse immunoglobulin heavy chain), the mouse immunoglobulin light chain, or the mouse immunoglobulin heavy chain of the invention
- the invention is a recombinant vector comprising a nucleic acid, or a pair of recombinant vectors comprising nucleic acids
- the recombinant vector comprises a nucleic acid encoding a mouse immunoglobulin light chain, wherein the mouse immunoglobulin light chain comprises SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13 [0095]
- the recombinant vector comprises a nucleic acid encoding a mouse immunoglobulin heavy chain, wherein the mouse immunoglobulin heavy chain comprises SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26
- the recombinant vector comprises a nucleic acid encoding a mouse immunoglobulin light chain and a mouse immunoglobulin heavy chain, wherein the mouse immunoglobulin light chain and mouse immunoglobulin heavy chain associate together to form a mouse monoclonal immunoglobulin that has binding specificity for human CD52
- the mouse immunoglobulin light chain comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, and the mouse immunoglobulin heavy chain comprises a variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO:
- the recombinant vector of the invention is an expression vector, such as a mammalian cell expression vector
- the vector is a plasmid or a viral vector ⁇ eg , an adenoviral or AAV vector)
- the invention also relates to a host cell that comprises one or more nucleic acids encoding the mouse monoclonal immunoglobulin (mouse immunoglobulin light chain and mouse immunoglobulin heavy chain), the mouse immunoglobulin light chain or the mouse immunoglobulin heavy chain of the invention
- the host cell comprises a recombinant vector (e g , expression vector, mammalian cell expression vector) of the invention
- the host cell comprises nucleic acid encoding a mouse immunoglobulin light chain and a mouse immunoglobulin heavy chain, wherein the mouse immunoglobulin light chain and the mouse immunoglobulin heavy chain associate together to form a mouse monoclonal immunoglobulin that has binding specificity for human CD52 and wherein the mouse immunoglobulin light chain comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO
- the host cell comprises nucleic acid encoding a mouse immunoglobulin light chain, wherein the mouse immunoglobulin light chain comprises a light chain variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13
- the host cell comprises a nucleic acid encoding a mouse immunoglobulin heavy chain, wherein the mouse immunoglobulin heavy chain comprises a heavy chain variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 [0102]
- the invention also relates to a method of preparing a mouse monoclonal immunoglobulin comprising maintaining a host cell of the invention (e g , a host cell that contains one or more recombinant nucleic acids (e g , recombinant vectors) that encode a mouse monoclonal immunoglobulin (e g , a mouse immunoglobulin light chain and a mouse immunoglobulin heavy chain) of the invention) under conditions appropriate for expression of a mouse monoclonal immuno
- the invention also relates to a method of preparing a heavy chain of a mouse monoclonal immunoglobulin, comprising maintaining a host cell of the invention containing a nucleic acid encoding a mouse immunoglobulin heavy chain of the invention under conditions appropriate for expression of said mouse immunoglobulin heavy chain, whereby a mouse immunoglobulin heavy chain is expressed In some embodiments, the method further comprises purifying or isolating the mouse immunoglobulin heavy chain [0105]
- the invention also relates to a method of diagnosing a disease (e g , autoimmune diseases (e g , multiple sclerosis, lupus, vasculitis), cancer (e g , leukemias (e g , chronic lymphocytic leukemia), and lymphomas (e g , non-Hodgkm's lymphoma)), and transplant (e g , solid organ transplant (e g , kidney transplant) and stem cell transplant)') comprising assaying a patient sample in
- the invention also relates to chimeric immunoglobulins that have binding specificity for human CD52
- Such chimeric immunoglobulins may include the variable regions of any of the mouse monoclonal immunoglobulin of the present invention
- the chimeric immunoglobulin of the invention comprises the light chain variable region of SEQ ID NO: 3 and the heavy chain variable region of SEQ ID NO: 16; the light chain variable region of SEQ ID NO: 4 and the heavy chain variable region of SEQ ID NO: 17; the light chain variable region of SEQ ID NO: 5 and the heavy chain variable region of SEQ ID NO: 18; the light chain variable region of SEQ ID NO: 6 and the heavy chain variable region of SEQ ID NO: 19; the light chain variable region of SEQ ID NO: 7 and the heavy chain variable region of SEQ ID NO: 20; the light chain variable region of SEQ ID NO: 8 and the heavy chain variable region of SEQ ID NO: 21; the light chain variable region of SEQ ID NO: 9 and the heavy chain variable region of SEQ ID NO: 22
- the invention also relates to a chimeric heavy chain comprising a variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26
- the chimeric immunoglobulins of the present invention comprise both a chimeric light chain of the invention and a chimeric heavy chain of the invention
- the invention provides a chimeric immunoglobulin which binds to the same epitope on human CD52 as a mouse monoclonal antibody comprising a light chain variable region of SEQ ID NO: 3 and a heavy chain variable region of SEQ ID NO: 16; a light chain variable region of SEQ ID NO: 4 and a heavy chain variable region of SEQ ID NO: 17; a light chain variable region of SEQ ID NO: 5 and a heavy chain variable region of SEQ ID NO: 18; a light chain variable region of SEQ ID NO: 6 and a heavy chain variable region of SEQ ID NO: 19; a light chain variable region of SEQ ID NO: 7 and a heavy chain variable region of SEQ ID NO: 20; a light chain variable region of SEQ ID NO: 8 and a heavy chain variable region of SEQ ID NO
- the invention provides a chimeric immunoglobulin which binds to an epitope on human CD52 comprising at least residue 1 of the mature human CD52 sequence
- the chimeric immunoglobulin may bind to an epitope comprising at least residues 1, 3, 4 and 5 of the mature human CD52 sequence, may bind to an epitope comprising at least residues 1, 2, 3, 4 and 5 of the mature human CD52 sequence, or may bind to an epitope on human CD52 comprising at least residues 7, 8 and 9 of the mature human CD52 sequence
- the epitope comprises at least residues 7, 8 and 11 of the mature human CD52 sequence
- the epitope comprises at least residues 4 and 11 of the mature human CD52 sequence
- the invention also relates to isolated nucleic acid molecules that encode the chimeric immunoglobulins, chimeric light chains or chimeric heavy chains of the invention
- the invention is an isolated nucleic acid molecule (one or more nucleic acid molecules) encoding a chimeric heavy chain and a chimeric light chain which associate together to form a chimeric immunoglobulin that has binding specificity for human CD52, wherein the chimeric light chain comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13; and/or the chimeric heavy chain comprises a variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21,
- the invention is a recombinant vector comprising a nucleic acid (or a pair of recombinant vectors comprising nucleic acids) encoding a chimeric immunoglobulin that comprises a light chain variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
- SEQ ID NO: 8 SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13; or a heavy chain variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26; or both such light chain and heavy chain
- the recombinant vector comprises a nucleic acid encoding a chimeric light chain, wherein the chimeric light chain comprises the variable region of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13 [0118]
- the recombinant vector comprises a nucleic acid encoding a chimeric heavy chain, wherein the chimeric heavy chain comprises the variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26 [0119]
- the recombinant vector of the invention is an expression vector, such as
- the host cell comprises a recombinant nucleic acid (or a pair of recombinant nucleic acids) encoding a chimeric light chain and a chimeric heavy chain, wherein the chimeric light chain and the chimeric heavy chain associate together to form a chimeric immunoglobulin that has binding specificity for human CD52 and wherein the chimeric light chain comprises a variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13; and/or the chimeric heavy chain comprises a variable region selected from the group consisting of the variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID
- the host cell comprises a recombinant nucleic acid encoding a chimeric light chain, wherein the chimeric light chain comprises a light chain variable region selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13
- the host cell comprises a recombinant nucleic acid encoding a chimeric heavy chain, wherein the chimeric heavy chain comprises a heavy chain variable region selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26
- the invention also relates to a method of preparing a chimeric immunoglobulin comprising maintaining a host cell of the invention (e g , a host cell that contains one or more isolated nucleic acids that encode a chimeric immunoglobulin (e g , a chimeric light chain and a chimeric heavy chain) of the invention) under conditions appropriate for expression of a chimeric immunoglobulin, whereby chimeric immunoglobulin chains are expressed and a chimeric immunoglobulin is produced
- the method further comprises purifying or isolating the chimeric immunoglobulin
- the invention also relates to a method of preparing a chimeric light chain comprising maintaining a host cell of the invention (e g , a host cell that contains a nucleic acid encoding a chimeric light chain of the invention) under conditions appropriate for expression of said chimeric light chain, whereby a chimeric light chain is expressed and a chimeric light chain is produced
- the invention also relates to a method of preparing a chimeric heavy chain comprising maintaining a host cell of the invention (e g , a host cell that contains a nucleic acid encoding a chimeric heavy chain of the invention) under conditions appropriate for expression of said chimeric heavy chain, whereby a chimeric heavy chain is expressed and a chimeric heavy chain is produced
- a host cell of the invention e g , a host cell that contains a nucleic acid encoding a chimeric heavy chain of the invention
- the method further comprises purifying or isolating the chimeric heavy chain
- the invention also relates to a method of diagnosing a disease selected from the group consisting of autoimmune diseases (e g , multiple sclerosis, lupus, vasculitis), cancer (e g , leukemias (e g , chronic lymphocytic leukemia), and lymphomas (e g , non-Hodgkin's lymphoma)), and transplant (e g , solid organ transplant (e g , kidney transplant) and stem cell transplant', comprising assaying a patient sample in vitro, with the chimeric immunoglobulin of the invention
- autoimmune diseases e g , multiple sclerosis, lupus, vasculitis
- cancer e g , leukemias (e g , chronic lymphocytic leukemia), and lymphomas (e g , non-Hodgkin's lymphoma)
- transplant e g , solid organ transplant (e g , kidney transplant) and stem cell transplant', comprising
- the invention relates to an antibody that binds to the same epitope on human CD52 as the above monoclonal antibody or antigen-bmdmg portion In some embodiments, the invention relates to an antibody that competes with the above monoclonal antibody or antigen-bindmg portion In some embodiments, the invention relates to an antibody that cross-competes with the above monoclonal antibody or antigen-bmdmg portion
- the invention relates to a monoclonal humanized anti-human CD52 antibody or an antigen-binding portion thereof, wherein the heavy chain and the light chain of said antibody comprise the amino acid sequences of SEQ ID NOs: 272 and 273, respectively, without the signal sequences
- the invention relates to a monoclonal anti-human CD52 antibody or an antigen-binding portion thereof, wherein the heavy chain and the light chain of said antibody comprise the amino acid sequences of SEQ ID NOs: 274 and 275, respectively, without the signal sequences
- the invention relates to a monoclonal anti-human CD52 antibody or an antigen-binding portion thereof, wherein the heavy chain and the light chain of said antibody comprise the amino acid sequences of SEQ ID NOs: 276 and 278, respectively, without the signal sequences
- the invention relates to a monoclonal anti-human CD52 antibody or an antigen- bmdmg portion thereof, wherein the heavy chain
- the invention relates to a monoclonal anti-human CD52 antibody or an antigen-binding portion thereof, wherein the heavy chain of said antibody comprises an ammo acid sequence selected from the group consisting of SEQ ID NOs: 103, 136, 137, 139-144, 149-152, and 158-163
- the invention relates to a monoclonal anti-human CD52 antibody or an antigen-binding portion thereof, wherein the heavy chain of said antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 272, 274, 276, 277, 279, and 281, without the signal sequences
- the invention relates to an antibody heavy chain or a portion thereof, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 103, 136, 137, 139-144, 149-152, 158-163, 272, 274, 276, 277, 279, and 281, without the signal sequences if present
- any of the above antibodies may be an IgG, IgM, IgA, IgD or IgE molecule
- said IgG is IgGl, IgG2, IgG3, or IgG4
- any of the above antigen-bmding portions may be a single chain antibody, Fv, Fab, Fab', F(ab')2, Fd, single chain Fv molecule (scFv), bispecif ⁇ c single chain Fv dimer, diabody, domain-deleted antibody or single domain antibody (dAb)
- the invention also relates to any of the above antibodies or antigen-bmding portions, wherein said antibody or antigen-binding portion depletes T or B lymphocytes, or both; preferentially depletes T lymphocytes as compard to B lymphocytes; increases circulating serum levels of TNF-alpha, IL-6, or MCP-I (e g , by at least
- the invention further relates to an isolated nucleic acid encoding the heavy chain or an antigen-bmdmg portion thereof, or the light chain or an antigen-bindmg portion thereof, of any of the above antibodies
- said isolated nucleic acid comprises a heavy chain nucleotide sequence selected from the group consisting of SEQ ID NOs: 283, 285, 287,
- nucleotide sequence without the sequence encoding a signal peptide; a light chain nucleotide sequence selected from the group consisting of SEQ ID NOs: 284, 286,
- said isolated nucleic acid comprises a heavy chain nucleotide sequence and a light chain nucleotide sequence selected from the group consisting of SEQ ID NO: 283 and SEQ ID NO: 284, respectively, both without sequences encoding signal peptides; SEQ ID NO: 285 and SEQ ID NO: 286, respectively, both without sequences encoding signal peptides; SEQ ID NO: 287 and SEQ ID NO: 289, respectively, both without sequences encoding signal peptides; SEQ ID NO: 288 and SEQ ID NO: 289, respectively, both without sequences encoding signal peptides; SEQ ID NO: 290 and SEQ ID NO: 291, respectively, both without sequences encoding signal peptides; and SEQ ID NO: 292 and SEQ ID NO:
- the invention also relates to the use of an isolated nucleic acid comprising a heavy chain nucleotide sequence and an isolated nucleic acid comprising a light chain nucleotide sequence for the manufacture of a medicament for treating a patient m need thereof, wherein said heavy chain nucleotide sequence and light chain nucleotide sequence are selected from the group consisting of SEQ ID NO: 283 and SEQ ID NO: 284, respectively, both without sequences encoding signal peptides; SEQ ID NO: 285 and SEQ ID NO: 286, respectively, both without sequences encoding signal peptides; SEQ ID NO: 287 and SEQ ID NO: 289, respectively, both without sequences encoding signal peptides; SEQ ID NO: 288 and SEQ ID NO: 289, respectively, both without sequences encoding signal peptides; SEQ ID NO: 290 and SEQ ID NO: 291, both respectively, without sequences encoding signal peptides; and SEQ ID NO:
- the invention also relates to a recombinant vector comprising (1) a nucleic acid sequence encoding the heavy chain or an antigen-binding portion thereof, (2) a nucleic acid sequence encoding the light chain or an antigen-bmding portion thereof, or (3) both, of any of the above antibodies
- the invention further relates to a host cell comprising a first nucleic acid sequence encoding the heavy chain or an antigen-binding portion thereof of any of the above antibodies, said first nucleic acid sequence operably linked to an expression control element, and a second nucleic acid sequence encoding the light chain or an antigen-binding portion thereof of said antibody, said second nucleic acid sequence operably linked to an expression control element
- the invention relates to a method of making an anti-human CD52 antibody or an antigen-bmdmg portion thereof, comprising maintaining said host cell under conditions appropriate for expression of the antibody or portion, and
- the invention relates to a composition
- a composition comprising the monoclonal antibody or antigen- bmdmg portion according to any one of claims 1-24 and a pharmaceutically acceptable vehicle or carrier
- the invention relates to a method for treating a patient in need thereof, comprising administering to the patient an effective amount of any of the above antibodies or antigen-bmdmg portions, or the above composition In certain embodiments, said patient is receiving a transplantation [0145] In some embodiments, the invention relates to a method for treating an autoimmune disease m a patient in need thereof, comprising administering to the patient an effective amount of any of the above antibodies or antigen-binding portions, or the above composition In certain embodiments, the autoimmune disease is, e g , multiple sclerosis, rheumatoid arthritis, or systemic lupus erythematosus [0146] In some embodiments, the invention relates to a method for treating cancer m a patient m need thereof, comprising administering to the patient an effective amount of any of the above antibodies or antigen-bmding portions, or the above composition In certain embodiments, the cancer is, e g , a lympho
- any of the above methods of treatment further comprising administering to the patient a neutrophil or NK cell stimulatory agent
- said agent is G-CSF or GM-CSF
- any of the above methods of treatment further comprises administering to the patient a T regulatory cell stimulatory agent
- said agent is rapamycin
- the invention relates to a method for inhibiting angiogenesis in a patient m need thereof, comprising administering an effective amount of any of the above antibodies or antigen-bmdmg portions to the patient
- the patient has a solid tumor
- the patient has neovascularization
- said neovascularization is m the eye
- the invention also relates to the use of any of the above antibodies or antigen-binding portions for the manufacture of a medicament for treating an autoimmune disease in a patient in need thereof
- the invention relates to the use of any of the above antibodies or antigen- bmdmg portions for the manufacture of a medicament for treating cancer in a patient in need thereof
- the invention relates to the use of any of the above antibodies or antigen-binding portions for the manufacture of a medicament for treating a patient in need of a transplantation
- the invention relates to the use of any of the above antibodies or antigen-bindmg portions for the manufacture of a
- FIG 1A-1B is a schematic representation of the development of new anti-CD52 monoclonal antibodies The general scheme is depicted in FIG IA and the names of the mouse anti-human CD52 antibody clones as well as their isotypes in shown m FIG IB [0152]
- FIG 2 is an alignment of the amino acid sequences of several mouse anti-human CD52 kappa light chain sequences (SEQ ID NOS 1-13)
- Campath-1G is the rat monoclonal antibody from which the humanized Campath-1H antibody is derived
- FIG 3 is an alignment of the amino acid sequences of several mouse anti-human CD52 heavy chain sequences (SEQ ID NOS 14-26)
- FIG 4 is an alignment of wildtype CD52 and 10 mutant CD52 proteins (SEQ ID NOS 104-114, from top to bottom) [0155]
- FIG 5 A illustrates the FACS-based N-terminal binding profile of antibodies 4B10 and 7Fl 1 on cells expressing CD52 alanine scanning mutants [0156]
- FIG 5B illustrates the FACS-based middle region binding profile of antibodies CF1D12, 3G7, 9D9, 5F7, 4G7, and l lCl l on cells expressing CD52 alanine scanning mutants [0157]
- FIG 5C illustrates the FACS-based binding profile of antibodies Campath-1H® ("Campath IH"), 2C3, 12G6, and 23E6 on cells expressing CD52 alanine scanning mutants [0158]
- FIG 5D depicts immunoblots of CD52 +/- N-linked glycosylation probed with the panel of chimeric monoclonal antibodies "ClH” stands for Campath-1H® [
- FIGS 9A-9C are graphs illustrating the level of CD4 T cells (FIG 9A), CD8 T cells (FIG 9B) and CD19 B cells (FIG 9C) in the blood 72 hours after dosing with chimeric antibodies 7Fl 1, 8G3, 23E6, 12G6, 4B10, or 5F7, or Campath-1H® ("Cam”)
- FIGS 10A- 1OC are graphs illustrating the level of CD4 T cells (FIG 10A), CD8 T cells (FIG 10B) and CD19 B cells (FIG 10C) in the spleen 72 hours after dosing with chimeric antibodies 7Fl 1, 8G3, 23E6, 12G6, 4B10, or 5F7, or Campath-1H® ("Cam")
- FIGS 1 IA-11C are graphs showing the level of CD4 T cells (FIG 1 IA), CD8 T cells (FIG HB) and CD19 B cells (FIG HC) in the blood 72 hours after dosing with chimeric antibodies 2C3, 9D9, 4B10, 3G7, or 11C11, or Campath-lH® ("Cam")
- FIG 12 is a Kaplan Meier Survival graph illustrating the percent of surviving mice after treatment with 7Fl 1, 4B10, or 12G6 chimeric monoclonal antibodies, or Campath-1H® ("Campath) [0166
- FIG 14 is a Kaplan Meier Survival graph illustrating the percent of surviving mice after treatment with 9D9 or 4B10 chimeric monoclonal antibodies, or Campath-1H® ("Campath”)
- FIG 15 is a Kaplan Meier Survival graph illustrating the percent of surviving mice after treatment with 2C3 or 1 ICl 1 chimeric monoclonal antibodies, or Campath-1H® ("Campath")
