WO2010042281A2 - Antisense oligonucleotides directed against connective tissue growth factor and uses thereof - Google Patents
Antisense oligonucleotides directed against connective tissue growth factor and uses thereof Download PDFInfo
- Publication number
- WO2010042281A2 WO2010042281A2 PCT/US2009/054973 US2009054973W WO2010042281A2 WO 2010042281 A2 WO2010042281 A2 WO 2010042281A2 US 2009054973 W US2009054973 W US 2009054973W WO 2010042281 A2 WO2010042281 A2 WO 2010042281A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- modified
- antisense
- seq
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P41/00—Drugs used in surgical methods, e.g. surgery adjuvants for preventing adhesion or for vitreum substitution
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
Definitions
- the present invention relates to novel antisense oligonucleotides (ASOs) useful for treating hyperprolific disorders and fibrotic diseases, and for reducing scarring resulting from wound healing.
- ASOs antisense oligonucleotides
- Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of connective tissue growth factor (CTGF) expression.
- CTGF connective tissue growth factor
- An antisense compound is an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid (e.g. a target mRNA molecule) .
- Antisense compounds, compositions and methods for modulating expression of CTGF and for treating disease associated with expression of CTGF are disclosed in aforementioned U.S. Pat. No. 6,965,025B2, herein incorporated by reference. However, there remains a need for additional such compounds capable of providing enhanced inhibition of CTGF expression and functions as well as other advantageous properties.
- this invention specifically provides preferred modified antisense oligonucleotides for inhibiting CTGF expression. These have been demonstrated to be significantly, and unexpectedly more potent than previously described ASOs targeting CTGF.
- Connective tissue growth factor (CTGF; also known as ctgrofact, fibroblast inducible secreted protein, fisp-12, N0V2 , insulin-like growth factor-binding protein-related protein 2, IGFBP-rP2, IGFBP-8, HBGF-O.8, Hcs24, and ecogenin) is a member of the CCN (CTGF/CYR61/NOV) family of modular proteins, named for the first family members identified, connective tissue growth factor, cysteine-rich (CYR61) , and nephroblastoma overexpressed (NOV) , but the family also includes the proteins ELM-I (expressed in low-metastatic cells), WISP-3 (Wnt-1-induced secreted protein), and COP-I (WISP-2) .
- CCN CCN
- CCN proteins have been found to be secreted, extracellular matrix-associated proteins that regulate cellular processes such as adhesion, migration, mitogenesis, differentiation, survival, angiogenesis, atherosclerosis, chondrogenesis , wound healing, tumorigenesis, and vascular and fibrotic diseases like scleroderma (Lau and Lam, Exp. Cell Res., 1999, 248, 44-57) .
- the connective tissue growth factor protein was shown to stimulate DNA synthesis and promote chemotaxis of fibroblasts (Bradham et al . , J. Cell Biol., 1991, 114, 1285-1294) .
- Connective tissue growth factor is expressed in fibroblasts during normal differentiation processes that involve extracellular matrix (ECM) production and remodeling, such as embryogenesis and uterine decidualization following implantation. Connective tissue growth factor is also frequently overexpressed in fibrotic skin disorders such as systemic sclerosis, localized skin sclerosis, keloids, scar tissue, eosinophilic fasciitis, nodular fasciitis, and Dupuytren's contracture.
- Connective tissue growth factor mRNA or protein levels are elevated in fibrotic lesions of major organs and tissues including the liver, kidney, lung, cardiovascular system, pancreas, bowel, eye, and gingiva.
- connective tissue growth factor is overexpressed in the stromal compartment.
- connective tissue growth factor expression is linked spatially and temporally to the profibrogenic cytokine transforming growth factor-beta (TGF- beta) (Moussad and Brigstock, MoI. Genet. Metab., 2000, 71, 276-292) .
- TGF- beta profibrogenic cytokine transforming growth factor-beta
- Connective tissue growth factor has been mapped to human chromosomal region 6q23.1, proximal to the c-myb gene, and chromosomal abnormalities involving this region have been associated with human tumors, such as Wilms' tumor (Martinerie et al., Oncogene, 1992, 7, 2529-2534) .
- CTGF may be involved in the pathogenesis of pediatric myofibroblastic tumors.
- Connective tissue growth factor mRNA is also specifically upregulated in malignant human leukemic lymphoblasts from children with acute lymphoblastic leukemia (ALL) (Vorwerk et al., Br. J. Cancer, 2000, 83, 756-760), and both mRNA and protein levels are upregulated by TGF-beta in Hs578T human breast cancer cells in a dose-dependent manner, indicating that CTGF is an important neuroendocrine factor and a critical downstream effector of TGF-beta (Yang et al . , J. Clin. Endocrinol. Metab., 1998, 83, 2593-2596) .
- ALL acute lymphoblastic leukemia
- connective tissue growth factor mKNA expression is also induced by bleomycin, a known lung fibrogenic agent (Lasky et al . , Am. J. Physiol., 1998, 275, L365-371), as well as in bronchoalveolar lavage cells from patients with idiopathic pulmonary fibrosis and pulmonary sarcoidosis, in comparison to healthy nonsmoking control subjects, indicating that connective tissue growth factor is involved in the fibroproliferative response to injury (Allen et al . , Am. J. Respir. Cell Moll. Biol., 1999, 21, 693-700) .
- connective tissue growth factor mRNA expression was strongly increased in extracapillary and mesangial proliferative lesions and in areas of periglomerular fibrosis.
- the early glomerular connective tissue growth factor overexpression coincided with a striking upregulation of TGF-beta proteins, and the kinetics of connective tissue growth factor expression strongly suggest a role in glomerular repair, possibly downstream of TGF-beta in this model of transient renal injury (Ito et al . , J. Am. Soc. Nephrol., 2001, 12, 472-484) .
- U.S. Pat. No. 5,876,730 is a substantially pure or isolated polypeptide characterized as having an amino acid sequence corresponding to the carboxy terminal amino acids of a connective tissue growth factor (CTGF) protein, wherein the polypeptide has an amino acid sequence beginning at amino acid residue 247 or 248 from the N-terminus of connective tissue growth factor, an isolated polynucleotide sequence encoding the connective tissue growth factor polypeptide, a recombinant expression vector which contains said polynucleotide, a host cell containing said expression vector, and a pharmaceutical composition comprising a therapeutically effective amount of connective tissue growth factor polypeptide in a pharmaceutically acceptable carrier.
- CTGF connective tissue growth factor
- Antisense oligonucleotides are generally disclosed (Brigstock and Harding, 1999) .
- WO 00/35936 Disclosed and claimed in U.S. Pat. Nos . 5,783,187; 5,585,270; 6,232,064; 6,150,101; 6,069,006 and PCT Publication WO 00/35936 are an isolated polynucleotide encoding the connective tissue growth factor polypeptide, expression vectors, host cells stably transformed or transfected with said vectors; an isolated polynucleotide comprising 5' untranslated regulatory nucleotide sequences isolated from upstream of connective tissue growth factor, wherein said untranslated regulatory nucleotide sequences comprises a transcriptional and translational initiation region and wherein said sequence is a TGF-beta responsive element; an isolated nucleic acid construct comprising a non-coding regulatory sequence isolated upstream from a connective tissue growth factor (CTGF) gene, wherein said non-coding regulatory sequence is operably associated with a nucleic acid sequence which expresses a protein of interest or antisense RNA, wherein said nu
- a method for identifying a composition which affects TGF- beta-induced connective tissue growth factor expression and a method of diagnosing a pathological state in a subject suspected of having a pathology selected from the group consisting of fibrotic disease and atherosclerosis, the method comprising obtaining a sample suspected of containing connective tissue growth factor, whereby detecting a difference in the level of connective tissue growth factor in the sample from the subject as compared to the level of connective tissue growth factor in the normal standard sample is diagnostic of a pathology characterized by a cell proliferative disorder associated with connective tissue growth factor in the subject.
- a method for ameliorating a cell proliferative disorder associated with connective tissue growth factor comprising administering to a subject having said disorder, at the site of the disorder, a composition comprising a therapeutically effective amount of an antibody or fragment thereof that binds to connective tissue growth factor, wherein said antibody or fragment thereof does not bind to PDGF.
- Antisense oligonucleotides are generally disclosed (Grotendorst , 2000; Grotendorst and Bradham, 2001; Grotendorst and Bradham, 2000; Grotendorst and Bradham, 1996; Grotendorst and Bradham, 1998; Grotendorst and Bradham, 2000) .
- PCT Publication WO 00/27868 is a substantially pure connective tissue growth factor polypeptide or functional fragments thereof, an isolated polynucleotide sequence encoding said polypeptide, said polynucleotide sequence wherein T can also be U, a nucleic acid sequence complementary to said polynucleotide sequence, and fragments of said sequences that are at least 15 bases in length and that will hybridize to DNA which encodes the amino acid sequence of the connective tissue growth factor protein under moderate to highly stringent conditions.
- an expression vector including said polynucleotide, a host cell stably transformed with said vector, an antibody that binds to said polypeptide, and a method for producing said polypeptide.
- a method for inhibiting the expression of connective tissue growth factor in a cell comprising contacting the cell with a polynucleotide which binds to a target nucleic acid in the cell, wherein the polynucleotide inhibits the expression of connective tissue growth factor in the cell, wherein the polynucleotide is an antisense polynucleotide, as well as a kit for the detection of connective tissue growth factor expression comprising a carrier means being compartmentalized to receive one or more containers, comprising at least one container containing at least one antisense oligonucleotide that binds to connective tissue growth factor (Schmidt et al . , 2000) .
- WO 00/13706 Disclosed and claimed in PCT Publication WO 00/13706 is a method for treating or preventing fibrosis, the method comprising administering to a subject in need an effective amount of an agent that modulates, regulates or inhibits the expression or activity of connective tissue growth factor or fragments thereof, and wherein the agent is an antibody, an antisense oligonucleotide, or a small molecule.
- the method is directed to treating kidney fibrosis and associated renal disorders, in particular, complications associated with diabetes and hypertension (Riser and Denichili, 2000) .
- WO 01/29217 Disclosed and claimed in PCT Publication WO 01/29217 is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from a group comprising NOVl, N0V2
- oligonucleotides are generally disclosed (Prayaga et al . , 2001) .
- Hypertrophic scar formation in particular, is a major clinical problem in the resolution of severe burns and can give rise to exuberant scarring that result in permanent functional loss and the stigma of disfigurement.
- An inhibitor of CTGF such as an antisense oligonucleotide (ASO) should be highly effective in preventing the severity of hypertrophic scars subsequent to burns. This activity could be evaluated by applying formulated ASO topically and monitoring the severity of the developed scar subsequent to occurring of the burn.
- ASO antisense oligonucleotide
- CTGF may be an attractive target for modulating hypertrophic scarring for several reasons.
- CTGF may represent a more specific target than TGF- ⁇ l or TGF- ⁇ 2 for gene-directed molecular therapies aimed at scarring, particularly since TGF- ⁇ l or TGF- ⁇ 2 has pluripotent effects unrelated to scar formation.
- CTGF may have TGF- ⁇ l or TGF- ⁇ 2 independent functions in maintaining a fibrotic phenotype that would be neglected by anti-TGF- ⁇ l or TGF- ⁇ 2 strategies.
- CTGF Despite advances in understanding CTGF' s roles in augmenting fibrosis in multiple organ systems and in chronic dermal diseases such as scleroderma, CTGF 's roles in acute scarring and wound healing remain largely observational.
- the dietary micronutrient NaB is a major end product of digestion of dietary starch and fiber, and is a potent growth inhibitor that initiates cell differentiation of many cell types in vitro. NaB exerts its biological effects, in part, as a histone deacetylase inhibitor in mammary epithelial cells, induces apoptotic cell death in Hs578T estrogen-non-responsive human breast cancer cells, and can activate different genes involved in cell cycle arrest depending on cell type.
- NaB specifically upregulates the expression of connective tissue growth factor in a dose- dependent manner, stimulating an increase in both mRNA and protein levels in both cancerous and non-cancerous mammary cells (Tsubaki et al . , J. Endocrinol., 2001, 169, 97-110) .
- TGF-beta has the unique ability to stimulate growth of normal fibroblasts in soft agar, a property of transformed cells.
- Connective tissue growth factor cannot induce these anchorage- independent growth normal rat kidney (NRK) fibroblasts, but connective tissue growth factor synthesis and action are essential for TGF-beta-induced anchorage-independence.
- Antibodies to connective tissue growth factor specifically blocked TGF-beta-induced anchorage-independent growth, and NRK fibroblasts transformed with a construct expressing the connective tissue growth factor gene in the antisense orientation were not responsive to TGF-beta in the anchorage- independent growth assay (Kothapalli et al . , Cell Growth. Differ., 1997, 8, 61-68) .
- CTGF-antisense expressing NRK cells were also used to show that TGF-beta-stimulated collagen synthesis is mediated by connective tissue growth factor, indicating that connective tissue growth factor may be a useful target for antifibrotic therapies (Duncan et al . , Faseb J., 1999, 13, 1774-1786) .
