WO2010128182A1 - Adenovirus oncolíticos para el tratamiento del cáncer - Google Patents

Adenovirus oncolíticos para el tratamiento del cáncer Download PDF

Info

Publication number
WO2010128182A1
WO2010128182A1 PCT/ES2010/000196 ES2010000196W WO2010128182A1 WO 2010128182 A1 WO2010128182 A1 WO 2010128182A1 ES 2010000196 W ES2010000196 W ES 2010000196W WO 2010128182 A1 WO2010128182 A1 WO 2010128182A1
Authority
WO
WIPO (PCT)
Prior art keywords
adenovirus
promoter
oncolytic
sequence
oncolytic adenovirus
Prior art date
Application number
PCT/ES2010/000196
Other languages
English (en)
French (fr)
Inventor
Sònia GUEDAN CARRIÓ
Manel Maria Cascallo Piqueras
Ramon Alemany Bonastre
Original Assignee
Fundació Privada Institut D'investigació Biomèdica De Bellvitge
Institut Català D'oncologia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43050014&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2010128182(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CN201080028895XA priority Critical patent/CN102548584A/zh
Priority to JP2012509064A priority patent/JP2012525833A/ja
Priority to AU2010244348A priority patent/AU2010244348B2/en
Priority to RU2011149458/10A priority patent/RU2536931C2/ru
Priority to ES10772050.0T priority patent/ES2600955T3/es
Priority to MX2011011818A priority patent/MX2011011818A/es
Priority to US13/318,876 priority patent/US10316065B2/en
Application filed by Fundació Privada Institut D'investigació Biomèdica De Bellvitge, Institut Català D'oncologia filed Critical Fundació Privada Institut D'investigació Biomèdica De Bellvitge
Priority to KR1020117029097A priority patent/KR101878274B1/ko
Priority to EP10772050.0A priority patent/EP2428229B1/en
Priority to BRPI1011445A priority patent/BRPI1011445B8/pt
Priority to CA2761183A priority patent/CA2761183C/en
Publication of WO2010128182A1 publication Critical patent/WO2010128182A1/es
Priority to IL216190A priority patent/IL216190A0/en
Priority to HK12108533.3A priority patent/HK1167818A1/zh
Priority to US16/405,285 priority patent/US20190345204A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/861—Adenoviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2474—Hyaluronoglucosaminidase (3.2.1.35), i.e. hyaluronidase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10371—Demonstrated in vivo effect