- FIG 16 is an alignment of the mouse anti-human CD52 antibody 4B10 heavy chain variable region (SEQ ID NO 96) sequence with the closest matched human germlme sequence (SEQ ID NO 97) and the humanized heavy chain variable region sequence (SEQ ID NO 98) Also shown is an alignment of the mouse anti-human CD52 antibody 4B10 light chain variable region (SEQ ID NO 99) sequence with the closest matched human germlme sequence (SEQ ID NO 100) and the humanized light chain variable region sequence (SEQ ID NO 101) [0170]
- FIG 17 shows the humanized 4B10 heavy chain (SEQ ID NO 103) and light chain (SEQ ID NO 102) variable region sequences [0171]
- FIG 18 is a graph showing that humanized antibody 4B10-H1/K1 ("4B10- Humamzed") and chimeric antibody 4B10 bind equivalently to cells expressing CD52 [0172]
- FIG 19 is a graph showing that humanized antibody 4B10 -Hl/Kl ("4B10 Humanized”) and
- Humamzed and chimeric antibody 4B10 mediate equivalent CDC activity on cells expressing
- FIG 21 is a graph illustrating the pharmacokinetic profile of chimeric anti-CD52 antibodies (12G6, 7Fl 1 and 4B10), Campath-1H® ("Campath"), and humanized anti-CD52 antibody 4B10-H1/K1 (“4B10 humanized (Hl/Kl)”) m heterozygous huCD52 transgenic mice
- FIGS 22A-22C are graphs showing the level of CD4 T cells (FIG 22A), CD8 T cells (FIG 22B) and CD19 B cells (FIG 22C) in the blood 72 hours after dosing with chimeric antibody 4B10 or humanized antibody 4B10-H1/K1 (“4BlO-Hu”) or Campath-IH® ("Campath)
- FIG 23 is a graph showing the summary of the relative binding affinities of the anti- CD52 monoclonal antibodies
- FIG 24 shows the humanized 7Fl 1 heavy and light (kappa) chain variable region sequences Amino acid residues
- FIG 25 is a histogram showing that chimeric and humanized 7Fl 1 antibodies bind equivalently to cells expressing CD52
- the X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population
- FIG 26A shows the humanized 2C3 heavy chain variable region sequences Amino acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 26B shows the humanized 2C3 light (kappa) chain variable region sequences Ammo acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 27A is a histogram showing binding of humanized and chimeric 2C3 antibodies to cells expressing CD52
- the X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population
- FIG 27B is a histogram showing that chimeric and a subset of the humanized 2C3 antibodies bind equivalently to cells expressing CD52
- the X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population
- FIG 28A shows the humanized 12G6 heavy chain variable region sequences Amino acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 28B shows the humanized 12G6 light (kappa) chain variable region sequences Ammo acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 29 is a histogram showing that chimeric and a subset of the humanized 12G6 antibodies bind equivalently to cells expressing CD52
- the X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population
- FIG 30A shows the humanized 9D9 heavy chain variable region sequences Amino acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 30B shows the humanized 9D9 light (kappa) chain variable region sequences Ammo acid residues that are back mutated to mouse residues are underlined and the CDRs are shown in boldface
- FIG 31 is a histogram showing that chimeric and a subset of the humanized 9D9 antibodies bind equivalently to cells expressing CD52 The X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population [0185]
- FIG 32A shows the binding curves of Campath-1H® ("ClH”), a chimeric 2C3 antibody, and a humanized 2C3-SFD1/K12 antibody to primary human T cells and huCD52 transgenic mouse T cells
- FIG 32B shows the binding curves of Campath-1H®
- FIG 33 is a table showing the relative binding efficiency of Campath-1H®, chimeric 2C3 and 12G6 antibodies, and humanized 2C3 and 12G6 antibodies to huCD52 expressing human and transgenic mouse T cells
- FIG 34 illustrates the comparative binding patterns of humanized anti-CD52 Campath- 1H®, 2C3, 12G6, and 9D9 antibodies to defined subsets of human peripheral blood mononuclear cell populations by flow cytometry These histograms show that the humanized anti-CD52 antibody binding is equivalent to that of Campath-1H® for various CD52 expressing human PBMC subsets
- the X axis represents the fluorescence emitted by the bound anti-CD52 antibody, while the area of each peak represents the total cell population
- FIG 35 is a graph showing that chimeric and humanized 7Fl 1 antibodies mediate equivalent ADCC activity on cells expressing CD52
- FIG 36 is a graph showing that chimeric and humanized 7Fl 1 antibodies mediate CDC activity on cells expressing CD52
- FIG 37 is a graph showing that chimeric and humanized 2C3 antibodies mediate ADCC activity on cells expressing CD52
- FIG 38 is a graph showing that chimeric and humanized 2C3 antibodies mediate CDC activity on cells expressing CD52
- FIG 39 is a graph showing that chimeric and humanized 12G6 antibodies mediate ADCC activity on cells expressing CD52
- FIG 40 is a graph showing that chimeric and humanized 12G6 antibodies mediate CDC activity on cells expressing CD52
- FIG 41 is a graph showing that chimeric and humanized 9D9 antibodies mediate
- FIG 42 is a graph showing that chimeric and humanized 9D9 antibodies mediate CDC activity on cells expressing CD52
- FIG 43 is a graph showing the ADCC activity of humanized anti-CD52 antibodies on primary T cells
- FIG 44 is a graph showing the CDC activity of humanized anti-CD52 antibodies on primary T cells
- FIG 45 is a graph showing neutralization of Campath-1H but not other anti-CD52 antibodies with CAMMS223 study human serum samples that contain anti-Campath-lH® neutralizing antibodies Serum samples were taken from a representative patient (MS-I) at month 12 (M12) and month 13 (M13)
- FIGS 46A-46E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells , myeloid cells, and neutrophils in the blood 72 hours after dosing with Campath-1H® ("Campath”) and humanized 4B10-H1/K1 (“4B10”) antibodies
- FIGS 47A-47E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, neutrophils, and macrophages in the spleen 72 hours after dosmg with
- Campath-1H® (“Campath) and humanized 4B10-H1/K1 (“4B10") antibodies
- FIGS 48A-48E show the levels of circulating cytokines 2 hours after dosmg with Campath-1H® ("Campath”) and humanized 4B10-H1/K1 (“4B10”) antibodies
- FIGS 49A and 49B show the repopulation of circulating lymphocytes over a time course after dosing with Campath-1H® ("Campath”) and humanized 4B10-H1/K1 (“4B10”) antibodies, (mg/kg)
- FIGS 5OA-5OE show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, and neutrophils in the blood 72 hours after dosing with the humanized
- FIGS 51 A-5 IE show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, and neutrophils in the spleen 72 hours after dosmg with the humanized
- FIGS 52A-52F show the levels of circulating cytokines 2 hours after dosing with the humanized 7F11-SFD1/K2 ("7Fl 1 SFDl”) and 7F11-SFD2/K2 ("7Fl 1 SFD2") antibodies
- FIGS 53A and 53B show the repopulation of circulating lymphocytes over a timecourse after dosing with the humanized 7Fl 1-SFD1/K2 (“7Fl 1 SFDl”) and 7Fl 1-SFD2/K2 (“7Fl 1 SFD2”) antibodies, (mg/kg)
- FIGS 54A and 54B show the level of CD4+ T cells, CD8+ T cells and B220+ B cells m the blood 72 hours after dosing with Campath-1H® ("Campath"), 7Fl 1-chime ⁇ c antibodies, and humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies
- FIG 55 shows the level of Campath-1H® ("Campath"), 7Fl 1-chime ⁇ c antibody and humanized 7Fl 1-SFD1/K2 and 7Fl 1-SFD2/K2 antibodies in the blood over a timecourse after dosing
- FIGS 56A-56E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, and neutrophils m the blood 72 hours after dosmg with 2C3-SFD1/K12 antibodies
- FIGS 57A-57E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, and neutrophils m the spleen 72 hours after dosmg with 2C3-SFD1/K12 antibodies
- FIGS 58A-58F show the levels of circulating cytokines 2 hours after dosing with 2C3-SFD1/K12 (“2C3”) antibodies
- FIG 59 shows the repopulation of circulating lymphocytes over a timecourse after dosing with 2C3-SFD1/K12 antibodies, (mg/kg)
- FIGS 60A-60E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, macrophages, and neutrophils in the blood 72 hours after dosmg with 12G6-SFD1/K11 antibodies
- FIGS 61 A-61E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, macrophages, neutrophils, and myeloid cells in the spleen 72 hours after dosmg with 12G6-SFD1/K11 antibodies
- FIGS 62A-62F show the levels of circulating cytokines 2 hours after dosing with 12G6-SFD1/K11 ("12G6 hu”) antibodies
- FIG 63 shows the repopulation of circulating lymphocytes over a timecourse after dosing with 12G6-SFD1/K11 antibodies, (mg/kg)
- FIGS 64A-64C show the level of 2C3-chime ⁇ c, 2C3-SFD1/K12, 12G6-chime ⁇ c, 12G6-SFD1/K11, 9D9-chime ⁇ c, and 9D9-H10/K12 antibodies m the blood over a timecourse after dosing
- FIGS 65A-65E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, macrophages, and neutrophils in the blood 72 hours after dosmg with 9D9-H10/K12 ("9D9") antibodies
- FIGS 66A-66E show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, myeloid cells, neutrophils, and macrophages in the spleen 72 hours after dosmg with 9D9-H10/K12 ("9D9") antibodies
- FIGS 67A-67F show the levels of circulating cytokines 2 hours after dosmg with 9D9-H10/K12 ("9D9") antibodies
- FIG 68 shows the repopulation of circulating lymphocytes over a timecourse after dosing with 9D9-H10/K12 (“9D9”) antibodies, (mg/kg)
- FIGS 69A-69D show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T cell, B220+ B cell and NK cell subtypes m the blood 72 hours after dosing with Campath-1H® ("Campath”), 2C3-SFD1/K12 ("2C3"), 12G6-SFD1/K11 (“12G6”), and 9D9-H10/K12 (“9D9”) antibodies
- FIGS 70A-70D show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T cell, B220+ B cell and NK cell subtypes m the spleen 72 hours after dosing with Campath-1H® ("Campath”), 2C3-SFD1/K12 (“2C3”), 12G6-SFD1/K11 (“12G6”), and 9D9-H10
- FIG 72 shows the level of CD4+ T cells, CD8+ T cells, B220+ B cells, and NK cells in the blood 72 hours after dosing with 9D9-H10/K12 and 9D9-H11/K12 antibodies
- FIG 73 shows the level of CD4+ T cells, CD8+ T cells, B220+ B cells, and NK cells in the spleen 72 hours after dosing with 9D9-H10/K12 and 9D9-H11/K12 antibodies
- FIGS 74A-74D show the level of CD4+ T cells, CD8+ T cells, B220+ B cells, NK cells, and myeloid cells m the blood 72 hours after dosmg with 12G6-SFD1/K11 ("12G6 Kl 1") and 12G6-SFD1/K12 ("12G6 K12”) antibodies
- FIGS 75A-75D show the level of CD4+ T cells, CD8+ T cells, B220+B cells, NK cells and myeloid cells in the spleen 72 hours after dosing with 12G6-SFD1/K11 ("12G6 Kl 1") and 12G6-SFD1/K12 (“12G6 K12”) antibodies
- FIG 76 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) in the blood 72 hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and
- FIGS 77A-77D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in the blood 72 hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- FIG 78 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) in the spleen 72 hours after dosmg with 9D9-H11/K12, 9D9-H16/K13, and
- FIGS 79A-79D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in the spleen 72 hours after dosing with 9D9-H11/K12,
- FIGS 80A-80F show the levels of circulating cytokines 2 hours after dosing with
- FIGS 81A and 81B show the level of 2C3-SFD1/K12, 12G6-SFD1/K11,
- FIGS 82A-82F show the level of cytokines in the blood over a 48-hour timecourse following dosing with Campath-1H® ("Campath"), 2C3-SFD1/K11, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 or 9D9-H18/K13 antibodies
- FIGS 83A-83E show the level of bulk lymphocytes, CD4+ T cells, CD8+ T cells,
- FIGS 84A-84G show the repopulation of circulating CD4+ and CD8+ T cells, regulatory T cells, B cells, NK cells, neutrophils and macrophages over a timecourse after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- FIG 85 shows the ability of FITC-labeled Campath-1H® ("Campath”), 2C3-SFD1/K12 (“2C3 K12”), 12G6-SFD1/K11 (“12G6 Kl 1”), 12G6-SFD1/K12 (“12G6 K12”),
- FIGS 86A-86E show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell, CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in the blood 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13 5 antibodies
- FIGS 87A-87E show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell, CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in the spleen 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13
- FIGS 88A-88F show the levels of circulating cytokines 2 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- FIGS 89A-89D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and
- NK/myeloid cell subtypes m the blood 72 hours after dosing with Campath- 1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- FIGS 90A-90D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes m the spleen 72 hours after dosmg with Campath- 1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- FIGS 91A-91D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes m the lymph node 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies [0245]
- FIG 92A shows the huCD52 expression level on CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in huCD52-KI/KO and non-transgemc control mice
- FIGS 91A-91D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes m the lymph node 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12
- 25 92B shows the huCD52 expression level on CD4+ T cells, CD8+ T cells, and B cells m huCD52-KI/KO and huCD52 CDl transgenic mice
- FIG 93 shows the binding to huCD52 of 12G6-SFD1/K12 and 2C3-SFD1/K12 antibodies from various production sources ("small scale” and “large scale”) as compared to a Campath-1H® control
- FIG 94 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, B220+ B cells and NK cells) m the blood 72 hours after dosmg with 12G6-SFD1/K12 and
- FIG 95 shows the levels of 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies m the blood over a timecourse after dosmg
- FIG 96 demonstrates the EAE clinical score of 2C3-SFD1/K12 and 12G6-SFD1/K12 over a timecourse of disease progression
- FIGS 97A and 97B demonstrate the ability of CampathlH® ("Campath")
- H310A/H435Q 2C3 His310Ala/His435Gln 2C3-SFD1/K12
- FIG 98 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3 unmodified"), 2C3-SFD1/K12-Modified 1 ("2C3-Fc mutant 1") and 2C3-SFD1/K12-Modified 2 ("2C3-Fc mutant 2") in nontransgemc mice
- FIG 99 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3"), 2C3-SFD1/K12-
- FIGS IOOA and 10OB show the level of bulk lymphocyte populations (CD4+ T cells
- CD8+ T cells, B220+ B cells, and NK cells m the blood and spleen 72 hours after dosing with
- FIGS 101A and 101B are representative sensorgrams of Biacore TlOO assays to determine the epitope specificity of the humanized 12G6-SFD1/K12 antibody and mutant peptides generated by alanine scanning
- FIG 101A shows no binding between 12G6-SFD1/K12 and the MUT 8 peptide
- FIG 101B shows binding between 12G6-SFD1/K12 and the
- FIG 102 shows the TCR V beta analysis for donor BMS486 CD4+ T cells educated with Campath-1H® peptide group 986-989 exhibited preferential expansion of a single V beta
- FIG 103 shows the TCR V beta analysis for donor BMS928 CD4+ T cells educated with 12G6-SFD1/K12 peptide groups 1066-67-68 and 1083-84-85 exhibited preferential expansion of a single V beta (V ⁇ 20)
- FIGS 104A-104J show the Campath-1H® immunogemcity assessment Proliferative responses are shown in CPM for individual donors A-J
- the X axis depicts the groups of peptides used to stimulate autologous CD4+ T cells three times Each group of T cells was assayed m triplicate with autologous DCs pulsed with the educating antigen/peptide group (specific response, left bar, white), irrelevant DR binding peptide (middle bar, striped), or media (right bar, black)
- FIGS 1O5A-1O5J show the 12G6-SFD1/K12 immunogenicity assessment Proliferative responses are shown m CPM for individual donors A-J
- the X axis depicts the groups of peptides used to stimulate autologous CD4+ T cells three times Each group of T cells was assayed in triplicate with autologous DCs pulsed with the educating peptide group (specific response, left bar, white), irrelevant DR binding peptide (middle bar, striped), or media (right bar, black) In groups assayed without the media control, the left bar (white) represents DCs pulsed with the educating peptide, and the right bar (striped) represents DCs pulsed with the irrelevant peptide
- FIG 106 shows the full-length humanized heavy chain ammo acid sequence of 2C3- SFDl (SEQ ID NO 272) and the full- length humanized light chain ammo acid sequence of 2C3-K12 (SEQ ID NO 273) The signal sequences are boldfaced and italicized and the CDRs are underlined
- FIG 107 shows the full- length humanized heavy chain ammo acid sequence of 7Fl 1- SFDl (SEQ ID NO 274) and the full- length humanized light chain ammo acid sequence of 7Fl 1-K2 (SEQ ID NO 275) The signal sequences are boldfaced and italicized and the CDRs are underlined
- FIG 108 shows the full-length humanized heavy chain ammo acid sequences of 9D9- H16 (SEQ ID NO 276) and 9D9-H18 (SEQ ID NO 277), and the full-length humanized light chain ammo acid sequence of 9D9-K13 (SEQ ID NO 278) The signal sequences are boldfaced and italicized and the CDRs are underlined
- FIG 109 shows the full- length humanized heavy chain ammo acid sequence of 12G6- SFDl (SEQ ID NO 279) and the full-length humanized light chain ammo acid sequence of
- FIG 110 shows the full-length humanized heavy chain ammo acid sequence of 4B10- Hl (SEQ ID NO 281) and the full-length humanized light chain amino acid sequence of 4B10- Kl (SEQ ID NO 282) The signal sequences are boldfaced and italicized and the CDRs are underlined
- FIG 111 shows the full-length humanized heavy chain nucleic acid sequence of 2C3- SFDl (SEQ ID NO 283) and the full-length humanized light chain nucleic acid sequence of 2C3-K12 (SEQ ID NO 284) The signal sequences are underlined, the variable domains are m boldface, and the constant regions are italicized
- FIG 112 shows the full-length humanized heavy chain nucleic acid sequence of 7Fl 1- SFDl (SEQ ID NO 285) and the full-length humanized light chain nucleic acid sequence of 7Fl 1-K2 (SEQ ID NO 286) The signal sequences are underlined, the variable domains are in boldface, and the constant regions are italicized [0266]
- FIG 113 shows the full- length humanized heavy chain nucleic acid sequences of 9D9-
- FIG 114 shows the full-length humanized light chain nucleic acid sequence of 9D9- K13 (SEQ ID NO 289) The signal sequence is underlined, the variable domain is m boldface, and the constant region is italicized
- FIG 115 shows the full-length humanized heavy chain nucleic acid sequence of 12G6- SFDl (SEQ ID NO 290) and the full-length humanized light chain nucleic acid sequence of 12G6-K12 (SEQ ID NO 291) The signal sequences are underlined, the variable domains are m boldface, and the constant regions are italicized [0269]
- FIG 116 shows the full-length humanized heavy chain nucleic acid sequence of 4B10-
- CD52 is a glycosylated, GPI anchored cell surface abundant protein (approximately 5 x 25 10 5 antibody binding sites per cell) present on at least 95% of all human peripheral blood lymphocytes and monocytes/macrophages (Hale G, et al , "The CAMPATH-I antigen (CD52),” Tissue Antigens, 35 178-327 (1990)), but is absent from hematopoietic stem cells
- This invention is directed to immunoglobulins (anti-CD52) which have binding specificity (e g , epitopic specificity) for, or are selective for binding to, human CD52 or a portion thereof
- binding specificity e g , epitopic specificity
- immunoglobulins described herein can be purified or isolated using known techniques Immunoglobulins that are "purified” or “isolated” have been separated away from molecules (e g , peptides) of their source of origin (e g , the supernatant of cells, in a mixture such as in a mixture of immunoglobulins in a library), and include immunoglobulins obtained by methods described herein or other suitable methods Isolated immunoglobulins include substantially pure (essentially pure) immunoglobulins, and immunoglobulins produced by chemical synthesis, recombinant techniques and a combination thereof
- the invention relates to anti-human CD52 immunoglobulins, antigen-bmdmg fragments (1 e , portions) of the immunoglobulins, the light chains of the immunoglobulins, the heavy chains of the immunoglobulins, and fragments of these light chains or heavy chains
- the invention also relates to mature immunoglobulins or chains thereof, such as glycosylated immunoglobulins
- the invention also relates to immature or precursor immunoglobulin (protein)
- the invention also relates to nucleic acid molecules (e g , vectors) that encode both these immature or mature proteins, to vectors and host cells that comprise such nucleic acid, to methods of producing immature and mature proteins and to methods of using the immunoglobulins
- the immunoglobulins of this invention can be used to treat a subject m need thereof (e g , a human patient) to deplete the subject's lymphocytes and other CD52+ cells (e g , CD52+ cancerous cells) as needed
- lymphocyte depletion is a type of immunosuppression by reducing the population of circulating lymphocytes, e g , T cells and/or B cells, resulting m lymphopenia
- the immunoglobulins of this invention can also be used to inhibit angiogenesis as further described below
- the immunoglobulins of this invention also can be used to enrich hematopoietic stem cells, for example, in ex vivo applications (see, e g , Lim et al , J Hematology & Oncology 1 19 (2008))
- Naturally occurring immunoglobulins have a common core structure in which two identical light chains (about 24 kD) and two identical heavy chains (about 55 or 70 kD) form a tetramer
- the amino-terminal portion of each chain is known as the variable (V) region and can be distinguished from the more conserved constant (C) regions of the remainder of each chain
- the variable region of the light chain also called the V L domain
- CDRs complementarity determining regions
- the CDR sequences are defined by using both the Kabat system and the IMGT system, that is, when the CDRs defined by the two systems do not entirely overlap, we include all the residues from the sequences defined by both systems
- Human immunoglobulins can be divided into classes and subclasses, depending on the isotype of the heavy chain