- the 3 ' -untranslated region (UTR) of the human connective tissue growth factor cDNA bears several consensus sequences for regulatory elements. When the 3'-UTR was fused downstream of a reporter gene, it was found to act as a strong cis-acting repressive element, and the antisense 3'-UTR had a similar, but stronger effect. (Kubota et al . , FEBS Lett., 1999, 450, 84-88) . Comparison of the human and mouse connective tissue growth factor 3'-UTRs revealed a conserved small segment of 91 bases.
- This region was amplified by RT-PCR from NIH3T3 mouse fibroblasts and used to make a chimeric fusion construct for analysis of its repressive effects.
- the mouse connective tissue growth factor 3 ' -UTR in either the sense or the antisense orientation had a strong repressive effect on transcription of the reporter gene, indicating an orientation independence of this regulatory element (Kondo et al . , Biochem. Biophys . Res. Commun. , 2000, 278, 119-124) .
- a phosphorothioate antisense oligonucleotide 16 nucleotides in length and targeted to the translation initiation start site, was used to inhibit expression of connective tissue growth factor and suppress proliferation and migration of bovine aorta vascular endothelial cells in culture (Shimo et al., J. Biochem. (Tokyo), 1998, 124, 130-140) .
- This antisense oligonucleotide was also used to show that connective tissue growth factor induces apoptosis in MCF-7 human breast cancer cells ⁇ and that TGF-beta-induced apoptosis is mediated, in part, by connective tissue growth factor (Hishikawa et al . , J. Biol.
- This antisense oligonucleotide was also used to block connective tissue growth factor expression and demonstrate that high blood pressure upregulates expression of connective tissue growth factor in mesangial cells, which in turn enhances ECM protein production and induces apoptosis, contributing to the remodeling of mesangium and ultimately glomerulosclerosis (Hishikawa et al . , J. Biol. Chem. , 2001, 276, 16797-16803) .
- This invention provides compounds which comprise modified oligonucleotides comprising 12-30 linked nucleosides, preferably comprising 20 or at least 12 linked nucleosides, more preferably at least 14 linked nucleosides, of which is capable of inhibitory expression of connective tissue factor.
- Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided.
- a method of treating an animal, particularly a human, having a disease or condition associated with CTGF by administering an amount of such compounds effective to inhibit expression of CTGF, wherein the disease or condition is a hyperprolific disorder, such as cancer and fibrotic diseases .
- a method of reducing scarring resulting from wound healing by administering an amount of such compounds effective to inhibit expression of CTGF.
- FIGURE 1 shows the targeted segments or regions on the CTGF genomic sequence, primarily exon targeted segments, against which antisense oligonucleotides to CTGF were made.
- FIGURE 2 shows the targeted segments or regions on the CTGF mRNA sequence against which antisense oligonucleotides to CTGF were made .
- FIGURE 3 provides a graphical representation of the testing of antisense oligonucleotides targeting exon sequences on the CTGF mRNA sequence for inhibition of CTGF expression.
- FIGURE 4 shows the target segments or regions on the CTGF genomic sequence, primarily intron targeted segments, against which antisense oligonucleotide to CTGF were made.
- FIGURE 5 shows the target segments or regions on the CTGF mRNA sequence against which antisense oligonucleotide to CTGF were made.
- FIGURE 6 provides a graphical representation of the result of testing of antisense oligonucleotides targeting primarily intron sequences on the CTGF mRNA sequence for inhibition against CTGF expression.
- FIGURE 7 shows the highly active antisense oligonucleotides against CTGF and compares their activity to that of two previously designed antisense oligonucleotides (ISIS 124238 and ISIS 124212) disclosed in U.S. Patent No. 6,965,025 B2.
- Figure 7A identifying the 8 exon targeting antisense oligonucleotides and Figure 7B provides preferred sequences of the antisense oligonucleotides.
- FIGURE 8 provides a graphical representation of the dose response obtained for the nine highly active novel lead antisense sequences of human CTGF for inhibiting CTGF expression in cultured human umbilical vein endothelial cells.
- Sequence 141923 is a negative control
- Sequences 124238 and 124212 are two previously designed sequences.
- FIGURE 9 provides a graphical representation of the plasma alanine aminotranferease (ALT) (FIGURE 9A) and aspartate aminotransferase (AST) (FIGURE 9B) levels in mice following four weeks of treatment with 25 mg/kg or 50 mg/kg antisense oligonucleotide ISIS 412294 (SEQ ID NO: 39), ISIS 412295 (SEQ ID NO: 40), or ISIS 418899 (SEQ ID NO: 166) .
- the results show that the plasma ALT and AST levels in the mice dosed with 25 mg/kg or 50 mg/kg of ISIS 412294 (SEQ ID NO: 39) or ISIS
- mice dosed with 50 mg/kg of ISIS 418899 shows significantly increase ALT and AST levels, above the values observed in the control group .
- FIGURE 10 provides a graphical representation of the result following four weeks of treatment with antisense oligonucleotides showing that weight gain for the 50 mg/kg 412295-treated group was significantly lower than the weight gain in the control group.
- FIGURE 11 shows that intradermal treatment of skin wounds in rats with 3.0, 1.0, 0.3 or 0.1 mg of CTGF antisense oligonucleotide resulted in a statistically significant reduction in both CTGF and CollA2 mRNA expression for all doses. These results clearly demonstrate that inhibition of CTGF expression with a 2'MOE modified antisense oligonucleotide will decrease the deposition of collagen in skin.
- FIGURE 12 provides a graphical representation showing significant levels of the CTGF antisense oligonucleotide present up to at least day 14 after 50 mg/mL (5 mg total dose) intradermal dosing in rabbits.
- this invention provides a compound which comprises a modified oligonucleotide consisting of 12-30 linked nucleosides, at least a 12 nucleobase sequence portion of which is present within the region selected from nucleotides 718-751, 1388-1423, 1457-1689, 2040-2069, 2120- 2147, 2728-2797, 2267-2301, 553-611, 1394-1423, 1469-1508, 1559-1605, 1659-1689, 2100-2129 and 1399-1423 of SEQ ID NO: 9.
- this invention provides a compound which comprises a modified oligonucleotide consisting of 12-30 linked nucleosides, at least a 12 nucleobase sequence portion of which is present within the region selected from nucleotides 2540-2559, 2568-2587, 2623-2647 and 2623-2642 of SEQ ID NO: 10.
- this invention provides a compound which comprises a modified oligonucleotide comprising 12-30 linked nucleosides, at least a 12 nucleobase sequence portion of which is present within nucleobase sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 43, 44, 45, 50, 51, 52, 56, 78, 125 and 166.
- the compound comprises 20 or at least 12 linked nucleosides, more preferably at least 14 linked nucleosides, of which is present within the nucleobase sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 43, 44, 45, 50, 51, 52, 56, 78, 125 and 166.
- the selection of these sequences was determined by screening results presented in Figures 1 to 7 as well as results from a dose response study in human umbilical vein endothelial cells (HuVEC) ( Figure 8) . Details of the experiment and data are provided in Example 8 in the Example Section below.
- a target region is a structurally defined region of the nucleic acid.
- a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
- Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
- the desired effect is a reduction in mRNA target nucleic acid levels.
- SEQ ID NOs. 39 and 40 were shown to be highly effective inhibitors of CTGF expression in the original ASO screen for activity (data shown here) .
- an additional ASO sequence (SEQ ID NO 166) was designated, which is designed to hybridize to sequence just upstream of those targeted by SEQ NOs. 39 and 40.
- This ASO (SEQ ID NO. 166) was also found to be a highly potent inhibitor of CTGF mRNA expression, demonstrating that this section of the CTGF mRNA is an attractive region to target with ASO inhibitors.
- the antisense compound is complimentary to a portion of the region of CTGF targeted by active oligonucleotides which stretches from target sites 1396 through 1424. This is the sequence space targeted by Isis 418899, 412295 and 412294 (SEQ ID NOs: 166, 40 and 39, respectively) .
- This invention also provides a compound which comprises a modified oligonucleotide comprising at least 12, preferably at least 14, linked nucleosides, the nucleobase sequence of which is a portion of one of the nucleobase sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 43, 44, 45, 50, 51, 52, 56, 78, 125 and 166.
- the antisense compounds described herein can comprise an oligonucleotide having 12 to 30, 12 to 20, and preferably 14 to 20 linked nucleosides.
- the modified oligonucleotide is a single-stranded or a double-stranded oligonucleotide .
- the present invention employs oligomeric compounds, particularly antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding connective tissue growth factor, ultimately modulating the amount of connective tissue growth factor produced. This is accomplished by providing antisense compounds which specifically hybridize with one or more nucleic acids encoding connective tissue growth factor.
- target nucleic acid and nucleic acid encoding connective tissue growth factor encompass DNA encoding connective tissue growth factor, RNA (including pre-mRNA and mKNA) transcribed from such DNA, and also cDNA derived from such RJMA.
- the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
- This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as "antisense" .
- the functions of DNA to be interfered with include replication and transcription.
- the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of connective tissue growth factor.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
- inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target .
- Targeting an antisense compound to a particular nucleic acid is a multistep process .
- antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
- Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
- a target region is a structurally defined region of the nucleic acid.
- a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
- the structurally defined regions for the nucleic acid can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
- a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3 ' target site of another target segment within the target region.
- Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
- the desired effect is a reduction in mRNA target nucleic acid levels.
- the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
- a target region may contain one or more target segments . Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In one embodiment, target segments within a target region are separated by no more than about 300 nucleotides. In other embodiments, target segments within a target region are separated by no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid. In another embodiment, target segments within a target region are separated by no more than about 5 nucleotides on the target nucleic acid. In additional embodiments, target segments are contiguous.
- Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, or an exon.
- Target segments containing a start codon or a stop codon are also suitable target segments.
- a suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon.
- the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
- the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences) .
- CTGF mRNA levels are indicative of inhibition of CTGF expression.
- Reductions in levels of a CTGF protein are also indicative of inhibition of target mRNA expression.
- phenotypic changes are indicative of inhibition of CTGF expression. For example, an increase in measures of CTGF is indicative of inhibition of CTGF expression.
- the targeting process usually begins with the identification of a nucleic acid sequence whose function is to be modulated.
- a nucleic acid sequence whose function is to be modulated.
- This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the target is a nucleic acid molecule encoding connective tissue growth factor.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
- a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule) , the translation initiation codon is also referred to as the "AUG codon, " the "start codon” or the “AUG start codon” . A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding connective tissue growth factor, regardless of the sequence (s) of such codons .
- a translation termination codon (or "stop codon”) of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5 ' -TAA, 5 ' -TAG and 5 ' -TGA, respectively) .
- start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.
- Other target regions include the 5' untranslated region (5' UTR) , known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5 ' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3 1 UTR) , known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3 ' end of an mRNA or corresponding nucleotides on the gene.
- 5' UTR 5' untranslated region
- 3 1 UTR known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination cod
- the 5' cap of an mRNA comprises an N7 -methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
- the 5' cap region may also be a preferred target region.
- some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence.
- mRNA splice sites i.e., intron-exon junctions
- intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.
- RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and extronic regions .
- pre-mRNA variants Upon excision of one or more exon or intron regions or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant . It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon.
- Alterants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
- Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA.
- One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
- Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with 17, specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway.
- Antisense modulation has, therefore, been harnessed for research use.
- the antisense compounds of the present invention can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
- Expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
- Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and ViIo, FEDS Lett., 2000, 480, 17-24; Celis, et al . , FEBS Lett., 2000, 480, 2-16) , SAGE (serial analysis of gene expression) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al . , Proc. Natl. Acad.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally- occurring portions which function similarly.
- backbone covalent internucleoside
- modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
- antisense oligonucleotides are a preferred form of antisense compound
- the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics.
- Antisense compound means an oligomeric compound capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
- Antisense compounds include, but are not limited to oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense oligonucleotides, siRNA, RNAi, ribozymes, external guide sequence (EGS) oligonucleotides (oligozymes) , and other oligonucleotides which hybridize to the target nucleic acid and modulate its expression.
- GSS external guide sequence
- an antisense compound has a nucleobase sequence that, when written in the 5' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
- an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
- an antisense compound targeted to a nucleic acid is 12 to 30 subunits in length.
- antisense compounds are from 12 to 30 linked subunits.
- the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits.
- the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
- the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.
- the compound comprises 20 or at least 14 linked nucleosides, wherein the modified oligonucleotide has a sequence which is 100% identical to one of the sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 45, 52, 56, 78, 125 and 166.
- the lead compound of interest has the sequence set forth in SEQ ID No: 39 (ISIS 412294) .
- a shortened or truncated antisense compound targeted to a nucleic acid has a single subunit deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation) .
- a shortened or truncated antisense compound targeted to a nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
- the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
- the additional subunit When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3 ' end of the antisense compound. When two are more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
- an antisense compound such as an antisense oligonucleotide
- an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
- an antisense compound such as an antisense oligonucleotide
- a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
- Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches .
- Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
- Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
- Short antisense compounds including compounds comprising chemically-modified high-affinity monomers 8 to 16 monomers in length. These short antisense compounds were shown to be useful for reducing target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Short antisense compounds were effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing.
- oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
- adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds .
- hybridization occurs between an antisense compound disclosed herein and a nucleic acid.
- the most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules .
- Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
- the antisense compounds provided herein are specifically hybridizable with a nucleic acid.
- “Complementary, as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or KNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus,
- An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid nonspecific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
- Antisense and other compounds of the invention which hybridize to the target and inhibit expression of the target are identified through experimentation, and the sequences of these compounds are hereinbelow identified as preferred embodiments of the invention.
- the target sites to which these preferred sequences are complementary are hereinbelow referred to as "active sites” and are therefore preferred sites for targeting. Therefore another embodiment of the invention encompasses compounds which hybridize to these active sites.
- An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CTGF nucleic acid) .
- a desired effect e.g., antisense inhibition of a target nucleic acid, such as a CTGF nucleic acid
- Non-complementary nucleobases between an antisense compound and a CTGF nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
- an antisense compound may hybridize over one or more segments of a CTGF nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure) .
- the antisense compounds provided herein are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% complementary to a CTGF nucleic acid. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
- an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
- the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases .
- an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
- Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al . , J. MoI. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656) .
- Percent homology, sequence identity or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489) .
- the antisense compounds provided herein are fully complementary (i.e. 100% complementary) to a target nucleic acid.
- antisense compound may be fully complementary to a CTGF nucleic acid, or a target region, or a target segment or target sequence thereof.
- "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
- non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
- the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
- two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
- a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
- antisense compounds up to 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary nucleobase (s) relative to a target nucleic acid, such as a CTGF nucleic acid.
- antisense compounds up to 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4 , no more than 3 , no more than 2 or no more than 1 non-complementary nucleobase (s) relative to a target nucleic acid, such as a CTGF nucleic acid.
- the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
- portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
- a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
- the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment. In another embodiment, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In yet another embodiment, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
- the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number.
- an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
- a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
- Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
- the non- identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
- the antisense compounds are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
- modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases.
- the compound comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase.
- antisense oligonucleotides containing a variety of modified internucleoside linkages may be employed, the currently preferred modified internucleoside linkage is a phosphothioate linkage between one or more of the nucleosides or wherein all of the internucleoside linkages are phosphothioate internucleoside linkages.
- the antisense oligonucleotide contains at least one and typically more than one modified sugar, wherein the sugar is a bicyclic sugar.
- various modified sugars may be employed it is presently preferred to employ a 2 ' -O-methoxyethyl sugar .
- nucleosides contained in the antisense oligonucleotide will be a modified nucleotide such as a 5-methylcytosine.
- a nucleoside is a base-sugar combination.
- the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
- Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide.
- the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
- Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases . Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
- Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
- the naturally occurring internucleoside linkage of RNA and DNA is a 3 ' to 5 ' phosphodiester linkage.
- Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
- Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
- Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates , phosphoramidate, and phosphorothioates . Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
- antisense compounds targeted to a CTGF nucleic acid comprise one or more modified internucleoside linkages.
- the modified internucleoside linkages are phosphorothioate linkages.
- each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
- nucleoside is a base-sugar combination.
- the base portion of the nucleoside is normally a heterocyclic base.
- the two most common classes of such heterocyclic bases are the purines and the pyrimidines .
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5 1 hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the normal linkage or backbone of RNA and DNA is a 3 ' to 5' phosphodiester linkage.
- oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
- Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates , phosphotriesters, aminoalkylphosphotri- esters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates, 5 ' -alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'- amino phosphoramidate and aminoalkylphosphoramidates , thiono- phosphoramidates, thionoalkylphosphonates, thionoalkylphospho- triesters, selenophosphates and boranophosphates having normal 3 ' -5 ' linkages, 2 ' -5 ' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 ' to 3 ' , 5' to 5 '
- Preferred oligonucleotides having inverted polarity comprise a single 3' to 3 ' linkage at the 3 '-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts .
- both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- an oligomeric compound an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) .
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al . , Science, 1991, 254, 1497-1500.
- oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- the furanosyl sugar ring can be modified in a number of ways including substitution with a substituent group, bridging to form a bicyclic nucleic acid "BNA" and substitution of the 4'-0 with a heteroatom such as S or N(R) as described in U.S. Pat. No.: 7,399,845 to Seth et al . , hereby incorporated by reference herein in its entirety.
- BNAs are described in published International Patent Application No. WO 2007/146511, hereby incorporated by reference herein in its entirety.
- Antisense compounds of the invention can optionally contain one or more nucleotides having modified sugar moieties.
- Sugar modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the antisense compounds.
- the furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to: addition of a substituent group, particularly at the 2' position; bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) ; and substitution of an atom or group such as -S-, -N(R)- or -C(Rl) (R2) for the ring oxygen at the 4 '-position.
- BNA bicyclic nucleic acid
- BNAs bicyclic modified sugars
- Methods for the preparations of modified sugars are well known to those skilled in the art.
- a 2 '-modified nucleoside has a bicyclic sugar moiety.
- the bicyclic sugar moiety is a D sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is a D sugar in the beta configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the alpha configuration. In certain such embodiments, the bicyclic sugar moiety is an L sugar in the beta configuration.
- the bicyclic sugar moiety comprises a bridge group between the 2' and the 4 ' -carbon atoms. In certain such embodiments, the bridge group comprises from 1 to 8 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises from 1 to 4 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises 2 or 3 linked biradical groups. In certain embodiments, the bicyclic sugar moiety comprises 2 linked biradical groups.
- the bicyclic sugar moiety is bridged between the 2' and 4' carbon atoms with a biradical group selected from -O- (CH 2 )p-, -0-CH 2 -, -0-CH 2 CH 2 -, -O-CH (alkyl) - , -
- each of said bridges is, independently, [C(Rl) (R2) ]n-, -[C(Rl) (R2) ]n-0-, -C (R1R2) -N(Rl) -0- or C (R1R2) -0-N(Rl) - .
- each of said bridges is, independently, 4 ' - (CH 2 ) 3 -2 ' , 4 ' - (CH 2 ) 2 -2 ' , 4 ' -CH 2 -O-2 ' , 4'- (CH 2 ) 2 -O-2 ' , 4'-CH 2 -O-N(Rl) -2 ' and 4 ' -CH 2 -N(Rl) -0-2 '- wherein each Rl is, independently, H, a protecting group or C1-C12 alkyl .
- nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
- antisense compounds targeted to a nucleic acid comprise one or more nucleotides having modified sugar moieties.
- the modified sugar moiety is 2'-MOE.
- the 2'-MOE modified nucleotides are arranged in a gapmer motif.
- oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Ci 0 alkyl or C 2 to Ci 0 alkenyl and alkynyl .
- n and m are from 1 to about 10.
- oligonucleotides comprise one of the following at the 2 ' position: Ci to Ci 0 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, 0-alkaryl or 0-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl , aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2 ' -methoxyethoxy
- MOE (Martin et al . , HeIv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2 ' -dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 J 2 group, also known as 2'-DMAOE, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0--CH 2 —0--CH 2 --N(CH 2 J 2 .
- a further preferred modification includes bicylic nucleic acid (also referred to as locked nucleic acids (LNAs) ) in which the 2 ' -hydroxy1 group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.
- LNAs locked nucleic acids
- the linkage is preferably a methelyne (--CH 2 --) n group bridging the 2 ' oxygen atom and the 4 ' carbon atom wherein n is 1 or 2 including a-L-Methyleneoxy (4 ' -CH2-O-2 ' ) BNA, ⁇ -D- Methyleneoxy (4 ' -CH2-O-2 ' ) BNA and Ethyleneoxy (4 ' - (CH2) 2 -0- 2') BNA.
- n is 1 or 2 including a-L-Methyleneoxy (4 ' -CH2-O-2 ' ) BNA, ⁇ -D- Methyleneoxy (4 ' -CH2-O-2 ' ) BNA and Ethyleneoxy (4 ' - (CH2) 2 -0- 2') BNA.
- Bicyclic modified sugars also include (6 ' S) -6 'methyl BNA, Aminooxy (4 ' -CH2-0-N(R) -2 ' ) BNA, Oxyamino (4 ' -CH2-N (R) -0- 2') BNA wherein, R is, independently, H, a protecting group, or C1-C12 alkyl.
- LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities. Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA: RNA) structurally resemble an A-form RNA: RNA duplex.
- LNAs in which the 2 ' -hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2 ' -C, 4' -C- oxymethylene linkage thereby forming a bicyclic sugar moiety.
- the linkage may be a methelyne (-CH 2 -) n group bridging the 2 1 oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456) .
- Other preferred bridge groups include the 2 ' -deoxy-2 ' -CH 2 OCH 2 - 4' bridge. LNAs and preparation thereof are described in published International Patent Application Nos . WO 98/39352 and WO 99/14226.
- 2'-0-allyl (2'-0-CH 2 -CH CH 2 ) and 2'-fluoro (2'-F) .
- the 2'- modification may be in the arabino (up) position or ribo
- Oligonucleotides may also have sugar mimetics or surrogates (sometimes referred to as DNA analogs) such as cyclobutyl moieties in place of the pentofuranosyl sugar.
- sugar mimetics or surrogates sometimes referred to as DNA analogs
- Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos .
- nucleosides are modified by replacement of the ribosyl ring with a surrogate ring system such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:
- bicyclo and tricyclo sugar surrogate ring systems are also know in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Christian J., ) . Such ring systems can undergo various additional substitutions to enhance activity.
- the compound comprising at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces the furanose ring.
- each of the at least one tetrahydropyran modified nucleoside has the structure:
- Bx is an optionally protected heterocyclic base moiety.
- Oligonucleotides may also include nucleobase (often referred to in the art simply as "base”) modifications or substitutions. Nucleobase modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C) . Certain nucleobase substitutions, including 5- methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 0 C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds . , Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) .
- Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2 -propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other
- Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
- Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
- antisense compounds targeted to a CTGF nucleic acid comprise one or more modified nucleobases.
- gap-widened antisense oligonucleotides targeted to a CTGF nucleic acid comprise one or more modified nucleobases.
- the modified nucleobase is 5-methylcytosine.
- each cytosine is a 5-methylcytosine.
- unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G) , and the pyrimidine bases thymine (T) , cytosine (C) and uracil (U) .
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CsC-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and gu
- nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (lH-pyrimido [5, 4- b] [1, 4]benzoxazin-2 (3H) -one) , phenothiazine cytidine (IH- pyrimido [5, 4-b] [1, 4]benzothiazin-2 (3H) -one) , G-clamps such as a substituted phenoxazine cytidine (e.g. 9- (2-aminoethoxy) -H- pyrimido[5, 4-b] [1, 4]benzoxazin-2 (3H) -one) , carbazole cytidine
- nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858- 859, Kroschwitz, J.
- nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5-substituted pyrimidines include 5-substituted pyrimidines , 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 0 C
- the compound comprises a modified oligonucleotide comprised of (a) a gap segment consisting of linked deoxynucleosides, preferably consists of a thirteen linked modified deoxynucleosides; (b) a 5' wing segment consisting of linked modified nucleosides, preferably consists of two linked modified nucleosides; and (c) a 3' wing segment consisting of linked modified nucleosides, preferably consists of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and wherein each modified nucleoside within each wing segment comprises a modified sugar, preferably comprises a 2'- O-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphothioate linkage.
- These patterns of modified nucleotides in an antisense compound are called motif. These motifs, confer to the antisense compounds properties such to enhance the inhibitory activity, increase binding affinity for a target nucleic acid, or increase resistance to degradation by in vivo nucleases.
- antisense compounds targeted to a CTGF nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
- Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
- a second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA: DNA duplex.
- Antisense compounds having a gapmer motif are considered chimeric antisense compounds .
- an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
- the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
- the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
- each distinct region comprises uniform sugar moieties.
- wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
- Any of the antisense compounds described herein can have a gapmer motif.
- X and Z are the same, in other embodiments they are different.
- Y is between 8 and 15 nucleotides.
- X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides.
- gapmers of the present invention include, but are not limited to, for example 2-13 -5 , 5-10-5 , 4-8-4 , 4-12 -3 , 4-12-4 , 3 -14-3 , 2-16-2 , 1-18-1 , 3 -10-3 , 2 -10-2 , 1-10-1 or 2 -8-2 .
- the antisense compound as a "wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X- Y or Y-Z configuration as described above for the gapmer configuration.
- wingmer configurations of the present invention include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10 or 8-2.
- antisense compounds targeted to a nucleic acid possess a 5-10-5 gapmer motif.
- an antisense compound targeted to a nucleic acid has a gap-widened motif. In other embodiments, an antisense oligonucleotide targeted to a nucleic acid has a gap-widened motif.
- a gap-widened antisense oligonucleotide targeted to a nucleic acid has a gap segment of fourteen 2 ' - deoxyribonucleotides positioned between wing segments of three chemically modified nucleosides.
- the chemical modification comprises a 2 '-sugar modification.
- the chemical modification comprises a 2'- MOE sugar modification.
- Antisense compounds having a gapmer motif are considered “chimeric” antisense compounds or “chimeras,” which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
- These oligonucleotides typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
- An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNArDNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease which cleaves the RNA strand of an RNArDNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers . Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos.
- the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
- the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
- the types of sugar moieties that are used to differentiate the regions of a gapmer may include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2'- modified nucleosides (such 2 '-modified nucleosides may include 2'-MOE), and bicyclic sugar modified nucleosides.