Definitions

  • the invention is related to the field of medicine, more particularly to the field of oncology, and specifically to virotherapy.
  • the tumor cell dies from the cytopathic effect caused by the replication of the virus inside it rather than the effect of a therapeutic gene.
  • the preferential replication in a tumor cell is called oncotropism and the lysis of the tumor is called oncolysis.
  • viruses that selectively replicate in tumors are called oncolytics, although in a broader sense the word oncolytic can be applied to any replicative virus capable of lysing tumor cells, although without selectivity. In this description the term oncolytic is used in both directions.
  • Cancer virotherapy is much earlier than gene therapy.
  • the first observations of cure of tumors with viruses date from the beginning of the last century.
  • 1912 De Pace obtained tumor regressions after inoculating the rabies virus in cervical carcinomas. Since then many types of viruses have been injected into tumors for treatment.
  • viruses that have a natural oncotropism such as autonomous parvovirus, vesicular stomatitis virus and reovirus.
  • Other viruses are They can be genetically engineered to selectively replicate in tumors.
  • Herpes Simplex virus (HSV) has been made oncotropic by eliminating the ribonucleotide reductase gene, an enzymatic activity that is available in cells in active proliferation such as tumor cells.
  • HSV Herpes Simplex virus
  • adenovirus due to its low pathogenicity and high capacity to infect tumor cells, has been the virus most used in both virotherapy and cancer gene therapy.
  • Type 5 (Ad5) human adenovirus which belongs to group C, is a virus formed by an icosahedral protein capsid that encloses a linear DNA of 36 kilobases. In adults, infection with Ad5 is usually asymptomatic and in children it causes a common cold and conjunctivitis. In general, Ad5 infects epithelial cells, which in the course of a natural infection are bronchial epithelial cells. It enters the cell through the interaction of the fiber, a viral protein that extends as an antenna from the twelve vertices of the capsid, with a cellular protein involved in intercellular adhesion called Coxsackie-Adenovirus Receptor (CAR).
  • CAR Coxsackie-Adenovirus Receptor
  • E1 to E4 When the viral DNA reaches the interior of the nucleus, the transcription of the early or "early" genes (E1 to E4) of the virus begins orderly.
  • the first viral genes that are expressed correspond to the genes of the early region 1A (E1A).
  • E1A binds to the Rb cell protein to release E2F and thus activate the transcription of other viral genes such as E2, E3 and E4 and of the cellular genes that activate the cell cycle.
  • E1 B binds to p53 to activate the cell cycle and prevent apoptosis of the infected cell.
  • E2 encodes for virus replication proteins
  • E3 encodes proteins that inhibit the antiviral immune response
  • E4 encodes for viral RNA transport proteins.
  • the expression of the early genes leads to the replication of the viral DNA, and once this is replicated, the main late promoter is activated that leads to the expression of a messenger RNA transcript that by differential splicing generates all the RNAs that code for the structural proteins that form the capsid.
  • selectivity and potency There are two important aspects to consider in relation to the oncolytic adenovirus design: selectivity and potency.
  • selectivity To obtain selectivity towards the tumor cell three strategies have been used: the elimination of viral functions that are necessary for the replication in normal cells, but expendable in tumor cells; the control of the viral genes that initiate the replication by selective tumor promoters; and the modification of the viral capsid proteins involved in the infection of the host cell.
  • these genetic modifications a considerable level of selectivity has been achieved, with a replicative capacity in a tumor cell of the order of 10,000 times higher than the replicative capacity in the normal cell.
  • oncolytic potency several genetic modifications have also been described to increase it.
  • modifications include: a) the increase in viral release, for example by the elimination of E1 B19K, the overexpression of E3-11.6K (ADP), or the relocation of the E3 / 19K protein in the plasma membrane; and b) the insertion of a therapeutic gene in the genome of the oncolytic adenovirus to generate an "armed oncolytic adenovirus".
  • the therapeutic gene should mediate the death of uninfected cancer cells by activating a prodrug with adjacent effect (that is, killing neighboring uninfected cells), the activation of the immune system against the tumor, Ia induction of apoptosis, inhibition of angiogenesis, or elimination of extracellular matrix, among others.
  • the form and time of expression of the therapeutic gene will be critical in the final result of the therapeutic approach.
  • Hyaluronic acid is one of the main components of the EMC involved in the resistance of tumor cells to therapeutic drugs. HA is overexpressed in a wide variety of malignant tissues, and in many cases HA levels are a prognostic factor for tumor progression. The interaction of HA with CD44 and RHAMM receptors increases tumor survival and invasion. In addition, HA can promote tumor metastases by inducing adhesion and cell migration, and protecting against the immune system.
  • hyaluronidases enzymes in charge of the degradation of HA
  • hyaluronidases increase the activity of different chemotherapies in patients with melanoma, kaposi sarcoma, head and neck cancer and hepatic colon metastases.
  • the mechanism of action of hyaluronidases is still unknown, but in general it is attributed to a decrease in cell adhesion barriers, a decrease in interstitial pressure and an improvement in the penetration of the anticancer drug into the tumor, rather than their inhibitory effects of signaling pathways related to cell survival.
  • the inventors have found that an adenovirus that replicates and that contains the inserted hyaluronidase enzyme gene in its adenoviral genome, is distributed more efficiently by the tumor mass.
  • the expression of hyaluronidase by the oncolytic adenovirus results in a degradation of the hyaluronic acid that forms part of the extracellular matrix of the tumor.
  • the degradation of hyaluronic acid results in a decrease in the interstitial pressure of the tumor and a lower resistance of the tumor to the distribution of the adenovirus, so that the distribution of the cell-cell virus by the tumor mass is improved. It's better Distribution translates into an increase in the oncolytic effect.
  • the inventors have found that by injecting the oncolytic adenovirus of the invention, regressions of the tumor volume are obtained. Therefore, the oncolytic adenovirus of the present invention is useful for the treatment of cancer.
  • the expression of the hyaluronidase gene does not affect the viral replication or the cytotoxicity of the oncolytic adenovirus.
  • intratumoral administration in vivo of the oncolytic adenovirus of the invention improves the antitumor effect with respect to a control adenovirus without hyaluronidase inserted (see FIG. 7).
  • the oncolytic adenovirus of the invention is injected intravenously (see FIG. 8 and FIG 9) and, comparing it with what is represented in Figure 2 of the article by Ganesh et al. 2, a much greater tumor growth suppression is observed in the case of the adenovirus of the invention, so that the treatment of the invention is more effective.
  • Tumors of mice injected with the oncolytic adenovirus of the invention show very large necrotic areas, areas with very small viable cells, and large and numerous foci of viral replication, compared to tumors injected with the control adenovirus, ICOVIR15 .
  • the administered doses are lower: in Ganesh et al. (surjra) four intratumoral injections of 1x10e10 viral particles are administered, while in the present invention a single intravenous dose of 2x10e9 viral particles is administered. This means a reduction in the dose of 20 times and the advantage that it is a single dose.
  • Ganesh et al. administer the hyaluronidase intratumorally on alternate days throughout the experiment.
  • adenovirus is also administered intratumorally at the beginning of treatment. This intratumoral administration of virus and hyaluronidase is hardly applicable to the clinic because the majority of tumors are not accessible for intratumoral administration.
  • the co-administration of soluble hyaluronidase and adenovirus was not performed systemically because the probability that both components jointly reach disseminated tumor cells in the body is low.
  • the present invention allows the expression of hyaluronidase at the site and at the time the viral replication occurs. This expression of hyaluronidase improves the distribution of the virus by the tumor mass and increases its antitumor potency. It is possible to administer adjusted doses, non-toxic to the animal and with great efficacy in the treatment.
  • oncolytic adenoviruses reach the target tumor cells, once inside they replicate, the capsid proteins are expressed and at the same time the hyaluronidase contained in the adenoviral genome is expressed.
  • This hyaluronidase has been modified to be released to the extracellular medium that surrounds the cells. In the extracellular environment, the hyaluronidase destroys the matrix and helps the adenoviruses that have replicated to infect the neighboring tumor cells.
  • one aspect of the invention refers to an oncolytic adenovirus that comprises a sequence that encodes a hyaluronidase enzyme inserted in its genome.
  • oncolytic adenovirus means an adenovirus that is capable of replication or that is competent in replication in the tumor cell.
  • oncolytic adenovirus and replicative adenovirus are synonyms. They differ from a non-replicative adenovirus because the latter is unable to replicate in the target cell.
  • Non-replicative adenoviruses are those used in gene therapy as carriers of genes to target cells since it seeks to express the therapeutic gene within the intact cell and not the lysis of the cell.
  • the therapeutic action of oncolytic adenoviruses is based precisely on the ability to replicate and lyse the target cell, and in particular the tumor cell to be eliminated.
  • Another aspect of the invention relates to a pharmaceutical composition comprising a therapeutically effective amount of the oncolytic adenovirus, together with pharmaceutically acceptable carriers or excipients.
  • Another aspect of the invention relates to the oncolytic adenovirus of the invention for use as a medicine.
  • Another aspect of the invention relates to the oncolytic adenovirus of the invention for the treatment of a cancer or a pre-malignant state thereof, in a mammal including a human.
  • Another aspect of the invention relates to the use of oncolytic adenovirus for the manufacture of a medicament for the treatment of a cancer or a pre-malignant state thereof, in a mammal including a human.
  • the treatment is based on the replication of these oncolytic adenoviruses in tumors.
  • this aspect of the invention can be formulated as a method for the treatment in a mammal including man, of a cancer or of a pre-malignant state thereof, which comprises administering to said mammal, an effective amount of adenovirus.
  • Another aspect of the invention relates to a shuttle vector that is capable of recombining with an adenoviral genome, for the construction of the oncolytic adenovirus of the invention.
  • This vector comprises inverted terminal repeating adenoviral sequences ("inverted terminal repeats", ITRs), a sequence that promotes the expression of the sequence encoding the hyaluronidase enzyme, the sequence encoding the enzyme and a polyadenylation sequence.
  • the oncolytic adenovirus of the invention is a human adenovirus, that is, it infects humans.
  • the human adenovirus is selected from the group consisting of human adenoviruses of serotype 1-51 and derivatives thereof.
  • derivative is understood a hybrid recombinant adenovirus of two or more different adenovirus serotypes, eg a serotype 5 adenovirus with the serotype 3 adenovirus fiber.
  • the human oncolytic adenovirus is serotype 5.
  • Hyaluronidases are a family of enzymes that degrade hyaluronic acid.
  • Hyaluronidase PH20 is highly expressed in the testicles and is involved in the process of fertilization of the oocyte by the sperm.
  • the hyaluronidase PH20 is anchored in the plasma membrane and in the internal acrosomal membrane of the sperm and gives the sperm the ability to penetrate through the extracellular matrix of the cumulus cells (rich in hyaluronic acid) to reach the pellucid area of the oocyte During the acrosomal reaction, part of the hyaluronidases anchored in the sperm membrane are enzymatically processed to give rise to a soluble form of the protein that is released from the acrosomal membrane.
  • hyaluronidase has been identified as the dispersion factor of the snake venom, spiders, scorpions and wasps.
  • the enzyme hyaluronidase is a testicular mammalian hyaluronidase, and more particularly, the human testicular hyaluronidase.
  • Human testicular hyaluronidase (GenBank GeneID: 6677) is also known as SPAM1 or sperm adhesion molecule 1 ("sperm adhesion molecule 1"), and PH-20.
  • the PH20 membrane protein is the only enzyme in the family of mammalian hyaluronidases with activity at neutral pH.
  • the gene that encodes it produces two transcriptional variants: the longer variant 1, which codes for the protein isoform 1 (GenBank accession number NP_003108.2) and the variant 2, which uses an alternative splicing in the coding region 3 'compared to the variant 1, which results in an isoform 2 with a shorter C-terminal end (GenBank accession number NP_694859.1).
  • the sequence of the enzyme has the sequence corresponding to the carboxy-terminal membrane binding domain removed so that the enzyme is soluble (see FIG. 2). The elimination of this carboxyterminal domain results in the secretion of hyaluronidase at extracellular medium
  • an oncolytic adenovirus that expresses a secreted hyaluronidase with enzymatic activity at neutral pH has been obtained.
  • the sequence that is inserted into the adenoviral genome is one that encodes SEQ ID NO: 1.
  • the sequence that is inserted is SEQ ID NO: 2.
  • the enzyme sequence is inserted into the oncolytic adenovirus after the nucleotide sequence of the adenoviral fiber.
  • the expression of the enzyme is controlled by an operative promoter in animal cells.
  • the promoter is selected from the group consisting of the cytomegalovirus promoter, the late adenovirus major promoter, the SV40 promoter, the herpes simplex virus thymidine kinase promoter, the RSV promoter, the EF1 alpha promoter, the promoter of The beta-actin, the human IL-2 promoter, the human IL-4 promoter, the IFN promoter, the E2F promoter and the GM-CSF human promoter.
  • the promoter that regulates the expression of the enzyme can be in the adenovirus naturally as is the case of the late adenovirus main promoter (see FIG. 1 (a), MLP, "major late promoter").
  • the promoter can also be inserted together with the sequence encoding the enzyme.
  • the promoter is the late main promoter of adenovirus.
  • the replicative adenovirus of the invention can have modifications in its genomic sequence that confer a selective replication in tumor cells. In a particular embodiment this is achieved with the incorporation of a tissue specific promoter or a tumor specific promoter, wherein said promoter controls the expression of one or more genes of the group E1a, E1 b, E2 and E4.
  • the promoter is selected from the group consisting of the E2F promoter, the hTERT telomerase promoter, the tyrosinase promoter, the prostate specific antigen (PSA) promoter, the alpha-fetoprotein promoter, the promoter of COX-2, as well as artificial promoters formed by several binding sites for transcription factors such as binding sites for hypoxia-inducible factor (HIF-1), Ets transcription factor, tumor cytotoxic factor (tcf), E2F transcription factor or Sp1 transcription factor.
  • the promoter controls the expression of E1a.
  • Another modification to achieve selective replication in tumors is the elimination of early E1A functions that block the retinoblastoma (RB) pathway.
  • the oncolytic adenovirus ICOVIR17 is characterized by simultaneously containing the hyaluronidase gene, the elimination? 24 that affects the interaction of E1a with pRB, the insertion of four E2F-1 binding sites and one site of binding to Sp1 in the endogenous E1a promoter to control the expression of E1a, and finally, the insertion of the RGD peptide in the adenoviral fiber to increase the infectivity of the virus.
  • the ICOVIR17 is a preferred embodiment of the invention.
  • RNAs associated with the virus are characterized by truncating the interferon pathway.
  • the selective replication in tumors is achieved with mutations in one or more genes of the group E1a, E1 b, E4 and VA-RNAs of the adenovirus.
  • the mutations are in E1a.
  • the adenovirus has modifications in its capsid to increase its infectivity or direct it to a receptor present in a tumor cell.
  • the adenoviral capsid proteins have been genetically modified to include ligands that increase infectivity or that direct the virus to a receptor in the tumor cell. Directing adenovirus to the tumor can also be achieved with bifunctional ligands that bind the virus on one side and the tumor receptor on the other.
  • the capsid can be covered with polymers such as polyethylene glycol
  • the oncolytic adenovirus has the modified capsid to increase its infectivity or better direct it to the target cell, so that the KKTK binding domain of the heparan sulfates present in the adenoviral fiber has been replaced by the RGDK domain.
  • the examples explain the construction of an adenovirus with these characteristics, the ICOVIR17RGDK.
  • the adenovirus comprises a sequence that optimizes the protein translation of the sequence encoding the hyaluronidase.
  • the adenovirus comprises a sequence that promotes the expression of the sequence encoding the hyaluronidase. More particularly, this sequence is selected from the group consisting of a splicing sequence that allows RNA processing, an IRES sequence ("internal ribosome entry site"), and the 2A sequence of picomavirus.
  • the oncolytic adenovirus in turn comprises other genes inserted in its genome commonly used in the field of cancer gene therapy to increase the cytotoxicity of oncolytic adenoviruses on tumor cells.
  • Some of them are the thymidine kinase gene, that of the cytosine deaminase, proapoptotic genes, immunostimulators, tumor suppressors or prodrug activators.
  • adenovirus genome modifications in the adenovirus genome are not exclusive among them.
  • the methods of genetically modified adenovirus construction are well established in the field of gene therapy and adenovirus virotherapy. The most commonly used method is based on first constructing the desired genetic modification in a plasmid containing the adenoviral region to be modified, and then performing homologous recombination in bacteria with a plasmid containing the rest of the viral genome.
  • the adenovirus containing the hyaluronidase gene object of the present invention is propagated and amplified in cell lines normally used in the field of gene therapy and virotherapy such as the HEK-293 and A549
  • the preferred method of propagation is by infection of a cell line permissive to adenovirus replication.
  • the A549 pulmonary adenocarcinoma line is an example of a line with such characteristics.
  • Propagation is carried out, for example, as follows: A549 cells are grown on plastic cell culture plates and infected using 100 viral particles per cell. Two days later the cytopathic effect that reflects the production of virus is observed as a clustering of the cells. The cells are collected and stored in tubes.
  • the cell precipitate is frozen and thawed three times to break the cells.
  • the resulting cell extract is centrifuged at 1000 g for 5 minutes and the virus supernatant is loaded on top of a gradient of cesium chloride and centrifuged for 1 hour at 35000 g.
  • the virus band obtained from the gradient is reloaded onto another gradient of cesium chloride and centrifuged for 16 hours at 35000 g.
  • the virus band is collected and dialyzed against PBS-10% glycerol.
  • the dialyzed virus is aliquot and stored at -80 0 C.
  • the quantification of the number of particles and plaque forming units is performed following standard protocols.
  • Saline phosphate buffer (PBS) with 5% glycerol is a standard formulation for adenovirus storage.
  • PBS serum phosphate buffer
  • new formulations have been described that improve the stability of the virus.
  • the methods of purification of the adenovirus containing the hyaluronidase gene for use in the treatment of cancer are the same as those described for other adenoviruses and adenoviral vectors used in virotherapy and gene therapy of cancer.
  • the oncolytic adenovirus of the present invention can be administered to a mammal, preferably a human.
  • the purpose of the administration of oncolytic adenovirus is therapeutic, including, but not limited to, melanoma, pancreatic cancer, colon cancer and lung cancer.