- the classes include IgG, IgM, IgA, IgD and IgE, m which the heavy chains are of the gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) or epsilon ( ⁇ ) type, respectively
- Subclasses include IgGl, IgG2, IgG3, IgG4, IgAl and IgA2, in which the heavy chains are of the ⁇ l, ⁇ 2, ⁇ 3, ⁇ 4, ⁇ l and ⁇ 2 type, respectively
- Human immunoglobulin molecules of a selected class or subclass may contain either a kappa (K) or lambda ( ⁇ ) light chain See e g , Cellular and
- Antigen- bmding fragments of antibodies can be m the format of, for example, single chain antibodies, Fv fragments, Fab fragments, Fab' fragments, F(ab') 2 fragments, Fd fragments, single chain Fv molecules (scFv), bispecif ⁇ c single chain Fv dimers (PCT ⁇ JS92/09665), diabodies,
- antigen-bmdmg molecules comprising a VH and/or a VL
- the molecule may also comprise one or more of a CHl, hinge, CH2 and CH3 region
- antigen-bindmg portion of an antibody
- recombinant techniques For instance, papain or pepsin cleavage can be used to generate Fab or F(ab')2 fragments, respectively
- Antibodies can also be produced in a variety of truncated forms using antibody genes m which one or more stop codons have been introduced upstream of the natural stop site
- a recombinant construct encoding the heavy chain of an F(ab')2 fragment can be designed to include DNA sequences encoding the CHi domain and hinge region
- the invention provides a variant of an antibody or portion thereof as described herein, wherein said variant binds to human CD52 specifically but differs from the reference antibody or portion thereof by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions
- the variant antibody is at least 90%, at least 91%, at least 93%, at least 95%, at least 97% or at least 99% identical to the reference antibody m the heavy chain, the heavy chain variable domain, the light chain, or the light chain variable domain [0279] Sequence similarity or identity for polypeptides, which is also referred to as sequence
- GCG contains programs such as "Gap” and "Bestfit” which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutein thereof See, e g , GCG Version 6 1 Polypeptide sequences also can be compared using FASTA using default or recommended parameters, a program in GCG Version 6 1 FASTA (e g , FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, Methods Enzymol 183 63-98 (1990), Pearson, Methods MoI Biol 132 185-219 (2000)) Another preferred algorithm when comparing a sequence of the invention to a database containing a large number of sequences from different organism
- one type of amino acid substitution that may be made is to change one or more cysteines in the antibody, which may be chemically reactive, to another residue, such as, without limitation, alanine or serine
- there is a substitution of a non-canonical cysteine The substitution can be made m a CDR or framework region of a variable domain or in the constant domain of an antibody
- the cysteine is canonical
- Another type of amino acid substitution that may be made is to remove potential proteolytic sites m the antibody Such sites may occur in a CDR or framework region of a variable domain or in the constant domain of an antibody Substitution of cysteine residues and removal of proteolytic sites may decrease the
- a conservative amino acid substitution is one in which an amino acid residue is substituted by another amino acid residue having a side chain R group) with similar chemical properties (e g , charge or hydrophobicity)
- a conservative amino acid substitution will not substantially change the functional properties of a protein
- the percent sequence identity or degree of similarity may be adjusted upwards to correct for the conservative nature of the substitution Means for making this adjustment are well-known to those of skill in the art See e g , Pearson, Methods MoI Biol 243:307-31 (1994)
- Examples of groups of amino acids that have side chains with similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine, and iso leucine; 2) aliphatic-hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containmg side chains: cysteine and methionine
- Preferred conservative amino acids substitution groups are: valine-leucine-iso leucine, phenylalanine-tyrosine, lysine-argmme, alanine-valine, glutamate-aspartate, and asparagme-glutamine
- a conservative replacement is any change having a
- humanized immunoglobulins comprising the CDRs of novel mouse anti-human CD52 antibodies
- the humanized immunoglobulin comprises a humanized light chain and a humanized heavy chain that have CDR amino acid sequences which differ from the amino acid sequence of other humanized versions of anti-CD52 antibodies (e g , Campath®)
- humanized immunoglobulin refers to an immunoglobulin comprising chains that comprise one or more light chain CDRs (CDRl, CDR2 and CDR3) and one or more heavy chain CDRs (CDRl, CDR2 and CDR3) of an anti-CD52 antibody of non- human origin, also referred to herein as the donor antibody (e g , a murine anti-CD52 antibody), and at least a portion of an immunoglobulin of human origin (e g , framework regions, or framework and constant regions, derived from a light and/or heavy chain of human origin, such as CDR-graf
- the humanized immunoglobulin comprises one or more light chain CDRs and one or more heavy chain CDRs of one or more of the following murine monoclonal antibodies mouse 8G3 25 3 5, mouse 4G7 F3, mouse 9D9 A2, mouse 1 ICl 1 C5, mouse 3G7 E9, mouse 5F7 1 1 4, mouse 12G6 15 1 2, mouse 23E6 2 2 1, mouse 2C3 3 8 1, mouse 7Fl 1 1 9 7, and mouse 4B10 1 2 4
- the humanized immunoglobulins bind human CD52 with an affinity similar to or better than that of Campath®
- the humanized immunoglobulin of the present invention has the binding specificity of a murine anti-human CD52 antibody of the invention (e g , having specificity for human CD52, having the same or similar epitopic specificity) and/or it has the same inhibitory function
- the humanized immunoglobulins can have the binding specificity and/or inhibitory activity of a murine anti- human CD52 antibody or humanized anti-human CD52 antibody described herein, and/or the epitopic specificity of a murine anti-human CD52 antibody or humanized anti-human CD52 antibody described herein (e g , it can compete with the murine anti-human CD52 antibody, or another humanized anti-CD52 antibody (e g , Campath®) for binding to CD52, and/or it can have the inhibitory function of the murine or humanized anti-human CD52 antibody)
- the humanized immunoglobulins can have the binding specificity
- the portion of the humanized immunoglobulin or immunoglobulin chain which is of human origin can be derived from any suitable human immunoglobulin or immunoglobulin chain
- a human constant region or portion thereof in a humanized or chimeric antibody can be derived from a human K or ⁇ light chain gene, and/or from a human ⁇ (e g , ⁇ l, ⁇ 2, ⁇ 3, ⁇ 4), ⁇ , ⁇ (e g , ⁇ l, ⁇ 2), ⁇ or ⁇ heavy chain gene, including allelic variants
- a particular constant region (e g , IgGl), variant or portion thereof can be selected in order to tailor effector function
- a mutated constant region (variant) can be incorporated into the immunoglobulin or immunoglobulin chain so as to minimize binding to Fc receptors and/or ability to fix complement (See e g , Winter et al , GB 2,209,757 B,
- germline refers to the nucleotide sequences and amino acid sequences of the antibody genes and gene segments as they are passed from parents to offspring via the germ cells This germline sequence is distinguished from the nucleotide sequences encoding antibodies m mature B cells which have been altered by recombination and hypermutation events during the course of B cell maturation
- An antibody that "utilizes" a particular germline has a nucleotide or amino acid sequence that most closely aligns with that germline nucleotide sequence or with the amino acid sequence that it specifies Such antibodies frequently are mutated compared with the germline sequence
- the human framework has minimal variation or mutation from germline sequence m its structure or sequence (e g , less than 3, 4, 5, 6, 7, 8, 9, or 10 acceptor framework residues have been replaced with donor framework residues to improve binding affinity, see Queen et al , U S Patent No 5,530,101)
- a limited number of amino acids e g , less than 3, 4, 5, 6, 7, 8, 9, or 10 acceptor framework residues
- the framework regions of the humanized immunoglobulin chains are obtained, or derived, from a human Ig variable region having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% overall sequence identity, with the variable region of the nonhuman donor
- the framework regions of the humanized immunoglobulin chains are obtained or derived from human variable region framework regions having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% overall sequence identity, with the framework regions of the variable region of the nonhuman donor immunoglobulin
- at least one of the framework regions (FR) of the humanized immunoglobulin is obtained or derived from one or more chains of an antibody of human origin
- the human heavy chain framework regions of the humanized antibodies of this invention utilize the human VH3-72 or VH3-23 germline sequence
- the human light chain framework regions of the humanized antibodies of this invention utilize the human Vk2-A18b germline sequence
- Back mutations may optionally be made m these FR regions at one or more of the residues as described in the Working Examples below to improve CD52-binding affinity of the humanized antibody
- "Affinity" is a term of art that describes the strength of a binding interaction and typically refers to the overall strength of binding of the immunoglobulin to human CD52
- the immunoglobulin has a binding activity measured as an EC50 value of less than 10 ⁇ g/ml (e g , as determined by flow cytometry) In another embodiment, the immunoglobulin has a binding activity measured as an EC50 value of less than
- the binding function of a humanized anti-CD52 immunoglobulin of the invention having binding specificity for human CD52 can be detected using any suitable method, e g , assays which monitor formation of a complex between humanized immunoglobulin and human CD52 (e g , a membrane fraction comprising human CD52, a cell bearing human CD52, such as a human T cell, a human B cell, a CHO cell or a recombinant host cell comprising and expressing a nucleic acid encoding human CD52, a peptide (e g , a synthetic peptide) having an ammo acid sequence of CD52, a solid support comprising human CD52)
- any suitable method e g , assays which monitor formation of a complex between humanized immunoglobulin and human CD52 (e g , a membrane fraction comprising human CD52, a cell bearing human CD52, such as a human T cell, a human B cell, a CHO cell or a recombin
- an immunoglobulin of the invention e g , a humanized immunoglobulin of the invention
- an immunoglobulin of the invention e g , a humanized immunoglobulin of the invention
- an immunoglobulin of the invention to bind to the same epitope on human CD52 as a particular murine, chimeric, or humanized monoclonal antibody, or to bind to an epitope on human CD52 which overlaps with the epitope on human CD52 to which a particular murine, chimeric, or humanized monoclonal antibody binds
- An "epitope" as used herein includes any protein determinant capable of specific binding to an immunoglobulin Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or
- test antibody to determine if a test antibody binds to the same or overlapping epitope of a humanized antibody of this invention, one allows the anti-CD52 antibody of the invention to bind to CD52 under saturating conditions and then measures the ability of the test antibody to bind to CD52 If the test antibody is able to bind to CD52 at the same time as the reference anti-CD52 antibody, then the test antibody binds to a different epitope than the reference anti-CD52 antibody However, if the test antibody is not able to bind to CD52 at the same time, then the test antibody binds to the same epitope, an overlapping epitope, or an epitope that is m close proximity to the epitope bound by the anti-CD52 antibody of the invention This experiment can be performed using ELISA, RIA, BIACORETM, or flow cytometry To test whether an anti-CD52 antibody cross-competes with another anti-CD52 antibody, one may use the competition method described above m two directions, i
- Epitope binning can also be useful to characterize the antibodies of this invention
- the term “binning” refers to a method to group antibodies based on their antigen binding characteristics
- a high throughput process for "binning" antibodies based upon their cross- competition is described in International Patent Application No WO 03/48731
- the "epitope binning” can be investigated by allowing an unlabeled form of an anti-CD52 antibody "A” to bind to a synthetic peptide corresponding to the sequence of CD52 or to CD52 positive cells
- anti-CD52 antibodies "A” and “B” can both be labeled with different flourochromes or chemicals enabling detection, and one can measure the quantities of both labeled antibodies that can engage the 5 CD52 peptide at the same time using a device capable of detecting the label or measure the amounts of both antibodies that simultaneously engage CD52 positive cells by flow cytometry Biacore and Octet technologies enable one to investigate the competitive binding of unlabelled forms of antibodies This use of unlabelled forms of antibodies is desired as the chemical modification of some antibodies can compromise the binding activity See also the technology
- portions of the humanized immunoglobulins such as light chains, heavy chains and portions of light and heavy chains
- immunoglobulin portions can be obtained or derived from immunoglobulins (e g , by reduction and/or cleavage), or
- nucleic acids encoding a portion of an immunoglobulin or chain thereof having the desired property e g , binds human CD52, sequence similarity
- They can be prepared by e g , de novo synthesis of the relevant portion Humanized immunoglobulins comprising the desired portions (e g , antigen-bmdmg region, CDR, FR, C region) of human and nonhuman origin can be produced using synthetic and/or recombinant nucleic acids to prepare
- a portion of an immunoglobulin e g , a portion of a chain
- one or more stop codons can be introduced at the desired position
- Nucleic acid (e g , DNA) sequences coding for humanized variable regions can be constructed using PCR mutagenesis methods to alter existing DNA sequences (see e g , Kamman, M , et al , Nucl Acids Res 17 5404 (1989)) PCR primers coding
- a nucleic acid comprising a sequence encoding a variable region sequence can be constructed from synthetic oligonucleotides (see e g , Kolbinger, F , Protein Engineering 8 971-
- the invention relates to a humanized immunoglobulin that has binding specificity for human CD52 and comprises a humanized light chain and a humanized heavy chain and/or portions thereof
- the humanized immunoglobulin comprises a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 16; a light chain comprising one or more
- a humanized immunoglobulin of this invention comprises H- CDR3 and L-CDR3 whose sequences are a) SEQ ID NOs: 69 and 43, respectively; b) SEQ ID NOs: 68 and 43, respectively; c) SEQ ID NOs: 70 and 43, respectively; d) SEQ ID NOs: 71 and 44, respectively; e) SEQ ID NOs: 71 and 45, respectively; f) SEQ ID NOs: 72 and 46, respectively; g) SEQ ID NOs: 73 and 47, respectively; h) SEQ ID NOs: 294 and 47, respectively; or i) SEQ ID NOs: 74 and 48, respectively
- the humanized immunoglobulin has binding specificity for human CD52 and comprises a light chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a combination thereof; and a heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53,
- the humanized immunoglobulin that has a binding specificity for human CD52 comprises a light chain comprising one or more CDRs (e g , all three CDRs) of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13, and a heavy chain comprising one or more CDRs (e g, all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 137, wherein the humanized immunoglobulin is not Campath®
- the invention also relates to a humanized immunoglobulin light chain of the humanized immunoglobulin described herein
- the humanized immunoglobulin light chain comprises one or more CDRs selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, and a combination thereof, wherein the humanized immunoglobulin light chain is not the light chain of Campath®
- the humanized antibody has L-CDRl, L-CDR2, and L
- the invention also relates to humanized heavy chain comprising one or more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO:
- the humanized immunoglobulin heavy chain is not the heavy chain of Campath®
- the humanized antibody has H-CDRl, H-CDR2, and H-CDR3 whose amino acid sequences are: a) SEQ ID NOs: 51, 59, and 69, respectively; b) SEQ ID NOs: 50, 60, and 69, respectively; c) SEQ ID NOs: 50, 61
- a humanized antibody of this invention comprises a light chain comprising a variable domain (V L ) sequence of one of SEQ ID NOs: 102, 138, 145-148, 153- 157, and 164-168
- the humanized antibody comprises a light chain whose amino acid sequence comprises or consists of one of SEQ ID NOs: 273, 275, 278, 280, 5 and 282
- a humanized antibody of this invention comprises a heavy chain comprising a variable domain (V H ) sequence of one of SEQ ID NOs: 103, 136, 137, 139-144, 149-152, and 158-163
- the humanized antibody comprises a heavy chain whose amino acid sequence comprises or consists of one of SEQ ID NOs: 272, 274, 276, 10 277, 279, and 281
- a humanized antibody of this invention comprises a V H and a V L whose amino acid sequences comprise or consist of a) SEQ ID NOs: 103 and 102, respectively (4B10-H1/K1); b) SEQ ID NOs: 136 and 138, respectively (7F11-SFD1/K2); 15 c) SEQ ID NOs: 137 and 138, respectively (7Fl 1-SFD2/K2) d) SEQ ID NO: 139 and one of SEQ ID NOs: 145-148, respectively (e g , SEQ ID NOs: 139 and 146, respectively (2C3-SFD1/K11); and SEQ ID NOs: 139 and 147, respectively (2C3- SFD1/K12)); e) SEQ ID NO: 140 and one of SEQ ID NOs: 145-148, respectively; 20 f) SEQ ID NO: 141 and one of SEQ ID NOs: 145-148, respectively; g) SEQ ID NO: 142
- SEQ ID NO: 158 and one of SEQ ID NOs: 164-168, respectively (e g , SEQ ID NOs:
- SEQ ID NO: 159 and one of SEQ ID NOs: 164-168, respectively e g , SEQ ID NOs: 159 and 165, respectively (9D9-H11/K12); and SEQ ID NOs: 159 and 166, respectively (9D9- H11/K13)
- a humanized antibody of this invention comprises a light chain (LC) and a heavy chain (HC) whose amino acid sequences comprise or consist of a) SEQ ID NOs: 273 and 272, respectively; b) SEQ ID NOs: 275 and 274, respectively; c) SEQ ID NOs: 278 and 276, respectively; d) SEQ ID NOs: 278 and 277, respectively; e) SEQ ID NOs: 280 and
- This invention also provides anti-human CD52 antibodies (except those, m any, known m the prior art) that binds to the same epitope as, or competes or cross-competes with, an antibody exemplified herein
- These antibodies can be, for example, humamzed,chime ⁇ c, or mouse antibodies
- the invention provides anti-human CD52 antibodies that bind to
- mouse antibodies 8G3, 4F7, 9D9, 11C11, 3G7, 5F7, 12G6, 23E6, 2C3, 7Fl 1, and 4B10, and humanized and chimeric versions of these mouse antibodies The ability of an antibody to bind to the same epitope as, or competes or cross-competes with a reference antibody can be determined as described above For example, we have found that the CD52 epitope bound by the humanized antibodies 2C3-
- this invention provides anti-CD52 antibodies that bind to the same epitope as, or competes or cross-competes with, those humanized antibodies [0319] If desired, for example, for diagnostic or assay purposes (e g , imaging to allow, for
- the humanized immunoglobulin (e g , antigen-binding fragment thereof) can comprise a detectable label Suitable detectable labels and methods for labeling a humanized immunoglobulin or antigen-binding fragment thereof are well known in the art Suitable detectable labels mclude, for example, a radioisotope (e g , as Indium- 111, Technnetium-99m or Iodine-131), positron emitting labels (e g , Fluorine-19), paramagnetic ions (e g , Gadlinium (III), Manganese (H)), an epitope label (tag), an affinity label (e g , biotin, avidm), a spin label, an enzyme, a fluorescent group or a chemiluminescent group
- complex formation e g , between humanized immunoglobulin and human CD52
- complex formation e g , between humanized immunoglobulin and human CD52
- complex formation e g , between humanized immunoglobul
- Anti-CD52 antibodies used in the invention also may be conjugated, via, for example, chemical reactions or genetic modifications, to other moieties (e g , pegylation moieties) that improve the antibodies' pharmacokinetics such as half-life
- the anti- CD52 antibodies used in this invention can be linked to a suitable cytokine via, e g , chemical conjugation or genetic modifications (e g , appending the coding sequence of the cytokine in frame to an antibody coding sequence, thereby creating an antibody cytokine fusion protein)
- the invention also relates to lmmunoconjugates in which the humanized immunoglobulin (e g , antigen-binding fragment thereof) of the invention is coupled to another therapeutic agent, such as a bioactive compound (e g , cytokines, superantigens, cytotoxic agents and toxins)
- a bioactive compound e g , cytokines, superantigens, cytotoxic agents and toxins
- mouse monoclonal immunoglobulins having binding specificity for human CD52 have been produced
- Humanized and chimeric antibodies of this invention can be derived from the mouse monoclonal antibodies of this invention That is, in some embodiments, humanized and chimeric anti-CD52 antibodies of the invention comprise sequences taken from a mouse monoclonal antibody of the invention, such as one or more CDR sequences
- a mouse monoclonal immunoglobulin of this invention comprises a light chain and a heavy chain that have CDR amino acid sequences which differ from the CDR amino acid sequences of known mouse anti-CD52 monoclonal antibodies (e g , from CF1D12)
- mouse monoclonal immunoglobulin refers to an immunoglobulin containing light chain CDRs (L-CDRl, L-CDR2 and L-CDR3) and heavy chain CDRs (H-CDRl, H-CDR2 and H-CDR3) of a murine