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
- the compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
- Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
- Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone , acridine, fluoresceins, rhodamines , coumarins , and dyes .
- Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
- Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92 /09196, filed ' Oct.
- Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al . , Proc . Natl. Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al . , Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al . , Ann. N. Y. Acad. Sci . , 1992, 660, 306-309; Manoharan et al .
- lipid moieties such as a cholesterol moiety (Letsinger et al . , Proc . Natl. Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al . , Bioorg. Med. Che
- a phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1, 2-di-0-hexadecyl-rac-glycero-3-H-phosphonate
- Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)- pranoprofen, carprofen, dansylsarcosine, 2 , 3 , 5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
- the compound comprises the modified oligonucleotide consists of 20 linked nucleosides .
- the compound comprises the nucleobase sequence is the sequence set forth in
- the composition comprises a modified oligonucleotide comprising linked nucleosides, the nucleobase sequence of which is a sequence set forth in one of SEQ ID NOs: 28, 30, 39, 40, 43, 44, 45, 50, 51, 52, 56, 78, 125 and 166 or a salt thereof, and a pharmaceutically acceptable carrier or diluent.
- a pharmaceutically acceptable carrier or diluent examples of pharmaceutically acceptable salts are well known to those skilled in the art.
- the antisense compound is complementary within a range of nucleotides on the CTGF sequence. In certain embodiments the antisense compound is complimentary within the range of nucleotides 718-751, 1388-
- the antisense compound is complimentary within the range of nucleotides 2728-2797 of SEQ ID NO: 10. Compounds targeted to these ranges demonstrate at least 50% inhibition (i.e. SEQ ID NOs: 15, 29, 31, 42, 46-49,
- the antisense compound is complementary within the range of nucleotides 553-611, 1394- 1423, 1469-1508, 1559-1605, 1659-1689 or 2100-2129 of SEQ ID NO: 9 and 2623-2647 of SEQ ID NO: 10.
- Compounds targeted therein demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 27, 28, 38, 39, 40, 43, 44, 45, 50, 51, 52, 54, 55, 56, 77, 78, 79, 138 and 139) .
- Certain additional target sites listed in Table 1 also demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 24, 30, 61, 63, 67, 69, 73, 86, 125, 128, and 161) .
- the antisense compound is complementary within the range of nucleotides 1399-1423.
- Compounds targeted therein demonstrate at least 70% inhibition (i.e. SEQ ID NOs: 39 and 40) .
- Certain target sites listed in Table 1 also demonstrate at least 70% inhibition (i.e. SEQ ID NOs: 28, 30, 44, 45, 51, 56, 78, 128, and 138) .
- One target site listed in Table 1 also demonstrates at least 80% inhibition (i.e. SEQ ID NOs: 24, 30, 61, 63, 67, 69, 73, 86, 125, 128, and 161) .
- the antisense compound is complementary within the range of nucleotides 1399-1423.
- Compounds targeted therein demonstrate at least 70% inhibition (i.e.
- the percent inhibition is achieved when the antisense compound is delivered to HuVec cells at a concentration of 50nm. Refer to Example 8, provided herein below, for more details.
- the modified oligonucleotide is a single-stranded or double stranded oligonucleotide.
- the modified oligonucleotide consists of 20 linked nucleosides
- a method for inhibiting expression of connective tissue growth factor in a cell or a tissue which comprises contacting the cell or tissue with the compound of interest under conditions such that expression of connective tissue growth factor is inhibited.
- Antisense oligonucleotides may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- Antisense compound targeted to a nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
- a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) .
- PBS is a diluent suitable for use in compositions to be delivered parenterally .
- employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a nucleic acid and a pharmaceutically acceptable diluent.
- the pharmaceutically acceptable diluent is PBS.
- the pharmaceutically acceptable diluent is pharmaceutical grade saline or pharmaceutical grade PBS.
- the antisense compound is an antisense oligonucleotide.
- Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents . Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
- prodrug versions of the oligonucleotides of the invention are prepared as SATE [ (S-acetyl-2-thioethyl)phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al . , published Dec. 9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et al .
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N, N' -dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al . , "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19) .
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
- a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines.
- Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
- Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4- aminosalicylic
- Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
- Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations . Carbonates or hydrogen carbonates are also possible.
- salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
- acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
- salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid
- a pharmaceutically acceptable carrier or diluent is an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable as a solvent, suspending agent or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to a human or non- human animal.
- Pharmaceutical carriers are well known to those skilled in the art.
- compositions of the present invention also incorporate carrier compounds in the formulation.
- carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
- a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
- the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido- 4 ' isothiocyano-stilbene-2 , 2 ' -disulfonic acid (Miyao et al . , Antisense Res. Dev. , 1995, 5, 115-121; Takakura et al . , Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183) .
- a "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc. ) .
- binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or
- compositions of the present invention can also be used to formulate the compositions of the present invention.
- suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
- the solutions may also contain buffers, diluents and other suitable additives.
- Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
- the composition comprises a modified oligonucleotide comprises a single-stranded or a double-stranded oligonucleotide, and wherein the modified oligonucleotide consists of 20 linked nucleosides.
- in another embodiment of the invention involves a method for inhibiting expression of connective tissue growth factor in a cell or a tissue which comprises contacting the cell or tissue with any one of the above-mentioned compounds under conditions such that expression of connective tissue growth factor is inhibited.
- In certain embodiment of the invention involves a method of treating an animal having a disease or condition associated with expression of connective tissue growth factor which comprises administering to the animal an amount of the compound described hereinabove effective to inhibit expression of connective tissue growth factor so as to thereby treat the animal .
- an animal in the practice of the method of this invention, includes a human as well as a non-human animal, preferably human .
- the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- Oligonucleotides with at least one 2'-O- methoxyethyl modification are believed to be particularly- useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful .
- Preferred topical formulations include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- Preferred lipids and liposomes include neutral (e.g.
- dioleoylphosphatidyl DOPE ethanolamine dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA) .
- Oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes.
- oligonucleotides may be complexed to lipids, in particular to cationic lipids.
- Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, l-dodecylazacycloheptan-2- one, an acylcarnitine, an acylcholine, or a Ci-io alkyl ester (e.g.
- isopropylmyristate IPM isopropylmyristate IPM
- monoglyceride diglyceride or pharmaceutically acceptable salt thereof.
- pharmaceutically acceptable salt thereof Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999 which is incorporated herein by reference in its entirety.
- compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators .
- Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
- Preferred bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA) , cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24 , 25-dihydro-fusidate, sodium glycodihydrofusidate, .
- DCA chenodeoxycholic acid
- UDCA ursodeoxychenodeoxycholic acid
- Preferred fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium) .
- arachidonic acid arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, gly
- penetration enhancers for example, fatty acids/salts in combination with bile acids/salts.
- a particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally in granular form including sprayed dried particles, or complexed to form micro or nanoparticles .
- Oligonucleotide complexing agents include poly- amino acids; polyimines; polyacrylates ; polyalkylacrylates, polyoxethanes , polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches.
- Particularly preferred complexing agents include chitosan, N- trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines , protamine, polyvinylpyridine, polythiodiethylaminomethyl-ethylene P(TDAE), polyaminostyrene
- polystyrene resin e.g. p-amino
- poly (methylcyanoacrylate) poly (ethylcyanoacrylate ), poly (butylcyanoacrylate) , poly (isobutylcyanoacrylate) , poly (iso-hexylcynaoacrylate) , DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE- albumin and DEAE-dextran, polymethyl-acrylate, polyhexylacrylate, poly (D, L-lactic acid), poly (DL-lactic-co- glycolic acid (PLGA) , alginate, and polyethylene-glycol (PEG) .
- D L-lactic acid
- PLGA poly (DL-lactic-co- glycolic acid
- PEG polyethylene-glycol
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients .
- Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome- containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self- emulsifying semisolids.
- the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier (s) or excipient (s) . In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl- cellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- the preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.
- compositions of the present invention may be prepared and formulated as emulsions.
- Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 um in diameter.
- Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
- emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
- Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed.
- compositions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil- in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions .
- Such complex formulations often provide certain advantages that simple binary emulsions do not.
- Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
- a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
- Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
- Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y. , volume 1, p. 199) .
- Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N. Y. , 1988, volume 1, p. 199) .
- Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance
- HLB hydrophilic styrene-maleic anhydride copolymer
- Rieger in Pharmaceutical Dosage Forms, Lieberman,
- Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
- Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations .
- polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
- non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y. , volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 199) .
- Hydrophilic colloids or hydrocolloids include naturally- occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth) , cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose) , and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers) . These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
- polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
- cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
- synthetic polymers for example, carbomers,
- emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives.
- preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
- Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
- Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
- antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p.
- the compositions of oligonucleotides and nucleic acids are formulated as microemulsions .
- a microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1, p. 245) .
- microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system.
- microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface- active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215) .
- Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
- microemulsion is of the water-in- oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271) .
- microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
- Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate
- ML310 tetraglycerol monooleate
- MO310 tetraglycerol monooleate
- PO310 hexaglycerol monooleate
- PO500 hexaglycerol pentaoleate
- MCA750 decaglycerol monocaprate
- SO750 decaglycerol sequioleate
- DAO750 decaglycerol decaoleate
- the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules .
- Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
- the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
- the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8- C12) mono, di , and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8- C12) mono, di , and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs.
- Lipid based microemulsions both o/w and w/o have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al . , Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205) .
- Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al . , Pharmaceutical Research, 1994, 11, 1385; Ho et al . , J. Pharm. Sci . , 1996, 85, 138-143) . Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides.
- Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration .
- Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention.
- Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al . , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92) . Each of these classes has been discussed above .
- liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
- Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered.
- Cationic liposomes possess the advantage of being able to fuse to the cell wall.
- Non-cationic liposomes although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
- lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 run, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores .
- liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs,- liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y. , volume 1, p. 245) .
- Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
- Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
- Liposomes have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin. Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis .
- Liposomes fall into two broad classes .
- Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex.
- the positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al . , Biochem. Biophys . Res. Commun., 1987, 147, 980-985) .
- Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al . , Journal of Controlled Release, 1992, 19, 269-274) .
- liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
- Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC) .
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE) .
- Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- PC phosphatidylcholine
- Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene - 10-stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al . S .T. P. Pharma. Sci., 1994, 4, 6, 466) .
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- Liposomes comprising sphingomyelin. Liposomes comprising 1 , 2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al . ) .
- liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
- Sunamoto et al . (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2Ci 2 15G, that contains a PEG moiety.
- Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 Bl and WO 90/04384 to Fisher.
- Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al . (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al . (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 Bl) .
- Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No.
- WO 96/40062 to Thierry et al discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
- U.S. Pat. No. 5,264,221 to Tagawa et al discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
- U.S. Pat . No. 5,665,710 to Rahman et al describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
- WO 97/04787 to Love et al discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.
- Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self- optimizing (adaptive to the shape of pores in the skin) , self- repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome- mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
- HLB hydrophile/lipophile balance
- Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values . In general their HLB values range from 2 to about 18 depending on their structure.
- Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
- Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
- the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class .
- Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates , and phosphates.
- the most important members of the anionic surfactant class are the alkyl sulfates and the soaps .
- Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class .
- amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides .
- the use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N. Y., 1988, p. 285) .
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals.
- nucleic acids particularly oligonucleotides
- Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants
- surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced.
- these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene- 20-cetyl ether) (Lee et al . , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al . , J. Pharm. Pharmacol., 1988, 40, 252) .
- Fatty acids Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid) , myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol) , dilaurin, caprylic acid, arachidonic acid, glycerol 1- monocaprate, l-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, Ci_io alkyl esters thereof (e.g., methyl, isopropyl and t-butyl) , and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate,
- Bile salts The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat- soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935) .
- the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
- the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate) , dehydrocholic acid (sodium dehydrocholate) , deoxycholic acid (sodium deoxycholate) , glucholic acid (sodium glucholate) , glycholic acid (sodium glycocholate) , glycodeoxycholic acid (sodium glycodeoxycholate) , taurocholic acid (sodium taurocholate) , taurodeoxycholic acid (sodium taurodeoxy- cholate) , chenodeoxycholic acid (sodium chenodeoxycholate) , ursodeoxycholic acid (UDCA), sodium tauro-24, 25-dihydro- fusidate (STDHF) , sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al .
- cholic acid or its
- Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced.
- chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315- 339) .
- Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA) , citric acid, salicylates (e.g., sodium salicylate, 5- methoxysalicylate and homovanilate) , N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta- diketones (enamines) (Lee et al . , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al . , J. Control ReI., 1990, 14, 43-51) .
- EDTA disodium ethylenediaminetetraacetate
- citric acid citric acid
- salicylates e.g., sodium salicylate, 5- methoxysalicylate and homovanilate
- N-acyl derivatives of collagen e.g., laureth-9 and N-amino
- Non-chelating non-surfactants can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33) .
- This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1- alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al .
- non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626) .
- Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention.
- cationic lipids such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al . , PCT Application WO 97/30731) , are also known to enhance the cellular uptake of oligonucleotides .
- agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
- glycols such as ethylene glycol and propylene glycol
- pyrrols such as 2-pyrrol
- azones such as 2-pyrrol
- terpenes such as limonene and menthone.
- compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forms of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
- the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
- chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mito- xantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen
- chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide) , or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide) .
- Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al . , eds., 1987, Rahway, N. J. , pages 2499-2506 and 46-49, respectively) . Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
- antisense compounds particularly oligonucleotides
- additional antisense compounds targeted to a second nucleic acid target Numerous examples of antisense compounds are known in the art . Two or more combined compounds may be used together or sequentially.
- the antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.) . Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives .
- the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. Pat.
- Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man.
- Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
- the disease is a hyperproliterative disorder which includes cancer, wherein the cancer is breast, prostate, renal, pancreatic, head and neck, gastric, and multiple myeloma cancer
- a hyperproliterative disorder which includes cancer
- the cancer is breast, prostate, renal, pancreatic, head and neck, gastric, and multiple myeloma cancer
- the method comprises treating a disease or condition, wherein the disease or disorder is a fibrotic disease.
- the fibrotic disease is hypertrophic scarring, keloids, skin scarring, liver fibrosis, pulmonary fibrosis, renal fibrosis, cardiac fibrosis, or restenosis.
- the method further comprises treating the above-mentioned disease or condition, wherein the disease or disorder is joint fibrosis (including frozen shoulder syndrome, tendon and peripheral nerve damage) , spinal cord damage, coronary bypass, abdominal and peritoneal adhesions (including endometriosis, uterine leiomyomata and fibroids) , radial keratotomy and photorefractive keratectomy, retinal reattachment surgery, device mediated fibrosis (in for example diabetes) , tendon adhesions, Dupuytren contracture, or scleroderma.
- joint fibrosis including frozen shoulder syndrome, tendon and peripheral nerve damage
- spinal cord damage including coronary bypass, abdominal and peritoneal adhesions (including endometriosis, uterine leiomyomata and fibroids)
- radial keratotomy and photorefractive keratectomy including retinal reattachment surgery
- device mediated fibrosis in for example diabetes
- in another embodiment of the invention also provides a method for reducing hypertropic scarring resulting from dermal wound healing in a subject in need thereof which comprises administering to the subject an amount of compound of an antisense oligonucleotide effective to inhibit expression of connective tissue growth factor (CTGF) in the subject so as to thereby reduce scarring from wound healing in the subject.
- CTGF connective tissue growth factor
- the say subject may include a human or a non-human animal.
- compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 S found to be effective in in vitro and in vivo animal models.
- dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
- oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
- the method further comprises reducing hypertropic scarring resulting from dermal wound healing, wherein wound healing is healing at a wound selected from the group consisting of skin breakage, surgical incisions and burns.
- the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
- the individual has one of the above mentioned disorders.
- the individual is at risk for one of the above mentioned disorders .
- the individual has been identified as in need of therapy.
- the invention provides methods for prophylactically reducing CTGF expression in an individual .
- Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a CTGF nucleic acid.
- administration of a therapeutically effective amount of an antisense compound targeted to a CTGF nucleic acid is accompanied by monitoring of CTGF levels in the serum of an individual, to determine an individual's response to administration of the antisense compound.
- An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
- administration of an antisense compound targeted to a CTGF nucleic acid results in reduction of CTGF expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
- administration of an antisense compound targeted to a CTGF nucleic acid results in a change in a measure of CTGF as measured by a standard test, for example, but not limited to, CTGF.
- administration of a CTGF antisense compound increases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
- administration of a CTGF antisense compound decreases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
- composition comprising an antisense compound targeted to CTGF is used for the preparation of a medicament for treating a patient suffering or susceptible to any one of the above-mentioned disorders .
- one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents .
- such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
- such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
- such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
- one or more pharmaceutical compositions of the present invention are co- administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
- one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
- pharmaceutical agents that may be co- administered with a pharmaceutical composition of the present invention include a second therapeutic agent.
- pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to second therapeutic agent.
- the second therapeutic agent is administered prior to administration of a pharmaceutical composition of the present invention.
- the second therapeutic agent is administered following administration of a pharmaceutical composition of the present invention.
- the second therapeutic agent is administered at the same time as a pharmaceutical composition of the present invention.
- the dose of a co-administered second therapeutic agent is the same as the dose that would be administered if the second therapeutic agent was administered alone.
- the dose of a coadministered second therapeutic agent is lower than the dose that would be administered if the second therapeutic agent was administered alone. In certain such embodiments the dose of a co-administered second therapeutic agent is greater than the dose that would be administered if the second therapeutic agent was administered alone.
- the co-administration of a second compound enhances the therapeutic effect of a first compound, such that co-administration of the compounds results in an therapeutic effect that is greater than the effect of administering the first compound alone, a synergistic effect.
- the co-administration results in therapeutic effects that are additive of the effects of the compounds when administered alone.
- the co-administration results in therapeutic effects that are supra-additive of the effects of the compounds when administered alone.
- the first compound is an antisense compound.
- the second compound is an antisense compound.
- CTGF nucleic acids can be tested in vitro in a variety of cell types.
- Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA) .
- Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes .
- Example 2 In vitro testing of antisense oligonucleotides
- Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
- cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
- One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA) .
- Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ⁇ g/mL per 100 nM antisense oligonucleotide.
- Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, CA) .
- Antisense oligonucleotide is mixed with LIPOFECTAMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ⁇ g/mL per 100 nM antisense oligonucleotide.
- Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
- the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM.
- RNA analysis can be performed on total cellular RNA or poly (A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols. EXAMPLE 4: Analysis of inhibition of target levels or expression
- Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR) , or quantitative real-time PCR.
- RNA analysis can be performed on total cellular RNA or poly (A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
- Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
- RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
- RT reverse transcriptase
- cDNA complementary DNA
- RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
- Gene (or KNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA) .
- Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately.
- Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invetrogen, Inc. Eugene, OR) .
- RNA quantification by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374) .
- a CYTOFLUOR® 4000 instrument PE Applied Biosystems is used to measure RIBOGREEN® fluorescence.
- Probes and primers are designed to hybridize to a CTGF nucleic acid.
- Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA) .
- Antisense inhibition of CTGF nucleic acids can be assessed by measuring CTGF protein levels .
- Protein levels of CTGF can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting) as described in Example 9 below, enzyme- linked immunosorbent assay (ELISA) , quantitative protein assays, protein activity assays (for example, caspase activity assays) , immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) .
- Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI) , or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of human and rat CTGF are commercially available.
- Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of CTGF and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models.
- antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight.
- RNA is isolated from liver tissue and changes in CTGF nucleic acid expression are measured. Changes in CTGF protein levels are also measured using the methods described hereinabove in Example 6.
- oligonucleotides were designed to target different regions of the human connective tissue growth factor RNA, using published sequences (GenBank accession number NM_001901.2 , incorporated herein as SEQ ID NO: 9, and GenBank accession number NT_025741.14, incorporated herein as SEQ ID NO: 10) .
- All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of either ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotides "wings” or 13 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by two- and five-nucleotides "wings,” respectively.
- the wings are composed of 2'- methoxyethyl (2'-MOE) nucleotides.
- the compounds were analyzed for their effect on human connective tissue growth factor mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments. If present, "N. D. " indicates "no data” .
- CDS 9 380 CCAGCTGCTTGGCGCAGACG 64 161
- SEQ ID NOs 11-15, 17-20, 24, 26-34, 36- 57, 59, 61, 63-82, 84-86, 88, 95, 97, 99, 102, 103, 105, 107, 108, 122, 125, 127-140, 145, 146, 149, 151-154, 156, 159, 161- 165 demonstrated at least 24% inhibition of human connective tissue growth factor expression in this assay and are therefore preferred.
- the target sites to which these preferred sequences are complementary are herein referred to as "active sites" and are therefore preferred sites for targeting by compounds of the present invention.
- the antisense compound is complementary within a range of nucleotides on the CTGF sequence, i.e. within the range of nucleotides 718-751, 1388-1423, 1457-1689, 2040-2069, 2120- 2147, or 2267-2301 of SEQ ID NO : 9.
- the antisense compound is complimentary within the range of nucleotides 2728-2797 of SEQ ID NO: 10.
- Compounds targeted to these ranges demonstrate at least 50% inhibition (i.e. SEQ ID NOs: 15, 29, 31, 42, 46-49, 53, 72, 81, 82, 152-154, 164, and 165) .
- Certain target sites listed in Table 1 also demonstrate at least 50% inhibition (i.e. SEQ ID NOs: 12, 20, 33, 34, 76, 107, 129, 132, 134, 136, and 146) .
- the antisense compound is complementary within the range of nucleotides 553-611, 1394-1423, 1469-1508, 1559-1605, 1659-1689 or 2100-2129.
- Compounds targeted therein demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 27, 38,
- the antisense compound is also complementary within the range of nucleotides 1399-1423.
- Compounds targeted therein demonstrate at least 70% inhibition (i.e. SEQ ID NOs: 39 and 40) .
- Certain target sites listed in Table 1 also demonstrate at least 70% inhibition (i.e. SEQ ID NOs: 28, 30, 45, 51, 56, 78, 128, and 138) .
- One target site listed in Table 1 also demonstrates at least 80% inhibition (i.e. SEQ ID NO: 44) .
- the percent inhibition is achieved when the antisense compound is delivered to HuVec cells at a concentration of 50nm.
- SEQ ID No. 15 (ISIS 124238), were identified in both exonic and intronic sequences.
- SEQ NO. 13 and 15 are the previously designated oligonucleotides and SEQ ID No: 167
- Oligonucleotides were screened and confirmed at a concentration 50 nM in human umbilical vein endothelial cells (HuVEC) using Lipofectin mediated transfection.
- HuVEC cells from Cascade Biologies (Portland, OR) maintained in Medium 200 supplemented with Low Serum Growth Supplement (from Cascade Biologies) were plated into 96-well plates at 5,000 cells per well and incubated overnight at 37 2 C in the presence of 5% CO 2 . The following day the medium was aspirated and replaced with prewarmed Opti-MEM I (Invitrogen) containing Oligo- Lipofectamine 2000 (Invitrogen) mixture (3 mg of Lipofectamine 2000 per 1 ml of Opti-MEM I medium) .
- Opti-MEM I Invitrogen
- Oligo- Lipofectamine 2000 Oligo- Lipofectamine 2000
- the new CTGF oligonucleotides (SEQ ID NOs: 28, 30, 39, 40, 45, 52, 56, 78, 125, and 166) show excellent inhibition of human CTGF mRNA expression.
- the highly active oligonucleotides identified are provided in Figure 7.
- a number of new intronic ( Figures 4, 5 and 6) and exonic ( Figures 1, 2 and 3) oligonucleotides surprisingly are significantly more active than the historical previously screened compounds, including ISIS 124238.
- the top 10 most active antisense oligonucleotides were confirmed in dose response experiments in HuVEC cells using the method described above.
- the purpose of this pilot toxicology study was to evaluate three oligonucleotides targeting human CTGF for potential toxicity in normal male BALB/c mice.
- the oligonucleotides tested were ISIS sequences 412294 (SEQ ID NO: 39), 412295 (SEQ ID NO: 40), and 418899 (SEQ ID NO: 166) .
- results following 4 weeks of dosing with 25 mg/kg or 50 mg/kg antisense oligonucleotide ISIS 412294 (SEQ ID NO: 39), ISIS 412295 (SEQ ID NO: 40) or ISIS 418899 (SEQ ID NO: 166) indicate a number of end-points differing significantly from the saline-treated control group of mice.
- ALT Plasma alanine aminotranferease
- AST aspartate aminotransferase
- Weight gain for the 50 mg/kg 412295-treated group was significantly lower than the weight gain in the control group (see Figure 10) .
- SEQ ID NO: 39 (ISIS 412294) did not exhibit as many undesirable toxicological characteristics as SEQ ID NO: 40 (ISIS 412295) and SEQ ID NO:166 (ISIS 418899) . This result was entirely unexpected, and was not predicted by the cell culture behavior of these oligonucleotide sequences.
- Example 11 Effect of a Rat CTGF Antisense Oligonucleotide (SEQ ID NO: 163) on Collagen and CTGF mRNA Expression in Wounded Rats
- the two biopsy sites on the right side of the animal were treated intra-dermally with the CTGF antisense oligonucleotide on Days 1, 5, 9, and 13 post-biopsy at either 3.0, 1.0, 0.3 or 0.1 mg antisense oligonucleotide.
- Biopsy sites on the left side of the animal were treated intra-dermally with phosphate buffer saline (PBS) .
- PBS phosphate buffer saline
- the animals were sacrificed on Day 15 post-biopsy.
- a total volume of 200 ⁇ l of antisense oligonucleotide or PBS was delivered to each punch biopsy site. This 200 ⁇ l volume was divided into four 50 ⁇ l aliquots which were injected around the wound's periphery, at approximately 0.25 cm to 0.5 cm to the left, right, top, and bottom sides of the wound.
- RNA analysis of rat CTGF and CollA2 was performed using the standard curve methodology for data analysis and RiboGreen as the housekeeping/ normalization gene.