  • the administration of the oncolytic adenovirus in pre-malignant stages of a tumor is also contemplated.
  • the oncolytic adenovirus is administered in a pharmaceutically acceptable form. Those skilled in the art can ensure the appropriate dose using standard procedures. It is understood that the dose must be an effective amount of the oncolytic adenovirus to produce a reduction of the tumor in the treated individual.
  • the administration it can be direct from the virus to the tumor, in the cavity where the tumor is located, in the vasculature of the tumor, around the tumor, or by systemic intravenous injection in the patient. Preferably, the administration is systemic.
  • the protocols for using the viruses described in the present invention in the treatment of cancer follow the same procedures as those used in the fields of adenovirus virotherapy and adenovirus gene therapy.
  • the purified adenovirus in any of the formulations described above is added to the culture medium for the infection of the tumor cells.
  • the adenovirus can be administered loco-regionally by injection into the tumor or into a body cavity where the tumor is located, or systemically by injection into the bloodstream.
  • the oncolytic adenovirus of the invention can be administered alone or in a composition with pharmaceutically acceptable carriers or excipients.
  • the person skilled in the art will adapt the composition depending on the particular mode of administration.
  • the compositions may comprise the oncolytic adenovirus as the sole agent against the tumor, or in combination with another therapeutic agent such as a chemotherapeutic drug or a vector with an inserted therapeutic gene.
  • the therapy can also be combined with oncolytic adenovirus with radiotherapy.
  • FIG. 1 (a) shows the oncolytic adenovirus structure characterized by containing and expressing the PH20 hyaluronidase gene.
  • the AdwtRGD-PH20 adenovirus contains the PH20 protein gene inserted behind the adenoviral fiber gene.
  • the expression of the PH20 protein gene is regulated by the late main promoter (MLP) of the adenovirus by means of the insertion of the Illa adenovirus splicing sequence (SA) in front of the PH20 protein gene.
  • MLP late main promoter
  • SA Illa adenovirus splicing sequence
  • the protein translation of said gene is optimized thanks to the introduction of the kozac (K) sequence just before the translation start sequence.
  • Adenoviruses ICOVIR15 and ICOVIR17 are adenoviruses of selective replication in tumors. They are characterized by containing 4 E2F binding sites and one Sp1 binding site in the endogenous E1a promoter. Both viruses have a modified version of the viral fiber in which the RGD-4C peptide has been incorporated, and also a mutant version of the E1A protein to which it has eliminated amino acids 121-129 in its polypeptide chain ( ⁇ 24 mutation).
  • ICOVIR17 contains the PH20 hyaluronidase gene in the same way as the AdwtRGD-PH20 wild adenovirus.
  • (b) shows the sequence incorporated in the Ad ⁇ 24RGD adenovirus replacing its nucleotide sequence 419 to 422. This incorporation is performed to insert four binding sites to the E2F-1 factors and one binding site to the Sp1 factor.
  • the subrallated sequences such as "nt 385-419" and "nt 422-461) correspond to the wild ones of Ad ⁇ 24RGD.
  • (C) shows the complete cassette integrated in the genomes of ICOVIR17 and AdwtRGD-PH20 with respect to the genomes of ICOVIR15 and AdwtRGD ( SEQ ID NO: 4)
  • the Illa splicing acceptor sequence, the Kozac sequence and the polyadenylation sequence (polA) are indicated.
  • the coding sequence for the PH20 protein goes from the kozac sequence to the polyadenylation sequence. corresponds to EXAMPLE 3.
  • FIG. 2 shows the amino acid sequence of the PH20 protein (SEQ ID NO: 1) and hydropathic graphic representation according to the Kyte-Doolittle algorithm.
  • the PH20 protein is a membrane protein present in the plasma and acrosomal membrane of the sperm
  • the sequence amino acid shows the hydrophobic sequence responsible for anchoring the protein in the membrane (sequence indicated with underlining).
  • the PH20 protein expressed by the viruses has a hydrophobic tail removed. The cut point is shown within a circle. In this way, the PH20 protein is secreted to the extracellular medium.
  • FIG. 3 is a demonstration that oncolytic adenoviruses containing the PH20 hyaluronidase gene express a soluble protein that has hyaluronidase activity.
  • the gels show how the hyaluronic acid samples incubated with the supernatants of the viruses expressing the hyaluronidase PH20 have been digested giving rise to oligosaccharides of different sizes. Samples incubated with control adenovirus supernatants (AdwtRGD and ICOVIR15) have undigested hyaluronic acid.
  • FIG. 3 corresponds to EXAMPLE 4.
  • FIG. 4 is a demonstration that the insertion and expression of the PH20 hyaluronidase gene does not interfere with the viral replication of a tumor selective replication adenovirus.
  • Cells of the A549 (a) and SKMel28 (b) lines were infected with the oncolytic adenoviruses ICOVIR15 and ICOVIR17 (which differs from ICOVIR15 because it contains the PH20 gene) and the amount of virus from the cell extracts (total virus) was measured , x axis, in TU / ml) at different times (y axis, in post-infection hours).
  • FIG. 4 corresponds to EXAMPLE 5.
  • FIG. 5 shows the oncolytic efficacy in vitro of an oncolytic adenovirus that contains and expresses the PH20 hyaluronidase gene.
  • the oncolytic capacity of an adenovirus expressing the hyaluronidase PH20 (ICOVIR17) was compared with that of a similar oncolytic virus but without the hyaluronidase gene PH20 (ICOVIR15) in two tumor lines expressing a large amount of hyaluronic acid in vitro.
  • the cytopathic effect (CPE) that the virus induces is measured as a decrease in Ia amount of protein in an infected cell monolayer (BCA method).
  • the cells were seeded in 96-well plates at 10,000 cells per well. The next day the cells were infected with serial dilutions of the virus. Infected cells were incubated for 5 days, washed with PBS and the amount of protein remaining in the well was measured. The results show that in vitro.
  • the expression of hyaluronidase PH20 does not improve the oncolytic capacity of adenovirus, the cytotoxicity curves being identical for both viruses.
  • FIG. 5 corresponds to EXAMPLE 5.
  • FIG. 6 is an in vivo demonstration of the antitumor capacity of an oncolytic adenovirus that expresses the hyaluronidase PH20.
  • Human melanoma cells (SKMel28) were inoculated in each posterior flank of athymic mice of the Balb / c strain. Once the tumors reached an average of 150 mm 3 , they were injected with PBS or 1x10e8 AdwtRGD-PH20 transduction units (10 tumors / group), (a) The graph shows the average tumor growth (in%) of each group with respect to day 0 based on post-administration time (in days).
  • FIG. 7 shows that the expression of hyaluronidase PH20 improves the antitumor effect of an oncolytic adenovirus after its intratumoral administration.
  • Human melanoma cells (SKMel28) were inoculated in each posterior flank of athymic mice of the Balb / c strain. Once the tumors reached an average of 130 mm 3 , the tumors were injected with PBS or 1x10e8 transduction units of ICOVIR15 and ICOVIR17 (10 tumors / group) in a single dose, (a) The graph shows the average of the growth of the tumors (in%) of each group with respect to day 0 depending on of post-administration time (in days).
  • the oncolytic adenovirus expressing the hyaluronidase PH20 (ICOVIR17) has a better antitumor effect than the control adenovirus that does not express said hyaluronidase (ICOVIR15).
  • ICOVIR17 The oncolytic adenovirus expressing the hyaluronidase PH20 (ICOVIR17) has a better antitumor effect than the control adenovirus that does not express said hyaluronidase (ICOVIR15).
  • FIG. 7 corresponds to EXAMPLE 6.2.
  • FIG. 8 shows that the expression of hyaluronidase PH20 improves the antitumor effect of an oncolytic adenovirus after its systemic administration.
  • Human melanoma cells (SKMel28) were inoculated in each posterior flank of athymic mice of the Balb / c strain. Once the tumors reached an average of 100 mm 3 , the mice were injected with PBS or 5x10e10 physical particles of ICOVIR15 and ICOVIR17 (ICOVIR15 armed with PH20) (8-10 tumors / group) intravenously, (a) The graph shows The average tumor growth (in%) of each group with respect to day 0 as a function of post-administration time (in days).
  • FIG. 8 corresponds to EXAMPLE 6.3.
  • FIG. 9 demonstrates that the increase in systemic antitumor activity of adenoviruses expressing the hyaluronidase enzyme PH20 is not restricted to a single tumor type.
  • FIG. 10 (a) shows the structure of oncolytic adenovirus ICOVIR17 and I COVI R17RG DK. (b) shows the amino acid sequence of the modified version of the fiber in ICOVIR17RGDK (SEQ ID NO: 9). The underlined sequence corresponds to amino acids 91 RGDK 94 that differ with respect to the native form of the human adenovirus type 5 fiber. FIG. 10 corresponds to EXAMPLE 8.
  • FIG. 11 shows the oncolytic capacity of the two adenoviruses (ICOVIR17 and ICOVIR17RGDK) in two tumor lines, one lung A549 (A) and another pancreas NP-18 (B). The% cell survival vs. TU / cells.
  • FIG. 11 corresponds to EXAMPLE 9.
  • EXAMPLE 1 Construction of oncolytic adenoviruses
  • Two oncolytic adenoviruses were constructed containing the hyaluronidase PH20 gene, the AdwtRGD-PH20 adenovirus and the ICOVIR17 adenovirus.
  • the PH20 hyaluronidase cDNA was obtained by PCR amplification of the different exons of the protein from the genome of the line A549 cell and the subsequent binding of these exons with specific oligonucleotides containing the target of the restriction enzyme Mfel.
  • the resulting fragment was digested with Mfel and cloned by ligation in the shuttle plasmid, pNKFiberRGD (containing the sequence of the adenoviral fiber modified with RGD), to give rise to plasmid pNKFiberPH20.
  • the cDNA corresponding to the PH20 protein cloned in plasmid pNKFiberPH20 is shown in SEQ ID NO: 2.
  • SEQ ID NO: 2 shows the nucleotides encoding the PH20 protein (isoform with access number to GenBank NP_694859.1) from its initiation of transcription (ATG) to position 1467.
  • the nucleotide sequence of region 1468 to 1527 encodes the hydrophobic tail of the protein, responsible for its anchoring to the membrane. Said sequence has been deleted and is not shown in the sequence. After nucleotide 1468, the stop codon of the TAA translation has been added.
  • EXAMPLE 2 Construction of the AdwtRGD-PH20 adenovirus: To generate the AdwtRGD-PH20 adenovirus, the plasmid adenoviral fiber gene pVK50cau (containing the complete Ad5 sequence with a Swal target in the fiber) was replaced by homologous recombination in yeasts by the fiber gene followed by the PH20 hyaluronidase gene of the plasmid pNKFiberPH20 digested with Notl / Kpnl.
  • the AdwtRGD-PH20 adenovirus characterized by expressing the PH20 hyaluronidase gene under the control of the late main promoter, and containing the RGD tripeptide in the adenoviral fiber, was generated by Paci digestion of plasmid pAdwtRGD-PH20 and transfection into HEK293 cells.
  • the AdwtRGD adenovirus previously described, is characterized by containing the RGD tripeptide in the adenoviral fiber (cf. M.
  • adenovirus ICOVIR17 To generate this adenovirus, the adenoviral plasmid plCOVIR17 was used. To generate this plasmid, the adenoviral fiber gene of plasmid plCOVIR15 was replaced by homologous recombination in yeasts by the fiber gene followed by the PH20 hyaluronidase gene of plasmid pAdwtRGD-PH20 digested with Spel / Pacl.
  • the adenovirus ICOVIR15 comes from the adenovirus Ad ⁇ 24RGD that is characterized by containing the elimination? 24 in the sequence coding for the E1a protein. This elimination affects the interaction of E1a with pRB. Ad ⁇ 24RGD also has the insertion of the RGD peptide into the adenoviral fiber to increase the infectivity of the virus. These two modifications are described in K. Suzuki et al., "A conditionally replicative adenovirus with enhanced infectivity shows improved oncolytic potency", Clin Cancer Res 2001, vol. 7, pp. 120-6.
  • the Sp1 binding site was introduced into the plasmid pEndK / Spe with the BsiWI site by ligation of said plasmid digested with BsiWI with the oligonucleotides Sp1 F (5'-GTACGTCGACCACAAACCCC GCCCAGCGTCTTGTCATTGGCGTCGACGCT-3 'SEQ ID3-R': (5'- GTACAGCGTCGACGCCAATGACAAGACGCTGGGCGGGGTTTGTGGTCG AC-3 1 SEQ ID NO: 6) paired with each other.
  • E2F binding sites were introduced through the binding of oligonucleotides E2FF2 (5'-GTACGTCG GCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCGTAAAAGTG GTTCGAA-3 'SEQ ID NO: 7) and E2FR2 (5'CCCGAGGTGTCCTAGTGTCCTAGTGTGTCCTAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
  • the ICOVIR17 virus which contains the same modifications as ICOVIR15, plus the insertion of the hyaluronidase gene behind the adenoviral fiber gene, was generated by Pac ⁇ digestion of plasmid plCOVIR17 and transfection into HEK293 cells.
  • the correct structure of the AdwtRGD-PH20 and ICOVIR17 genomes was verified by restriction with Hindlll. Additionally, the region of the PH20 gene was sequenced with specific oligonucleotides.
  • the complete cassette integrated in the genomes of ICOVIR17 and AdwtRGD-PH20 with respect to the genomes of ICOVIR15 and AdwtRGD is represented in FIG. 1 (c) and in SEQ ID NO: 4:
  • the coding sequence for the PH20 protein goes from the kozac sequence to the polyadenylation sequence.
  • EXAMPLE 4 Expression of a soluble protein with hyaluronidase activity by an adenovirus containing the PH20 hyaluronidase gene
  • the digested hyaluronic acid was analyzed by electrophoresis in a gel of 15% polyacrylamide (cf. M. Ikegami-Kawai et al., "Microanalysis of hyaluronan oligosaccharides by polyacrylamide gel electrophoresis and its application to assay of hyaluronidase activity", Analvtical biochemistrv 2002, vol. 311, pp. 157-65) .
  • the oligosaccharides resulting from the digestion of hyaluronic acid were fixed in the gel matrix by a 30 min bath in a solution of alcian blue. Finally, the oligosaccharides were stained with silver nitrate. The result is shown in FIG. 3. It is shown that the supernatants of cells infected with adenoviruses containing the hyaluronidase gene PH20 (AdwtRGD-PH20 and ICOVIR17) contain a soluble protein capable of digesting hyaluronic acid (a high molecular weight polysaccharide) in oligosaccharides of 5 to more than 50 repeated units of disaccharides.
  • Tumors in the control group received a single intratumoral injection of saline buffer (20 ⁇ l).
  • the mice in the group treated with AdwtRGD-PH20 received an intratumoral injection (20 ⁇ l) of 1x10 8 units of virus transduction per tumor (equivalent to 2x10 9 viral particles or vp).
  • V (mm 3 ) A (mm) x B 2 (mm 2 ) xp / 6, where A is the length greater or longitudinal, and B is the transverse length.
  • FIG. 6 shows the percentage of tumor growth with respect to the start of treatment (day 0). The results are presented as mean ⁇ SE The existence of significant differences between the results was calculated using a non-parametric trial of unpaired Mann-Whitney data. The growth curves were compared using an analysis of the variance. The results were considered significant if p ⁇ 0.05. Treatment of tumors with the AdwtRGD-PH20 adenovirus resulted in a tumor regression in 100% of the treated tumors.
  • The% of tumor growth was significantly lower than the control group from the first days after injection.
  • the analysis of the tumors at the end of the experiment revealed a decrease in the amount of hyaluronic acid contained in the extracellular matrix of the tumors injected with the AdwtRGD-PH20.
  • the different sections of the tumors frozen in OCT were treated with an a-hexon antibody (adenovirus capsid protein) and were counterstained with 4 ', 6'-diaminine-2-phenylindole.
  • the antitumor activity of ICOVIR17 correlates with the replication of adenovirus at the intra-tumor level, evaluated in tumors obtained at day 48 post-injection. Tumors treated with ICOVIR17 have large necrotic areas, better viral distribution, and less viable cell areas than tumors injected with ICOVIR15.
  • EXAMPLE 7 Toxicological profile of oncolytic adenoviruses that express the hyaluronidase gene
  • an animal model was chosen where the human adenovirus is able to replicate, as is the hamster model Golden Syrian (Mesocricetus auratus).
  • the hamster constitutes an animal model permissive to the replication of the human adenovirus.
  • 5-week-old immunocompetent female animals (5-6 animals / group) were used, which received a single dose of 4 x 10 11 vp of ICOVIR15 or ICOVIR17 intravenously through the cephalic vein on day 0 and in a 300 ⁇ l volume of PBS.
  • the control group was injected with an equivalent volume. Five days after the administration, the animals were sacrificed and from each of them whole blood and serum were extracted by cardiac puncture, to proceed to the monitoring of liver toxicity parameters (AST and ALT enzymes) as well as the count of the different blood populations by flow cytometry (blood count). Simultaneously, the livers of the animals that were fixed in 4% paraformaldehyde were obtained for subsequent staining with eosin / hematoxylin.
  • both viruses induce some liver inflammation in this model with elevations in the levels of AST and ALT transaminases, but no differences were observed between animals treated with ICOVIR15 and those treated with ICOVIR17.
  • both viruses caused elevations in the populations of neutrophils, basophils and monocytes, as well as reductions in platelet count with respect to control animals, but again without differences between them.
  • EXAMPLE 8 Construction of the ICOVIR17RGDK virus
  • the adenoviral plasmid plCOVIR17RGDK was used to generate this adenovirus.
  • the native adenovirus type 5 fiber gene has been replaced by a modified version in its heparan sulfate binding domain (amino acids 91 KKTK94 of the polypeptide sequence replaced by 91 RGDK94).
  • Plasmid plCOVIR17RGDK was constructed by homologous recombination in yeasts between the product of partial digestion of plCOVIR17 with Ndel and EcoRI digestion of plasmid pBSattKKT, (which contains the modified version of the adenovirus fiber and is described in N. Bayó- Puxan et al. "Replacement of adenovirus type 5 fiber shaft heparan sulfate proteoglycan-binding domain with RGD for improved tumor infectivity and targeting.” Human Gene Therapy 2009, vol. 20, pp 1214-21).
  • FIG. 10 shows the location of the modification 91 RGDK94 in the context of ICOVIR17RGDK, as well as the complete sequence of the fiber protein in this adenovirus.
  • the ICOVIR17 adenovirus contains a version of the adenoviral fiber gene in which the RGD-4C peptide (Cys-Asp-Cys-Arg-Gly-Asp-Cys-Phe-Cys; CDCRGDCFC. SEQ ID NO: 10) has been inserted. in the Hl region of the zone of the "head” (knob domain) of the protein (hyper-variable loop little conserved evolutionarily and very exposed of the adenoviral capsid).
  • ICOVIR17RGDK is totally analogous to ICOVIR17 except in the fiber gene, since in this case the fiber of ICOVIR17RGDK only differs from the native form of human adenovirus type 5 in which they have been replaced amino acids 91 KKTK 94 for the high affinity peptide for integrins 91 RGDK 94 , in the "mango" domain of the protein (shaft domain) (SEQ ID NO: 9).
  • the modification of the capsid present in ICOVIR17RGDK does not modify the in vitro cytotoxicity of an oncolytic adenovirus that contains and expresses the PH20 hyaluronidase gene.
  • the oncolytic capacity of the two adenoviruses expressing the hyaluronidase PH20 were compared in two tumor lines, one lung A549 (FIG. 11 (a)) and another pancreas NP-18 (FIG. 11 (b) ).
  • the cytopathic effect that the virus induces is measured as a decrease in the amount of protein in an infected cell monolayer (BCA method).
  • the cells of the two tumor lines were seeded in 96-well plates at 10,000 cells per well. The next day the cells were infected with serial dilutions of the virus. Infected cells were incubated for 6 days, washed with PBS and the amount of protein remaining in the well was measured. The results show that in vitro. The modification of the capsid does not significantly modulate the oncolytic capacity of adenoviruses.
  • EXAMPLE 10 Toxicological profile of different oncolytic adenoviruses that express the hyaluronidase gene
  • the immunocompetent mouse model BaIbC without tumor was used.
  • 6-week-old males (7 animals / group) were used who received a single dose of 5 x 10 10 vp of ICOVIR17 or ICOVIR17RGDK intravenously through the tail vein on day 0 and in a 150 ⁇ l volume of PBS.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La invención se refiere a un adenovirus oncolítico que comprende una secuencia que codifica una enzima hialuronidasa insertada en su genoma. Este adenovirus se distribuye más eficientemente por la masa tumoral y por consiguiente se aumenta el efecto oncolítico. Inyectando el adenovirus oncolítico de la invención endovenosamente se obtienen regresiones del volumen tumoral. Por lo tanto el adenovirus oncolítico de la presente invención es útil para el tratamiento del cáncer o de un estado pre-maligno del mismo.