- the invention relates to the mouse monoclonal immunoglobulins described herein, including antigen-binding fragments (i e , portions) of the mouse monoclonal immunoglobulins, the light chains of the mouse monoclonal immunoglobulins, the heavy chains of the mouse monoclonal immunoglobulins, and fragments of these heavy and light chains
- the mouse monoclonal antibody is the mouse 8G3 25 3 5 (also called GENZ 8G3 25 3 5 or 8G3), mouse GMA 4G7 F3 (also called 4G7 F3 or 4G7), mouse GMA 9D9 A2 (also called 9D9 A2 or 9D9), mouse GMA 1 ICl 1 C5 (also called 1 ICl 1 C5 or 1 ICl 1), mouse GMA 3G7 E9 (also called 3G7 E9 or 3G7), mouse 5F7 1 1 4 (also called GENZ 5F7 1 1 4 or 5F7), mouse 12G6 15 1 2 (
- the binding function of a mouse monoclonal immunoglobulin having binding specificity for human CD52 can be detected using any suitable method, for example using assays which monitor formation of a complex between mouse monoclonal immunoglobulin and human CD52 (e g , a membrane fraction comprising human CD52, or a cell bearing human CD52, such as a human T cell, a human B cell, CHO cell or a recombinant host cell comprising a nucleic acid encoding human CD52, a peptide (e g , a synthetic peptide) having an amino acid sequence of CD52)
- portions of the murine immunoglobulins which include light chains, heavy chains and portions of light and heavy chains These immunoglobulin portions can be obtained or derived from immunoglobulins (e g , by reduction and/or cleavage), or nucleic acids encoding a portion of an immunoglobulin or chain thereof having the desired property (e g , bind
- a mouse monoclonal immunoglobulin of this invention comprises a light chain comprising SEQ ID NO: 3 and a heavy chain comprising SEQ ID NO: 16; a light chain comprising SEQ ID NO: 4 and a heavy chain comprising SEQ ID NO: 17; a light chain comprising SEQ ID NO: 5 and a heavy chain comprising SEQ ID NO: 18; a light chain comprising SEQ ID NO: 6 and a heavy chain comprising SEQ ID NO: 19; a light chain comprising SEQ ID NO: 7 and a heavy chain comprising SEQ ID NO: 20; a light chain comprising SEQ ID NO: 8 and a heavy chain comprising SEQ ID NO: 21; a light chain comprising SEQ ID NO: 9 and a heavy chain comprising SEQ ID NO: 22; a light chain comprising SEQ ID NO: 10 and a heavy chain comprising SEQ ID NO: 23; a light chain comprising SEQ ID NO: 11 and a heavy chain comprising SEQ ID NO:
- the mouse monoclonal immunoglobulin (e g , antigen binding fragment thereof) can comprise a detectable label Suitable detectable labels and methods for labeling a mouse monoclonal immunoglobulin are well known m the art Suitable detectable labels include, for example, a radioisotope (e g , as Indium-I l l, Technnetium-99m or Iodine- 131), positron emitting labels (e g , Fluo ⁇ ne-19), paramagnetic ions (e g , Gadlimum (III), Manganese (H)), an epitope label (tag), an affinity label (e g , biotin, avidm), a spin label, an enzyme, a fluorescent group or a chemiluminescent group When labels are not employed, complex formation (e g , between mouse monoclonal immunoglobulin and CD52) can be determined.
- a radioisotope e g , as Indium-I l l,
- chimeric immunoglobulins having binding specificity for human CD52 have been produced
- the chimeric immunoglobulin comprises a chimeric light chain and/or a chimeric heavy chain that have amino acid sequences which differ from the amino acid sequence of known chimeric antibodies having binding specificity for human CD52
- the term "chimeric immunoglobulin” refers to a recombinant protein that contains the variable domains including the complementarity determining regions (CDRs) of an antibody derived from one species, preferably a murine anti-human CD52 monoclonal antibody, while the constant domains of the antibody molecule are derived from those of a different species, e g , from a human antibody
- the invention relates to the chimeric immunoglobulins described herein, including antigen-bmdmg fragments (i e , portions) of the chimeric immunoglobulins, the chimeric light chains and chimeric heavy chains of the chimeric immunoglobulins and fragments of these chimeric light and heavy chains
- the invention relates to mature chimeric immunoglobulin, such as the chimeric immunoglobulin following processing to remove the heavy and light signal peptides and/or to the glycosylated immunoglobulin
- the invention also relates to immature or precursor protein, such as a chimeric heavy chain comprising a signal peptide
- the invention also relates to nucleic acid molecules (e g , vectors) that encode these immature or mature proteins, to host cells that comprise such nucleic acids and to methods of producing these immature and mature proteins [0333]
- the bmdmg function of a chimeric immunoglobulin having binding specificity for human CD52 can
- a chimeric immunoglobulin of this invention comprises the light chain variable region of SEQ ID NO: 3 and the heavy chain variable region of SEQ ID NO: 16; the light chain variable region of SEQ ID NO: 4 and the heavy chain variable region of SEQ ID NO: 17; the light chain variable region of SEQ ID NO: 5 and the heavy chain variable region of SEQ ID NO: 18; the light chain variable region of SEQ ID NO: 6 and the heavy chain variable region of SEQ ID NO: 19; the light chain variable region of SEQ ID NO: 7 and the heavy chain variable region of SEQ ID NO: 20; the light chain variable region of SEQ ID NO: 8 and the heavy chain variable region of SEQ ID NO: 21; the light chain variable region of SEQ ID NO: 9 and the heavy chain variable region of SEQ ID NO: 22; the light chain variable region of SEQ ID NO: 10 and the heavy chain variable region of SEQ ID NO: 23; the light chain variable region of SEQ ID NO: 11 and the heavy chain variable region of SEQ ID NO: 24;
- the invention also relates to a chimeric antibody that has binding specificity for human CD52, comprising a light chain variable region sequence selected from the group consisting of: the light chain variable region of SEQ ID NO: 3, the light chain variable region of SEQ ID NO: 4, the light chain variable region of SEQ ID NO: 5, the light chain variable region of SEQ ID NO: 6, the light chain variable region of SEQ ID NO: 7, the light chain variable region of SEQ ID NO: 8, the light chain variable region of SEQ ID NO: 9, the light chain variable region of SEQ ID NO: 10, the light chain variable region of SEQ ID NO: 11, the light chain variable region of SEQ ID NO: 12 and the light chain variable region of SEQ ID NO: 13, and a heavy chain variable region sequence selected from the group consisting of: the heavy chain variable region of SEQ ID NO: 16, the heavy chain variable region of SEQ ID NO: 17, the heavy chain variable region of SEQ ID NO: 18, the heavy chain variable region of SEQ ID NO: 19, the heavy chain variable region of SEQ ID NO: 20, the heavy chain
- the invention also relates to a chimeric light chain comprising the variable region of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13 [0338]
- the invention also relates to a chimeric heavy chain comprising the variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23; SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26 [0339] If desired, for example,
- Nucleic Acids and Recombinant Vectors also relates to isolated and/or recombinant (including, e g , essentially pure) nucleic acids comprising sequences which encode a humanized immunoglobulin, humanized light chain, humanized heavy chain, mouse monoclonal immunoglobulin, mouse immunoglobulin light chain, mouse immunoglobulin heavy chain, chimeric immunoglobulin, chimeric light chain or chimeric heavy chain of the present invention
- Nucleic acids referred to herein as "isolated” or “purified” are nucleic acids which have been separated away from the nucleic acids of the genomic DNA or cellular RNA of their source of origin (e g , as they exist in cells or in a mixture of nucleic acids such as a library), and include nucleic acids obtained by methods desc ⁇ bed herein or other suitable methods, including essentially pure nucleic acids, nucleic acids produced by chemical synthesis, by combinations of biological and chemical methods, and recomb
- Nucleic acids referred to herein as "recombinant" are nucleic acids which have been produced by recombinant DNA methodology, including those nucleic acids that are generated by procedures which rely upon a method of artificial recombination, such as the polymerase chain reaction
- the present invention also relates more specifically to isolated and/or recombinant nucleic acids comprising a nucleotide sequence which encodes a humanized immunoglobulin, mouse immunoglobulin or chimeric immunoglobulin that has binding specificity for human CD52 (eg , a humanized immunoglobulin of the present invention in which the nonhuman portion (e g , the CDRs) is de ⁇ ved from a murine anti-CD52 monoclonal antibody, a mouse immunoglobulin of the present invention, or a chimeric immunoglobulin of the present invention in which the nonhuman portion (e g , the V H and V L ) IS derived from a
- a promoter can be provided for expression in a suitable host cell
- Promoters can be constitutive or inducible
- a promoter can be operably linked to a nucleic acid encoding a humanized immunoglobulin or immunoglobulin chain, such that it directs expression of the encoded polypeptide
- suitable promoters for prokaryotic e g , lac, tac, T3, T7 promoters for E cob
- eukaryotic eg , yeast alcohol dehydrogenase (ADHl), SV40, CMV
- the vectors typically comprise a selectable marker for selection of host cells carrying the vector, and, in the case of a replicable vector, an origin of replication
- Genes encoding products which confer antibiotic or drug resistance are common selectable markers and may be used in prokaryotic (e g , ⁇ -lactamase gene (ampicillin resistance), Tet gene (tetracycline resistance) and eukaryotic cells (e g , neomycin (G418 or geneticin), gpt (mycophenolic acid), ampicillin, or hygromycin resistance genes)
- Dihydrofolate reductase marker genes permit selection with methotrexate in a variety of hosts
- Genes encoding the gene product of auxotrophic markers of the host e g , LEU2, URA3, HIS3 are often used as selectable markers m yeast
- viral e g , baculovirus
- phage vectors which are capable of
- the invention thus relates to isolated nucleic acid molecules that encode the humanized immunoglobulin, humanized light chain, humanized heavy chain, mouse immunoglobulin, mouse immunoglobum light chain, mouse immunoglobuin heavy chain, chimeric immunoglobulin, chimeric light chain, or chimeric heavy chain of this invention
- the invention also relates to isolated nucleic acid molecules that encode an antigen-binding portion of the immunoglobulins and their chains Polypeptide sequences encoded by the nucleic acids of this invention are described above and m the following Examples [0350]
- a nucleic acid and vector of this invention encodes a heavy chain (or an antigen-binding portion thereof) or a light chain (or an antigen-binding portion thereof) of this invention
- a host cell containing both the heavy chain-encoding nucleic acid and the light chain-encoding nucleic acid can be used to make an antibody comprising the heavy and light chain (or an antigen-bmdmg portion of the antibody)
- the antibody of this invention can be produced, for example, by the expression of one or more recombinant nucleic acids encoding the antibody in a suitable host cell
- the host cell can be produced using any suitable method.
- the expression constructs (e g , the one or more vectors, e g, a mammalian cell expression vector) described herein can be introduced into a suitable host cell, and the resulting cell can be maintained (e g , m culture, in an animal, in a plant) under conditions suitable for expression of the construct(s) or vector(s)
- Suitable host cells can be prokaryotic, including bacterial cells such as E cob ⁇ e g, strain DH5 ⁇ TM (Invitrogen, Carlsbad, CA)), B subtihs and/or other suitable bacteria, eukaryotic cells, such as fungal or yeast cells (e g , Pichi ⁇ p ⁇ stons, Aspergillus sp , S ⁇ cch ⁇ romyces cerevisi ⁇ e,
- the invention relates to a host cell that comprises recombinant nucleic acid(s) encoding an immunoglobulin provided herein (e g , a humanized immunoglobulin, a humanized light chain or a humanized heavy chain, a mouse immunoglobulin, a mouse light chain or a mouse heavy chain, a chimeric immunoglobulin, a chimeric heavy chain, or a chimeric light chain of the invention)
- the invention also relates to a host cell that comprises recombinant nucleic acid(s) encoding an antigen-bmdmg portion of the immunoglobulin or their chains
- the host cell comprises a recombinant vector (e g , expression vector, mammalian cell expression vector) of the invention as referred to herein
- the invention also relates to a method of preparing an immunoglobulin or an immunoglobulin polypeptide chain of this invention In one embodiment, the method comprises maintaining a host cell of the invention
- Selections can be performed using CD52 coupled to DYNABEADS M-270 amine (Dynal) according to the manufacturer's recommendations Alternatively, selections using biotinylated CD52 can be prepared using the primary amine specific reagent succimmidyl-6- (biotinamido) hexanoate following the manufacturer's instructions (EZ link NHS LC Biotin,
- Samples that are able to compete in the high throughput screens may be subjected to DNA sequencing as described m Vaughan et al (1996) and Osburn et al (1996) Clones would then be expressed and purified as scFvs or IgGs and assessed for their ability to bind CD52, neutralize CD52 or a combination thereof, e g , using assays such as antibody-dependent cell mediated cytotoxicity (ADCC) assay and complement dependent cytotoxicity (CDC) assay
- ADCC antibody-dependent cell mediated cytotoxicity
- CDC complement dependent cytotoxicity
- Purified scFv preparations can then be prepared as described in Example 3 of WO 01/66754 Protein concentrations of purified scFv preparations were determined using the BCA method
- the invention is directed to a method of producing a hyb ⁇ doma that secretes a monoclonal antibody that has binding specificity for human CD52 comprising administering lymphocytes of a CD52 transgenic mouse to a non-transgemc mouse having the same strain (e g , CDl) as the human CD52 transgenic mouse, thereby producing an immunized, non-transgemc mouse Splenocytes of the immunized, non-transgemc mouse are contacted with immortalized cells, thereby producing fused cells, and the fused cells are maintained under conditions in which hyb ⁇ domas that secrete a monoclonal antibody having binding specificity for human CD52 are produced, thereby producing a hyb ⁇ doma that secretes a monoclonal antibody that has binding specificity for human CD52 Immunoglobulins Containing a Toxin Moiety or Toxin
- the invention also relates to immunoglobulins that comprise a toxin moiety or toxm
- Suitable toxin moieties comprise a toxin (e g , surface active toxin, cytotoxin)
- the toxin moiety or toxin can be linked or conjugated to the immunoglobulin using any suitable method
- the toxin moiety or toxin can be covalently bonded to the immunoglobulin directly or through a suitable linker
- Suitable linkers can include noncleavable or cleavable linkers, for example, pH cleavable linkers or linkers that comprise a cleavage site for a cellular enzyme (e g , cellular esterases, cellular proteases such as cathepsin B)
- cleavable linkers can be used to prepare an immunoglobulin that can release a toxm moiety or toxm after the immunoglobulin is internalized
- Suitable toxm moieties and toxms include, for example, a maytansmoid (e g , maytansmol, e g , DMl, DM4), a taxane, a calicheamicm, a duocarmycm, or derivatives thereof
- the maytansmoid can be, for example, maytansmol or a maytansmol analogue
- Examples of maytansmol analogs m clude those having a modified aromatic rmg (e g , C-19-decloro, C-20- demethoxy, C-20-acyloxy) and those havmg modifications at other positions (e g , C-9-CH, C- 14-alkoxymethyl, C-14-hydroxymethyl or aceloxymethyl, C-15-hydroxy/acyloxy, C-15- methoxy, C-18-N-demethyl, 4,5-deoxy) Maytansmol and maytansmol analogs are described, for example, m U S Patent Nos 5,208,
- the taxane can be, for example, a taxol, taxotere, or novel taxane (see, e g , WO 01/38318)
- the cahcheamicin can be, for example, a bromo-complex calicheamicm (e g , an alpha, beta or gamma bromo-complex), an lodo-complex cahcheamicin (e g , an alpha, beta or gamma lodo-complex), or analogs and mimics thereof
- Bromo-complex cahcheamicms include H-BR, I2-BR, I3-BR, I4-BR, Jl-BR, J2-BR and Kl-BR lodo-complex cahcheamicms include H-I, I
- Antisense compounds of nucleic acids designed to bind, disable, promote degradation or prevent the production of the mRNA responsible for generating a particular target protein can also be used as a toxin
- Antisense compounds include antisense RNA or DNA, single or double stranded, oligonucleotides, or their analogs, which can hybridize specifically to individual mRNA species and prevent transcription and/or RNA processing of the mRNA species and/or translation of the encoded polypeptide and thereby effect a reduction m the amount of the respective encoded polypeptide Ching, et al , Proc Natl Acad Sci USA 86 10006-10010 (1989), Broder, et al , Ann Int Med 113 604-618 (1990), Loreau, et al , FEBS Letters 274 53- 56 (1990)
- Useful antisense therapeutics include for example Veglm TM (VasGene) and OGX- 011 (Oncogemx)
- Toxins can also be photoactive agents Suitable photoactive agents include porphyrm- based materials such as porf ⁇ mer sodium, the green porphyrins, chlorm E6, hematoporphyrin derivative itself, phthalocyanmes, etiopurpurms, texaphrin, and the like
- the toxin can be an antibody or antibody fragment that binds an intracellular target
- Such antibodies or antibody fragments can be directed to defined subcellular compartments or targets
- the antibodies or antibody fragments can bind an intracellular target selected from erbB2, EGFR, BCR-ABL, p21Ras, Caspase3, Caspase7, Bcl-2, p53, Cyclin E, ATF-1/CREB, HPV16 E7, HPl, Type IV collagenases, cathepsin L as well as others described m Kontermann, R E , Methods, 34 163-170 (2004), incorporated herein by reference m its entirety
- the antibodies of this invention are useful in lmmuno-suppression and lmmuno- ablation
- the antibodies target CD52-expressing cells (e g , T and B cells) and reduce (or
- Lymphocyte depletion may be useful in treating a variety of diseases and conditions such as inflammation, autoimmune diseases and cancer (e g , lymphocyte (either B or T cell) malignancy) See, e g , Reiff, A , Hematology, 10(2) 79-93 (2005)
- diseases and conditions that can be treated with the antibodies or antigen-binding portions of this invention include, without limitation, multiple sclerosis, lupus, rheumatoid arthritis, graft versus host disease (GVHD), inflammatory bowl disease, vasculitis, Behcet's disease, Wegener's granulomatosis, Sjogren's syndrome, uveitis, psoriasis, scleroderma, polymyositis, type I (autoimmune-based) diabetes, autoimmune cytopemas (e g , autoimmune neutropenia, transfusion-dependent refractory PRCA, leukemia
- Antibodies of this invention can be administered to an individual (e g , a human) alone or in conjunction with another agent (e g , an immunosuppressant) in a combination therapy
- the antibody can be administered before, along with or subsequent to administration of the additional agent
- the additional agent is, for example, an anti-inflammatory compound such as sulfasalazine, another non-steroidal anti-inflammatory compound, or a steroidal anti-inflammatory compound
- the additional agent is another lympho-depleting antibody such as another anti-CD52 antibody, an anti-CD20 antibody, an anti-BAFF antibody, an anti- BAFF-R antibody, and the like
- the additional agent is, e g , a cytokine (e g , IL-7), anti-cytokine receptor antibody, or a soluble receptor, that skews, manipulates, and/or augments the reconstitution process that occurs following lymphodepletion mediated by an anti-CD52 antibody (see
- an agent that stimulates neutrophils and NK cells can be administered to a patient, before, during or after anti-CD52 antibody therapy, to augment the antibody therapy
- Stimulating neutrophils and/or NK cells include, without limitation, (1) increasing their rates of division, (2) increasing their cell surface expression of the Fc receptors corresponding to the isotype of the anti-CD52 antibody (e g , Fc ⁇ RIIIa and Fc ⁇ RIIIb, Fc ⁇ RII, Fc ⁇ RI, and Fc ⁇ RI), (3) mobilizing and increasing the number of circulating cells, (4) recruiting the cells to target sites (e g , sites of tumors, inflammation, or tissue damage), (5) and increasing their cytotoxic activity
- agents that stimulate neutrophils and/or NK cells include, for example, granulocyte monocyte
- Regulatory T cells are cells that are capable of inhibiting the proliferation and/or function of other lymphoid cells via contact-dependent or contact-independent (e g , cytokine production) mechanisms
- ⁇ T cells natural killer T (NKT) cells
- CD8 + T cells CD4 + T cells
- double negative CD4 CD8 T cells See, e g , Bach et al , Immunol 3 189-98 (2003) CD4 + CD25 + FoxP3 + regulatory T cells have been referred as "naturally occurring" regulatory T cells, they express CD4, CD25 and forkhead family transcription factor FoxP3 (forkhead box p3)
- an effective amount of anti-CD52 antibody for treating a disease is an amount that helps the treated subject to reach one or more desired clinical end points
- lupus whose manifestations include systemic lupus erythematosus, lupus nephritis, cutaneous lupus erythematosus, CNS lupus, cardiovascular manifestations, pulmonary manifestations, hepatic manifestations, haematological manifestations, gastrointestinal manifestations, musculoskeletal manifestations, neonatal lupus erythematosus, childhood systemic lupus erythematosus, drug-induced lupus erythematosus, anti-phospho lipid syndrome, and complement deficiency syndromes resulting m lupus manifestations, see, e g , Robert G Lahita, Editor, Systemic Lupus Erythematosus, 4th Ed , Elsevier Academic Press, 2004), clinical end
- composition will vary according to the route of administration selected (e g , solution, emulsion)
- An appropriate composition comprising the antibody to be administered can be prepared in a physiologically acceptable vehicle or earner
- the composition can comprise multiple doses or be a single unit dose composition.
- suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including salme and buffered media
- Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils
- Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers (See, generally, Remington s
- the immunoglobulins of the present invention also are useful in a variety of processes with applications in research and diagnosis For instance, they can be used to detect, isolate, and/or purify human CD52 or variants thereof (e g , by affinity purification or other suitable methods such as flow cytometry, e g , for cells, such as lymphocytes, in suspension), and to study human CD52 structure (e g , conformation) and function
- a suitable dispenser for administration e g , an atomizer, nebulizer or pressurized aerosol dispenser
- diagnostic methods and Compositions e.g , an atomizer, nebulizer or pressurized aerosol dispenser
- the immunoglobulins of the present invention can be used in diagnostic applications (e g , in vitro, ex vivo) For
- the immunoglobulins can be used to examine tissues after treatment with a depleting anti-CD52 therapeutic antibody to gauge how effective the depletion has been as well as to determine whether there has been any downregulation in the expression of CD52 (Rawstrom et al , Br J Heam , 107 148-153 (1999))
- the mouse anti-human CD52 antibodies m the following working examples were generated by immunizing CDl strain mice with splenocytes from human CD52 transgenic mice with a CDl background (FIG IA), where display of human CD52 on the surface of mouse B and T cells of the transgenic mice was verified by flow cytometry Because the transgenic mice had the same background (CDl) as the immunized mice, splenocytes from the transgenic mice presented human CD52 at the cell surface as a unique, non-self antigen m a native format, and the immunized nontransgemc mice mounted an antibody response primarily towards the human CD52
- mice were euthanized, spleens were harvested and single cell suspensions were prepared by passing through a syringe CDl mice were then immunized with the collected human CD52 positive spleen cells at 5x10 6 in 100 ⁇ l per mouse with or without Freund's Complete Adjuvant by intraperitoneal (i p ) injection Mice were given two booster doses every two weeks after first immunization with transgenic mouse human CD52 positive spleen cells at 5xlO 6 in 100 ⁇ l per mouse with Freund's Incomplete Adjuvant, ip
- Clones 8G3 25 3 5, 4G7 F3, 9D9 A2, l lCl l C5, 3G7 E9, 5F7 1 1 4, 12G6 15 1 2, 23E6 2 2 1, 2C3 3 8 1, 7Fl 1 1 9 7 and 4B10 1 2 4 are hereafter referred to as 8G3, 4G7, 9D9, 1 ICl 1, 3G7, 5F7, 12G6, 23E6, 2C3, 7Fl 1 and 4B10, respectively Table 7 1: SEQ ID NOs of the CDRs of the Anti-Human CD52 Antibodies
- PCR polymerase chain reaction
- Lead-ML kappa 5 ' ATGGGC WTC AARATGRARWC WCAT 3 ' (Forward primer m leader sequence) (SEQ ID NO: 75)
- VK-MK 5 ' GAY ATTGTGMTS ACMC ARWCTMCA 3 ' (Forward primer in the frame work 1) (SEQ ID NO: 78)
- MKC-Const 5 ' GGATACAGTTGGTGCAGCATC 3 ' (Reverse primer in constant region) (SEQ ID NO: 79)
- MH-SP-ALTl 5' ATGRASTTSKGGYTMARCTKGRTT 3' (Forward primer in leader sequence) (SEQ ID NO: 80)
- MH-SP-ALT2 5' ATGRAATGSASCTGGGTYWTYCTCT 3' (Forward primer m leader sequence) (SEQ ID NO: 81)
- MH-FRl-I 5' SAGGTGMAGCTCSWRSARYCSGGG 3' (Forward primer in the frame work 1) (SEQ ID NO: 83)
- MH-J2 5' TGAGGAGACTGTGAGAGTGGTGCC 3 ' (Reverse primer in J region) (SEQ ID NO: 84)
- VH MH5 5' CAGGTCCAACTVCAGCARCC 3'(Forward primer m the frame work 1) (SEQ ID NO: 90)
- VH MH6 5' GAGGTGAASSTGGTGGAATC 3'(Forward primer in the frame work 1) (SEQ ID NO: 91)
- VH MH7 5 ' GATGTGAACTTGGAAGTGTC 3 '(Forward primer m the frame work 1) (SEQ ID NO: 92)
- IgGl 5' ATAGACAGATGGGGGTGTCGTTTTGGC 3' (Reverse primer in mouse IgGl CHl constant region) (SEQ ID NO: 93)
- IgG2A 5 ' CTTGACCAGGCATCCT AGAGTCA 3 ' (Reverse primer in mouse
- IgG2B 5' AGGGGCCAGTGGATAGAGTGATGG 3' (Reverse primer in mouse
- Functional chimeric anti-CD52 antibodies were produced by joining the heavy chain and light chain variable regions to the DNA encoding human IgGl heavy chain (identical sequence to that found in Campath-1H ® ) and human kappa light chain constant region (identical sequence to that found in Campath-IH ® ), respectively
- pCEP4 Invitrogen
- the light chain variable sequence was PCR amplified and engineered by ligase independent cloning into the pCEP4 LIC light chain vector to have the human kappa signal sequence in the 5' end and the light chain constant region m the 3 'end
- the variable region of the heavy chain sequence was engineered by ligase independent cloning into the pCEP4 LIC heavy chain vector to have the human kappa chain signal sequence in the 5' end and the heavy chain constant region encompassmg CHl, hinge, CH2 and CH3 regions in
- pCEP4 LIC vector was digested with BfuAl(New England Biolabs-NEB) in appropriate buffer following the manufacturer's recommendations and after complete digestion, the vector was purified using PureLink PCR Purification Kit (Invitrogen) The linearized plasmid was then treated with T4 DNA polymerase (New England Bio labs) to generate single- stranded ends and was used to clone the variable region fragment Heavy chain specific pCEP4 LIC vector was used for cloning heavy chain variable region and light chain specific pCEP4 LIC vector was used for cloning light chain variable region Variable region insert was generated by PCR using pCR2 1-TOPO heavy chain variable region containing plasmid or pCR2 1-TOPO light chain variable region containing plasmid as template and primers that contain variable chain specific sequence and vector overhangs VENT DNA polymerase (New England Bio labs) was used for PCR amplification of the insert PCR-amplified insert was gel purified and
- the epitope specificities of the clones were determined by assessing the ability of the chimeric antibodies to bind to a panel of cell lines engineered to express mutants of human CD52 (FIG 4) generated by alanine scanning mutagenesis
- Antibody substitution of the first 10 amino acids of the 12 amino acid extracellular region of CD52 was conducted on human CD52 cDNA m pcDNA3 1 expression vector (Invitrogen) using the STRAT AGENE QUIKCHANGE II XL site-directed mutagenesis kit pcDNA3 1 vector encoding wild type or mutant CD52 sequence was sequence-verified and transfected into CHO cells using LipofectamineTM and by selecting in media containing G418 to generate CHO cell lines that expressed wild type or alanine mutant CD52
- Epitope specific binding of anti-human CD52 chimeric antibodies was determined by measuring the binding of the antibodies against the wild type and mutant CD52 expressing cells by FACS FACS analysis was carried out by detecting the binding of chimeric anti-CD52 antibodies
- FIGS 5A-5C show the Mean Fluorescence Intensity (MFI) of anti- CD52 monoclonal antibodies to wild type and mutant CD52 expressing cell lines
- MFI Mean Fluorescence Intensity
- CD52 is an extremely small antigen but possesses a relatively large, hydrophilic relinked glycan moiety as well as a hydrophobic GPI-anchor
- samples of affinity purified CD52 from CHO-CD52 cells were treated with the endoglycosidase, PNGase-F, to completely remove N-linked sugars from the antigen Treated and mock-treated control samples were then resolved by SDS-PAGE, blotted to polyvmylidene fluoride (PVDF) membrane (Invitrogen), probed with 3 ⁇ g/ml final of each of the anti-CD52 chimeric monoclonal antibodies indicated, and subsequently developed according to standard western blotting procedures using enhanced chemiluminescent detection Blots with Campath-1H® (ClH) and with secondary antibody alone (2° Alone) were run as positive and negative controls, respectively, and probed with each of the mono VDF
- a complement-dependent cytotoxicity (CDC) assay was performed as described ⁇ below Briefly, CHO Kl cells engineered to express CD52 protein (CHO-CD52) were used as target cells and labeled with Na 2 51 CrO 4 (New England Nuclear, Boston, MA) at 37°C for 1-2 hrs The cells were washed, resuspended with X- Vivo media, and mixed with anti-human CD52 antibodies to final concentration of 2 2 ⁇ g/ml Human complement (Sigma) was added to the experimental wells to a final concentration of 10% After a 1-5-hour incubation, 25 ⁇ l of cell- free supernatant was collected from each well and counted in a MICROBETA TRILUX Scintillation Counter (Wallac, Gaithersburg, MD) The amount Of 51 Cr spontaneously released was obtained by incubating target cells in medium alone Spontaneous release from target cells was typically less than 20% The total amount Of 51 Cr incorporated was determined by adding 1% Triton X-
- ADCC antibody-dependent cytotoxicity
- Figs 9A-9C show the level of CD4 T cells, CD8 T cells and CD19 B cells in the blood 72 hours after dosmg with the chimeric antibodies
- Figs lOA-lOC show the level of CD4 T cells, CD8 T cells and CD19 B cells in the spleen 72 hours after dosing
- FIG 14 shows the percent survival of the mice after treatment
- Example 13 Analysis of the Efficacy of Chimeric Anti-CD52 Antibodies in a Xenograft Tumor Model (2C3 and 11C11)
- Example 14 Generation and Analysis of Humanized Anti-CD52 Antibody 4B10
- Humanized anti-human CD52 antibody 4B10 was generated by grafting the CDR regions from the mouse 4B10 antibody into a human antibody variable region framework
- Mouse 4B10 heavy chain and light chain sequences were evaluated by a web-based sequence alignment in order to identify a human germline heavy chain and light chain framework sequence that would serve as a suitable acceptor for the CDR graft (FIG 16)
- the residues defining the CDR regions by Kabat and IMGT® were superimposed into human framework regions that have high sequence identity to generate humanized heavy chain and light chain sequences
- Visual inspection and sequence analysis of the superimposed 4B10 heavy and light chain sequences was carried out to identify the most suitable acceptor sequence Of all the germline sequences that have high similarity, the VH3-72 germline sequence for heavy chain and the VK2-A18b for light chain (human germ line sequences can be found at the website described in the publication by Tomlinson, IM, et al
- Example 15 Assessment of the Binding Activities of Chimeric and Humanized 4B10 Monoclonal Antibodies
- Chimeric and humanized 4B10 antibodies were produced and purified as described in Example 3 and analyzed for their ability to bind to the B cell line B 104, which endogenously expresses CD52, by FACS Briefly, 2 x 10 5 B104 cells were incubated with antibody (0 02 ⁇ g/ml to 16 7 ⁇ g/ml) in PBS containing 5% fetal bovine serum and 5% goat serum. The bound antibody was detected with FITC labeled goat anti-human secondary antibody which detected chimeric or humanized anti-CD52 antibodies Labeled cells were analyzed using a
- FIG 18 shows the fold increase in Geometric mean fluorescence intensity of each sample normalized (divided) to that of 2°-only sample
- the results indicate that the humanized 4B10 antibody bound as well or slightly better than chimeric 4B10 antibody to CD52 expressing cells
- Example 16 Assessment of the ADCC Activities of Chimeric and Humanized 4B10 Monoclonal Antibodies
- Humanized and chimeric 4B10 antibodies were evaluated for their ability to mediate ADCC killing of CD52-expressmg cells
- An ADCC assay was carried out as described above in Example 6 Briefly, CHO Kl cells engineered to express CD52 protein (CHO-CD52) were used as target cells and labeled with Na 2 51 CrC ⁇ (New).
- Example 18 Analysis of Pharmacokinetic Profile of Chimeric And Humanized Anti-CD52 Antibodies in CD52 Transgenic Mice (12G6, 7F11, Chimeric And Humanized 4B10) [0444] Human CD52 transgenic mice were administered one of Campath®, 12G6, 7Fl 1, and chimeric and humanized 4B10 anti-CD52 antibodies to examine the level of lymphocyte depletion Mice were injected intravenously with one of those antibodies in a 100 ⁇ l volume at a dose of 1 mg/kg For analysis of anti-antibody responses, 100 ⁇ l of blood was collected into serum separator tubes via puncture of the retro-orbital plexus at 2 hours, 1, 2, 4, 7, and 10 days post antibody injection ELISA analysis was used to determine the level of circulating human IgGl in each serum sample Based on circulating levels of antibody, there appears to be little to no difference between Campath®, 7Fl 1, and the chimeric and humanized forms of 4B10 The 12G6 antibody displayed lower cmax values following injection, suggesting that this antibody may be degrade
- Humanization of anti-human CD52 antibody clone 7Fl 1 was performed by grafting the CDR regions from the mouse 7Fl 1 antibody into a human antibody variable region framework as described in Example 14 for 4B10 antibody humanization CDR-I, CDR-2, and CDR-3 sequences of the heavy chain and light chain of 7Fl 1 were grafted into VH3-72 and VK2 A18b human framework regions, respectively
- the human JH6 (WGQGTTVTVSS SEQ ID NO 133) and JK2 (FGQGTKLEIK SEQ ID NO 134) sequences were selected as the C- terminal peptides for the humanized heavy and light chains, respectively, to generate humanized heavy chain (7Fl 1-SFDl and 7Fl 1-SFD2) and humanized light chain (7Fl 1-VK2) variable region sequences for 7Fl 1 (FIG 24)
- the two humanized heavy chain variable region sequences (7Fl 1-SFDl and 7Fl 1-SFD2) differ by one amino acid residue in the CDR-3 region
- Chimeric and humanized 7Fl 1 antibodies (7Fl 1-SFD1/K2 and 7Fl 1-SFD2/K2) were 10 produced and purified using the methods described m Example 3, and analyzed for their ability to bind to CD52 expressed on the surface of CHO-CD52 cells (CHO cells engineered to express human CD52) by flow cytometry Briefly, 2 x 10 5 CHO-CD52 cells were incubated with an antibody at 10 ⁇ g/ml in PBS containing 5% fetal bovine serum and 5% goat serum Bound antibody was detected with a FITC-labeled goat anti-human secondary antibody which detected 15 chimeric or humanized anti-CD52 antibodies Labeled cells were analyzed using a
- FIG 25 compares the levels of CD52 detected with chimeric and humanized 7Fl 1 antibodies The results indicate that the humanized 7Fl 1 antibodies bound as well or slightly better than the chimeric 7Fl 1 antibody to CD52 20 expressing cells
- Example 24 Assessment of the Binding Activities of Chimeric and Humanized 2C3 Monoclonal Antibodies
- Chimeric and humanized 2C3 antibodies were produced and purified using the methods described in Example 3
- a number of the humanized antibodies produced by pairing heavy chain variants with light chain variants, and a corresponding chimeric antibody, were analyzed by flow cytometry for their ability to bind to CD52 expressed on the surface of CHO-CD52 cells, using the methods described in Example 22
- the binding data suggest that clones generated by pairing heavy chain variants with light chain variants 2C3-VK1 or 2C3-VK11 had reduced binding ability, while clones generated by pairing heavy chain variants with 2C3-VK12 or 2C3-VK13 showed binding equivalent to or better than that of a chimeric 2C3 antibody
- a representative histogram of selected clones compares the level of CD52 detected by chimeric and humanized 2C3 antibodies Binding of 2C3-SFD1/K1 is reduced significantly compared
- Example 28 Assessment of the Binding Activities of Chimeric and Humanized 9D9 Monoclonal Antibodies
- Chimeric and humanized 9D9 antibodies were produced and purified using the methods described m
- Example 3 A number of the humanized antibodies produced by pairing heavy chain variants with light chain variants, and a corresponding chimeric antibody, were analyzed by flow cytometry for their ability to bind to CD52 expressed on the surface of CHO- CD52 cells (CHO cells engineered to express human CD52), using the methods described m
- the binding data suggest that clones generated by pairing heavy chain variants with light chain variants 9D9-VK2, 9D9-VK14, or 9D9-VK15 had reduced binding ability, while clones generated by pairing 9D9-VK12 or 9D9-VK13 light chain variants with back mutated heavy chain variants 9D9-VH11, 9D9-VH15, 9D9-VH16, and 9D9-VH18 showed binding equivalent to or better than that of the
- Example 29 Determination of Relative Binding Efficiency of Humanized Anti-Human CD52 Antibodies.