- SEQ ID NO: 39 The potential for SEQ ID NO: 39 to induce unwanted antisense effects that could translate into "off-target” toxicity was assessed by conducting a search of the human genome database for sequences that have complete or partial homology or complimentarity with the SEQ ID NO: 39 nucleotide sequence.
- SEQ ID NO:39 has a high degree of specificity for the intended target with minimal potential for off-target effects.
- SEQ ID NO: 39 A Phase 1 Single-Dose Intra-Dermal Clinical Study to Assess the Safety and Tolerability of a CTGF Antisense Oligonucleotide (SEQ ID NO: 39)
- the human CTGF antisense oligonucleotide SEQ ID NO: 39 (Isis No. 412294) was administered to six patients by intra-dermal dosing (80 mg total dose) as part of a Phase 1 study protocol to assess the safety and tolerability of a single dose of drug.
- CTGF antisense oligonucleotide administered at doses anticipated to be within the therapeutic range is well tolerated in humans, demonstrating the safety of this compound for treating skin scarring.
- Skin drug levels were evaluated in a cohort of patients in an initial clinical study, where 5 patients each received 40 mg of the antisense oligonucleotide (ASO) (administered as 10 equal doses of 4 mg each) .
- Skin biopsies were obtained 21 days following the single-dose administration of the ASO on Day 1, at the site of the simulated surgical wound (drawn line on skin as a reference for dosing locations) .
- the punch biopsy- consisted of a 4-irun cylindrical core of tissue sample.
- Levels of the ASO were determined using capillary electrophoresis and fluorescently-labeled sequence-specific probes and were 84.2 ⁇ g/gram of tissue. Projected therapeutic concentrations of the ASO drug are anticipated to be between 1 and 100 ⁇ g/gram tissues .
- Example 16 A Phase 2 Randomized, Double-blind, Within-Subject Controlled Clinical Efficacy and Safety Study of SEQ ID NO: 39 on Reducing Scar Severity in Subjects Undergoing an Elective
- This study is a randomized, double-blind, within-subject controlled study evaluating efficacy and safety of CTGF antisense oligonucleotide SEQ ID NO:39 (i.e. the drug product) .
- the drug product is administered adjacent to both sides of the abdominoplasty incision via intradermal injections in subjects undergoing an elective abdominoplasty.
- the study duration is approximately 24 weeks. Subjects receive the abdominoplasty on Day 1, followed by dosing of the drug product and placebo over a 10 week period. Scar observation and assessment are performed every 4 weeks up to week 12, and again at week 24.
- Efficacy is determined by ratings of each matched pair of incisions .
- VAS visual analog scale
- SEQ ID NO: 39 is efficacious by these criteria.
- Example 17 A Phase 2 Randomized, Double-blind, Within-subject Controlled Clinical Efficacy and Safety Study of SEQ ID NO: 39 in Reducing Skin Scarring in Subjects Undergoing an Elective Revision of Medial Scars Resulting from Prior Breast Reduction or Mastopexy Surgery.
- This study is a randomized, double-blind, within-subject controlled study evaluating efficacy and safety of CTGF antisense oligonucleotide SEQ ID NO: 39 (i.e. the drug product) .
- the drug product is administered to the medial portion of the revised breast reduction scars via intradermal injections.
- a section of either side of the medial portion of the revised breast wound/scar is treated with drug product or placebo, after the surgical incision is closed.
- Up to 40 subjects are recruited into this study.
- the study duration is approximately 24 weeks.
- the subjects receive the scar revisions on Day 1, followed by drug product and placebo dosing over a 10-week period. Scar observation and assessment are performed every 4 weeks up to week 12, and again at week 24.
- Efficacy is determined by ratings each matched pair of incisions. Efficacy is evaluated at weeks 12 and 24 following revision of the medial portions of the breast reduction scar using two methods of rating severity of incisional scars:
- SEQ ID NO: 39 is efficacious by these criteria.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Epidemiology (AREA)
- Endocrinology (AREA)
- Physical Education & Sports Medicine (AREA)
- Dermatology (AREA)
- Heart & Thoracic Surgery (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Urology & Nephrology (AREA)
- Cardiology (AREA)
- Rheumatology (AREA)
- Surgery (AREA)
- Pulmonology (AREA)
- Neurosurgery (AREA)
- Gastroenterology & Hepatology (AREA)
Priority Applications (19)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2011525160A JP5420668B2 (ja) | 2008-08-25 | 2009-08-25 | 結合組織成長因子を対象とするアンチセンスオリゴヌクレオチドおよびその使用 |
| DK09819622.3T DK2331141T3 (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides WHO IS TARGETING connective tissue, AND USES THEREOF |
| ES09819622.3T ES2566508T3 (es) | 2008-08-25 | 2009-08-25 | Oligonucleótidos antisentido dirigidos contra el factor de crecimiento de tejido conjuntivo y usos de los mismos |
| KR1020117006585A KR101762734B1 (ko) | 2008-08-25 | 2009-08-25 | 결합 조직 성장 인자에 대한 안티센스 올리고뉴클레오타이드 및 그의 용도 |
| CN200980133819.2A CN103429270B (zh) | 2008-08-25 | 2009-08-25 | 阻止结缔组织生长因子的反义核苷酸及其用途 |
| HK11113582.4A HK1158965B (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| CA2733262A CA2733262C (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| KR1020177020644A KR101877698B1 (ko) | 2008-08-25 | 2009-08-25 | 결합 조직 성장 인자에 대한 안티센스 올리고뉴클레오타이드 및 그의 용도 |
| NZ591416A NZ591416A (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| MX2011002143A MX2011002143A (es) | 2008-08-25 | 2009-08-25 | Oligonucleotidos antisentido dirigidos contra el factor de crecimiento del tejido conectivo y usos de los mismos. |
| BRPI0912923A BRPI0912923A8 (pt) | 2008-08-25 | 2009-08-25 | Composto que consiste de um oligonucleotídeo modificadpo composto de 12-30 nucleosídeos ligados, compostos que compreende um oligonucleotídeo modificado que compreende pelo menos 12 nucleosídeos ligados, composto que compreende um oligonucleotídeo modificado que compreende nucleosídeos ligados, e, uso de um composto |
| GB1002626A GB2465902B (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| EA201170345A EA022207B1 (ru) | 2008-08-25 | 2009-08-25 | Антисмысловые олигонуклеотиды против фактора роста соединительной ткани и способы их применения |
| EP09819622.3A EP2331141B1 (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| HK10111332.2A HK1144908B (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| IL211230A IL211230A (en) | 2008-08-25 | 2011-02-15 | Oligonucleotide antisense directed against connective tissue growth factor and uses |
| ZA2011/01549A ZA201101549B (en) | 2008-08-25 | 2011-02-28 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| IL224697A IL224697A (en) | 2008-08-25 | 2013-02-13 | Oligonucleotide antisense directed against the growth factor of connective tissue and their use |
| IL236309A IL236309A (en) | 2008-08-25 | 2014-12-17 | Oligonucleotide antisense directed against connective tissue growth factor and uses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US19012108P | 2008-08-25 | 2008-08-25 | |
| US61/190,121 | 2008-08-25 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010042281A2 true WO2010042281A2 (en) | 2010-04-15 |
| WO2010042281A9 WO2010042281A9 (en) | 2011-10-06 |
Family
ID=41818313
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2009/054973 Ceased WO2010042281A2 (en) | 2008-08-25 | 2009-08-25 | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
Country Status (19)
| Country | Link |
|---|---|
| US (6) | US8252762B2 (enExample) |
| EP (2) | EP2331141B1 (enExample) |
| JP (5) | JP5420668B2 (enExample) |
| KR (2) | KR101877698B1 (enExample) |
| CN (2) | CN103429270B (enExample) |
| AU (2) | AU2009275387B2 (enExample) |
| BR (1) | BRPI0912923A8 (enExample) |
| CA (1) | CA2733262C (enExample) |
| CO (1) | CO6341577A2 (enExample) |
| DK (1) | DK2331141T3 (enExample) |
| EA (1) | EA022207B1 (enExample) |
| ES (1) | ES2566508T3 (enExample) |
| GB (1) | GB2465902B (enExample) |
| IL (3) | IL211230A (enExample) |
| MX (2) | MX2011002143A (enExample) |
| NZ (2) | NZ601660A (enExample) |
| SG (1) | SG196769A1 (enExample) |
| WO (1) | WO2010042281A2 (enExample) |
| ZA (1) | ZA201101549B (enExample) |
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012106508A1 (en) | 2011-02-02 | 2012-08-09 | Pfizer Inc. | Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf) |
| US8252762B2 (en) | 2008-08-25 | 2012-08-28 | Excaliard Pharmaceuticals, Inc. | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| JP2013530934A (ja) * | 2010-04-28 | 2013-08-01 | ポステック アカデミー−インダストリー ファンデーション | 結合組織成長因子を用いた薬学的組成物 |
| US8664189B2 (en) | 2008-09-22 | 2014-03-04 | Rxi Pharmaceuticals Corporation | RNA interference in skin indications |
| US8802839B2 (en) | 2011-07-15 | 2014-08-12 | Fibrogen, Inc. | Connective tissue growth factor antisense oligonucleotides |
| US8815818B2 (en) | 2008-07-18 | 2014-08-26 | Rxi Pharmaceuticals Corporation | Phagocytic cell delivery of RNAI |
| US8946172B2 (en) | 2008-08-25 | 2015-02-03 | Excaliard Pharmaceuticals, Inc. | Method for reducing scarring during wound healing using antisense compounds directed to CTGF |
| US9074211B2 (en) | 2008-11-19 | 2015-07-07 | Rxi Pharmaceuticals Corporation | Inhibition of MAP4K4 through RNAI |
| US9080171B2 (en) | 2010-03-24 | 2015-07-14 | RXi Parmaceuticals Corporation | Reduced size self-delivering RNAi compounds |
| US9095504B2 (en) | 2010-03-24 | 2015-08-04 | Rxi Pharmaceuticals Corporation | RNA interference in ocular indications |
| US9340786B2 (en) | 2010-03-24 | 2016-05-17 | Rxi Pharmaceuticals Corporation | RNA interference in dermal and fibrotic indications |
| US9493774B2 (en) | 2009-01-05 | 2016-11-15 | Rxi Pharmaceuticals Corporation | Inhibition of PCSK9 through RNAi |
| US9745574B2 (en) | 2009-02-04 | 2017-08-29 | Rxi Pharmaceuticals Corporation | RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality |
| EP3077050A4 (en) * | 2013-12-04 | 2017-11-01 | RXi Pharmaceuticals Corporation | Methods for treatment of wound healing utilizing chemically modified oligonucleotides |
| US10131904B2 (en) | 2008-02-11 | 2018-11-20 | Rxi Pharmaceuticals Corporation | Modified RNAi polynucleotides and uses thereof |
| US10808247B2 (en) | 2015-07-06 | 2020-10-20 | Phio Pharmaceuticals Corp. | Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach |
| US10900039B2 (en) | 2014-09-05 | 2021-01-26 | Phio Pharmaceuticals Corp. | Methods for treating aging and skin disorders using nucleic acids targeting Tyr or MMP1 |
| US10934550B2 (en) | 2013-12-02 | 2021-03-02 | Phio Pharmaceuticals Corp. | Immunotherapy of cancer |
| US11001845B2 (en) | 2015-07-06 | 2021-05-11 | Phio Pharmaceuticals Corp. | Nucleic acid molecules targeting superoxide dismutase 1 (SOD1) |
| US11021707B2 (en) | 2015-10-19 | 2021-06-01 | Phio Pharmaceuticals Corp. | Reduced size self-delivering nucleic acid compounds targeting long non-coding RNA |
| US11279934B2 (en) | 2014-04-28 | 2022-03-22 | Phio Pharmaceuticals Corp. | Methods for treating cancer using nucleic acids targeting MDM2 or MYCN |
| US12234458B2 (en) | 2018-07-31 | 2025-02-25 | Lemonex Inc. | Composition for inhibiting CTGF expression |
| US12544344B2 (en) | 2017-04-19 | 2026-02-10 | Phio Pharmaceuticals Corp. | Topical delivery of nucleic acid compounds |
Families Citing this family (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2655993A1 (en) * | 2005-09-30 | 2007-07-05 | The Regents Of The University Of California | Satb1: a determinant of morphogenesis and tumor metastatis |
| WO2012174470A1 (en) * | 2011-06-16 | 2012-12-20 | Isis Pharmaceuticals, Inc. | Antisense modulation of pyruvate carboxylase expression |
| WO2014018930A1 (en) * | 2012-07-27 | 2014-01-30 | Isis Pharmaceuticals. Inc. | Modulation of renin-angiotensin system (ras) related diseases by angiotensinogen |
| AR092982A1 (es) | 2012-10-11 | 2015-05-13 | Isis Pharmaceuticals Inc | Modulacion de la expresion de receptores androgenicos |
| CN104740628B (zh) * | 2015-02-12 | 2017-09-26 | 西安交通大学医学院第一附属医院 | 用于治疗肝纤维化的结缔组织生长因子嵌合疫苗及其应用 |
| MX2017012426A (es) * | 2015-04-03 | 2018-01-26 | Ionis Pharmaceuticals Inc | Composiciones y metodos para modular la expresion de tmprss6. |
| CN113817735A (zh) | 2015-10-08 | 2021-12-21 | Ionis制药公司 | 用于调节血管紧张素原表达的化合物和方法 |
| CA3043768A1 (en) | 2016-11-29 | 2018-06-07 | PureTech Health LLC | Exosomes for delivery of therapeutic agents |
| KR20190141770A (ko) * | 2017-05-04 | 2019-12-24 | 사노피 | 알포트 증후군의 치료 방법 |
| WO2020027640A1 (ko) * | 2018-07-31 | 2020-02-06 | 주식회사 레모넥스 | Ctgf 발현 억제용 조성물 |
| US12492399B2 (en) | 2019-03-14 | 2025-12-09 | Rena Therapeutics Inc. | Nucleic acid complex for regulating IHH expression |
| WO2021045538A1 (ko) | 2019-09-03 | 2021-03-11 | 소바젠 주식회사 | eIF4E 저해제를 포함하는 eIF4E 활성증가와 관련된 상태의 진단 또는 치료용 조성물 |