Description

Adenovirus oncolíticos para el tratamiento del cáncer
La invención está relacionada con el campo de Ia medicina, más particularmente con el campo de Ia oncología, y específicamente con Ia viroterapia.
ESTADO DE LA TÉCNICA
El tratamiento actual del cáncer se basa principalmente en Ia quimioterapia, Ia radioterapia y Ia cirugía. Pese a una elevada tasa de curación para el cáncer en estadios tempranos, Ia mayoría de casos avanzados de cáncer son incurables porque no pueden ser extirpados quirúrgicamente o porque las dosis radio o quimioterapéuticas administradas se ven limitadas por su toxicidad en células normales. Para paliar esta situación se han desarrollado estrategias biotecnológicas que buscan aumentar Ia potencia y selectividad de los tratamientos oncológicos. Entre ellas, Ia terapia génica y Ia viroterapia utilizan virus con propósitos terapéuticos contra el cáncer. En terapia génica el virus se modifica para impedir su replicación y para servir de vehículo o vector de material genético terapéutico. Por el contrario, Ia viroterapia utiliza virus que se replican y propagan selectivamente en las células tumorales. En viroterapia Ia célula tumoral muere por el efecto citopático causado por Ia replicación del virus en su interior más que por el efecto de un gen terapéutico. La replicación preferencial en una célula tumoral se denomina oncotropismo y Ia lisis del tumor se denomina oncolisis. En un sentido estricto, los virus que se replican selectivamente en tumores se denominan oncolíticos, aunque en un sentido más amplio Ia palabra oncolítico se puede aplicar a cualquier virus replicativo capaz de lisar células tumorales, aunque sin selectividad. En esta descripción el término oncolítico se utiliza en los dos sentidos.
La viroterapia del cáncer es muy anterior a Ia terapia génica. Las primeras observaciones de curaciones de tumores con virus datan de principios del siglo pasado. Ya en 1912 De Pace obtuvo regresiones tumorales tras inocular el virus de Ia rabia en carcinomas cervicales. Desde entonces se han inyectado muchos tipos de virus en tumores para su tratamiento. Hay virus que presentan un oncotropismo natural como por ejemplo el parvovirus autónomo, el virus de Ia estomatitis vesicular y el reovirus. Otros virus se pueden manipular genéticamente para que se repliquen selectivamente en tumores. Por ejemplo el Herpes Simplex virus (HSV) se ha hecho oncotrópico al eliminar el gen de Ia ribonucleótido reductasa, una actividad enzimática dispensable en células en proliferación activa como las células tumorales. Sin embargo, el adenovirus, por su baja patogenicidad y alta capacidad de infectar células tumorales ha sido el virus más utilizado tanto en viroterapia como en terapia génica del cáncer.
Se han identificado 51 serotipos de adenovirus humanos y clasificado en 6 grupos diferenciados del A al F.
El adenovirus humano tipo 5 (Ad5), que pertenece al grupo C, es un virus formado por una cápside proteica icosaédrica que encierra un ADN lineal de 36 kilobases. En adultos Ia infección con Ad5 suele ser asintomática y en niños causa un resfriado común y conjuntivitis. En general el Ad5 infecta células epiteliales, que en el curso de una infección natural son las células del epitelio bronquial. Entra en Ia célula por medio de Ia interacción de Ia fibra, proteína viral que se extiende a modo de antena desde los doce vértices de Ia cápside, con una proteína celular implicada en adhesión intercelular llamada Receptor de Coxsackie-Adenovirus (CAR). Cuando el ADN viral llega al interior del núcleo empieza ordenadamente Ia transcripción de los genes tempranos o "early" (E1 a E4) del virus. Los primeros genes virales que se expresan corresponden a los genes de Ia región temprana 1A (E1A). E1A se une a Ia proteína celular Rb para liberar E2F y activar así Ia transcripción de otros genes virales como E2, E3 y E4 y de los genes celulares que activan el ciclo celular. Por otro lado, E1 B se une a p53 para activar el ciclo celular e impedir Ia apoptosis de Ia célula infectada. E2 codifica para proteínas de replicación del virus; E3 codifica proteínas que inhiben Ia respuesta inmune antiviral; E4 codifica para proteínas de transporte de ARN viral. La expresión de los genes tempranos conduce a Ia replicación del ADN viral, y una vez replicado éste, se activa el promotor tardío principal que conduce a Ia expresión de un transcrito de ARN mensajero que por corte y empalme diferencial genera todos los ARN que codifican para las proteínas estructurales que forman Ia cápside.
Hay dos aspectos importantes a considerar en relación al diseño de adenovirus oncolíticos: Ia selectividad y Ia potencia. Para conseguir selectividad hacia Ia célula tumoral se han usado tres estrategias: Ia eliminación de funciones virales que son necesarias para Ia replicación en células normales, pero prescindibles en células tumorales; el control de los genes virales que inician Ia replicación por promotores selectivos de tumor; y Ia modificación de las proteínas de Ia cápside viral implicadas en Ia infección de Ia célula huésped. Con estas modificaciones genéticas se ha conseguido un nivel de selectividad considerable, con una capacidad replicativa en célula tumoral del orden de 10000 veces superior a Ia capacidad replicativa en Ia célula normal. Con respecto a Ia potencia oncolítica también se han descrito diversas modificaciones genéticas para aumentarla. Estas modificaciones incluyen: a) el aumento de Ia liberación viral, por ejemplo mediante Ia eliminación de E1 B19K, Ia sobreexpresión de E3-11.6K (ADP), o Ia relocalización de Ia proteína E3/19K en Ia membrana plasmática; y b) Ia inserción de un gen terapéutico en el genoma del adenovirus oncolítico para generar un "adenovirus oncolítico armado". En este caso, el gen terapéutico debería mediar Ia muerte de las células cancerígenas no infectadas mediante Ia activación de un profármaco con efecto adyacente (es decir, que mata a las células vecinas no infectadas), Ia activación del sistema inmune contra el tumor, Ia inducción de Ia apoptosis, Ia inhibición de Ia angiogénesis, o Ia eliminación de Ia matriz extracelular, entre otros. En estos casos, Ia forma y el tiempo de expresión del gen terapéutico serán críticos en el resultado final de Ia aproximación terapéutica.
En Ia última década, se han administrado diferentes adenovirus oncolíticos a pacientes con tumores de cabeza y cuello, tumores de ovario, cáncer colorectal, cáncer pancreático y carcinoma hepatocelular, entre otros. El perfil de seguridad de estos adenovirus en los ensayos clínicos ha sido muy prometedor. Los efectos secundarios detectados, como algunos síntomas parecidos a Ia gripe y elevaciones transitorias de las transaminasas, fueron bien tolerados, incluso después de Ia administración sistémica de altas dosis de virus (cfr. D. Ko et al., "Development of transcriptionally regulated oncolytic adenoviruses", Oncogene 2005, vol. 24, pp. 7763-74; y T. Reid et al., "Intravascular adenoviral agents in cáncer patients: lessons from clinical triáis", Cáncer gene therapy 2002, vol. 9, pp. 979-86). Aunque Ia administración de los adenovirus recombinantes indujo una supresión parcial del crecimiento tumoral, no se detectó ninguna erradicación completa de los tumores y, después de un corto periodo de tiempo, los tumores volvieron a crecer rápidamente. Estos resultados se debieron probablemente a que los adenovirus inyectados sólo se distribuyeron en una pequeña parte del tumor para alcanzar una respuesta antitumoral restringida, de manera que las células no infectadas con virus siguieron creciendo rápidamente. En un trabajo reciente, se observó que Ia replicación de adenovirus oncolíticos en tumores xenógrafos humanos persistía hasta los 100 días después de su administración sistémica, aunque esta replicación no se traducía en una erradicación completa del tumor (cfr. H. Sauthoff et al., "Intratumoral spread of wild-type adenovirus ¡s limited after local injection of human xenograft tumors: virus persists and spreads systemically at late time points", Human gene therapy 2003. vol. 14, pp. 425-33). Esta baja eficacia antitumoral se debe en parte a que el tejido conectivo y Ia matriz extracelular (ECM) presentes en Ia célula tumoral impiden Ia correcta distribución de los adenovirus recombinantes por el tumor.
Esta dificultad de los adenovirus oncolíticos de distribuirse eficientemente por Ia masa tumoral se ha descrito también para otros fármacos anticancerígenos como Ia doxorubicina, el taxol, Ia vincristina o el metotrexato. Son muchos los estudios que demuestran Ia implicación de Ia ECM en Ia resistencia de las células tumorales a los fármacos quimioterapéuticos (cfr. BP Toóle et al., "Hyaluronan: a constitutive regulator of chemoresistance and malignancy ¡n cáncer cells", Seminars in cáncer bioloqy 2008, vol. 18, pp. 244-50). Las células tumorales y las células del estroma producen y ensamblan una matriz de colágenos, proteoglicanos y otras moléculas que dificultan el transporte de macromoléculas por el interior del tumor. El ácido hialurónico (HA) es uno de los principales componentes de Ia EMC implicado en Ia resistencia de las células tumorales a los fármacos terapéuticos. El HA se encuentra sobreexpresado en una gran variedad de tejidos malignos, y en muchos casos los niveles de HA son un factor pronóstico de progresión tumoral. La interacción del HA con los receptores CD44 y RHAMM incrementa Ia supervivencia tumoral y Ia invasión. Además el HA puede promover las metástasis tumorales mediante Ia inducción de Ia adhesión y Ia migración celular, y Ia protección frente al sistema inmunológico.
Por otra parte, Ia inhibición de las interacciones entre el ácido hialurónico y las células tumorales revierte Ia resistencia a gran cantidad de fármacos. Diferentes trabajos han indicado que las hialuronidasas (enzimas encargados de la degradación del HA) aumentan Ia actividad de diferentes quimioterapias en pacientes con melanoma, sarcoma de kaposi, cáncer de cabeza y cuello y metástasis hepáticas de colon. El mecanismo de acción de las hialuronidasas es aun desconocido, pero por Io general se atribuye a una disminución de las barreras de adhesión celular, una disminución de Ia presión intersticial y una mejora en Ia penetración del fármaco anticancerígeno en el tumor, más que a sus efectos inhibitorios de las vías de señalización relacionadas con Ia supervivencia celular.
Recientemente se ha descrito que Ia coadministración de hialuronidasa con un adenovirus oncolítico mediante inyección intratumoral, reduce Ia progresión tumoral (cfr. S. Ganesh et al., "Intratumoral coadministration of hyaluronidase enzyme and oncolytic adenoviruses enhances virus potency in mestastasic tumor models", Clin Cáncer Res 2008, vol. 14, pp. 3933-41 ). En estos estudios los adenovirus oncolíticos se administran en cuatro inyecciones intratumorales y Ia hialuronidasa se administra intratumoralmente en días alternos durante todo el tratamiento. Esta pauta de administración es poco aplicable a pacientes debido a que Ia mayoría de los tumores son inaccesibles para ser administrados intratumoralmente. Tampoco los pacientes con enfermedad diseminada (metástasis) se podrían beneficiar del tratamiento propuesto por Ganesh y colaboradores.
A pesar de los esfuerzos realizados hasta Ia fecha, existe todavía Ia necesidad de encontrar nuevas aproximaciones terapéuticas que sean eficaces en el tratamiento del cáncer.
EXPLICACIÓN DE LA INVENCIÓN
Los inventores han encontrado que un adenovirus que se replica y que contiene en su genoma adenoviral el gen de Ia enzima hialuronidasa insertado, se distribuye más eficientemente por Ia masa tumoral. La expresión de Ia hialuronidasa por parte del adenovirus oncolítico resulta en una degradación del ácido hialurónico que forma parte de Ia matriz extracelular del tumor. La degradación del ácido hialurónico resulta en una disminución de Ia presión intersticial del tumor y una menor resistencia del tumor a Ia distribución del adenovirus, de manera que se mejora Ia distribución del virus célula-célula por Ia masa tumoral. Esta mejor distribución se traduce en un aumento del efecto oncolítico. Los inventores han encontrado que inyectando el adenovirus oncolítico de Ia invención endovenosamente se obtienen regresiones del volumen tumoral. Por Io tanto el adenovirus oncolítico de Ia presente invención es útil para el tratamiento del cáncer. Además, Ia expresión del gen de Ia hialuronidasa no afecta a Ia replicación viral ni a Ia citotoxicidad del adenovirus oncolítico.
Como se ha comentado antes, se ha descrito que Ia coadministración intratumoral de un adenovirus oncolítico y Ia hialuronidasa soluble aumenta Ia eficacia antitumoral de un adenovirus oncolítico. Aún así, previamente a esta invención el gen de Ia hialuronidasa no ha sido incorporado en ningún adenovirus oncolítico para el tratamiento del cáncer.
Como se describe en los ejemplos, Ia administración in vivo intratumoral del adenovirus oncolítico de Ia invención mejora el efecto antitumoral respecto a un adenovirus control sin hialuronidasa insertada (ver FIG. 7). Pero cuando se inyecta el adenovirus oncolítico de Ia invención endovenosamente (ver FIG. 8 y FIG 9) y, comparándolo con Io que se representa en Ia figura 2 del artículo de Ganesh et al. 2, se observa una supresión del crecimiento tumoral mucho mayor en el caso del adenovirus de Ia invención, por Io que el tratamiento de Ia invención es más efectivo. Los tumores de los ratones inyectados con el adenovirus oncolítico de Ia invención (ICOVIR17) muestran zonas necróticas muy extensas, zonas con células viables muy reducidas, y grandes y numerosos focos de replicación viral, en comparación con los tumores inyectados con el adenovirus control, ICOVIR15.
Además, con el adenovirus de Ia invención las dosis administradas son menores: en Ganesh et al. (surjra) se administran cuatro inyecciones intratumorales de 1x10e10 partículas virales, mientras que en Ia presente invención se administra una sola dosis endovenosa de 2x10e9 partículas virales. Esto significa una reducción en Ia dosis de 20 veces y Ia ventaja de que se trata de una única dosis. En su aproximación, Ganesh et al. administran Ia hialuronidasa intratumoralmente en días alternos durante todo el experimento. Además el adenovirus también es administrado intratumoralmente al inicio del tratamiento. Esta administración intratumoral de virus y hialuronidasa es difícilmente aplicable a Ia clínica debido a que Ia mayoría de tumores no son accesibles para una administración intratumoral. Presumiblemente la coadministración de hialuronidasa soluble y adenovirus no se realizó por vía sistémica pues Ia probabilidad de que ambos componentes alcancen conjuntamente las células tumorales diseminadas en el organismo es baja.
La presente invención permite Ia expresión de Ia hialuronidasa en el sitio y en el momento que se produce Ia replicación viral. Esta expresión de hialuronidasa mejora Ia distribución del virus por Ia masa tumoral y aumenta su potencia antitumoral. Se consigue administrar dosis ajustadas, no tóxicas para el animal y con una gran eficacia en el tratamiento.
En Ia presente invención los adenovirus oncolíticos llegan a las células tumorales diana, una vez dentro se replican, se expresan las proteínas de Ia cápside y al mismo tiempo se expresa Ia hialuronidasa contenida en el genoma adenoviral. Esta hialuronidasa ha sido modificada para ser liberada al medio extracelular que envuelve las células. En el medio extracelular, Ia hialuronidasa destruye Ia matriz y ayuda a que los adenovirus que se han replicado puedan infectar las células tumorales vecinas.
Así, un aspecto de Ia invención se refiere a un adenovirus oncolítico que comprende una secuencia que codifica una enzima hialuronidasa insertada en su genoma.
Tal y como se usa aquí, el término "adenovirus oncolítico" significa un adenovirus que es capaz de replicarse o que es competente en replicación en Ia célula tumoral. En esta descripción adenovirus oncolítico y adenovirus replicativo son sinónimos. Se diferencian de un adenovirus no replicativo porque este último es incapaz de replicarse en Ia célula diana. Los adenovirus no replicativos son los utilizados en terapia génica como portadores de genes a las células diana puesto que se busca expresar el gen terapéutico dentro de Ia célula intacta y no Ia lisis de Ia célula. En cambio, Ia acción terapéutica de los adenovirus oncolíticos se basa precisamente en Ia capacidad de replicarse y lisar Ia célula diana, y en particular Ia célula tumoral que se quiere eliminar. Otro aspecto de Ia invención se refiere a una composición farmacéutica que comprende una cantidad terapéuticamente efectiva del adenovirus oncolítico, junto con portadores o excipientes farmacéuticamente aceptables.
Otro aspecto de Ia invención se refiere al adenovirus oncolítico de Ia invención para su uso como medicamento.
Otro aspecto de Ia invención se refiere al adenovirus oncolítico de Ia invención para el tratamiento de un cáncer o de un estado pre-maligno del mismo, en un mamífero incluyendo un humano.
Otro aspecto de Ia invención se refiere al uso del adenovirus oncolítico para Ia fabricación de un medicamento para el tratamiento de un cáncer o de un estado pre-maligno del mismo, en un mamífero incluyendo un humano. El tratamiento se basa en Ia replicación de estos adenovirus oncolíticos en tumores. Alternativamente, este aspecto de Ia invención se puede formular como un método para el tratamiento en un mamífero incluyendo el hombre, de un cáncer o de un estado pre-maligno del mismo, que comprende Ia administración a dicho mamífero, de una cantidad efectiva del adenovirus oncolítico.
Otro aspecto de Ia invención se refiere a un vector lanzadera que es capaz de recombinar con un genoma adenoviral, para Ia construcción del adenovirus oncolítico de Ia invención. Este vector comprende secuencias repetidas terminales invertidas adenovirales ("inverted terminal repeats", ITRs), una secuencia que promueve Ia expresión de Ia secuencia que codifica Ia enzima hialuronidasa, Ia secuencia que codifica Ia enzima y una secuencia de poliadenilación.
En una realización particular, el adenovirus oncolítico de Ia invención es un adenovirus humano, es decir que infecta humanos. Particularmente, el adenovirus humano se selecciona del grupo que consiste en los adenovirus humanos de serotipo 1-51 y derivados de los mismos. Se entiende por "derivado" un adenovirus recombinante híbrido de dos o más serotipos diferentes de adenovirus, p.ej. un adenovirus serotipo 5 con Ia fibra del adenovirus serotipo 3. En una realización particular de Ia invención, el adenovirus oncolítico humano es de serotipo 5. Las hialuronidasas son una familia de enzimas que degradan el ácido hialurónico. En el hombre existen 6 genes que codifican para hialuronidasas con propiedades y localizaciones diferentes. Las isoformas Hyali y Hyal2 se encuentran en Ia mayoría de tejidos, siendo Hyali Ia forma predominante en el plasma humano. La Hyal3 se localiza en medula ósea y en los testículos, pero su función no está bien caracterizada. La hialuronidasa PH20 se encuentra altamente expresada en los testículos y está implicada en el proceso de fertilización del oocito por parte del espermatozoide. La hialuronidasa PH20 se encuentra anclada en Ia membrana plasmática y en Ia membrana acrosomal interna de los espermatozoides y confiere al espermatozoide Ia capacidad para penetrar a través de Ia matriz extracelular de las células del cumulus (rica en ácido hialurónico) para alcanzar Ia zona pelúcida del oocito. Durante Ia reacción acrosomal, parte de las hialuronidasas ancladas en Ia membrana del espermatozoide son procesadas enzimáticamente para dar lugar a una forma soluble de Ia proteína que es liberada de Ia membrana acrosomal. Además, Ia hialuronidasa se ha identificado como el factor de dispersión del veneno de serpientes, arañas, escorpiones y avispas.
En una realización particular, Ia enzima hialuronidasa es una hialuronidasa testicular de mamífero, y más particularmente, Ia hialuronidasa testicular humana. La hialuronidasa testicular humana (GenBank GeneID: 6677) también se conoce como SPAM1 o molécula de adhesión del espermatozoide 1 ("sperm adhesión molecule 1"), y PH-20. La proteína de membrana PH20, es Ia única enzima de Ia familia de las hialuronidasas de mamífero con actividad a pH neutro. El gen que Ia codifica produce dos variantes transcripcionales: Ia variante 1 , más larga, que codifica por Ia isoforma 1 de Ia proteína (número de acceso al GenBank NP_003108.2) y Ia variante 2, que utiliza un splicing alternativo en Ia región codificante 3' comparado con Ia variante 1 , que resulta en una isoforma 2 con un extremo C terminal más corto (número de acceso al GenBank NP_694859.1 ).
En una realización particular de Ia invención, Ia secuencia de Ia enzima tiene eliminada Ia secuencia correspondiente al dominio carboxiterminal de unión a membrana para que Ia enzima sea soluble (ver FIG. 2). La eliminación de este dominio carboxiterminal resulta en Ia secreción de Ia hialuronidasa al medio extracelular. Así, se ha obtenido un adenovirus oncolítico que expresa una hialuronidasa secretada con actividad enzimática a pH neutro. En una realización particular, Ia secuencia que se inserta en el genoma adenoviral es una que codifica Ia SEQ ID NO: 1. En una realización más particular, Ia secuencia que se inserta es Ia SEQ ID NO: 2.
En otra realización, Ia secuencia de Ia enzima está insertada en el adenovirus oncolítico después de Ia secuencia de nucleótidos de Ia fibra adenoviral.
En otra realización particular, Ia expresión de Ia enzima está controlada por un promotor operativo en células animales. Particularmente, el promotor se selecciona del grupo que consiste en el promotor del citomegalovirus, el promotor principal tardío del adenovirus, el promotor SV40, el promotor de Ia timidin quinasa del herpes simplex virus, el promotor RSV, el promotor EF1 alfa, el promotor de Ia beta-actina, el promotor de Ia IL-2 humana, el promotor de Ia IL-4 humana, el promotor de IFN, el promotor de E2F y el promotor humano GM-CSF. El promotor que regula Ia expresión de Ia enzima puede estar en el adenovirus de manera natural como es el caso del promotor principal tardío del adenovirus (ver FIG. 1 (a), MLP, "major late promotor"). El promotor también puede insertarse junto con Ia secuencia que codifica Ia enzima. En una realización preferida, el promotor es el promotor principal tardío del adenovirus.