- CD4+ T cells isolated from healthy donor PBMCs obtained from commercial sources (Bioreclamation, NY, USA) CD4+ T cells were isolated by negative selection using an EasySep kit (Stem Cell Technologies) CD4+ T cells isolated from huCD52 transgenic CDl mouse spleen tissue were also used (Stem Cell Technologies) according to the methods described above m Example 20 for CHO-CD52 cells Briefly, human CD4+ T cells were isolated from 50 ml of peripheral blood from healthy volunteers (Bioreclamation), and huCD52 transgenic mouse CD4+ T cells were isolated from spleen tissue Cells were rinsed with
- Campath-1H® (ClH) and humanized 2C3 (2C3-SFD1/K12), 9D9 (9D9-H16/ K13 and 9D9-H18/K13), and 12G6 (12G6-SFD1/K11, 12G6-SFD1/K12) antibodies were evaluated for their binding to various PBMC subsets in normal donor PBMCs using the methods described above m
- Example 7 for chimeric anti-CD52 antibodies A number of fluorochrome conjugated antibodies were used for flow cytometric analysis
- Anti-CD27-PE, anti-CD19 and anti-CDl Ic- PE Cy5, anti-CD56 and anti-CD123-PE Cy7, anti-CD16-APC Cy7, and CD4-APC were obtained from BD Biosciences (San Diego, CA), while anti-CD54RA-ECD and anti-HLA-DR- ECD were obtained from Beckman Coulter Anti-CD3-Pacific Blue, anti-CD8 and anti-CD14- Pacif ⁇ c Orange, and anti
- lymphocyte cocktail comprised antibodies against CD3, CD27, CD45RA, CD56, CD19, CD8, CD4, and CD16
- the antibody cocktail to define myeloid populations included antibodies against HLA-DR, CDl Ic, CD123, CD4, and CD14
- one of the anti- CD52 antibodies was included at 10 ⁇ g/ml concentration
- the cells were stained for 30 mm at 4 0 C and were washed and fixed in PBS containing 1% paraformaldehyde 100,000 events of the stained cells were acquired on a BD LSR II flow cytometer (BD Biosciences, San Jose, CA), and the data was analyzed using Flow Jo version 7 2 software (Tree Star, Inc, Oregon, USA) Multiple subsets with distinct phenotypic characteristics have been defined among B and T lymphocytes, and CD
- Humanized and chimeric 7Fl 1 antibodies were evaluated for their ability to mediate ADCC killing of CD52 expressing cells
- An ADCC assay was carried out using the methods described above m Example 6 Briefly, CHO Kl cells engineered to express CD52 protein (CHO-CD52) were used as target cells The target cells were labeled with Na 2 51 CrC ⁇ (New England Nuclear, Boston, MA) at 37 0 C for 2-3 hrs The cells were washed, re-suspended m RPMI 1640 media with 10% FCS, and mixed with an IgG control antibody, a chimeric 7Fl 1 antibody, or a humanized 7Fl 1 antibody (7Fl 1-SFD1/K2 or 7Fl 1-SFD2/K2) at various concentrations ranging from 5 ⁇ g/ml to 0 01 ⁇ g/ml Human NK cells isolated from PBMCs using an NK cell isolation kit (Stem Cell Technologies) were used as effector cells and were added at a 1 5 target to effector cell ratio After 2-6
- CHO Kl cells engineered to express CD52 protein were used as target cells and labeled with Na 2 51 CrO 4 (New England Nuclear, Boston, MA) at 37°C for 2-3 hrs
- the cells were washed, resuspended in RPMI 1640 media, and mixed with an IgG control antibody, a chimeric 7Fl 1 antibody, or a humanized 7Fl 1 antibody (7Fl 1-SFD1/K2 or 7Fl 1-SFD2/K2) at various concentrations ranging from 20 ⁇ g/ml to 500 ng/ml Human complement (Sigma) was added to the experimental wells to a final concentration of 10%
- 25 ⁇ l of cell-free supernatant were collected from each well and counted in a MicroBeta T ⁇ lux Scintillation Counter (Wallac, Gaithersburg, MD)
- the amount Of 51 Cr spontaneously released was obtained by incubating target cells in medium alone Spontaneous release from target cells was typically
- Humanized and chimeric 2C3 antibodies were evaluated for their ability to mediate ADCC killing of CD52 expressing cells
- An ADCC assay was carried out using the methods described above in Example 6, with slight modifications Briefly, T cells isolated from healthy donor PBMCs using a CD4+ T cell isolation kit (Stem Cell Technologies) were used as target cells The target cells were labeled overnight with Na 2 51 CrO 4 (New England Nuclear, Boston, MA) at 37 0 C The cells were washed, re-suspended m RPMI 1640 media with 10% FCS, and mixed with an IgG control antibody, a chimeric 2C3 antibody, or a humanized 2C3 antibody (2C3-SFD1/K12) at various concentrations ranging from 10 ⁇ g/ml to 100 pg/ml Human NK cells isolated from PBMCs (using an NK cell isolation kit from Stem Cell Technologies) were used as effector cells and were added at a 1 5 target to effector cell ratio After 2-6 hrs of incubation
- control IgG concentrations of control IgG, chimeric 2C3 antibody, and humanized 2C3 antibody (2C3-SFD1/K12) used in the assay (X axis) vs % specific lysis (Y axis)
- the results indicate that the chimeric 2C3 antibody and the humanized 2C3 antibody (2C3-SFD1/K12) mediated equivalent lysis
- the control IgGl isotype antibody showed only low levels of background killing at the concentrations tested
- FIG 39 illustrates the concentrations of control IgG, chimeric 12G6 antibody, and humanized 12G6 antibodies (12G6-SFD1/K11 or 12G6-SFD1/K12) used in the assay (X axis) vs % specific lysis (Y axis)
- the results indicate that humanized 12G6 antibodies 12G6- SFD1/K11 and 12G6-SFD1/K12 mediated equivalent ADCC killing as compared to the 12G6 chimeric antibody
- the IgGl isotype control showed only low levels of background killing at
- FIG 40 illustrates the concentrations of control IgG, chimeric 12G6 antibody, and humanized 12G6 antibodies (12G6-SFD1/K11 and 12G6- SFD1/K12) used m the assay (X axis) vs % specific lysis (Y axis)
- the results indicate that the chimeric 12G6 antibody mediated equivalent lysis as compared to humanized 12G6 antibodies (12G6-SFD1/K11 and 12G6-SFD1/K12)
- the control IgGl isotype antibody showed only low levels of background killing at the concentrations tested
- FIG 41 illustrates the concentrations of control IgG, chimeric 9D9 antibody, and humanized 9D9 antibodies (9D9-H10/K13, 9D9-H11/K13, 9D9-H16/K13, and 9D9-H18/K13) used in the assay (X axis) vs % specific lysis (Y axis)
- the results indicate that the chimeric and humanized 9D9 antibodies (with the exception of 9D9-H10/K13) mediated equivalent ADCC killing
- the IgGl isotype control showed only low levels of background killing at the concentrations tested
- FIG 42 illustrates the concentrations of control IgG, chimeric 9D9 antibody, and humanized 9D9 antibodies (9D9-H10/K13, 9D9-H11/K13, 9D9- H16/K13, and 9D9-H18/K13) used m the assay (X axis) vs % specific lysis (Y axis)
- the results indicate that a chimeric 9D9 antibody mediated equivalent lysis as compared to humanized 9D9 antibodies (with the exception of 9D9-H10/K13)
- the control IgGl isotype antibody showed only low levels of background killing at the concentrations tested
- Example 39 Assessment of the ADCC Activities of Campath-1H® and Humanized Anti-
- anti-CD52 antibodies (Campath- 1H®, 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 ) were reacted with human serum containing anti-Campath-lH® antibody reactivity and evaluated for binding to CD52 expressing Raji cells Serum samples obtained from relapsing remitting multiple sclerosis patients who were enrolled m the CAMMS223 study (The CAMMS223 Trial Investigators, "Alemtuzumab vs interferon Beta-la in early multiple sclerosis," N Engl J Med 359 1786-1801 (2008)) were used in the assay Repeated administration of the Campath-1H® antibody resulted in generation of anti-Campath-lH® antibody responses in most patients The anti-Campath-lH antibody titer is very low at month 12 in
- lymphocyte levels in the 0 5 and 0 1 mg/kg dosed groups had rebounded to the levels of untreated mice
- lymphocytes had returned to normal levels by 50 and 80 days, respectively, for clone 7Fl 1-SFD1/K2 and by 80 days post dosing for both the 1 0 and 5 0 mg/kg groups of clone 7Fl 1-SFD2/K2
- Total lymphocytes were monitored for repopulation m the blood
- FIGS 5OA-5OE show the level of CD4+ T cells, CD8+ T cells and B220+ B cells in the blood 72 hours after dosing with the humanized 7Fl 1-SFD1/K2 ("7Fl 1 SFDl") and 7Fl 1-SFD2/K2 (“7Fl 1 SFD2”) antibodies
- FIGS 51 A-5 IE show the level of CD4+ T cells, CD8+ T cells and B220+ B cells in the spleen 72 hours after dosing with the humanized 7F11-SFD1/K2 ("7Fl 1 SFDl") and 7F11-SFD2/K2 (“7Fl 1 SFD2”) antibodies
- FIGS 52A-52F show the levels of circulating cytokines 2 hours after dosing with the humanized 7Fl 1-SFD1/K2 (“7Fl 1 SFDl") and 7F11-SFD2/K2 (“7Fl 1 SFD2”) antibodies
- FIGS 53A-53B show the repopulation of circulating lymphocytes over
- FIGS 54A-54B show the level of CD4+ T cells, CD8+ T cells and B220+ B cells m the blood 72 hours after dosing with Campath-1H® ("Campath"), 7Fll-chime ⁇ c antibodies, and humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies
- Campath-1H® Campath
- 7Fll-chime ⁇ c antibodies humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies
- Example 45 Analysis of PK Profiles of Anti-CD52 Antibodies in CD52 Transgenic Mice (7F11-SFD1/K2 and 7F11-SFD2/K2)
- FIG 55 shows the level of Campath-1H® ("Campath"), 7Fl 1-chime ⁇ c antibody and humanized 7Fl 1-SFD1/K2 and 7Fl 1-SFD2/K2 antibodies in the blood
- Example 46 Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in huCD52 transgenic mice (2C3-SFD1/K12)
- FIGS 56A-56E show the level of CD4+ T cells, CD8+ T cells and B220 B cells in the blood 72 hours after dosing with 2C3-SFD1/K12 antibodies
- FIGS 57A-57E show the level of CD4+ T cells, CD8+ T cells and B220+ B cells m the spleen 72 hours after dosmg with
- FIGS 58A-58F show the levels of circulating cytokines 2 hours after dosing with 2C3-SFD1/K12 antibodies
- FIG 59 shows the repopulation of circulating lymphocytes over a timecourse after dosing with 2C3-SFD1/K12 antibodies
- FIGS 60A-60E show the level of CD4+ T cells, CD8+ T cells and B220+ B cells in the blood 72 hours after dosing with 12G6-SFD1/K11 antibodies
- FIGS 61 A-61E show the level of CD4+ T cells, CD8+ T cells and B220+ B cells m the spleen 72 hours after dosing with 12G6-SFD1/K11 antibodies
- FIGS 62A-62F show the levels of circulating cytokines 2 hours after dosing with 12G6-SFD1/K11 (“12G6 hu”) antibodies
- FIG 63 shows the repopulation of circulating lymphocytes over a timecourse after dosing with 12G6-SFD1/K11 antibodies
- FIGS 64A-64C show the level of 2C3-chime ⁇ c, 2C3-SFD1/K12, 12G6-chime ⁇ c, 12G6-SFD1/K11, 9D9-chime ⁇ c, and 9D9-H10/K12antibodies in the blood over a timecourse after dosmg
- Example 49 Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in huCD52 Transgenic Mice (9D9-H10/K12)
- T and B cell subset analysis was performed to determine the overall depleting effect All of the humanized antibodies (2C3-SFD1/K12, 12G6-SFD1/K11 and 9D9-H10/K12) mediated depletion of lymphocytes withm the spleen and blood when compared with PBS treated animals Depletion was more robust in the blood than the spleen for all antibodies, and the depletion was dose-dependent in both tissues Depletion was most dramatic for CD4 and CD8+ T cells with less depletion in the B cell compartment Various T and B cell subsets were depleted to differing degrees Naive T cells (both CD4 and CD8) demonstrated the most depletion compared to other cell populations (including memory and T reg cells), which were depleted to a lesser degree In the B cell compartment,
- FIGS 69A-69D show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T cell and B220+ B/NK cell subtypes in the blood 72 hours after dosing with Campath-1H® ("Campath”), 2C3-SFD1/K12 ("2C3"), 12G6-SFD1/K11 (“12G6"), and 9D9-H10/K12 (“9D9”) antibodies
- FIGS 70A-70D show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T cell and B220+ B/NK cell subtypes m the spleen 72 hours after dosmg with Campath-1H® ("Campath”), 2C3-SFD1/K12 (“2C3”), 12G6-SFD1/K11 (“12G6”), and
- FIGS 71A-71F show the levels of circulating cytokines 2 hours after dosing with Campath-1H®, 2C3-SFD1/K12, 12G6-SFD1/K11, and 9D9-H10/K12 antibodies
- Example 51 Direct Comparison of Anti-huCD52 Humanized 9D9 Clones in huCD52 Transgenic Mice (9D9 H10/K12 and 9D9 Hl 1/K12)
- FIG 72 shows the level of CD4+ T cells, CD8+ T cells, B220+ B cells, and NK cells in the blood 72 hours after dosing with 9D9-H10/K12 and 9D9-H11/K12 antibodies
- FIG 73 shows the level of CD4+ T cells, CD8+ T cells, B220+ B cells, and NK cells m the spleen 72 hours after dosing with 9D9-H10/K12 and 9D9-H11/K12 antibodies
- Example 52 Direct Comparison of Anti-huCD52 Humanized 12G6 Clones in huCD52 Transgenic Mice (12G6-SFD1/K11 and 12G6-SFD1-K12)
- FIGS 75A-75D show the level of CD4+ T cells, CD8+ T cells, B220+ B/NK cells, and myeloid cells in the spleen 72 hours after dosing with 12G6-SFD1/K11 ("12G6 KI l") and 12G6-SFD1/K12 ("12G6 K12") antibodies
- 12G6-SFD1/K11 12G6 KI l
- 12G6-SFD1/K12 12G6 K12
- Example 53 Direct Comparison of Anti-huCD52 Humanized 9D9 Clones in huCD52 Transgenic Mice (9D9 H11/K12, 9D9 H16/K13, and 9D9 H18/K13)
- FIG 76 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) in the blood 72 hours after dosmg with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- FIGS 77A-77D show the level of CD4+ T cell, CD8+ T cell, B220+ B/NK cell, and myeloid cell subtypes in the blood 72 hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- FIG 78 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) m the spleen 72 hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- FIGS 79A-79D show the level of CD4+
- FIGS 81A-81B show the level of 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 and 9D9-H18/K13 antibodies in the blood over a timecourse after dosmg TABLE 16
- FIGS 84A-84G show the repopulation of circulating CD4+ and CD8+ T cells, regulatory T cells, B cells, NK cells, neutrophils and macrophages over a timecourse after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- FIGS 86A-86E show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell, CD8+ T cell, B220+ B/NK cell, and myeloid cell subtypes in the blood 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies
- Campath-1H® (“Campath")
- 15 87A-87E show the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and
- FIGS 88A- 88C show the levels of circulating cytokines 2 hours after dosing with Campath-1H®
- Example 59 In Depth Depletion of Lymphocytes in huCD52 Transgenic Mice Following Single Dose Treatment With Anti-huCD52 Antibodies
- FIGS 89A-89D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes m the blood 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- FIGS 90A-90D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in the spleen
- FIGS 91 A-91D show the level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in the lymph node 72 hours after dosing with Campath-1H® ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies
- Example 60 Creation and Evaluation of the huCD52 Knock-in/Knock-out (KI/KO)
- FIG 92A shows the huCD52 expression level on CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in huCD52-KI/KO and non-transgemc control mice
- FIG 92B shows the huCD52 expression level on CD4+ T cells, CD8+ T cells, and B cells m huCD52-KI/KO and huCD52 CDl transgenic mice
- Example 61 Direct Comparison of Depletion Characteristics Between Small and Large Scale Lots of 12G6 and 2C3 [0520] huCD52 KI/KO transgenic mice were dosed with 12G6-SFD1/K12 or 2C3-SFD1/K12 to determine the depleting activity In addition, activity was examined using antibodies generated from two different sources (small scale and large scale lots) at Genzyme Mice were injected i v with each antibody at 1 mg/kg Three days post injection, mice were sacrificed, and blood was collected for flow cytometry analysis to determine the levels of circulating CD4+ and CD8+ T cells, B cells, NK cells, neutrophils and macrophages No significant differences m depletion of CD4 T cells, CD8+ T cells, B cells, and NK cells were observed between the small scale and large scale lot derived antibodies
- FIGS 93A-93B show binding to huCD52 of 12G6-SFD1/K12 and 2C3-SFD1/K12 antibodies (from various production sources) as compared to a Campath-1H® control
- FIG 94 shows the level of bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B cells) m the blood 72 hours after dosmg with 12G6-SFD1/K12 and 2C3-SFD1/K12 antibodies
- Example 62 Analysis of PK Profile for Anti-CD52 Antibodies in huCD52-KI/KO Transgenic Mice
- FIGS 95A-95B show the levels of 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies in the blood over a timecourse after dosmg