| EP4172338A4 (en) * | 2020-06-29 | 2025-06-11 | Ionis Pharmaceuticals, Inc. | COMPOUNDS AND METHODS FOR MODULATING PLP1 |
| LT4136092T (lt) | 2020-11-18 | 2024-09-25 | Ionis Pharmaceuticals, Inc. | Junginiai ir būdai, skirti angiotenzinogeno raiškos moduliavimui |
| CN114807127A (zh) * | 2021-01-19 | 2022-07-29 | 陈璞 | 用于结缔组织生长因子的小干扰rna及其应用 |
| CN112800489B (zh) * | 2021-02-07 | 2023-12-26 | 北京中电华大电子设计有限责任公司 | 一种基于se的高安全指纹模块软件实现方法 |
| CN112966441B (zh) * | 2021-03-08 | 2022-04-29 | 中国人民解放军海军航空大学 | 一种基于连续Weiner过程损伤的设备剩余寿命评估方法 |
| MX2024005273A (es) * | 2021-11-01 | 2024-07-10 | Ionis Pharmaceuticals Inc | Compuestos y metodos para reducir la expresion de psd3. |
| KR20250009923A (ko) * | 2023-07-10 | 2025-01-20 | 소바젠 주식회사 | Gap43 활성 또는 발현을 조절하기 위한 조성물 |
| WO2025026439A1 (zh) * | 2023-08-02 | 2025-02-06 | 广州瑞风生物科技有限公司 | 基因编辑系统及其应用 |
| WO2025147949A1 (zh) * | 2024-01-11 | 2025-07-17 | 广州瑞风生物科技有限公司 | 基因编辑系统及其应用 |
| CN117019405B (zh) * | 2023-08-10 | 2024-08-20 | 昆明理工大学 | 一种组合捕收剂及其在锂云母浮选中的应用 |
Citations (204)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| WO1988004924A1 (en) | 1986-12-24 | 1988-07-14 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| WO1990004384A1 (en) | 1988-10-20 | 1990-05-03 | Royal Free Hospital School Of Medicine | Liposomes |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| WO1991005545A1 (en) | 1989-10-20 | 1991-05-02 | Liposome Technology, Inc. | Liposome microreservoir composition and method |
| US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
| US5225212A (en) | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
| US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
| WO1993024510A1 (fr) | 1992-05-25 | 1993-12-09 | Centre National De La Recherche Scientifique (Cnrs) | Composes biologiquement actifs de type phosphotriesters |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| WO1994020073A1 (en) | 1993-03-03 | 1994-09-15 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
| US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
| US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| WO1994026764A1 (fr) | 1993-05-12 | 1994-11-24 | Centre National De La Recherche Scientifique (Cnrs) | Oligonucleotides phosphorothioates triesters et procede de preparation |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
| US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
| US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
| US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| WO1996010391A1 (en) | 1994-09-30 | 1996-04-11 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
| US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
| US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5540935A (en) | 1993-12-06 | 1996-07-30 | Nof Corporation | Reactive vesicle and functional substance-fixed vesicle |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
| US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
| US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5585270A (en) | 1991-08-30 | 1996-12-17 | University Of South Florida | Polynucleotides encoding connective tissue growth factor |
| WO1996040062A1 (en) | 1995-06-07 | 1996-12-19 | Georgetown University | A method of transfection of cells using liposomally encapsulated nucleic acids |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
| US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
| US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| WO1997004787A1 (en) | 1995-08-01 | 1997-02-13 | Novartis Ag | Liposomal oligonucleotide compositions |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| WO1997013499A1 (en) | 1995-10-11 | 1997-04-17 | The University Of British Columbia | Liposomal formulations of mitoxantrone |
| US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
| US5645985A (en) | 1991-11-26 | 1997-07-08 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
| US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| WO1997030731A2 (en) | 1996-02-21 | 1997-08-28 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
| US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
| US5665710A (en) | 1990-04-30 | 1997-09-09 | Georgetown University | Method of making liposomal oligodeoxynucleotide compositions |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
| US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| US5705188A (en) | 1993-02-19 | 1998-01-06 | Nippon Shinyaku Company, Ltd. | Drug composition containing nucleic acid copolymer |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
| US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| WO1998039352A1 (en) | 1997-03-07 | 1998-09-11 | Takeshi Imanishi | Novel bicyclonucleoside and oligonucleotide analogues |
| US5830653A (en) | 1991-11-26 | 1998-11-03 | Gilead Sciences, Inc. | Methods of using oligomers containing modified pyrimidines |
| US5876730A (en) | 1997-08-07 | 1999-03-02 | Childrens Hospital Research Foundation | Heparin-binding growth factor (HBGF) polypeptides |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| WO2000013706A1 (en) | 1998-09-08 | 2000-03-16 | Henry Ford Health System | Methods for detecting, preventing, and treating renal disorders by modulating, regulating, and inhibiting connective tissue growth factor |
| WO2000027868A2 (en) | 1998-11-06 | 2000-05-18 | Fibrogen, Inc. | Connective tissue growth factor (ctgf) and methods of use |
| US6069006A (en) | 1991-08-30 | 2000-05-30 | University Of South Florida | Connective tissue growth factor (CTGF) regulatory nucleic acid sequences |
| WO2000035936A1 (en) | 1998-12-14 | 2000-06-22 | University Of Miami | Connective tissue growth factor fragments and methods and uses thereof |
| WO2001015729A1 (en) | 1999-08-27 | 2001-03-08 | Fibrogen, Inc. | Connective tissue growth factor receptor, its agonists and antagonists, and their therapeutic and diagnostic uses |
| WO2001029217A2 (en) | 1999-10-15 | 2001-04-26 | Curagen Corporation | Novel polypeptides and polynucleotides encoding same |
| WO2005049582A1 (en) | 2003-11-14 | 2005-06-02 | Auspex Pharmaceuticals, Inc. | Method of preparation of novel nucleoside analogs and uses |
| US6965025B2 (en) | 2001-12-10 | 2005-11-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of connective tissue growth factor expression |
| WO2006069037A1 (en) | 2004-12-23 | 2006-06-29 | Alcon, Inc. | Rnai inhibition of ctgf for treatment of ocular disorders |
| WO2007146511A2 (en) | 2006-05-05 | 2007-12-21 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating gene expression |
| US20080108583A1 (en) | 2006-01-20 | 2008-05-08 | Elena Feinstein | Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| US8262498B2 (en) | 2008-05-16 | 2012-09-11 | Taylor Made Golf Company, Inc. | Golf club |
| US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
| US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
Family Cites Families (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7384634B2 (en) * | 1991-08-30 | 2008-06-10 | University Of South Florida | Connective tissue growth factor |
| US5801154A (en) | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US6551618B2 (en) | 1994-03-15 | 2003-04-22 | University Of Birmingham | Compositions and methods for delivery of agents for neuronal regeneration and survival |
| AU4411499A (en) | 1998-06-05 | 1999-12-20 | Human Genome Sciences, Inc. | Connective tissue growth factor-4 |
| US6335194B1 (en) | 1998-09-29 | 2002-01-01 | Isis Pharmaceuticals, Inc. | Antisense modulation of survivin expression |
| US6348329B1 (en) | 1998-11-06 | 2002-02-19 | Fibrogen, Inc. | Nucleic acids encoding rat connective tissue growth factor (CTGF) and methods of use |
| ES2234563T5 (es) * | 1999-02-12 | 2018-01-17 | Daiichi Sankyo Company, Limited | Nuevos análogos de nucleósidos y oligonucleótidos |
| US5998148A (en) | 1999-04-08 | 1999-12-07 | Isis Pharmaceuticals Inc. | Antisense modulation of microtubule-associated protein 4 expression |
| WO2001019161A2 (en) | 1999-09-17 | 2001-03-22 | Isis Pharmaceuticals, Inc. | ANTISENSE MODULATION OF TRANSFORMING GROWTH FACTOR-β EXPRESSION |
| ES2336887T5 (es) * | 2000-03-30 | 2019-03-06 | Whitehead Inst Biomedical Res | Mediadores de interferencia por ARN específicos de secuencias de ARN |
| AU2001256865A1 (en) | 2000-05-11 | 2001-11-20 | Academisch Ziekenhuis Bij De Universiteit Van Amsterdam | Myc targets |
| EP1315807B1 (en) | 2000-09-06 | 2005-04-20 | McGILL UNIVERSITY | Chimeric antisense oligonucleotides of arabinofuranose analogues and deoxyribose nucleotides |
| GB2367378B (en) | 2000-09-27 | 2004-08-25 | Krone Gmbh | Patch panel |
| CA2429814C (en) * | 2000-12-01 | 2014-02-18 | Thomas Tuschl | Rna interference mediating small rna molecules |
| US20030119010A1 (en) | 2001-03-01 | 2003-06-26 | University Of Queensland | Polynucleotides and polypeptides linked to a disease or condition |
| US20060148743A1 (en) * | 2001-05-18 | 2006-07-06 | Vasant Jadhav | RNA interference mediated inhibition of histone deacetylase (HDAC) gene expression using short interfering nucleic acid (siNA) |
| US20030096272A1 (en) | 2001-07-30 | 2003-05-22 | Incyte Genomics, Inc. | Genes regulated by peroxisome proliferator-activated receptor gamma agonist |
| WO2003035083A1 (de) | 2001-10-26 | 2003-05-01 | Ribopharma Ag | Medikament zur behandlung einer fibrotischen erkrankung durch rna interferenz |
| ATE526041T1 (de) | 2001-12-11 | 2011-10-15 | Fibrogen Inc | Verfahren zur hemmung okularer vorgänge |
| US6738004B2 (en) | 2002-08-15 | 2004-05-18 | Cirrus Logic, Inc. | Method and system of integrating a mismatch noise shaper into the main loop of a delta-sigma modulator |
| AU2003295600A1 (en) | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| WO2006006948A2 (en) | 2002-11-14 | 2006-01-19 | Dharmacon, Inc. | METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY |
| WO2005033136A1 (en) | 2003-09-29 | 2005-04-14 | Children's Hospital, Inc. | Unique integrin binding site in connective tissue growth factor (ctgf) |
| WO2005038013A1 (en) | 2003-10-07 | 2005-04-28 | Isis Pharmaceuticals, Inc. | Artisense oligonucleotides optimized for kidney targeting |
| GB0326780D0 (en) * | 2003-11-18 | 2003-12-24 | Imp College Innovations Ltd | Biological materials and uses thereof |
| GB0326778D0 (en) | 2003-11-18 | 2003-12-24 | Imp College Innovations Ltd | Biological materials and uses thereof |
| CN101884789A (zh) | 2004-02-11 | 2010-11-17 | 法布罗根股份有限公司 | Ctgf作为糖尿病肾病的治疗靶点 |
| WO2005110479A2 (en) | 2004-04-28 | 2005-11-24 | Fibrogen, Inc. | Treatments for pancreatic cancer |
| JP2007535562A (ja) | 2004-04-29 | 2007-12-06 | ジェンザイム・コーポレイション | 多嚢胞性疾患の処置のための方法および組成物 |
| US20080261904A1 (en) | 2004-06-03 | 2008-10-23 | Balkrishen Bhat | Chimeric Gapped Oligomeric Compounds |
| WO2005120231A1 (en) | 2004-06-08 | 2005-12-22 | Fibrogen, Inc. | Connective tissue growth factor regulates intracellular signaling pathways |
| DE102004062138B3 (de) | 2004-12-23 | 2006-03-30 | Benz Gmbh Werkzeug- U. Maschinenbau Kg | Verstellbares Werkzeugaggregat |
| CA2606778A1 (en) | 2005-05-05 | 2006-11-16 | Fibrogen, Inc. | Vascular disease therapies |
| US20070072817A1 (en) | 2005-09-29 | 2007-03-29 | Fibrogen, Inc. | Methods for reducing blood pressure |
| WO2008005533A2 (en) | 2006-07-06 | 2008-01-10 | Aaron Thomas Tabor | Compositions and methods for genetic modification of cells having cosmetic function to enhance cosmetic appearance |
| ES2383235T3 (es) | 2006-10-16 | 2012-06-19 | Bayer Pharma Aktiengesellschaft | CTGF como biomarcador , diana terapéutica y diagnóstica |
| JP2010507387A (ja) * | 2006-10-25 | 2010-03-11 | クアーク・ファーマスーティカルス、インコーポレイテッド | 新規のsiRNAおよびその使用方法 |
| US20080193443A1 (en) | 2006-10-30 | 2008-08-14 | Oxana Beskrovnaya | Methods and compositions for the treatment of polycystic diseases |
| US20090069623A1 (en) | 2007-08-21 | 2009-03-12 | Virginia Commonwealth University Intellectual Property Foundation | Methods and compositions for treatment or prevention of radiation-induced fibrosis |
| RU2487716C2 (ru) | 2007-10-03 | 2013-07-20 | Кварк Фармасьютикалс, Инк. | Новые структуры малых интерферирующих рнк (sirna) |
| GB0724231D0 (en) | 2007-12-12 | 2008-01-30 | Renono Ltd | Methods for inhibiting scarring |
| WO2010027830A2 (en) * | 2008-08-25 | 2010-03-11 | Excaliard Pharmaceuticals, Inc. | Methods for modulation of connective tissue growth factor expression by administering antisense oligonucleotides through a delivery system so as to reduce scarring from wound healing and threat fibrotic diseases |
| NZ601660A (en) * | 2008-08-25 | 2014-05-30 | Excaliard Pharmaceuticals Inc | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| WO2010027831A1 (en) * | 2008-08-25 | 2010-03-11 | Excaliard Pharmaceuticals, Inc. | Method for reducing scarring during wound healing using antisense compounds directed to ctgf |
| EP2342340A1 (en) | 2008-09-22 | 2011-07-13 | Rxi Pharmaceuticals Corporation | Rna interference in skin indications |