El adenovirus replicativo de Ia invención puede tener modificaciones en su secuencia genómica que Ie confieran una replicación selectiva en células tumorales. En una realización particular esto se consigue con Ia incorporación de un promotor específico de tejido o un promotor específico de tumor, donde dicho promotor controla Ia expresión de uno o más genes del grupo E1a, E1 b, E2 y E4. Particularmente el promotor se selecciona del grupo que consiste en el promotor de E2F, el promotor de Ia telomerasa hTERT, el promotor de Ia tirosinasa, el promotor del antígeno específico de próstata (PSA), el promotor de Ia alfa-fetoproteína, el promotor de Ia COX-2, así como promotores artificiales formados por varios sitios de unión a factores de transcripción como sitios de unión para el factor inducible por hipoxia (HIF-1 ), el factor de transcripción Ets, el factor citotóxico tumoral (tcf), el factor de transcripción E2F o el factor de transcripción Sp1. Preferiblemente el promotor controla Ia expresión de E1a. Otra modificación para conseguir replicación selectiva en tumores es Ia eliminación de funciones tempranas de E1A que bloquean Ia vía de retinoblastoma (RB). Otros genes virales que interaccionan directamente con pRB como E4 y E4orf6/7 respectivamente, son candidatos a ser eliminados para conseguir replicación selectiva en células tumorales. Como se ilustra en los ejemplos, el adenovirus oncolítico ICOVIR17 se caracteriza por contener simultáneamente el gen de Ia hialuronidasa, Ia eliminación ?24 que afecta a Ia interacción de E1a con pRB, Ia inserción de cuatro sitios de unión a E2F-1 y un sitio de unión a Sp1 en el promotor endógeno de E1a para controlar Ia expresión de E1a, y finalmente, Ia inserción del péptido RGD en Ia fibra adenoviral para aumentar Ia infectividad del virus. El ICOVIR17 es una realización preferida de Ia invención.
Otra modificación descrita para conseguir replicación selectiva en tumores es Ia eliminación de los genes adenovirales que codifican los ARN asociados al virus (VA-RNAs). Estos RNAs bloquean Ia actividad antiviral del interferón y su eliminación resulta en adenovirus sensibles a ser inhibidos por interferón. Puesto que las células tumorales se caracterizan por truncar Ia vía de interferón dichos adenovirus se replican normalmente en tumores. Así, en otra realización particular, Ia replicación selectiva en tumores se consigue con mutaciones en uno o más genes del grupo E1a, E1 b, E4 y VA-RNAs del adenovirus. Preferiblemente las mutaciones son en E1a.
Estas dos estrategias para conseguir Ia replicación selectiva en tumores no son excluyentes entre sí.
En otra realización de Ia invención, el adenovirus tiene modificaciones en su cápside para aumentar su infectividad o dirigirlo a un receptor presente en una célula tumoral. En una realización más preferida las proteínas de Ia cápside adenoviral se han modificado genéticamente para incluir ligandos que aumentan Ia infectividad o que dirigen el virus a un receptor en Ia célula tumoral. Dirigir el adenovirus al tumor también se puede conseguir con ligandos bifuncionales que unen al virus por un lado y al receptor tumoral por otro. Por otro lado, para aumentar Ia persistencia del adenovirus en sangre y con ello aumentar las posibilidades de alcanzar nodulos tumorales diseminados, Ia cápside puede cubrirse con polímeros como el polietilenglicol. En una realización preferida, el adenovirus oncolítico tiene Ia cápside modificada para aumentar su infectividad o dirigirlo mejor a Ia célula diana, de manera que se ha sustituido el dominio de unión KKTK de los heparan sulfatos presente en Ia fibra adenoviral por el dominio RGDK. En los ejemplos se explica Ia construcción de un adenovirus con estas características, el ICOVIR17RGDK.
En otra realización particular, el adenovirus comprende una secuencia que optimiza Ia traducción proteica de Ia secuencia que codifica Ia hialuronidasa.
En otra realización particular, el adenovirus comprende una secuencia que promueve Ia expresión de Ia secuencia que codifica Ia hialuronidasa. Más particularmente, esta secuencia se selecciona del grupo que consiste en una secuencia de corte y empalme que permite el procesamiento del RNA, una secuencia IRES ("internal ribosome entry site"), y Ia secuencia 2A de picomavirus.
En otra realización particular, el adenovirus oncolítico a su vez comprende otros genes insertados en su genoma usados comúnmente en el campo de terapia génica del cáncer para aumentar Ia citotoxicidad de los adenovirus oncolíticos sobre células tumorales. Algunos de ellos son el gen de Ia timidina quinasa, el de Ia citosina deaminasa, genes proapoptóticos, ¡nmunoestimuladores, supresores tumorales o activadores de prodrogas.
Estas modificaciones en el genoma del adenovirus no son excluyentes entre ellas. Existen varios métodos para manipular el genoma adenoviral. Los métodos de construcción de adenovirus modificados genéticamente están bien establecidos en el campo de Ia terapia génica y Ia viroterapia con adenovirus. El método más comúnmente utilizado se basa en construir primero Ia modificación genética deseada en un plásmido que contiene Ia región adenoviral a modificar, para después realizar una recombinación homologa en bacterias con un plásmido que contiene el resto del genoma viral.
El adenovirus que contiene el gen de Ia hialuronidasa objeto de Ia presente invención se propaga y amplifica en líneas celulares normalmente utilizadas en el campo de Ia terapia génica y viroterapia como las líneas HEK-293 y A549. El método preferido de propagación es por infección de una línea celular permisiva a Ia replicación del adenovirus. La línea de adenocarcinoma pulmonar A549 es un ejemplo de línea con tales características. La propagación se realiza por ejemplo del siguiente modo: Las células A549 se crecen sobre placas de cultivo celular de plástico y se infectan usando 100 partículas virales por célula. Dos días después el efecto citopático que refleja Ia producción de virus se observa como un arracimamiento de las células. Las células se recogen y se almacenan en tubos. Después de una centrifugación a 1000 g durante 5 minutos, el precipitado celular se congela y descongela tres veces para romper las células. El extracto celular resultante se centrifuga a 1000 g durante 5 minutos y el sobrenadante con virus se carga encima de un gradiente de cloruro de cesio y se centrifuga durante 1 hora a 35000 g. La banda de virus obtenida del gradiente se carga de nuevo sobre otro gradiente de cloruro de cesio y se centrifuga durante 16 horas a 35000 g. La banda de virus se recoge y se dializa frente a PBS-10% glicerol. El virus dializado se alícuota y almacena a -80 0C. La cuantificación del número de partículas y unidades formadoras de placa se realiza siguiendo protocolos estándar. El tampón fosfato salino (PBS) con glicerol al 5% es una formulación estándar para el almacenamiento de adenovirus. Sin embargo se han descrito nuevas formulaciones que mejoran Ia estabilidad del virus. Los métodos de purificación del adenovirus que contiene el gen de Ia hialuronidasa para su utilización en el tratamiento del cáncer son los mismos que los descritos para otros adenovirus y vectores adenovirales utilizados en viroterapia y terapia génica del cáncer.
El adenovirus oncolítico de Ia presente invención puede ser administrado a un mamífero, preferiblemente un humano. El propósito de Ia administración del adenovirus oncolítico es terapéutico, incluyendo, pero no limitándose a, melanoma, cáncer de páncreas, cáncer de colon y cáncer de pulmón. También se contempla Ia administración del adenovirus oncolítico en estadios pre-malignos de un tumor.
Se entiende que el adenovirus oncolítico se administra en una forma farmacéuticamente aceptable. Los expertos en Ia materia pueden asegurarse de Ia dosis apropiada usando procedimientos estándares. Se entiende que Ia dosis debe ser una cantidad efectiva del adenovirus oncolítico para que produzca una reducción del tumor en el individuo tratado. La administración puede ser directa del virus al tumor, en Ia cavidad donde se localiza el tumor, en Ia vasculatura del tumor, alrededor del tumor, o por Ia inyección endovenosa sistémica en el paciente. Preferiblemente, Ia administración es sistémica.
Los protocolos para usar los virus descritos en Ia presente invención en el tratamiento del cáncer siguen los mismos procedimientos que los usados en los campos de viroterapia con adenovirus y terapia génica con adenovirus. Existe una amplia experiencia en el uso de adenovirus no oncolíticos y oncolíticos en el campo de Ia terapia génica. Existen numerosas publicaciones de tratamiento de células tumorales en cultivo, en modelos animales y en ensayos clínicos con pacientes. Para el tratamiento de células en cultivos in vitro el adenovirus purificado en cualquiera de las formulaciones descritas más arriba se añade al medio de cultivo para Ia infección de las células tumorales. Para tratar tumores en modelos animales o en pacientes humanos el adenovirus se puede administrar loco-regionalmente por inyección en el tumor o en una cavidad corporal donde se localiza el tumor, o bien sistémicamente por inyección en el torrente sanguíneo.
El adenovirus oncolítico de Ia invención puede administrarse solo o en una composición con transportadores o excipientes farmacéuticamente aceptables. El experto en el tema adaptará Ia composición dependiendo del modo particular de administración. Las composiciones pueden comprender el adenovirus oncolítico como único agente contra el tumor, o en combinación con otro agente terapéutico como un fármaco quimioterapéutico o un vector con un gen terapéutico insertado. También puede combinarse Ia terapia con el adenovirus oncolítico con radioterapia.
A menos que se defina de otro modo, todos los términos técnicos y científicos aquí usados tienen el mismo significado a los comúnmente entendidos por una persona experta en el campo de Ia invención. Métodos y materiales similares o equivalentes a los aquí descritos pueden ser usados en Ia práctica de Ia presente invención. A Io largo de Ia descripción y las reivindicaciones Ia palabra "comprende" y sus variantes no pretenden excluir otras características técnicas, aditivos, componentes o pasos. Para los expertos en Ia materia, otros objetos, ventajas y características de Ia invención se desprenderán en parte de Ia descripción y en parte de Ia práctica de Ia invención. Los siguientes ejemplos y dibujos se proporcionan a modo de ilustración, y no se pretende que sean limitativos de Ia presente invención.
DESCRIPCIÓN DE LOS DIBUJOS
La FIG. 1 (a) muestra Ia estructura de adenovirus oncolíticos caracterizados por contener y expresar el gen de Ia hialuronidasa PH20. El adenovirus AdwtRGD-PH20 contiene el gen de Ia proteína PH20 inserido detrás del gen de Ia fibra adenoviral. La expresión del gen de Ia proteína PH20 está regulada por el promotor principal tardío (MLP) del adenovirus mediante Ia inserción de Ia secuencia de corte y empalme Illa del adenovirus (SA) delante del gen de Ia proteína PH20. La traducción proteica de dicho gen está optimizada gracias a Ia introducción de Ia secuencia kozac (K) justo antes de Ia secuencia de inicio de Ia traducción. Los adenovirus ICOVIR15 e ICOVIR17 son adenovirus de replicación selectiva en tumores. Se caracterizan por contener 4 sitios de unión a E2F y un sitio de unión a Sp1 en el promotor endógeno de E1a. Ambos virus presentan una versión modificada de Ia fibra viral en Ia que se ha incorporado el péptido RGD-4C, y también una versión muíante de Ia proteína E1A a Ia que ha eliminando los aminoácidos 121-129 en su cadena polipeptídica (mutación Δ24). Además, ICOVIR17, contiene el gen de Ia hialuronidasa PH20 del mismo modo que el adenovirus salvaje AdwtRGD-PH20. (b) muestra Ia secuencia incorporada en el adenovirus AdΔ24RGD sustituyendo su secuencia del nucleótido 419 al 422. Esta incorporación se realiza para insertar cuatro sitios de unión a los factores E2F-1 y un sitio de unión al factor Sp1. La secuencias subralladas como "nt 385-419" y "nt 422-461 ) corresponden a las salvajes de AdΔ24RGD. (c) muestra el cásete completo integrado en los genomas de ICOVIR17 y AdwtRGD-PH20 respecto a los genomas de ICOVIR15 y AdwtRGD (SEQ ID NO: 4). Se indica Ia secuencia aceptora de splicing Illa, Ia secuencia Kozac y Ia secuencia de poliadenilación (polA). La secuencia codificante para Ia proteína PH20 va de Ia secuencia kozac a Ia secuencia de poliadenilación. La FIG. 1 corresponde al EJEMPLO 3.
La FIG. 2 muestra Ia secuencia aminoacídica de Ia proteína PH20 (SEQ ID NO: 1 ) y representación gráfica hidropática según el algoritmo de Kyte- Doolittle. La proteína PH20 es una proteína de membrana presente en Ia membrana plasmática y acrosomal de los espermatozoides, (a) La secuencia aminoacídica muestra Ia secuencia hidrofóbica responsable del anclaje de Ia proteína en Ia membrana (secuencia señalada con subrayado). En Ia presente invención, Ia proteína PH20 expresada por los virus, presenta una cola hidrofóbica eliminada. El punto de corte se muestra dentro de un círculo. De ésta forma, Ia proteína PH20 es secretada al medio extracelular. (b) Representación gráfica hidropática de los últimos 100 aminoácidos de Ia proteína PH20 según Kyte-Doolittle. Con una flecha se indica el inicio de Ia cola hidrofóbica que ha sido eliminada.
La FIG. 3 es una demostración de que los adenovirus oncolíticos que contienen el gen de Ia hialuronidasa PH20 expresan una proteína soluble que presenta actividad hialuronidasa. Los geles muestran como las muestras de ácido hialurónico incubadas con los sobrenadantes de los virus que expresan Ia hialuronidasa PH20 han sido digeridas dando lugar a oligosacáridos de diferentes tamaños. Las muestras incubadas con los sobrenadantes de los adenovirus controles (AdwtRGD e ICOVIR15) presentan el ácido hialurónico sin digerir. La FIG. 3 corresponde al EJEMPLO 4.
La FIG. 4 es una demostración de que Ia inserción y expresión del gen de Ia hialuronidasa PH20 no interfiere en Ia replicación viral de un adenovirus de replicación selectiva de tumor. Se infectaron células de las líneas A549 (a) y SKMel28 (b) con los adenovirus oncolíticos ICOVIR15 e ICOVIR17 (que se diferencia de ICOVIR15 por contener el gen de Ia PH20) y se midió Ia cantidad de virus de los extractos celulares (virus total, eje de las x, en TU/ml) a diferentes tiempos (eje de las y, en horas post-infección). Las gráficas muestran como las cinéticas de producción viral son idénticas para los dos virus, demostrando que Ia inserción y expresión del gen de Ia hialuronidasa PH20, en el adenovirus ICOVIR17, no afecta a Ia replicación viral. La FIG. 4 corresponde al EJEMPLO 5.
La FIG. 5 muestra Ia eficacia oncolítica in vitro de un adenovirus oncolítico que contiene y expresa el gen de Ia hialuronidasa PH20. La capacidad oncolítica de un adenovirus que expresa Ia hialuronidasa PH20 (ICOVIR17) se comparó con Ia de un virus oncolítico similar pero sin el gen de Ia hialuronidasa PH20 (ICOVIR15) en dos líneas tumorales que expresan gran cantidad de ácido hialurónico in vitro. las SKMel28 (a) y las PC3 (b). El efecto citopático (CPE) que el virus induce se mide como una disminución de Ia cantidad de proteína en una monocapa celular infectada (método BCA). Las células se sembraron en placas de 96 pocilios a 10000 células por pocilio. Al día siguiente las células se infectaron con diluciones seriadas de virus. Las células infectadas se incubaron durante 5 días, se lavaron con PBS y se medió Ia cantidad de proteína restante en el pocilio. Los resultados muestran que in vitro. Ia expresión de Ia hialuronidasa PH20 no mejora Ia capacidad oncolítica del adenovirus, siendo las curvas de citotoxicidad idénticas para los dos virus. Se representa el % de supervivencia celular vs. TU/células. La FIG. 5 corresponde al EJEMPLO 5.
La FIG. 6 es una demostración in vivo de Ia capacidad antitumoral de un adenovirus oncolítico que expresa Ia hialuronidasa PH20. Se inocularon células de melanoma humano (SKMel28) en cada flanco posterior de ratones atímicos de Ia cepa Balb/c. Una vez los tumores alcanzaron una media de 150 mm3, fueron inyectados con PBS o 1x10e8 unidades de transducción de AdwtRGD-PH20 (10 tumores/grupo), (a) La gráfica muestra Ia media del crecimiento de los tumores (en %) de cada grupo respecto al día 0 en función del tiempo post-administración (en días). El resultado demuestra que un adenovirus oncolítico que expresa el gen de Ia hialuronidasa PH20 presenta una elevada capacidad antitumoral, significativamente distinta al grupo control (PBS), p<0.00001. El 100% de los tumores inyectados con el AdwtRGD-PH20 regresaron entre un 10-50 % a día 27 post-inyección, frente a un 0 % de regresión en el grupo inyectado con PBS. (b) La cantidad de ácido hialurónico de los tumores inyectados con PBS o AdwtRGD-PH20 fue analizado al final del experimento por inmunohistoquímica. Las fotografías muestran que los tumores inyectados con el AdwtRGD-PH20 presentan una cantidad de ácido hialurónico inferior a los tumores controles. La FIG. 6 corresponde al EJEMPLO 6.1.
La FIG. 7 muestra que Ia expresión de Ia hialuronidasa PH20 mejora el efecto antitumoral de un adenovirus oncolítico después de su administración intratumoral. Se inocularon células de melanoma humano (SKMel28) en cada flanco posterior de ratones atímicos de Ia cepa Balb/c. Una vez los tumores alcanzaron una media de 130 mm3, los tumores fueron inyectados con PBS o 1x10e8 unidades de transducción de ICOVIR15 e ICOVIR17 (10 tumores/grupo) en una única dosis, (a) La gráfica muestra Ia media del crecimiento de los tumores (en %) de cada grupo respecto al día 0 en función del tiempo post-administración (en días). El adenovirus oncolítico que expresa Ia hialuronidasa PH20 (ICOVIR17) presenta un mejor efecto antitumoral que el adenovirus control que no expresa dicha hialuronidasa (ICOVIR15). (b) Después de 42 días de tratamiento, los ratones fueron sacrificados y los tumores fueron extraídos y pesados. La tabla muestra un resumen de los valores de volumen tumoral, porcentaje de crecimiento tumoral y peso de los tumores al final del experimento. Los tumores inyectados con ICOVIR17 presentan un peso tumoral significativamente inferior a los tumores inyectados con ICOVIR15 (* p<0.05) y a los tumores inyectados con PBS (# p<0.05). A diferencia de los resultados obtenidos in vitro. donde los virus pueden difundir sin dificultad por Ia monocapa de células, los resultados in vivo demuestran que en el interior de un tumor, donde Ia matriz extracelular dificulta Ia correcta distribución del virus, Ia expresión de Ia hialuronidasa PH20 incrementa Ia potencia antitumoral de un adenovirus oncolítico. La FIG. 7 corresponde al EJEMPLO 6.2.
La FIG. 8 muestra que Ia expresión de Ia hialuronidasa PH20 mejora el efecto antitumoral de un adenovirus oncolítico después de su administración sistémica. Se inocularon células de melanoma humano (SKMel28) en cada flanco posterior de ratones atímicos de Ia cepa Balb/c. Una vez los tumores alcanzaron una media de 100 mm3, los ratones fueron inyectados con PBS ó 5x10e10 partículas físicas de ICOVIR15 e ICOVIR17 (ICOVIR15 armado con PH20)(8-10 tumores/grupo) por vía endovenosa, (a) La gráfica muestra Ia media del crecimiento de los tumores (en %) de cada grupo respecto al día 0 en función del tiempo post-administración (en días). El resultado demuestra que Ia expresión de Ia hialuronidasa PH20 resulta en un aumento de Ia potencia oncolítica del adenovirus, siendo Ia supresión del crecimiento tumoral inducida por ICOVIR17 significativamente mejor a Ia del grupo control (ICOVIR15), * p<0.00001. (b) Las fotografías muestran Ia distribución de los adenovirus ICOVIR15 e ICOVIR17 por las masas tumorales, extraídas al final del experimento (día 48). Los tumores de los ratones inyectados con el adenovirus oncolítico ICOVIR17 muestran zonas necróticas muy extensas (flecha gruesa), zonas con células viables muy reducidas (v), y grandes y numerosos focos de replicación viral (zonas con fluorescencia verde indicadas con flechas delgadas) en comparación con los tumores inyectados con el adenovirus control, ICOVIR15. La FIG. 8 corresponde al EJEMPLO 6.3. La FIG. 9 demuestra que el incremento de Ia actividad antitumoral sistémica de los adenovirus que expresan el enzima hialuronidasa PH20 no está restringido a un único tipo tumoral. (a) La gráfica muestra Ia media del crecimiento de los tumores pancreáticos NP-18 (en %) de cada grupo respecto al día 0 en función del tiempo post-administración (en días). #, significa un resultado significativo (p = 0.02) comparado con los tumores tratados con PBS desde el día 14 al 30; &, significativo (p = 0.05 comparado con los tumores tratados con PBS desde el día 14 al 30; *, significativo (p = 0.02) comparado con los tumores tratados con ICOVIR-15 desde el día 12 al 30. (b) Las fotografías muestran Ia distribución de los adenovirus ICOVIR15 e ICOVIR17 en los tumores NP-18 a día 30. *, p = 0.01 comparado con los tumores tratados con ICOVIR15. "% a.p." significa "% área positiva". La FIG. 9 corresponde al EJEMPLO 6.4.
La FIG. 10 (a) muestra Ia estructura de adenovirus oncolíticos ICOVIR17 e I COVI R17RG DK. (b) muestra Ia secuencia aminoacídica de Ia versión modificada de Ia fibra en ICOVIR17RGDK (SEQ ID NO: 9). La secuencia subrayada corresponde a los aminoácidos 91RGDK94 que difieren respecto a Ia forma nativa de Ia fibra del adenovirus humano tipo 5. La FIG. 10 corresponde al EJEMPLO 8.
La FIG. 11 muestra Ia capacidad oncolítica de los dos adenovirus (ICOVIR17 e ICOVIR17RGDK) en dos líneas tumorales, una de pulmón A549 (A) y otra de páncreas NP-18 (B). Se representa el % de supervivencia celular vs. TU/células. La FIG. 11 corresponde al EJEMPLO 9.