- Example 63 Evaluation of 12G6 and 2C3 Pretreatment on EAE in huCD52-KI/KO Transgenic Mice
- the efficacy of anti-CD52 antibody treatment on reducing the overall disease incidence and severity of Experimental Autoimmune Encephalomyelitis (EAE) was evaluated in huCD52 KI/KO mice huCD52-KI/KO mice were treated with a course of either 2C3-SFD1/K12 or 12G6-SFD1/K12 on days -5 thru -1 EAE (a model of multiple sclerosis) was induced by immunization with MOG35-55 peptide emulsified m CFA, and treatment with pertussis toxin, on days 0 and 2 Vehicle treated mice began to display signs of paralysis by day
- the FcRn molecule is expressed on vascular endothelium and is believed to be the mam site of IgG recycling
- the FcRn binds to the antibody Fc portion which then becomes internalized withm a cell
- Antibodies that have high affinity interactions with the FcRn will be recycled back to the surface of the cell and will be released back into circulation
- Antibodies that have lower affinity interactions dissociate within the cell and ultimately degrade Site directed mutagenesis to increase the interaction with FcRn generates an antibody that can be maintained m circulation for longer periods of time compared to an unmodified antibody
- mutations withm the Fc region of an antibody that decrease FcRn binding shorten the circulating half-life of the antibody Mutations that have been described to decrease binding to FcRn resulting in shorter
- 2C3-SFD1/K12-Modified 1 and 2C3-SFD1/K12-Modified 2 antibodies that exhibited decreased binding to the FcRn receptor responsible for maintaining antibodies in circulation The pharmacokinetic profile was determined for the 2C3-SFD1/K12 antibody and the 2C3-SFD1/K12-Modified 1 and 2C3-SFD1/K12-Modified 2 antibodies with reduced FcRn binding C57BL/6 mice were used to evaluate the PK profile in the absence of target antigen (2C3-SFD1/K12 binds to human CD52 but does not cross-react with mouse CD52) Mice were injected i v with antibodies at 1 mg/kg At various timepoints, blood was collected to analyze the level of circulating human IgGl in the mouse serum by ELISA Both 2C3-SFD1/K12- Modified 1 and 2C3-SFD1/K12-Modified 2 antibodies were cleared from the blood faster than the 2C3-SFD1/K12 antibody 2C3-SFD1/K12 had
- FIG 98 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3 unmodified"), 2C3-SFD1/K12-Modified 1 ("2C3-Fc mutant 1") and 2C3-SFD1/K12-Modified 2 ("2C3-Fc mutant 2") in nontransgemc mice Table 17-Summary of Pharmacokinetic Data Across Groups
- Example 66 Evaluation of the Half-Life of Fc Modified Anti-CD52 Antibodies Following LV. Administration in Heterozygous huCD52 Transgenic Mice
- Human CD52 expressed in such mammalian cells can be glycosylated, affecting binding This is not the case for the human CD52 used m the Biacore TlOO assay Table 21 Binding to alanine- scanning mutant hCD52 peptides
- Example 69 Assessment of CD4+ T cell responses induced by Campath-1H® or 12G6- SFD1/K12
- Peptide Peptides encompassing the heavy and light chain variable regions of Campath-1H® and 12G6-SFD1/K12 were synthesized using a Rainin Symphony automated peptide synthesizer using standard Fmoc-chemistry on CLEAR resin (Peptides International, Louisville, KY) Amino acids (EMD Biosciences, San Diego, CA or Anaspec, San Jose, Ca) were orthogonally protected with tert-Butoxycarbonyl (BOC), tert-Butyl (tBu), 2,2,4,6,7- Pentamethyldihydro-benzofi ⁇ ran-5-sulfonyl (Pbf), or T ⁇ tyl (Trt) groups Couplings were performed using an amino acid/HCTU/HOBt/DIEA/resin with a molar ratio of 6 6 3 12 1 A solution of 20% Pipe ⁇ dine and 2 5% l,8-diazabicyclo[5 4 0]undec-7-ene (DBU) m
- DC antigen pulsing and maturation Before treatment with the peptides, DCs were thawed, washed and plated in RPMI (Invitrogen, Carlsbad, CA) supplemented with 5% Human Serum (HS, Sigma, St Louis, MO), 1% Penicillin-Streptomycin (Invitrogen, Carlsbad, CA), 100 ng/ml GM-CSF, and 20 ng/ml IL-4 DCs were plated at 2 x 10 5 cells/ml in 4 ml media in 6-well tissue culture plates and allowed to adhere for 1 hour at 37 0 C Following cell adherence, 10 ⁇ g/ml (40 ⁇ g total) of each peptide were added to wells containing DCs, correlating to either 120 ⁇ g or 160 ⁇ g of total peptides added to each well (Campath-1H® 3-peptide or 4-peptide groups), or 200 ⁇ g or 240 ⁇ g of total peptide added to each well (12G6-SFD
- NNFTVSFWLRVPKVSASHLE (SEQ ID NO 185) were added to one well of DCs Similarly, a heat inactivated adenovirus was employed as a positive antigen source and was added to one well of DCs at 1 ⁇ g/ml Lastly, one group of DCs remained impulsed with antigen and served as a 'null' educated group
- the DCs pulsed with the various antigens were incubated for at least three hours at 37 0 C DCs were then treated with a 'maturating cytokine cocktail' containing 50 ng/ml TNF- ⁇ , 10 ng/ml IL-6, 25 ng/ml IL-I beta (Peprotech, Rocky Hill, NJ) and 500 ng/ml PGE-2 (Sigma Aldrich, St Louis, MO)
- the antigen pulsed DCs were then allowed to mature overnight at 37 0 C
- Proliferation assay DCs were plated, antigen pulsed and matured as stated above at 5 x 10 5 cells/ml in 1 ml media on 24-well low binding plates to ease the subsequent transfer of cells to U-bottom assay plates
- An irrelevant HLA DR binding peptide, CS 378-398 (peptide sequence DIEKKIAKMEKASSVFNVVNS (SEQ ID NO 186)), was used as a negative control (Alexander J, et al , "Development of high potency universal DR-rest ⁇ cted helper epitopes by modification of high affinity DR-blocking peptides," Immunity, 1 751-761 (1994))
- the cells were detached from plates using ice cold PBS washes
- DCs were plated in U-bottom 96 well plates with the antigen stimulated T cells at a 1 I T cell DC ratio (2 5 x 10 4 DC/well)
- Each T cell group was assayed m triplicate with DC pulsed with the educating peptide
- V beta chain expression Cells were thawed and stained with antibodies recognizing 24 conjugated Vbeta family members for 30 minutes following manufacturer's directions m the IOTest Beta Mark Kit (Beckman Coulter, France) After washing with PBS and resuspending m 1% formaldehyde, cells were analyzed on FACScalibur (Becton Dickinson, Franklin Lakes, NJ) The percentage of cells expressing each of the detected V-beta chains was calculated, as summarized m FIG 102 and FIG 103
- V beta and specific proliferative response indicated that BMS486 was a Campath-1H® responder
- the Campath-1H® data was quantified as a 70% (7/10) responder rate
- the total number of peptide groups eliciting an immune response was eight Three of those eight immunogenic peptide groups elicited strong responses in the respective donors with stimulation indices of 3 0 or above (Table 26)
- Table 25 Summary of Stimulation Index Data Table 25A Campath-1H® Stimulation Index
- Example 70 Assessment of CD4+ T Cell Responses induced by 12G6-SFD1/K12
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Rheumatology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Plant Pathology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Oncology (AREA)
- Pain & Pain Management (AREA)
- Transplantation (AREA)
- Hematology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
Priority Applications (24)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10775530A EP2429582A4 (en) | 2009-05-13 | 2010-05-13 | IMMUNOGLOBULINS ANTI-CD52 HUMAN |
| US13/320,019 US8617554B2 (en) | 2009-05-13 | 2010-05-13 | Anti-human CD52 immunoglobulins |
| KR1020167022759A KR20160103160A (ko) | 2009-05-13 | 2010-05-13 | 항-인간 cd52 면역글루불린 |
| MX2011012047A MX2011012047A (es) | 2009-05-13 | 2010-05-13 | Inmunoglobulinas humanas anti-cd52. |
| EP15191351.4A EP2998405B1 (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
| KR1020157036932A KR20160005143A (ko) | 2009-05-13 | 2010-05-13 | 항-인간 cd52 면역글루불린 |
| SG2011083847A SG176060A1 (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
| NZ596384A NZ596384A (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
| CA2761800A CA2761800C (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
| KR1020177026871A KR20170113704A (ko) | 2009-05-13 | 2010-05-13 | 항-인간 cd52 면역글루불린 |
| CN2010800312662A CN102459628A (zh) | 2009-05-13 | 2010-05-13 | 抗人cd52 免疫球蛋白 |
| BRPI1013085-3A BRPI1013085A2 (pt) | 2009-05-13 | 2010-05-13 | imunoglobulinas anti-cd52 humana |
| AU2010249003A AU2010249003B2 (en) | 2009-05-13 | 2010-05-13 | Anti-human CD52 immunoglobulins |
| RU2011150516/10A RU2603743C2 (ru) | 2009-05-13 | 2010-05-13 | Иммуноглобулины k cd52 человека |
| KR1020147020065A KR20140102764A (ko) | 2009-05-13 | 2010-05-13 | 항-인간 cd52 면역글루불린 |
| JP2012511010A JP5894912B2 (ja) | 2009-05-13 | 2010-05-13 | 抗ヒトcd52免疫グロブリン |
| EP19214547.2A EP3683317A3 (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
| IL216141A IL216141B (en) | 2009-05-13 | 2011-11-03 | Immunoglobulins against human 52cd |
| ZA2011/08077A ZA201108077B (en) | 2009-05-13 | 2011-11-03 | Anti-human cd52 immunoglobulins |
| US14/091,083 US20140341910A1 (en) | 2009-05-13 | 2013-11-26 | Anti-human cd52 immunoglobulins |
| US14/864,736 US20160208010A1 (en) | 2009-05-13 | 2015-09-24 | Anti-human cd52 immunoglobulins |
| IL262639A IL262639A (en) | 2009-05-13 | 2018-10-28 | Immunoglobulins against human cd52 |
| US16/380,389 US20200040091A1 (en) | 2009-05-13 | 2019-04-10 | Anti-Human CD52 Immunoglobulins |
| US17/191,440 US11945874B2 (en) | 2009-05-13 | 2021-03-03 | Anti-human CD52 immunoglobulins |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17783709P | 2009-05-13 | 2009-05-13 | |
| US61/177,837 | 2009-05-13 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/320,019 A-371-Of-International US8617554B2 (en) | 2009-05-13 | 2010-05-13 | Anti-human CD52 immunoglobulins |
| US14/091,083 Continuation US20140341910A1 (en) | 2009-05-13 | 2013-11-26 | Anti-human cd52 immunoglobulins |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010132659A2 true WO2010132659A2 (en) | 2010-11-18 |
| WO2010132659A3 WO2010132659A3 (en) | 2011-01-06 |
Family
ID=43085579
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/034704 Ceased WO2010132659A2 (en) | 2009-05-13 | 2010-05-13 | Anti-human cd52 immunoglobulins |
Country Status (19)
| Country | Link |
|---|---|
| US (5) | US8617554B2 (cg-RX-API-DMAC7.html) |
| EP (3) | EP2998405B1 (cg-RX-API-DMAC7.html) |
| JP (4) | JP5894912B2 (cg-RX-API-DMAC7.html) |
| KR (5) | KR101537840B1 (cg-RX-API-DMAC7.html) |
| CN (3) | CN104231084B (cg-RX-API-DMAC7.html) |
| AR (1) | AR076770A1 (cg-RX-API-DMAC7.html) |
| AU (1) | AU2010249003B2 (cg-RX-API-DMAC7.html) |
| BR (1) | BRPI1013085A2 (cg-RX-API-DMAC7.html) |
| CA (2) | CA2761800C (cg-RX-API-DMAC7.html) |
| HK (2) | HK1222682A1 (cg-RX-API-DMAC7.html) |
| IL (2) | IL216141B (cg-RX-API-DMAC7.html) |
| MX (1) | MX2011012047A (cg-RX-API-DMAC7.html) |
| MY (1) | MY160126A (cg-RX-API-DMAC7.html) |
| NZ (2) | NZ621170A (cg-RX-API-DMAC7.html) |
| RU (2) | RU2603743C2 (cg-RX-API-DMAC7.html) |
| SG (2) | SG176060A1 (cg-RX-API-DMAC7.html) |
| TW (3) | TWI529247B (cg-RX-API-DMAC7.html) |
| WO (1) | WO2010132659A2 (cg-RX-API-DMAC7.html) |
| ZA (1) | ZA201108077B (cg-RX-API-DMAC7.html) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012164063A1 (en) * | 2011-06-01 | 2012-12-06 | Antitope Ltd | Humanised anti-cd52 antibodies |
| US20130309244A1 (en) * | 2010-12-21 | 2013-11-21 | Duke University | Methods and compositions combining immunotherapy with monocyte activation |
| WO2014151644A3 (en) * | 2013-03-15 | 2015-01-15 | Genzyme Corporation | Anti-cd52 antibodies |
| EP2700652A4 (en) * | 2011-04-18 | 2015-07-15 | Univ Tokyo | DIAGNOSIS AND TREATMENT OF CANCER BY ANTI-ITM2A ANTIBODIES |
| EP2970496A4 (en) * | 2013-03-12 | 2016-07-27 | Inst Of Arthritis Res Llc | IMMUNOLOGICALLY ACTIVE POLYPEPTIDE |
| US9617343B2 (en) | 2009-05-13 | 2017-04-11 | Genzyme Corporation | Methods and compositions for treating lupus |
| US9669057B2 (en) | 2008-04-25 | 2017-06-06 | Duke University | Regulatory B cells and their uses |
| US10017739B2 (en) | 2012-09-06 | 2018-07-10 | Duke University | Methods of expanding and assessing B cells and using expanded B cells to treat disease |
| WO2018195457A2 (en) | 2017-04-21 | 2018-10-25 | Genzyme Corporation | Treatment of multiple sclerosis with anti-cd52 antibodies |
| US11230598B2 (en) | 2016-12-15 | 2022-01-25 | Duke University | Antibodies and methods for depleting regulatory bio cells and use in combination with immune checkpoint inhibitors |
| US11883432B2 (en) | 2020-12-18 | 2024-01-30 | Century Therapeutics, Inc. | Chimeric antigen receptor system with adaptable receptor specificity |
| US11945874B2 (en) | 2009-05-13 | 2024-04-02 | Genzyme Corporation | Anti-human CD52 immunoglobulins |
| US12221481B2 (en) | 2019-05-21 | 2025-02-11 | Novartis Ag | CD19 binding molecules and uses thereof |
| WO2025031965A1 (en) * | 2023-08-04 | 2025-02-13 | Cimeio Therapeutics Ag | Discernible cell surface protein variants of cd52 for use in cell therapy |
| US12304946B2 (en) | 2018-12-19 | 2025-05-20 | Humabs Biomed Sa | Antibodies that neutralize hepatitis B virus and uses thereof |
| US12404318B2 (en) | 2018-12-20 | 2025-09-02 | Vir Biotechnology, Inc. | Combination HBV therapy |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3559049B1 (en) | 2011-10-28 | 2025-06-11 | Teva Pharmaceuticals Australia Pty Ltd | Polypeptide constructs and uses thereof |
| WO2013185165A1 (en) * | 2012-06-14 | 2013-12-19 | The Walter And Eliza Hall Institute Of Medical Research | Cd-52 antibodies and their use in determining and enhancing an immune response in a subject |
| US20150299315A1 (en) * | 2012-10-22 | 2015-10-22 | Becton, Dickinson And Company | Non-b-lineage cells capable of producing antibody |
| US10501531B2 (en) | 2013-03-13 | 2019-12-10 | Prothena Biosciences Limited | Tau immunotherapy |
| KR102042174B1 (ko) | 2013-03-29 | 2019-11-08 | 삼성전자주식회사 | 인간화 및 친화도 성숙된 항 c-Met 항체 및 그의 용도 |
| KR102060540B1 (ko) * | 2013-04-03 | 2019-12-31 | 삼성전자주식회사 | 항 c-Met 항체 및 항 Ang2 항체를 포함하는 병용 투여용 약학 조성물 |
| CA2908380A1 (en) | 2013-04-09 | 2014-10-16 | Boston Biomedical, Inc. | Methods for treating cancer |
| KR102186363B1 (ko) * | 2013-09-06 | 2020-12-04 | 삼성전자주식회사 | c-Met 저해제 및 베타-카테닌 저해제를 포함하는 병용 투여용 약학 조성물 |
| KR102192591B1 (ko) * | 2013-09-09 | 2020-12-18 | 삼성전자주식회사 | c-Met 저해제 및 c-Myc 저해제를 포함하는 병용 투여용 약학 조성물 |
| TW201717935A (zh) | 2015-06-03 | 2017-06-01 | 波士頓生醫公司 | 用於治療癌症的組成物和方法 |
| MY198194A (en) | 2016-05-02 | 2023-08-09 | Prothena Biosciences Ltd | Antibodies Recognizing Tau |
| MX2018013386A (es) | 2016-05-02 | 2019-02-28 | Prothena Biosciences Ltd | Anticuerpos que reconocen tau. |
| PT3452507T (pt) | 2016-05-02 | 2022-12-20 | Prothena Biosciences Ltd | Imunoterapia anti-tau |
| WO2018102427A1 (en) | 2016-11-29 | 2018-06-07 | Boston Biomedical, Inc. | Naphthofuran derivatives, preparation, and methods of use thereof |
| KR102784294B1 (ko) | 2017-05-02 | 2025-03-19 | 프로테나 바이오사이언시즈 리미티드 | 타우 인식 항체 |
| WO2018213424A1 (en) | 2017-05-17 | 2018-11-22 | Boston Biomedical, Inc. | Methods for treating cancer |
| GB201710836D0 (en) * | 2017-07-05 | 2017-08-16 | Ucl Business Plc | ROR1 Car T-Cells |
| WO2019126594A2 (en) * | 2017-12-20 | 2019-06-27 | Radimmune Therapeutics, Inc. | Antibodies to centrin-1, methods of making, and uses thereof |
| JP7630834B2 (ja) | 2019-03-03 | 2025-02-18 | プロセナ バイオサイエンシーズ リミテッド | タウ認識抗体 |
| CN109929835A (zh) * | 2019-03-27 | 2019-06-25 | 中国人民解放军第四军医大学 | 一种鼠单克隆抗体功能轻链可变区基因的扩增方法 |
| JP7678768B2 (ja) * | 2019-07-02 | 2025-05-16 | テリックス ファーマシューティカルズ (イノベーションズ) ピーティーワイ リミテッド | 新生児fc受容体に対する低下した親和性を有する、caixに対する抗体 |
| US12560598B2 (en) | 2020-03-11 | 2026-02-24 | Genesis Intelligence, Llc | Cartridge-based automated rapid test analyzer |
| CN115515984B (zh) * | 2020-05-08 | 2026-02-06 | 亘利生物科技(上海)有限公司 | 一种抗cd19抗体的抗体及其制备和应用 |
| EP4247947A1 (en) * | 2020-11-19 | 2023-09-27 | Genzyme Corporation | Flow cytometry attenuated reporter expression (flare) multiple reporter system and methods of use thereof |
Family Cites Families (75)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8308235D0 (en) | 1983-03-25 | 1983-05-05 | Celltech Ltd | Polypeptides |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US6054561A (en) | 1984-02-08 | 2000-04-25 | Chiron Corporation | Antigen-binding sites of antibody molecules specific for cancer antigens |
| GB8422238D0 (en) | 1984-09-03 | 1984-10-10 | Neuberger M S | Chimeric proteins |