EJEMPLOS
EJEMPLO 1. Construcción de los adenovirus oncolíticos
Se construyeron dos adenovirus oncolíticos que contenían el gen de Ia hialuronidasa PH20, el adenovirus AdwtRGD-PH20 y el adenovirus ICOVIR17.
El cDNA de Ia hialuronidasa PH20 se obtuvo mediante Ia amplificación por PCR de los diferentes exones de Ia proteína a partir del genoma de Ia línea celular A549 y Ia posterior unión de estos exones con oligonucleótidos específicos que contienen Ia diana del enzima de restricción Mfel. El fragmento resultante se digirió con Mfel y se clonó por ligación en el plásmido lanzadera, pNKFiberRGD (que contiene Ia secuencia de Ia fibra adenoviral modificada con RGD), para dar lugar al plásmido pNKFiberPH20. El cDNA correspondiente a Ia proteína PH20 clonada en el plásmido pNKFiberPH20 se muestra en Ia SEQ ID NO: 2. La SEQ ID NO: 2 muestra los nucleótidos codificantes para Ia proteína PH20 (isoforma con número de acceso al GenBank NP_694859.1 ) desde su inicio de transcripción (ATG) hasta Ia posición 1467. La secuencia nucleotídica de Ia región 1468 a Ia 1527 codifica para Ia cola hidrofóbica de Ia proteína, responsable de su anclaje a Ia membrana. Dicha secuencia ha sido eliminada y no se muestra en Ia secuencia. Después del nucleótido 1468 se ha añadido el codón de parada de Ia traducción TAA.
EJEMPLO 2. Construcción del adenovirus AdwtRGD-PH20: Para generar el adenovirus AdwtRGD-PH20, el gen de Ia fibra adenoviral del plásmido pVK50cau (que contiene Ia secuencia completa del Ad5 con una diana Swal en Ia fibra) fue reemplazado por recombinación homologa en levaduras por el gen de Ia fibra seguido del gen de Ia hialuronidasa PH20 del plásmido pNKFiberPH20 digerido con Notl/Kpnl.
El adenovirus AdwtRGD-PH20, caracterizado por expresar el gen de Ia hialuronidasa PH20 bajo el control del promotor principal tardío, y contener el tripéptido RGD en Ia fibra adenoviral, se generó por digestión con Pací del plásmido pAdwtRGD-PH20 y transfección en células HEK293. El adenovirus AdwtRGD, previamente descrito, se caracteriza por contener el tripéptido RGD en Ia fibra adenoviral (cfr. M. Majem et al., "Control of E1 A under an E2F-1 promoter insulated with the myotonic dystrophy locus insulator reduces the toxicity of oncolytic adenovirus Ad-Delta24RGD", Cáncer gene therapy 2006, vol. 13, pp. 696-705). El AdwtRGD se construyó mediante digestión del plásmido pVK503 que contiene el genoma de Ad5 completo con Ia fibra modificada RGD (cfr. I. Dmitriev et al., "An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism", J. Virol. 1998, vol. 72, pp. 9706-13) con Pací y posterior transfección de células 293. EJEMPLO 3. Construcción del adenovirus ICOVIR17: Para generar este adenovirus se usó el plásmido adenoviral plCOVIR17. Para generar este plásmido, el gen de Ia fibra adenoviral del plásmido plCOVIR15 fue reemplazado por recombinación homologa en levaduras por el gen de Ia fibra seguido del gen de Ia hialuronidasa PH20 del plásmido pAdwtRGD-PH20 digerido con Spel/Pacl.
El adenovirus ICOVIR15, proviene del adenovirus AdΔ24RGD que se caracteriza por contener Ia eliminación ?24 en Ia secuencia codificante para Ia proteína E1a. Esta eliminación afecta a Ia interacción de E1a con pRB. AdΔ24RGD también tiene Ia inserción del péptido RGD en Ia fibra adenoviral para aumentar Ia infectividad del virus. Estas dos modificaciones se describen en K. Suzuki et al., "A conditionally replicative adenovirus with enhanced infectivity shows improved oncolytic potency", Clin Cáncer Res 2001 , vol. 7, pp. 120-6. A partir de AdΔ24RGD, se realizó Ia inserción de cuatro sitios de unión a E2F-1 y un sitio de unión a Sp1 en el promotor endógeno de E1a para controlar Ia expresión de E1a. Así se obtiene ICOVIR15. Esta inserción se realizó mediante sustitución de Ia secuencia 419-422 del genoma por Ia secuencia con los 4 sitios de unión a E2F-1 y un sitio de unión a Sp1 , de manera que Ia secuencia final es Ia que figura en Ia SEQ ID NO: 3 y Ia FIG. 1 (b). Para realizarlo se creó un sitio único de corte BsiWI por mutagénesis dirigida en el promotor E1A del pEndK/Spe (cfr. J. E. Carette et al., "Conditionally replicating adenoviruses expressing short hairpin RNAs silence the expression of a target gene in cáncer cells", Cáncer Res 2004, vol. 64, pp. 2663-7). El sitio de unión a Sp1 se introdujo en el plásmido pEndK/Spe con el sitio BsiWI mediante Ia ligación de dicho plásmido digerido con BsiWI con los oligonucleótidos Sp1 F (5'-GTACGTCGACCACAAACCCC GCCCAGCGTCTTGTCATTGGCGTCGACGCT-3' SEQ ID NO: 5) y SpI R (5'- GTACAGCGTCGACGCCAATGACAAGACGCTGGGCGGGGTTTGTGGTCG AC-31 SEQ ID NO: 6) emparejados entre sí. Los sitios de unión a E2F se introdujeron mediante Ia unión de los oligonucleótidos E2FF2 (5'-GTACGTCG GCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCGTAAAAGTG GTTCGAA-3' SEQ ID NO: 7) y E2FR2 (5'-GTACTTCGAACCACTTTTACGCG CCAAATCCTTTTTGCCGCGAAAGAGCCACGAGCCGCCGAC-3' SEQ ID NO: 8) emparejados entre sí, para crear el plásmido pEndK415Sp1 E2F2. A continuación se introdujo por recombinación homologa en levaduras Ia secuencia CAU, que contiene los elementos necesarios para Ia replicación del plásmido en levaduras (un centrómero, Ia secuencia de recombinación autónoma ARS y el marcador de selección URS3, para crear el plásmido pEndK415Sp1 E2F2CAU. Finalmente, se realizó una recombinación homologa en levaduras del plásmido pEndK415Sp1 E2F2CAU digerido con Kpnl con el genoma adenoviral del adenovirus Ad?24RGD para construir el plCOVIR15cau. ICOVIR15 se obtuvo por transfección de Ia digestión Pací del plCOVIR15cau a células HEK293.
El virus ICOVIR17, que contiene las mismas modificaciones que ICOVIR15, más Ia inserción del gen de Ia hialuronidasa detrás del gen de Ia fibra adenoviral, se generó por digestión con Pací del plásmido plCOVIR17 y transfección en células HEK293. La estructura correcta de los genomas de AdwtRGD-PH20 e ICOVIR17 se verificó por restricción con Hindlll. Adicionalmente se secuenció Ia región del gen PH20 con oligonucleótidos específicos.
El cásete completo integrado en los genomas de ICOVIR17 y AdwtRGD- PH20 respecto a los genomas de ICOVIR15 y AdwtRGD se representa en Ia FIG. 1 (c) y en Ia SEQ ID NO: 4: La secuencia codificante para Ia proteína PH20 va de Ia secuencia kozac a Ia secuencia de poliadenilación.
EJEMPLO 4. Expresión de una proteína soluble con actividad hialuronidasa por un adenovirus que contiene el gen de Ia hialuronidasa PH20
Para demostrar que un adenovirus que contiene el gen de Ia hialuronidasa PH20 expresa una proteína soluble con actividad hialuronidasa se procedió a infectar cultivos celulares de Ia línea A549 con los virus AdwtRGD, AdwtRGD- PH20, ICOVIR15 e ICOVIR17 usando una multiplicidad de infección que permitía más del 80 % de infección (20 M. Oí). Después de 24 h postinfección, el medio de infección se retiró y se añadió medio fresco. Después de 24 h más, el medio fresco (o sobrenadante) se recogió y se concentró por filtración en una columna de Amicon Ultra-4 (Millipore, Billerica, USA), según las instrucciones del fabricante. Los sobrenadantes concentrados se incubaron toda Ia noche a 370C con una solución de ácido hialurónico (1.5 mg/ml) en un tampón fosfato (pH=6) que contenía 0.1 M NaCI y 0.05 % BSA. El ácido hialurónico digerido se analizó mediante una electroforesis en un gel de poliacrilamida al 15 % (cfr. M. Ikegami-Kawai et al., "Microanalysis of hyaluronan oligosaccharides by polyacrylamide gel electrophoresis and its application to assay of hyaluronidase activity", Analvtical biochemistrv 2002, vol. 311 , pp. 157-65). Los oligosacáridos resultantes de Ia digestión del ácido hialurónico se fijaron en Ia matriz del gel mediante un baño de 30 min en una solución de azul alcian. Finalmente, los oligosacáridos fueron teñidos con nitrato de plata. El resultado se muestra en Ia FIG. 3. Se demuestra que los sobrenadantes de las células infectadas con los adenovirus que contienen el gen de Ia hialuronidasa PH20 (AdwtRGD-PH20 e ICOVIR17) contienen una proteína soluble capaz de digerir el ácido hialurónico (un polisacárido de elevado peso molecular) en oligosacáridos de 5 a más de 50 unidades repetidas de disacáridos.
EJEMPLO 5. Ausencia de efectos en Ia replicación viral y en Ia citotoxicidad in vitro del adenovirus oncolítico que expresa el gen de Ia hialuronidasa PH20
Para comprobar que Ia inserción del gen de Ia hialuronidasa PH20 no afectaba a Ia replicación viral, se infectaron células de las líneas tumorales A549 y SKMel-28 con los adenovirus oncolíticos ICOVIR15 e ICOVIR17. Después de 4 h post-infección, el medio se retiró y se añadió medio fresco. Los extractos celulares totales se recogieron a diferentes tiempos postinfección y se sometieron a tres ciclos de congelación-descongelación para liberar el virus. La cantidad de virus en el extracto celular se determinó por infección en HEK293 y tinción anti-hexón (cfr. M. Majem supra). El resultado se muestra en Ia FIG. 4. La inserción del gen de Ia hialuronidasa PH20 no afecta a Ia replicación del adenovirus ICOVIR17, siendo ésta idéntica a Ia del adenovirus control.
Para demostrar el efecto de Ia expresión de Ia hialuronidasa PH20 en Ia citotoxicidad de un adenovirus oncolítico in vitro. se infectaron células de las líneas tumorales PC3 y SKMel-28 con diluciones seriadas de los virus ICOVIR15 e ICOVIR17. Cinco y seis días post-infección, respectivamente, se evaluó espectrofotométricamente Ia cantidad de proteína como reflejo de Ia supervivencia celular. Los resultados se muestran en Ia FIG. 5. La capacidad lítica de ICOVIR17 en las dos líneas tumorales es Ia misma que Ia de ICOVIR15, indicando que Ia expresión de Ia hialuronidasa PH20 no aporta ninguna ventaja in vitro. EJEMPLO 6. Utilización del adenovirus que se replica y que contiene el gen de Ia hialuronidasa PH20 para tratar eficazmente tumores
6.1. Se realizó un experimento in vivo con ratones atímicos de Ia cepa Balb/c que contenían tumores SKMel-28. Un total de 5 x 106 células tumorales de Ia línea SKMel-28 se inyectaron subcutáneamente en cada flanco posterior del ratón. Después de 21 días los ratones con tumores formados (que alcanzan 150 mm3) se distribuyeron en los distintos grupos experimentales (n=10 por grupo). Los tumores del grupo control recibieron una única inyección intratumoral de tampón salino (20 μl). Los ratones del grupo tratado con AdwtRGD-PH20 recibieron una inyección intratumoral (20 μl) de 1x108 unidades de transducción del virus por tumor (equivalente a 2x109 partículas virales ó vp). Los tumores se midieron cada dos o tres días con un pie de rey y su volumen se estimó según Ia fórmula: V (mm3)= A (mm) x B2 (mm2) x p/6, en donde A es Ia longitud mayor o longitudinal, y B es Ia longitud transversal. La FIG. 6 muestra el porcentaje de crecimiento tumoral respecto al inicio del tratamiento (día 0). Los resultados se presentan como media ± S. E. La existencia de diferencias significativas entre los resultados se calculó usando un ensayo no paramétrico de datos no apareados de Mann-Whitney. Las curvas de crecimiento se compararon usando un análisis de Ia variancia. Los resultados se consideraron significativos si p<0.05. El tratamiento de los tumores con el adenovirus AdwtRGD-PH20 dio lugar a una regresión tumoral en el 100 % de los tumores tratados. El % de crecimiento tumoral fue significativamente menor al grupo control des de los primeros días postinyección. El análisis de los tumores al final del experimento reveló una disminución en Ia cantidad de ácido hialurónico contenido Ia matriz extracelular de los tumores inyectados con el AdwtRGD-PH20.
6.2. En otro experimento el tratamiento se realizó por inyección intratumoral de ICOVIR15 e ICOVIR17. Se implantaron tumores de Ia línea celular de melanoma humana SKMel-28 en ratones atímicos BaIb C nu/nu, y una vez establecidos fueron tratados por administración intratumoral de PBS o 1x108 unidades de transducción de los virus ICOVIR15 e ICOVIR17 (equivalente a 2x109 partículas virales ó vp). Los resultados se muestran en Ia FIG. 7. El tratamiento con ICOVIR17 demostró actividad oncolítica que resultó en una supresión del crecimiento tumoral significativamente distinta al grupo control (PBS), p<0.05. Al final del experimento los tumores fueron extraídos y pesados. La tabla de Ia FIG. 7 muestra las medias de volumen tumoral, porcentaje de crecimiento tumoral y peso de los tumores al finalizar el experimento. El peso de los tumores inyectados con ICOVIR17 es significativamente inferior al de los tumores tratados con los grupos controles, PBS (# p<0.05) e ICOVIR15 (* p<0.05).
6.3. En otro experimento el tratamiento se realizó por inyección sistémica de ICOVIR15 e ICOVIR17. Se implantaron tumores de Ia línea celular de melanoma humana SKMel-28 en ratones atímicos BaIb C nu/nu, y una vez establecidos fueron tratados por administración en Ia vena de Ia cola con PBS o 5x1010 partículas físicas de los virus ICOVIR15 e ICOVIR17. Los resultados se muestran en Ia FIG. 8. El tratamiento con ICOVIR17 demostró actividad oncolítica que resultó en una supresión del crecimiento tumoral significativamente distinta a los grupos controles, PBS (# p<0.0001 ) e ICOVIR15 (* p<0.00001 ). Al finalizar el experimento, los tumores fueron extraídos y congelados en OCT. Las diferentes secciones de los tumores congelados en OCT se trataron con una anticuerpo a-hexon (proteína de Ia cápside del adenovirus) y se contratiñeron con 4',6'-diamin¡d¡no-2-fenil¡ndol. La actividad antitumoral de ICOVIR17 correlaciona con Ia replicación del adenovirus a nivel ¡ntratumoral, evaluada en los tumores obtenidos a día 48 post-inyección. Los tumores tratados con ICOVIR17 presentan grandes zonas necróticas, una mejor distribución viral, y menos zonas de células viables que los tumores inyectados con ICOVIR15.
6.4. En otro experimento el tratamiento se realizó por inyección sistémica de ICOVIR15 e ICOVIR17 en ratones atímicos BaIb C nu/nu donde se habían implantado tumores de Ia línea celular de adenocarcinoma pancreático humano NP-18. Una vez establecidos los tumores hasta una media de 60 mm3, los animales fueron tratados por administración en Ia vena de Ia cola con PBS ó 5x1010 partículas físicas de los virus ICOVIR15 e ICOVIR17 (10 tumores/grupo). Los resultados se muestran en Ia FIG. 9, donde se demuestra que el incremento de Ia actividad antitumoral de los adenovirus que expresan el enzima hialuronidasa PH20 no está restringido a un único tipo tumoral. La FIG. 9 (a) demuestra que Ia expresión de Ia hialuronidasa PH20 nuevamente resulta en un aumento de Ia potencia oncolítica del adenovirus, respecto al grupo PBS y al del virus control (ICOVIR15), #, significativo (p = 0.02) comparado con los tumores tratados con PBS desde el día 14 al 30; &, significativo (p = 0.05 comparado con los tumores tratados con PBS desde el día 14 al 30; *, significativo (p = 0.02) comparado con los tumores tratados con ICOVIR15 desde el día 12 al 30. A día 30, los tumores fueron extraídos para congelación en OCT1 y posteriormente se trataron con una anticuerpo α- hexon y se contratiñeron con DAPI.
Para cuantificar el nivel de replicación ¡ntratumoral de ICOVIR-17, se analizaron 5 áreas viables de cada uno de los tumores (7/10 animales por grupo) y se estimó el porcentaje de áreas positivas usando un programa informático (software ImageJ). Los resultados de este análisis se muestran en Ia FIG. 9 (b) donde se aprecia que los tumores NP-18 tratados con ICOVIR17 presentan significativamente mayor positividad para presencia de adenovirus respecto a los tumores tratados con ICOVIR15 (*, significativo p=0.01 ).
EJEMPLO 7. Perfil toxicolóqico de los adenovirus oncolíticos que expresan el gen de Ia hialuronidasa
Para comprobar que Ia inserción del gen de Ia hialuronidasa no modifica substancialmente el patrón de toxicidad inducido por los adenovirus oncolíticos después de ser administrados por vía endovenosa, se escogió un modelo animal donde el adenovirus humano es capaz de replicar, como es el modelo de hámster sirio dorado (Mesocricetus auratus). El hámster constituye un modelo animal permisivo a Ia replicación del adenovirus humano. Se usaron animales hembras inmunocompetentes de 5 semanas de edad (5-6 animales/grupo), que recibieron una única dosis de 4 x 1011 vp of ICOVIR15 ó ICOVIR17 por vía intravenosa a través de Ia vena cefálica en el día 0 y en un volumen de 300 μl de PBS. El grupo control se inyectó con un volumen equivalente. Cinco días después de Ia administración, los animales fueron sacrificados y de cada uno de ellos se extrajo sangre total y suero mediante punción cardiaca, para proceder a Ia monitorización de parámetros de toxicidad hepáticos (enzimas AST y ALT) así como al recuento de las distintas poblaciones sanguíneas mediante citometría de flujo (hemograma). Simultáneamente se obtuvieron los hígados de los animales que se fijaron en paraformaldehido al 4% para su posterior tinción con eosina / hematoxilina.
Los resultados del estudio de toxicidad hepática indicaron que ambos virus inducen cierta inflamación hepática en este modelo con elevaciones de los niveles de las transaminasas AST y ALT, pero no se observaron diferencias entre los animales tratados con ICOVIR15 y los tratados con ICOVIR17. A nivel hematológico, ambos virus provocaban elevaciones de Ia poblaciones de neutrófilos, basófilos y monocitos, así como reducciones en el recuento plaquetario con respecto a los animales control, pero nuevamente sin diferencias entre sí.
EJEMPLO 8. Construcción del virus ICOVIR17RGDK
Para generar este adenovirus se usó el plásmido adenoviral plCOVIR17RGDK. En este plásmido el gen de Ia fibra del adenovirus tipo 5 nativo ha sido reemplazado por una versión modificada en su dominio de unión a heparan-sulfatos (aminoácidos 91 KKTK94 de Ia secuencia polipeptídica reemplazados por 91 RGDK94). El plásmido plCOVIR17RGDK se construyó por recombinación homologa en levaduras entre el producto de Ia digestión parcial de plCOVIR17 con Ndel y Ia digestión con EcoRI del plásmido pBSattKKT, (que contiene Ia versión modificada de Ia fibra del adenovirus y que se describe en N. Bayó-Puxan et al. "Replacement of adenovirus type 5 fiber shaft heparan sulfate proteoglycan-binding domain with RGD for improved tumor infectivity and targeting". Human Gene Therapy 2009, vol. 20, pp 1214-21 ).
La FIG. 10 muestra Ia localización de Ia modificación 91 RGDK94 en el contexto de ICOVIR17RGDK, así como Ia secuencia completa de Ia proteína fibra en este adenovirus. El adenovirus ICOVIR17 contiene una versión del gen de Ia fibra adenoviral en Ia que se ha inserido el péptido RGD-4C (Cys- Asp-Cys-Arg-Gly-Asp-Cys-Phe-Cys; CDCRGDCFC. SEQ ID NO: 10) en Ia región Hl de Ia zona de Ia "cabeza" (dominio knob) de Ia proteína (bucle hiper-variable poco conservado evolutivamente y muy expuesto de Ia cápside adenoviral). ICOVIR17RGDK es totalmente análogo a ICOVIR17 excepto en el gen de Ia fibra, pues en este caso Ia fibra de ICOVIR17RGDK sólo difiere de Ia forma nativa del adenovirus humano tipo 5 en que se han reemplazado los aminoácidos 91KKTK94 por el péptido de alta afinidad por integrinas 91RGDK94, en el dominio del "mango" de Ia proteína (dominio shaft) (SEQ ID NO: 9).
EJEMPLO 9. Eficacia oncolítica del adenovirus con Ia modificación en Ia cápside ICOVIR17RGDK
Tal y como se muestra en Ia FIG. 11 , Ia modificación de Ia cápside presente en ICOVIR17RGDK no modifica Ia citotoxicidad in vitro de un adenovirus oncolítico que contiene y expresa el gen de Ia hialuronidasa PH20. La capacidad oncolítica de los dos adenovirus que expresan Ia hialuronidasa PH20 (ICOVIR17 y ICOVR17RGDK) se compararon en dos líneas tumorales, una de pulmón A549 (FIG. 11 (a)) y otra de páncreas NP-18 (FIG. 11 (b)). El efecto citopático que el virus induce se mide como una disminución de Ia cantidad de proteína en una monocapa celular infectada (método BCA). Las células de las dos líneas tumorales se sembraron en placas de 96 pocilios a 10000 células por pocilio. Al día siguiente las células se infectaron con diluciones seriadas de virus. Las células infectadas se incubaron durante 6 días, se lavaron con PBS y se midió Ia cantidad de proteína restante en el pocilio. Los resultados muestran que in vitro. Ia modificación de Ia cápside no modula significativamente Ia capacidad oncolítica de los adenovirus.
EJEMPLO 10. Perfil toxicolóqico de distintos adenovirus oncolíticos que expresan el gen de Ia hialuronidasa
Para evaluar el impacto de Ia modificación RGDK en el entorno de los adenovirus oncolíticos que expresan hialuronidasa se usó el modelo de ratón inmunocompetente BaIbC sin tumor. En este caso se usaron machos de 6 semanas de edad (7 animales/grupo) que recibieron una única dosis de 5 x 1010 vp of ICOVIR17 ó ICOVIR17RGDK por vía intravenosa a través de Ia vena de Ia cola en el día 0 y en un volumen de 150 μl de PBS. A día 7 (2 animales/grupo) y día 12 post-administración (5 animales/grupo) los animales fueron sacrificados y de cada uno de ellos se extrajo sangre total y suero mediante punción cardiaca, para proceder al recuento de las distintas poblaciones sanguíneas mediante citometría de flujo (hemograma) y también a Ia monitorización de parámetros de toxicidad hepáticos (enzimas AST y ALT). El resultado de este estudio mostró que ambos virus incrementan los niveles de enzimas a día 7 pero que éstos tienden a normalizarse a día 12. No se apreciaron diferencias significativas entre los grupos correspondientes a ICOVIR17 e ICOVIR17RGDK en ningún punto, pese a que sí que se observó una tendencia a menor hepatotoxicidad (niveles de AST y ALT ligeramente inferiores) en el grupo de los animales inyectados con ICOVIR17RGDK con respecto a grupo ICOVIR17. En cuanto al perfil hematológico de los animales obtenido a día 12 post-administración, se observó que no existían diferencias significativas ni en Ie serie blanca ni en el recuento plaquetario de los animales, excepto en el número de linfocitos presentes en Ia sangre de los animales tratados con ICOVIR17, que era menor que el de Ia sangre de los animales de los grupos PBS e ICOVIR17RGDK.

Claims

REIVINDICACIONES
1. Adenovirus oncolítico que comprende una secuencia que codifica una enzima hialuronidasa insertada en su genoma.
2. Adenovirus oncolítico según Ia reivindicación 1 , donde el adenovirus es un adenovirus humano.
3. Adenovirus oncolítico según Ia reivindicación 2, donde el adenovirus humano se selecciona del grupo que consiste en los adenovirus humanos de serotipo 1-51 y derivados de los mismos.
4. Adenovirus oncolítico según Ia reivindicación 3, donde el adenovirus humano es de serotipo 5.
5. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-4, donde Ia enzima hialuronidasa es una hialuronidasa testicular de mamífero.
6. Adenovirus oncolítico según Ia reivindicación 5, donde Ia enzima hialuronidasa es Ia hialuronidasa testicular humana.
7. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-6, donde Ia secuencia de Ia enzima tiene eliminada Ia secuencia correspondiente al dominio de unión a membrana para que Ia enzima sea soluble.
8. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-7, donde Ia secuencia de Ia enzima está insertada en el adenovirus oncolítico después de Ia secuencia de nucleótidos de Ia fibra adenoviral.
9. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-8, donde Ia expresión de Ia enzima está controlada por un promotor operativo en células animales.
10. Adenovirus oncolítico según Ia reivindicación 9, donde el promotor se selecciona del grupo que consiste en el promotor del citomegalovirus, el promotor principal tardío del adenovirus, el promotor SV40, el promotor de Ia timidin quinasa del herpes simplex virus, el promotor RSV, el promotor EF1 alfa, el promotor de Ia beta-actina, el promotor de Ia IL-2 humana, el promotor de Ia IL-4 humana, el promotor de IFN, el promotor de E2F y el promotor humano GM-CSF.
11. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-10, donde el adenovirus comprende un promotor específico de tejido o de tumor, donde dicho promotor controla Ia expresión de uno o más genes del grupo E1a, E1b, E2 y E4, para conseguir replicación selectiva en tumores.
12. Adenovirus oncolítico según Ia reivindicación 11 , donde el promotor se selecciona del grupo que consiste en el promotor de E2F, el promotor de Ia telomerasa hTERT, el promotor de Ia tirosinasa, el promotor del antígeno específico de próstata, el promotor de Ia alfa-fetoproteína, y el promotor de Ia COX-2.
13. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-12, donde el adenovirus tiene mutaciones en uno o más genes del grupo E1a, E1 b, E4 y VA-RNAs, para conseguir replicación selectiva en tumores.
14. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-13, donde el adenovirus tiene modificaciones en su cápside para aumentar su infectividad o dirigirlo a un receptor presente en una célula tumoral.
15. Adenovirus oncolítico según Ia reivindicación 14, donde Ia modificación de Ia cápside es Ia sustitución del dominio de unión KKTK de los heparan sulfatos presente en Ia fibra adenoviral por el dominio RGDK.
16. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-15, donde el adenovirus comprende una secuencia que optimiza Ia traducción proteica de Ia secuencia que codifica Ia hialuronidasa.
17. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-16, donde el adenovirus comprende una secuencia que promueve Ia expresión de Ia secuencia que codifica Ia hialuronidasa.
18. Adenovirus oncolítico según Ia reivindicación 17, donde Ia secuencia que promueve Ia expresión se selecciona del grupo que consiste en una secuencia de corte y empalme que permite el procesamiento del RNA, una secuencia IRES y Ia secuencia 2A de picornavirus.
19. Adenovirus oncolítico según cualquiera de las reivindicaciones 1-18, donde el adenovirus comprende uno o más genes insertados en su genoma.
20. Composición farmacéutica que comprende una cantidad terapéuticamente efectiva del adenovirus oncolítico definido en cualquiera de las reivindicaciones 1-19, junto con portadores o excipientes farmacéuticamente aceptables.
21. Uso del adenovirus oncolítico definido en cualquiera de las reivindicaciones 1-19 para Ia fabricación de un medicamento para el tratamiento de un cáncer o de un estado pre-maligno del mismo, en un mamífero incluyendo un humano.
PCT/ES2010/000196 2009-04-23 2010-05-05 Adenovirus oncolíticos para el tratamiento del cáncer WO2010128182A1 (es)

Priority Applications (14)

Application Number Priority Date Filing Date Title
CA2761183A CA2761183C (en) 2009-05-06 2010-05-05 Oncolytic adenoviruses for treating cancer
US13/318,876 US10316065B2 (en) 2009-05-06 2010-05-05 Oncolytic adenoviruses for treating cancer
AU2010244348A AU2010244348B2 (en) 2009-05-06 2010-05-05 Oncolytic adenoviruses for treating cancer
RU2011149458/10A RU2536931C2 (ru) 2009-05-06 2010-05-05 Онколитический аденовирус для лечения рака, его применение и фармацевтическая композиция, содержащая его
KR1020117029097A KR101878274B1 (ko) 2009-05-06 2010-05-05 암 치료용 암 용해성 아데노바이러스
MX2011011818A MX2011011818A (es) 2009-05-06 2010-05-05 Adenovirus oncoliticos para el tratamiento del cancer.
JP2012509064A JP2012525833A (ja) 2009-05-06 2010-05-05 癌治療のための腫瘍溶解アデノウイルス
CN201080028895XA CN102548584A (zh) 2009-05-06 2010-05-05 用于治疗癌症的溶瘤腺病毒
ES10772050.0T ES2600955T3 (es) 2009-05-06 2010-05-05 Adenovirus oncolíticos para el tratamiento del cáncer
EP10772050.0A EP2428229B1 (en) 2009-05-06 2010-05-05 Oncolytic adenoviruses for treating cancer
BRPI1011445A BRPI1011445B8 (pt) 2009-05-06 2010-05-05 Adenovírus oncolíticos para o tratamento de câncer
IL216190A IL216190A0 (en) 2009-04-23 2011-11-07 Oncolytic adenoviruses for treating cancer
HK12108533.3A HK1167818A1 (zh) 2009-05-06 2012-08-31 用於治療癌症的溶瘤腺病毒
US16/405,285 US20190345204A1 (en) 2009-05-06 2019-05-07 Oncolytic adenoviruses for treating cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP200901201 2009-05-06
ES200901201A ES2385251B1 (es) 2009-05-06 2009-05-06 Adenovirus oncolíticos para el tratamiento del cáncer.

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/318,876 A-371-Of-International US10316065B2 (en) 2009-05-06 2010-05-05 Oncolytic adenoviruses for treating cancer
US16/405,285 Continuation US20190345204A1 (en) 2009-05-06 2019-05-07 Oncolytic adenoviruses for treating cancer

Publications (1)

Publication Number Publication Date
WO2010128182A1 true WO2010128182A1 (es) 2010-11-11

Family

ID=43050014

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2010/000196 WO2010128182A1 (es) 2009-04-23 2010-05-05 Adenovirus oncolíticos para el tratamiento del cáncer

Country Status (14)

Country Link
US (2) US10316065B2 (es)
EP (1) EP2428229B1 (es)
JP (1) JP2012525833A (es)
KR (1) KR101878274B1 (es)
CN (2) CN102548584A (es)
AU (1) AU2010244348B2 (es)
BR (1) BRPI1011445B8 (es)
CA (1) CA2761183C (es)
ES (2) ES2385251B1 (es)
HK (2) HK1167818A1 (es)
MX (1) MX2011011818A (es)
PL (1) PL2428229T3 (es)
RU (1) RU2536931C2 (es)
WO (1) WO2010128182A1 (es)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103405480A (zh) * 2013-05-03 2013-11-27 浙江理工大学 10-羟基喜树碱-丁二酸与腺病毒结合物及制法和用途
WO2020047345A1 (en) 2018-08-31 2020-03-05 Yale University Compositions and methods of using cell-penetrating antibodies in combination with immune checkpoint modulators
WO2021024207A1 (en) 2019-08-05 2021-02-11 Mesoblast International Sarl Cellular compositions comprising viral vectors and methods of treatment
WO2022034506A1 (en) 2020-08-10 2022-02-17 Mesoblast International Sárl Cellular compositions and methods of treatment
US11896635B2 (en) 2017-11-08 2024-02-13 Kagoshima University Oncolytic virus (oncolytic immunotherapy) capable of effectively treating even metastatic cancer while ensuring safety, with expression control system providing optimal expression level of mounted immunogenic gene
WO2024081736A2 (en) 2022-10-11 2024-04-18 Yale University Compositions and methods of using cell-penetrating antibodies