| US4970198A (en) | 1985-10-17 | 1990-11-13 | American Cyanamid Company | Antitumor antibiotics (LL-E33288 complex) |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| GB8607679D0 (en) | 1986-03-27 | 1986-04-30 | Winter G P | Recombinant dna product |
| JPH0684377B2 (ja) | 1986-04-17 | 1994-10-26 | 協和醗酵工業株式会社 | 新規化合物dc―88a及びdc―89a1 |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| JP3101690B2 (ja) | 1987-03-18 | 2000-10-23 | エス・ビィ・2・インコーポレイテッド | 変性抗体の、または変性抗体に関する改良 |
| ATE243754T1 (de) | 1987-05-21 | 2003-07-15 | Micromet Ag | Multifunktionelle proteine mit vorbestimmter zielsetzung |
| WO1989007142A1 (en) | 1988-02-05 | 1989-08-10 | Morrison Sherie L | Domain-modified constant region antibodies |
| JP3121823B2 (ja) * | 1988-02-12 | 2001-01-09 | ビーティージー・インターナショナル・リミテッド | 抗体におけるまたは抗体に関する改良 |
| JP2598116B2 (ja) | 1988-12-28 | 1997-04-09 | 協和醗酵工業株式会社 | 新規物質dc113 |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| JP2510335B2 (ja) | 1989-07-03 | 1996-06-26 | 協和醗酵工業株式会社 | Dc―88a誘導体 |
| US5187186A (en) | 1989-07-03 | 1993-02-16 | Kyowa Hakko Kogyo Co., Ltd. | Pyrroloindole derivatives |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| ATE158021T1 (de) | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| GB9022547D0 (en) | 1990-10-17 | 1990-11-28 | Wellcome Found | Purified immunoglobulin |
| GB9022543D0 (en) | 1990-10-17 | 1990-11-28 | Wellcome Found | Antibody production |
| GB9108056D0 (en) * | 1991-04-16 | 1991-06-05 | Hale Geoffrey | Synthetic antigen |
| EP0519596B1 (en) | 1991-05-17 | 2005-02-23 | Merck & Co. Inc. | A method for reducing the immunogenicity of antibody variable domains |
| EP1400536A1 (en) | 1991-06-14 | 2004-03-24 | Genentech Inc. | Method for making humanized antibodies |
| WO1994004679A1 (en) | 1991-06-14 | 1994-03-03 | Genentech, Inc. | Method for making humanized antibodies |
| US5264586A (en) | 1991-07-17 | 1993-11-23 | The Scripps Research Institute | Analogs of calicheamicin gamma1I, method of making and using the same |
| US5269388A (en) | 1991-11-12 | 1993-12-14 | Stress-Tek, Inc. | Weighing bed |
| GB9125768D0 (en) | 1991-12-04 | 1992-02-05 | Hale Geoffrey | Therapeutic method |
| EP0563475B1 (en) | 1992-03-25 | 2000-05-31 | Immunogen Inc | Cell binding agent conjugates of derivatives of CC-1065 |
| WO1994026087A2 (en) | 1993-05-14 | 1994-11-24 | Connor Kim C O | Recombinant protein production and insect cell culture and process |
| AU691811B2 (en) | 1993-06-16 | 1998-05-28 | Celltech Therapeutics Limited | Antibodies |
| US7119248B1 (en) | 1994-04-12 | 2006-10-10 | Miltenyi Biotec Gmbh | Antibodies against epitopes with homology to self antigens, methods of preparation and applications thereof |
| US5641780A (en) | 1994-04-22 | 1997-06-24 | Kyowa Hakko Kogyo Co., Ltd. | Pyrrolo-indole derivatives |
| US5550246A (en) | 1994-09-07 | 1996-08-27 | The Scripps Research Institute | Calicheamicin mimics |
| US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| GB9603507D0 (en) | 1996-02-20 | 1996-04-17 | Isis Innovation | Antibody variants |
| US7147851B1 (en) | 1996-08-15 | 2006-12-12 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
| EP0983303B1 (en) | 1997-05-21 | 2006-03-08 | Biovation Limited | Method for the production of non-immunogenic proteins |
| AU776910B2 (en) | 1998-12-08 | 2004-09-23 | Merck Patent Gesellschaft Mit Beschrankter Haftung | Modifying protein immunogenicity |
| CA2388063C (en) | 1999-11-24 | 2010-06-08 | Immunogen, Inc. | Cytotoxic agents comprising taxanes and their therapeutic use |
| ATE414151T1 (de) | 2000-03-03 | 2008-11-15 | Cambridge Antibody Tech | Antikörper gegen eotaxin und deren verwendung |
| US6333410B1 (en) | 2000-08-18 | 2001-12-25 | Immunogen, Inc. | Process for the preparation and purification of thiol-containing maytansinoids |
| US7465790B2 (en) | 2000-10-09 | 2008-12-16 | Isis Innovation, Inc. | Therapeutic antibodies |
| US20020132983A1 (en) * | 2000-11-30 | 2002-09-19 | Junghans Richard P. | Antibodies as chimeric effector cell receptors against tumor antigens |
| US7771951B2 (en) | 2001-12-03 | 2010-08-10 | Amgen Fremont Inc. | Antibody categorization based on binding characteristics |
| AU2003217912A1 (en) * | 2002-03-01 | 2003-09-16 | Xencor | Antibody optimization |
| AU2003291281A1 (en) | 2002-11-01 | 2004-06-07 | The Ohio State University Research Foundation | Cytogenetic abnormalities that are predictive of response to therapy for chronic lymphocytic leukemia |
| CN1225480C (zh) * | 2002-12-18 | 2005-11-02 | 马菁 | 抗cd52单克隆抗体、其编码序列及应用 |
| US7534427B2 (en) | 2002-12-31 | 2009-05-19 | Immunomedics, Inc. | Immunotherapy of B cell malignancies and autoimmune diseases using unconjugated antibodies and conjugated antibodies and antibody combinations and fusion proteins |
| EP1618891A1 (en) | 2003-03-31 | 2006-01-25 | Kirin Beer Kabushiki Kaisha | Method of inducing differentiation and proliferating regulatory t cell by anti-cd52 antibody and medicinal composition therefor |
| WO2005017149A1 (en) | 2003-06-03 | 2005-02-24 | Cell Genesys, Inc. | Compositions and methods for enhanced expression of recombinant polypeptides from a single vector using a peptide cleavage site |
| US7264806B2 (en) * | 2003-11-01 | 2007-09-04 | Biovation Ltd. | Modified anti-CD52 antibody |
| US20060204496A1 (en) * | 2003-11-28 | 2006-09-14 | Tetsuo Kojima | Agonist antibody against heteroreceptor |
| ITRM20030601A1 (it) | 2003-12-24 | 2005-06-25 | Lay Line Genomics Spa | Metodo per l'umanizzazione di anticorpi e anticorpi umanizzati con esso ottenuti. |
| AU2005282720B2 (en) * | 2004-09-02 | 2011-08-04 | Genentech, Inc. | Anti-FC-gamma RIIB receptor antibody and uses therefor |
| US7655229B2 (en) * | 2004-09-02 | 2010-02-02 | Chan Andrew C | Anti-FC-gamma RIIB receptor antibody and uses therefor |
| TR201901929T4 (tr) | 2005-02-08 | 2019-03-21 | Genzyme Corp | TGFBeta'ya antikorlar. |
| WO2006126068A2 (en) * | 2005-05-24 | 2006-11-30 | Avestha Gengraine Technologies Pvt Ltd | Recombinant method for the production of a monoclonal antibody to cd52 for the treatment of chronic lymphocytic leukemia |
| MEP35408A (en) | 2005-05-27 | 2011-02-10 | Biogen Idec Inc | Tweak binding antibodies |
| ATE550353T1 (de) * | 2005-12-30 | 2012-04-15 | Merck Patent Gmbh | Die bindung von mit il-6ralpha komplexiertem il-6 an gp130 verhindernde anti-il-6-antikörper |
| DK2380585T3 (en) * | 2006-04-12 | 2015-10-05 | Genzyme Corp | Methods of treating autoimmune diseases |
| ES2917882T3 (es) | 2006-09-13 | 2022-07-12 | Alcafleu Man Gmbh & Co Kg | Tratamiento de esclerosis múltiple (MS) con Campath-1H |
| CA2679400A1 (en) | 2007-02-28 | 2008-09-04 | Schering Corporation | Combination therapy for treatment of immune disorders |
| WO2009000406A1 (en) * | 2007-06-22 | 2008-12-31 | Bayer Healthcare Ag | Use of antibodies against the cd52 antigen for the treatment of neurological disorders, particularly transmissible spongiform encephalopathy and alzheimer's disease |
| WO2010132697A2 (en) | 2009-05-13 | 2010-11-18 | Genzyme Corporation | Methods and compositions for treatment |
| EP3345620B1 (en) | 2009-05-13 | 2024-08-28 | Genzyme Corporation | Methods and compositions for treating lupus |
| NZ621170A (en) | 2009-05-13 | 2015-08-28 | Genzyme Corp | Anti-human cd52 immunoglobulins |
| JP6192294B2 (ja) | 2009-07-15 | 2017-09-06 | エーアイエムエム セラピューティクス ベー.フェー. | グラム陽性菌特異的結合化合物 |
| KR102318383B1 (ko) | 2010-07-16 | 2021-10-27 | 아디맵 엘엘씨 | 항체 라이브러리 |
| ITMI20110376A1 (it) | 2011-03-10 | 2012-09-11 | Wilic Sarl | Aerogeneratore raffreddato a fluido |
| GB201109238D0 (en) | 2011-06-01 | 2011-07-13 | Antitope Ltd | Antibodies |
| AR095199A1 (es) | 2013-03-15 | 2015-09-30 | Genzyme Corp | Anticuerpos anti-cd52 |
| CA3205824A1 (en) | 2014-10-09 | 2016-04-14 | Genzyme Corporation | Glycoengineered antibody drug conjugates |
| CN110546167A (zh) | 2017-04-21 | 2019-12-06 | 建新公司 | 以抗-cd52抗体治疗多发性硬化症 |
-
2010
- 2010-05-13 NZ NZ621170A patent/NZ621170A/en not_active IP Right Cessation
- 2010-05-13 KR KR1020117029662A patent/KR101537840B1/ko not_active Expired - Fee Related
- 2010-05-13 CN CN201410379748.7A patent/CN104231084B/zh active Active
- 2010-05-13 KR KR1020167022759A patent/KR20160103160A/ko not_active Ceased
- 2010-05-13 TW TW099115371A patent/TWI529247B/zh not_active IP Right Cessation
- 2010-05-13 EP EP15191351.4A patent/EP2998405B1/en active Active
- 2010-05-13 SG SG2011083847A patent/SG176060A1/en unknown
- 2010-05-13 CA CA2761800A patent/CA2761800C/en active Active
- 2010-05-13 BR BRPI1013085-3A patent/BRPI1013085A2/pt not_active IP Right Cessation
- 2010-05-13 CA CA2939492A patent/CA2939492C/en active Active
- 2010-05-13 WO PCT/US2010/034704 patent/WO2010132659A2/en not_active Ceased
- 2010-05-13 EP EP10775530A patent/EP2429582A4/en not_active Withdrawn
- 2010-05-13 RU RU2011150516/10A patent/RU2603743C2/ru not_active IP Right Cessation
- 2010-05-13 MX MX2011012047A patent/MX2011012047A/es active IP Right Grant
- 2010-05-13 KR KR1020177026871A patent/KR20170113704A/ko not_active Ceased
- 2010-05-13 EP EP19214547.2A patent/EP3683317A3/en not_active Withdrawn
- 2010-05-13 CN CN201910228216.6A patent/CN110016081A/zh active Pending
- 2010-05-13 TW TW106123171A patent/TW201825115A/zh unknown
- 2010-05-13 MY MYPI2011005455A patent/MY160126A/en unknown
- 2010-05-13 NZ NZ596384A patent/NZ596384A/en not_active IP Right Cessation
- 2010-05-13 KR KR1020147020065A patent/KR20140102764A/ko not_active Withdrawn
- 2010-05-13 JP JP2012511010A patent/JP5894912B2/ja active Active
- 2010-05-13 AR ARP100101677A patent/AR076770A1/es not_active Application Discontinuation
- 2010-05-13 CN CN2010800312662A patent/CN102459628A/zh active Pending
- 2010-05-13 SG SG10201608169QA patent/SG10201608169QA/en unknown
- 2010-05-13 AU AU2010249003A patent/AU2010249003B2/en not_active Ceased
- 2010-05-13 US US13/320,019 patent/US8617554B2/en active Active
- 2010-05-13 RU RU2016142225A patent/RU2016142225A/ru not_active Application Discontinuation
- 2010-05-13 TW TW104144762A patent/TWI614267B/zh not_active IP Right Cessation
- 2010-05-13 KR KR1020157036932A patent/KR20160005143A/ko not_active Withdrawn
-
2011
- 2011-11-03 IL IL216141A patent/IL216141B/en not_active IP Right Cessation
- 2011-11-03 ZA ZA2011/08077A patent/ZA201108077B/en unknown
-
2012
- 2012-09-10 HK HK16110806.5A patent/HK1222682A1/en unknown
-
2013
- 2013-11-26 US US14/091,083 patent/US20140341910A1/en not_active Abandoned
-
2014
- 2014-07-16 JP JP2014145770A patent/JP2014195474A/ja not_active Withdrawn
-
2015
- 2015-06-18 HK HK15105820.8A patent/HK1205152A1/xx unknown
- 2015-09-24 US US14/864,736 patent/US20160208010A1/en not_active Abandoned
-
2016
- 2016-02-10 JP JP2016023418A patent/JP2016093194A/ja not_active Withdrawn
-
2017
- 2017-12-01 JP JP2017231850A patent/JP2018029624A/ja not_active Withdrawn
-
2018
- 2018-10-28 IL IL262639A patent/IL262639A/en unknown
-
2019
- 2019-04-10 US US16/380,389 patent/US20200040091A1/en not_active Abandoned
-
2021
- 2021-03-03 US US17/191,440 patent/US11945874B2/en active Active
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2429582A4 * |
Cited By (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9913863B2 (en) | 2008-04-25 | 2018-03-13 | Duke University | Regulatory B cells and their uses |
| US9669057B2 (en) | 2008-04-25 | 2017-06-06 | Duke University | Regulatory B cells and their uses |
| US9617343B2 (en) | 2009-05-13 | 2017-04-11 | Genzyme Corporation | Methods and compositions for treating lupus |
| US11945874B2 (en) | 2009-05-13 | 2024-04-02 | Genzyme Corporation | Anti-human CD52 immunoglobulins |
| US20130309244A1 (en) * | 2010-12-21 | 2013-11-21 | Duke University | Methods and compositions combining immunotherapy with monocyte activation |
| US9814740B2 (en) | 2010-12-21 | 2017-11-14 | Duke University | Methods and compositions combining immunotherapy with monocyte activation |
| US9920129B2 (en) | 2011-04-18 | 2018-03-20 | The University Of Tokyo | Diagnosis and treatment of cancer using anti-ITM2A antibody |
| EP2700652A4 (en) * | 2011-04-18 | 2015-07-15 | Univ Tokyo | DIAGNOSIS AND TREATMENT OF CANCER BY ANTI-ITM2A ANTIBODIES |
| US9321841B2 (en) | 2011-06-01 | 2016-04-26 | Antitope Limited | Humanised anti-CD52 antibodies |
| RU2605307C2 (ru) * | 2011-06-01 | 2016-12-20 | Антитоуп Лтд | Гуманизированные антитела к сd52 |
| WO2012164063A1 (en) * | 2011-06-01 | 2012-12-06 | Antitope Ltd | Humanised anti-cd52 antibodies |
| CN103649122B (zh) * | 2011-06-01 | 2017-09-05 | 安迪拓普有限公司 | 人源化cd52抗体 |
| JP2014518630A (ja) * | 2011-06-01 | 2014-08-07 | アンチトープ・リミテッド | ヒト化抗cd52抗体 |
| CN103649122A (zh) * | 2011-06-01 | 2014-03-19 | 安迪拓普有限公司 | 人源化cd52抗体 |
| US10611999B2 (en) | 2012-09-06 | 2020-04-07 | Duke University | Methods of expanding and assessing B cells and using expanded B cells to treat disease |
| US10017739B2 (en) | 2012-09-06 | 2018-07-10 | Duke University | Methods of expanding and assessing B cells and using expanded B cells to treat disease |
| US11435346B2 (en) | 2013-03-12 | 2022-09-06 | Cdres Pharma Llc | Antibodies binding to TLR2/TLR4-interacting immunologically active polypeptide |
| US10871489B2 (en) | 2013-03-12 | 2020-12-22 | Institute of Arthritis Research, LLC | Immunologically active polypeptide |
| EP2970496A4 (en) * | 2013-03-12 | 2016-07-27 | Inst Of Arthritis Res Llc | IMMUNOLOGICALLY ACTIVE POLYPEPTIDE |
| US9816989B2 (en) | 2013-03-12 | 2017-11-14 | Institute of Arthritis Research, LLC | Immunologically active polypeptide |
| US10365275B2 (en) | 2013-03-12 | 2019-07-30 | Institute of Arthritis Reasearch, LLC | Immunologically active polypeptide |
| US9708407B2 (en) | 2013-03-15 | 2017-07-18 | Genzyme Corporation | Anti-CD52 antibodies |
| EA031730B1 (ru) * | 2013-03-15 | 2019-02-28 | Джензим Корпорейшн | Антитела к cd52 |
| AU2014233685B2 (en) * | 2013-03-15 | 2019-02-28 | Genzyme Corporation | Anti-CD52 antibodies |
| WO2014151644A3 (en) * | 2013-03-15 | 2015-01-15 | Genzyme Corporation | Anti-cd52 antibodies |
| CN105209495A (zh) * | 2013-03-15 | 2015-12-30 | 建新公司 | 抗cd52抗体 |
| US20160024219A1 (en) * | 2013-03-15 | 2016-01-28 | Genzyme Corporation | Anti-cd52 antibodies |
| US11230598B2 (en) | 2016-12-15 | 2022-01-25 | Duke University | Antibodies and methods for depleting regulatory bio cells and use in combination with immune checkpoint inhibitors |
| WO2018195457A3 (en) * | 2017-04-21 | 2018-11-29 | Genzyme Corporation | Routes and schedules for treating multiple sclerosis with anti-cd52 antibodies |
| WO2018195457A2 (en) | 2017-04-21 | 2018-10-25 | Genzyme Corporation | Treatment of multiple sclerosis with anti-cd52 antibodies |
| US12304946B2 (en) | 2018-12-19 | 2025-05-20 | Humabs Biomed Sa | Antibodies that neutralize hepatitis B virus and uses thereof |
| US12404318B2 (en) | 2018-12-20 | 2025-09-02 | Vir Biotechnology, Inc. | Combination HBV therapy |
| US12221481B2 (en) | 2019-05-21 | 2025-02-11 | Novartis Ag | CD19 binding molecules and uses thereof |
| US11883432B2 (en) | 2020-12-18 | 2024-01-30 | Century Therapeutics, Inc. | Chimeric antigen receptor system with adaptable receptor specificity |
| WO2025031965A1 (en) * | 2023-08-04 | 2025-02-13 | Cimeio Therapeutics Ag | Discernible cell surface protein variants of cd52 for use in cell therapy |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11945874B2 (en) | Anti-human CD52 immunoglobulins | |
| AU2014233685B2 (en) | Anti-CD52 antibodies | |
| AU2017202364B2 (en) | Anti-human CD52 immunoglobulins | |
| HK40031934A (en) | Anti-human cd52 immunoglobulins | |
| OA17634A (en) | Anti-CD52 antibodies. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080031266.2 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10775530 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4216/KOLNP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2010249003 Country of ref document: AU Date of ref document: 20100513 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13320019 Country of ref document: US Ref document number: 2761800 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012511010 Country of ref document: JP Ref document number: MX/A/2011/012047 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 596384 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010775530 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20117029662 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2011150516 Country of ref document: RU Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1013085 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI1013085 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111111 |