Families Citing this family (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2177620T3 (en) 2003-03-05 2015-01-26 Halozyme Inc Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, use and pharmaceutical compositions comprising thereof
ES2385251B1 (es) * 2009-05-06 2013-05-06 Fundació Privada Institut D'investigació Biomèdica De Bellvitge Adenovirus oncolíticos para el tratamiento del cáncer.
JP6576326B2 (ja) 2013-03-14 2019-09-18 ソーク インスティテュート フォー バイオロジカル スタディーズ 腫瘍溶解性アデノウイルス組成物
CN103614416B (zh) * 2013-09-30 2016-09-07 中国人民解放军第二军医大学东方肝胆外科医院 一种携带人穿膜肽p53与GM-CSF基因的重组溶瘤腺病毒及其用途
PL3021859T3 (pl) * 2013-10-25 2018-06-29 Psioxus Therapeutics Limited Adenowirusy onkolityczne wyposażone w geny heterolityczne
EP2940128A1 (en) * 2014-04-30 2015-11-04 Institut d'Investigació Biomèdica de Bellvitge (IDIBELL) Adenovirus comprising an albumin-binding moiety
DK3186281T3 (da) 2014-08-28 2019-06-11 Halozyme Inc Kombinationsterapi med et hyaluronan-nedbrydende enzym og en immun-checkpoint-inhibitor
BR112017007765B1 (pt) 2014-10-14 2023-10-03 Halozyme, Inc Composições de adenosina deaminase-2 (ada2), variantes do mesmo e métodos de usar o mesmo
GB201505860D0 (en) * 2015-04-07 2015-05-20 Agalimmune Ltd Therapeutic compositions and methods of use for treating cancer
SI3288573T1 (sl) 2015-04-30 2020-06-30 Psioxus Therapeutics Limited Onkolitični adenovirus, ki kodira protein B7
CA2985029A1 (en) * 2015-05-04 2016-11-10 Vcn Biosciences Sl Oncolytic adenoviruses with mutations in immunodominant adenovirus epitopes and their use in cancer treatment
CN104946601A (zh) * 2015-05-28 2015-09-30 金宁一 重组溶瘤腺病毒及其应用
CN108697746A (zh) 2015-12-17 2018-10-23 皮斯奥克斯治疗公司 编码抗tcr复合体抗体或片段的病毒
AU2017222568B2 (en) 2016-02-23 2020-09-10 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
KR20180112024A (ko) 2016-02-23 2018-10-11 더 솔크 인스티튜트 포 바이올로지칼 스터디즈 바이러스 동역학에 미치는 영향 최소화를 위한 치료용 아데노바이러스의 외인성 유전자 발현
CN108350468B (zh) * 2016-04-22 2020-10-30 深圳市亦诺微医药科技有限公司 用于癌症治疗的溶瘤性单纯疱疹病毒(oHSV)专性载体及其构建体的构建
WO2017190147A1 (en) * 2016-04-29 2017-11-02 Inovio Pharmaceuticals, Inc. The in vivo use of chondroitinase and/or hyaluronidase to enhance delivery of an agent
WO2017201635A1 (zh) * 2016-05-23 2017-11-30 蔡胜和 透明质酸酶的细胞表达及其在实体瘤细胞治疗中的应用
EP3478321A4 (en) * 2016-06-30 2020-04-22 Oncorus, Inc. PSEUDOTYPIZED ONCOLYTIC VIRAL ADMINISTRATION OF THERAPEUTIC POLYPEPTIDES
GB201713765D0 (en) 2017-08-28 2017-10-11 Psioxus Therapeutics Ltd Modified adenovirus
CN109982709A (zh) * 2016-11-17 2019-07-05 Vcn生物科学有限公司 病毒载体在治疗视网膜母细胞瘤中的用途
EP3532082A4 (en) 2016-12-12 2020-08-26 Salk Institute for Biological Studies SYNTHETIC ADENOVIRUS TUMOR TARGETING AND THEIR USES
CN117004573A (zh) * 2017-12-13 2023-11-07 苏州康聚生物科技有限公司 一种包含肿瘤抗原识别受体的免疫细胞及其应用
JP2021508477A (ja) 2017-12-29 2021-03-11 オンコラス， インコーポレイテッド 治療用ポリペプチドの腫瘍溶解性ウイルス送達
KR102267837B1 (ko) * 2018-01-19 2021-06-22 코오롱생명과학 주식회사 재조합 백시니아 바이러스 및 이를 포함하는 약학 조성물
CN111094324B (zh) * 2018-03-14 2023-10-10 武汉博威德生物技术有限公司 一种溶瘤病毒、合成dna序列及其应用
CN111909962A (zh) * 2020-07-23 2020-11-10 药鼎(北京)国际细胞医学技术有限公司 一种治疗肝癌的病毒构建体及其用途和构建方法
RU2753742C1 (ru) * 2020-10-16 2021-08-24 Федеральное государственное автономное образовательное учреждение высшего образования "Новосибирский национальный исследовательский государственный университет" (Новосибирский государственный университет, НГУ) Рекомбинантный штамм Ad6-hTERT-GMCSF, содержащий встройку промотора теломеразы человека hTERT, а также гена гранулоцитарно-макрофагального колониестимулирующего фактора человека, обладающий избирательной цитолитической активностью против теломераза-положительных опухолевых клеток и экспрессирующий активный человеческий гранулоцитарно-макрофагальный колониестимулирующий фактор
JP2024516400A (ja) 2021-04-30 2024-04-15 カリヴィル イムノセラピューティクス， インコーポレイテッド 修飾されたｍｈｃ発現のための腫瘍溶解性ウイルス
CN114703186B (zh) * 2022-03-31 2023-08-29 四川大学 肿瘤特异性启动子及其应用
WO2024062372A1 (en) * 2022-09-19 2024-03-28 Theriva Biologics, S.L. Combination therapies with oncolytic adenovirus and topoisomerase i inhibitors or prodrugs thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005018332A1 (en) * 2003-08-13 2005-03-03 The General Hospital Corporation Modified microorganisms for anti-cancer therapy

Family Cites Families (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL97312A (en) 1990-02-23 1999-01-26 Lilly Co Eli A method of generating a polypeptide in an eukaryotic vector AND recombinant surrogate cell containing an enhanced transcriptional control unit based on the primary late adenovirus coefficient
US5721348A (en) 1990-12-14 1998-02-24 University Of Connecticut DNA encoding PH-20 proteins
EP0872552A1 (en) 1997-04-15 1998-10-21 Leadd B.V. A gene delivery vehicle expressing the apoptosis-inducing proteins VP2 and/or Apoptin
US5516631A (en) 1992-10-13 1996-05-14 La Jolla Cancer Research Foundation Method of inhibiting replication of hyperproliferative cells
GB9223084D0 (en) 1992-11-04 1992-12-16 Imp Cancer Res Tech Compounds to target cells
US5801029A (en) 1993-02-16 1998-09-01 Onyx Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
DE69426841T2 (de) 1993-02-16 2001-09-06 Onyx Pharma Inc Cytopatische Viren zur Therapie und Prophylaxe der Neoplasie
GB9415167D0 (en) 1994-07-27 1994-09-14 Springer Caroline J Improvements relating to cancer therapy
US5998205A (en) 1994-11-28 1999-12-07 Genetic Therapy, Inc. Vectors for tissue-specific replication
US6326356B1 (en) 1996-10-18 2001-12-04 Board Of Regents, The University Of Texas System Suppression of neu overexpression using a mini-E1A gene
US20040048821A1 (en) 1997-06-27 2004-03-11 Cold Spring Harbor Laboratory Enhancement of drug cytotoxicity in tumor cells containing mutant Rb gene
AU744252B2 (en) 1998-02-06 2002-02-21 Uab Research Foundation, The Adenovirus vector containing a heterologous peptide epitope in the hi loop of the fiber knob
US6900049B2 (en) 1998-09-10 2005-05-31 Cell Genesys, Inc. Adenovirus vectors containing cell status-specific response elements and methods of use thereof
SK4412001A3 (en) 1998-10-15 2001-12-03 Canji Inc Selectively replicating viral vectors
US20020037274A1 (en) 1998-10-26 2002-03-28 Angelica Williams Single agent method for killing tumor and tumor associated endothelial cells using adenoviral mutants
EP1131458A1 (en) 1998-11-18 2001-09-12 CANJI, Inc. Viral vectors with late transgene expression
US6495130B1 (en) 1998-12-30 2002-12-17 Calydon, Inc. Target cell-specific adenoviral vectors containing E3 and methods of use thereof
WO2000067576A1 (en) 1999-05-12 2000-11-16 The Uab Research Foundation Infectivity-enhanced conditionally-replicative adenovirus and uses thereof
US7078030B2 (en) 1999-11-15 2006-07-18 Onyx Pharmaceuticals, Inc Oncolytic adenovirus
CN1382218A (zh) 1999-11-15 2002-11-27 昂尼克斯药物公司 溶瘤腺病毒
US7306902B2 (en) 2002-06-28 2007-12-11 Oncolyties Biotech Inc. Oncolytic viruses as phenotyping agents for neoplasms
EP1325125B1 (en) 2000-07-10 2013-06-05 Board Of Regents, The University Of Texas System Chromosome 3p21.3 genes are tumor suppressors
EP1203819A3 (en) 2000-10-06 2002-08-07 Transgene S.A. Anti-inflammatory vectors
CA2439185A1 (en) 2001-02-23 2002-09-06 Novartis Ag Vector constructs
IL152420A0 (en) 2001-02-23 2003-05-29 Novartis Ag Novel oncolytic adenoviral vectors
EP1385466B1 (en) 2001-05-11 2011-03-09 Wellstat Biologics Corporation Oncolytic virus therapy
JP4488290B2 (ja) 2002-01-24 2010-06-23 ザ・スクリップス・リサーチ・インスティテュート 効率的ターゲティングのためのファイバーシャフト変異
AU2003241268A1 (en) 2002-02-05 2003-09-09 Cornell Research Foundation, Inc. Adenoviral vector with replication-dependent transgene expression
EP1521523A4 (en) 2002-05-20 2006-04-19 Univ Texas METHODS AND COMPOSITIONS FOR DELIVERING NUCLEIC ACID ENZYMES AND MOLECULES IN BRAIN, BONE, AND OTHER FABRICS
US20060104968A1 (en) 2003-03-05 2006-05-18 Halozyme, Inc. Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases
DK2177620T3 (en) 2003-03-05 2015-01-26 Halozyme Inc Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, use and pharmaceutical compositions comprising thereof
EP1613757A2 (en) * 2003-03-28 2006-01-11 The Scripps Research Institute Adenovirus particles with enhanced infectivity of dendritic cells and particles with decreased infectivity of hepatocytes
WO2005030927A2 (en) * 2003-09-23 2005-04-07 Uab Research Foundation Methods and compositions for in vivo inflammation monitoring
WO2005086922A2 (en) * 2004-03-10 2005-09-22 Board Of Regents, University Of Texas System Oncolytic adenovirus armed with therapeutic genes
US20060292682A1 (en) * 2004-07-22 2006-12-28 Hawkins Lynda K Addition of transgenes into adenoviral vectors
KR20070111542A (ko) 2005-03-09 2007-11-21 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 암 치료유전자의 종양-특이적, 발현 고효율을 위한 신규한ｈＴＭＣ 프로모터 및 벡터
WO2007059473A2 (en) * 2005-11-12 2007-05-24 Introgen Therapeutics, Inc. Methods for the production and purification of adenoviral vectors
EP1979000B1 (en) 2005-12-22 2011-07-13 Memorial Sloan-Kettering Cancer Center Method for detection of cancer cells using virus
CA2717383C (en) * 2008-03-06 2017-01-03 Halozyme, Inc. Large-scale production of soluble hyaluronidase
ES2385251B1 (es) * 2009-05-06 2013-05-06 Fundació Privada Institut D'investigació Biomèdica De Bellvitge Adenovirus oncolíticos para el tratamiento del cáncer.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005018332A1 (en) * 2003-08-13 2005-03-03 The General Hospital Corporation Modified microorganisms for anti-cancer therapy

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
GANESH S ET AL.: "Intratumoral coadministration of hyaluronidase inzyme and oncolytic adenoviruses inhances virus potency in metastatic tumor models", CLIN. CANCER RES, vol. 14, no. 12, 2008, pages 3933 - 3941, XP009153332 *
GANESH S. ET AL.: "Relaxin-espressing fiber chimeric oncolytic adenovirus prolongs survival of tumor-bearing mice", CANCER RES, vol. 67, no. 9, 2007, pages 4399 - 4407, XP009153328 *
GANESH S: "Intratumoral coadmisinistration of hyaluronidase inzyme and oncolytic adenoviruses inhances virus potency in metastatic tumor models", CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 14, no. 12, 1 January 2008 (2008-01-01), pages 3933 - 3941, XP009153332, ISSN: 1078-0432 *
JIN CHENG ET AL: "Human Matrix Metalloproteinase-8 Gene Delivery Increases the Oncolytic Activity of a Replicating Adenovirus", MOLECULAR THERAPY, vol. 15, no. 11, 1 November 2007 (2007-11-01), pages 1982 - 1990, XP055010312, ISSN: 1525-0016, DOI: 10.1038/sj.mt.6300264 *
KIM JOO-HANG ET AL: "Relaxin expression from tumor-targeting adenoviruses and its intratumoral spread, apoptosis induction, and efficacy", JOURNAL OF THE NATIONAL CANCER INSTITUTE, OXFORD UNIVERSITY PRESS, GB, vol. 98, no. 20, 1 October 2006 (2006-10-01), pages 1482 - 1493, XP002480992, ISSN: 0027-8874 *
SONIA GUEDAN ET AL: "Hyaluronidase Expression by an Oncolytic Adenovirus Enhances Its Intratumoral Spread and Suppresses Tumor Growth", MOLECULAR THERAPY, vol. 18, no. 7, 4 May 2010 (2010-05-04), pages 1275 - 1283, XP055010308, ISSN: 1525-0016, DOI: 10.1038/mt.2010.79 *
TOOLE B P ET AL: "Hyaluronan: A constitutive regulator of chemoresistance and malignancy in cancer cells", SEMINARS IN CANCER BIOLOGY, SAUNDERS SCIENTIFIC PUBLICATIONS, PHILADELPHIA, PA, US, vol. 18, no. 4, 1 August 2008 (2008-08-01), pages 244 - 250, XP022713903, ISSN: 1044-579X, [retrieved on 20080326], DOI: 10.1016/J.SEMCANCER.2008.03.009 *
YUN C CO: "Overcoming the extracellular matrix barrier to improve intratumoral spread and therapeutic potential of oncolytic virotherapy", CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 10, no. 4, 2008, pages 356 - 361, XP009153330 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103405480A (zh) * 2013-05-03 2013-11-27 浙江理工大学 10-羟基喜树碱-丁二酸与腺病毒结合物及制法和用途
CN103405480B (zh) * 2013-05-03 2015-11-25 浙江理工大学 10-羟基喜树碱-丁二酸与腺病毒结合物及制法和用途
US11896635B2 (en) 2017-11-08 2024-02-13 Kagoshima University Oncolytic virus (oncolytic immunotherapy) capable of effectively treating even metastatic cancer while ensuring safety, with expression control system providing optimal expression level of mounted immunogenic gene
WO2020047345A1 (en) 2018-08-31 2020-03-05 Yale University Compositions and methods of using cell-penetrating antibodies in combination with immune checkpoint modulators
WO2021024207A1 (en) 2019-08-05 2021-02-11 Mesoblast International Sarl Cellular compositions comprising viral vectors and methods of treatment
WO2022034506A1 (en) 2020-08-10 2022-02-17 Mesoblast International Sárl Cellular compositions and methods of treatment
WO2024081736A2 (en) 2022-10-11 2024-04-18 Yale University Compositions and methods of using cell-penetrating antibodies

Also Published As

Publication number Publication date
RU2011149458A (ru) 2013-06-27
CA2761183A1 (en) 2010-11-11
AU2010244348A1 (en) 2011-12-01
BRPI1011445A2 (pt) 2020-09-15
BRPI1011445B8 (pt) 2022-10-25
BRPI1011445B1 (pt) 2022-10-04
KR101878274B1 (ko) 2018-07-13
CA2761183C (en) 2019-03-26
CN107252438A (zh) 2017-10-17
MX2011011818A (es) 2012-06-19
CN102548584A (zh) 2012-07-04
EP2428229A1 (en) 2012-03-14
HK1167818A1 (zh) 2012-12-14
ES2385251B1 (es) 2013-05-06
AU2010244348B2 (en) 2016-08-11
ES2600955T3 (es) 2017-02-13
PL2428229T3 (pl) 2017-02-28
US20190345204A1 (en) 2019-11-14
KR20120049185A (ko) 2012-05-16
US10316065B2 (en) 2019-06-11
ES2385251A1 (es) 2012-07-20
RU2536931C2 (ru) 2014-12-27
HK1244679A1 (zh) 2018-08-17
US20120148535A1 (en) 2012-06-14
EP2428229B1 (en) 2016-08-03
JP2012525833A (ja) 2012-10-25

Similar Documents

Publication Publication Date Title
ES2385251B1 (es) Adenovirus oncolíticos para el tratamiento del cáncer.
ES2304281B1 (es) Adenovirus oncoliticos para el tratamiento del cancer.
Cody et al. Armed replicating adenoviruses for cancer virotherapy
KR102628234B1 (ko) 알부민-결합 모이어티를 포함하는 아데노바이러스
ES2466415T3 (es) Construcción de recombinante de adenovirus oncolítico que expresa específicamente el factor inmunomodulador GM-CSF en células tumorales y usos del mismo
ES2367227T3 (es) Adenovirus con mutaciones en el dominio de retención en el retículo endoplasmático de la proteína e3-19k y su utilización en el tratamiento del cáncer.
ES2827012T3 (es) Uso de vectores virales oncolíticos en el tratamiento del retinoblastoma
ES2231281T3 (es) Vectores competentes de replicacion anticancerosos.
WO2003080083A1 (es) Uso de adenovirus mutados en los genes va para el tratamiento del cancer
Fu et al. Potential adenovirus-mediated gene therapy of glioma cancer
Garcia-Aragoncillo et al. Design of virotherapy for effective tumor treatment
CN101880688B (zh) 一种使复制缺陷型腺病毒选择性复制的方法和用途
CA2627638A1 (en) Conditionally replicating viruses and methods for cancer virotherapy
JP2022553870A (ja) 複製促進腫瘍溶解性アデノウイルス
ES2367240T3 (es) Vectores adenovíricos para le tratamiento de enfermedades.
KR20230095830A (ko) 면역 회피성 항종양 아데노바이러스
Koizumi et al. 527. Reductions in Tissue Transduction and Toxicity after Systemic Administration of Adenovirus Vectors Containing Fiber-Shaft Exchange in Combination with both CAR-and av Integrin-Binding Ablation

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080028895.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10772050

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012509064

Country of ref document: JP

Ref document number: 2761183

Country of ref document: CA

Ref document number: MX/A/2011/011818

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010244348

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 9086/DELNP/2011

Country of ref document: IN

REEP Request for entry into the european phase

Ref document number: 2010772050

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010772050

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2010244348

Country of ref document: AU

Date of ref document: 20100505

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20117029097

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2011149458

Country of ref document: RU

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13318876

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1011445

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1011445

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20111107