| EP2169059A1 (en) | 2008-09-25 | 2010-03-31 | Academisch Medisch Centrum bij de Universiteit van Amsterdam | Means and methods for counteracting, preventing and/or determining fibrosis or a risk of fibrosis |
| WO2010042201A1 (en) | 2008-10-07 | 2010-04-15 | Fibrogen, Inc. | Methods for treatment of focal segmental glomerulosclerosis |
| WO2010042202A1 (en) | 2008-10-07 | 2010-04-15 | Fibrogen, Inc. | Methods for treatment of podocyte injury |
| EP2408916A2 (en) | 2009-03-19 | 2012-01-25 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| EP2448971A1 (en) | 2009-07-02 | 2012-05-09 | Fibrogen, Inc. | Methods for treatment of muscular dystrophy |
-
2009
- 2009-08-25 NZ NZ601660A patent/NZ601660A/en not_active IP Right Cessation
- 2009-08-25 JP JP2011525160A patent/JP5420668B2/ja not_active Expired - Fee Related
- 2009-08-25 CN CN200980133819.2A patent/CN103429270B/zh not_active Expired - Fee Related
- 2009-08-25 SG SG2013087341A patent/SG196769A1/en unknown
- 2009-08-25 CA CA2733262A patent/CA2733262C/en not_active Expired - Fee Related
- 2009-08-25 ES ES09819622.3T patent/ES2566508T3/es active Active
- 2009-08-25 BR BRPI0912923A patent/BRPI0912923A8/pt not_active Application Discontinuation
- 2009-08-25 MX MX2011002143A patent/MX2011002143A/es active IP Right Grant
- 2009-08-25 NZ NZ591416A patent/NZ591416A/xx not_active IP Right Cessation
- 2009-08-25 CN CN201610938776.7A patent/CN107083386A/zh active Pending
- 2009-08-25 KR KR1020177020644A patent/KR101877698B1/ko not_active Expired - Fee Related
- 2009-08-25 KR KR1020117006585A patent/KR101762734B1/ko not_active Expired - Fee Related
- 2009-08-25 WO PCT/US2009/054973 patent/WO2010042281A2/en not_active Ceased
- 2009-08-25 US US12/547,474 patent/US8252762B2/en not_active Expired - Fee Related
- 2009-08-25 DK DK09819622.3T patent/DK2331141T3/en active
- 2009-08-25 AU AU2009275387A patent/AU2009275387B2/en not_active Ceased
- 2009-08-25 EP EP09819622.3A patent/EP2331141B1/en active Active
- 2009-08-25 GB GB1002626A patent/GB2465902B/en not_active Withdrawn - After Issue
- 2009-08-25 EA EA201170345A patent/EA022207B1/ru not_active IP Right Cessation
- 2009-08-25 EP EP16150258.8A patent/EP3081648A1/en not_active Withdrawn
-
2010
- 2010-09-28 AU AU2010224447A patent/AU2010224447B2/en not_active Ceased
-
2011
- 2011-02-15 IL IL211230A patent/IL211230A/en active IP Right Grant
- 2011-02-25 MX MX2013007766A patent/MX343397B/es unknown
- 2011-02-28 ZA ZA2011/01549A patent/ZA201101549B/en unknown
- 2011-03-22 CO CO11034740A patent/CO6341577A2/es active IP Right Grant
-
2012
- 2012-06-25 US US13/532,254 patent/US9096851B2/en not_active Expired - Fee Related
- 2012-08-13 US US13/584,573 patent/US8772260B2/en not_active Expired - Fee Related
- 2012-12-28 JP JP2012287043A patent/JP6058391B2/ja not_active Expired - Fee Related
-
2013
- 2013-02-13 IL IL224697A patent/IL224697A/en active IP Right Grant
-
2014
- 2014-12-17 IL IL236309A patent/IL236309A/en active IP Right Grant
-
2015
- 2015-06-29 US US14/753,860 patent/US9688987B2/en not_active Expired - Fee Related
- 2015-10-01 JP JP2015195988A patent/JP2016041067A/ja active Pending
-
2017
- 2017-01-26 JP JP2017012167A patent/JP2017113007A/ja not_active Withdrawn
- 2017-05-23 US US15/602,955 patent/US20170335329A1/en not_active Abandoned
-
2018
- 2018-11-29 US US16/204,866 patent/US20190323013A1/en not_active Abandoned
-
2019
- 2019-03-06 JP JP2019040774A patent/JP2019129828A/ja not_active Withdrawn
Patent Citations (237)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| US4789737A (en) | 1982-08-09 | 1988-12-06 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives and production thereof |
| US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US5541313A (en) | 1983-02-22 | 1996-07-30 | Molecular Biosystems, Inc. | Single-stranded labelled oligonucleotides of preselected sequence |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
| US5552538A (en) | 1984-10-16 | 1996-09-03 | Chiron Corporation | Oligonucleotides with cleavable sites |
| US5578717A (en) | 1984-10-16 | 1996-11-26 | Chiron Corporation | Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides |
| US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
| US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| WO1988004924A1 (en) | 1986-12-24 | 1988-07-14 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5286717A (en) | 1987-03-25 | 1994-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US5405939A (en) | 1987-10-22 | 1995-04-11 | Temple University Of The Commonwealth System Of Higher Education | 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
| US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
| US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| US5519126A (en) | 1988-03-25 | 1996-05-21 | University Of Virginia Alumni Patents Foundation | Oligonucleotide N-alkylphosphoramidates |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5453496A (en) | 1988-05-26 | 1995-09-26 | University Patents, Inc. | Polynucleotide phosphorodithioate |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5565555A (en) | 1988-09-23 | 1996-10-15 | Gilead Sciences, Inc. | Nucleoside hydrogen phosphonodithioate diesters and activated phosphonodithioate analogues |
| US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
| WO1990004384A1 (en) | 1988-10-20 | 1990-05-03 | Royal Free Hospital School Of Medicine | Liposomes |
| EP0445131B1 (en) | 1988-10-20 | 1994-04-27 | PolyMASC Pharmaceuticals plc | Liposomes |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
| US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
| US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US5416203A (en) | 1989-06-06 | 1995-05-16 | Northwestern University | Steroid modified oligonucleotides |
| US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5213804A (en) | 1989-10-20 | 1993-05-25 | Liposome Technology, Inc. | Solid tumor treatment method and composition |
| US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| WO1991005545A1 (en) | 1989-10-20 | 1991-05-02 | Liposome Technology, Inc. | Liposome microreservoir composition and method |
| US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
| EP0496813B1 (en) | 1989-10-20 | 1994-12-14 | SEQUUS PHARMACEUTICALS, INC. (a Delaware Corporation) | Liposome microreservoir composition and method |
| US5225212A (en) | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5527899A (en) | 1989-10-23 | 1996-06-18 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
| US5466786B1 (en) | 1989-10-24 | 1998-04-07 | Gilead Sciences | 2' Modified nucleoside and nucleotide compounds |
| US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
| US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5455233A (en) | 1989-11-30 | 1995-10-03 | University Of North Carolina | Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
| US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
| US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
| US5587469A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides containing N-2 substituted purines |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
| US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
| US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
| US5366878A (en) | 1990-02-15 | 1994-11-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
| US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| US5541306A (en) | 1990-03-08 | 1996-07-30 | Worcester Foundation For Biomedical Research | Aminoalkylphosphotriester oligonucleotide derivatives |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5536821A (en) | 1990-03-08 | 1996-07-16 | Worcester Foundation For Biomedical Research | Aminoalkylphosphorothioamidate oligonucleotide deratives |
| US5563253A (en) | 1990-03-08 | 1996-10-08 | Worcester Foundation For Biomedical Research | Linear aminoalkylphosphoramidate oligonucleotide derivatives |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| US5665710A (en) | 1990-04-30 | 1997-09-09 | Georgetown University | Method of making liposomal oligodeoxynucleotide compositions |
| US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5567810A (en) | 1990-08-03 | 1996-10-22 | Sterling Drug, Inc. | Nuclease resistant compounds |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
| US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
| US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
| US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
| US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US6069006A (en) | 1991-08-30 | 2000-05-30 | University Of South Florida | Connective tissue growth factor (CTGF) regulatory nucleic acid sequences |
| US6150101A (en) | 1991-08-30 | 2000-11-21 | University Of South Florida | Methods of identifying a composition that alters connective tissue growth factor expression |
| US5585270A (en) | 1991-08-30 | 1996-12-17 | University Of South Florida | Polynucleotides encoding connective tissue growth factor |
| US5783187A (en) | 1991-08-30 | 1998-07-21 | University Of South Florida | Treatment of cell proliferative disorders using antibodies which bind connective tissue growth factor |
| US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
| US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5393878A (en) | 1991-10-17 | 1995-02-28 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
| US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
| US5645985A (en) | 1991-11-26 | 1997-07-08 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| US5830653A (en) | 1991-11-26 | 1998-11-03 | Gilead Sciences, Inc. | Methods of using oligomers containing modified pyrimidines |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
| US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| WO1993024510A1 (fr) | 1992-05-25 | 1993-12-09 | Centre National De La Recherche Scientifique (Cnrs) | Composes biologiquement actifs de type phosphotriesters |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| US5700920A (en) | 1992-07-01 | 1997-12-23 | Novartis Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
| US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| US5705188A (en) | 1993-02-19 | 1998-01-06 | Nippon Shinyaku Company, Ltd. | Drug composition containing nucleic acid copolymer |
| WO1994020073A1 (en) | 1993-03-03 | 1994-09-15 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
| US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
| US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
| US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
| US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
| US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5770713A (en) | 1993-05-12 | 1998-06-23 | Centre National De La Recherche Scientifique | Phosphorothioate triester oligonucleotides and method of preparation |
| WO1994026764A1 (fr) | 1993-05-12 | 1994-11-24 | Centre National De La Recherche Scientifique (Cnrs) | Oligonucleotides phosphorothioates triesters et procede de preparation |
| US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
| US6005096A (en) | 1993-09-17 | 1999-12-21 | Gilead Sciences, Inc. | Pyrimidine derivatives |
| US5763588A (en) | 1993-09-17 | 1998-06-09 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5540935A (en) | 1993-12-06 | 1996-07-30 | Nof Corporation | Reactive vesicle and functional substance-fixed vesicle |
| US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
| US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
| US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US6232064B1 (en) | 1993-12-14 | 2001-05-15 | University Of South Florida | Methods of diagnosing a pathology characterized by a cell proliferative disorder associated with connective tissue growth factor |
| US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
| US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| WO1996010391A1 (en) | 1994-09-30 | 1996-04-11 | The University Of British Columbia | Polyethylene glycol modified ceramide lipids and liposome uses thereof |
| US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
| US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
| US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
| WO1996040062A1 (en) | 1995-06-07 | 1996-12-19 | Georgetown University | A method of transfection of cells using liposomally encapsulated nucleic acids |
| WO1997004787A1 (en) | 1995-08-01 | 1997-02-13 | Novartis Ag | Liposomal oligonucleotide compositions |
| US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
| WO1997013499A1 (en) | 1995-10-11 | 1997-04-17 | The University Of British Columbia | Liposomal formulations of mitoxantrone |
| WO1997030731A2 (en) | 1996-02-21 | 1997-08-28 | The Immune Response Corporation | Method of preparing polynucleotide-carrier complexes for delivery to cells |
| WO1998039352A1 (en) | 1997-03-07 | 1998-09-11 | Takeshi Imanishi | Novel bicyclonucleoside and oligonucleotide analogues |
| US5876730A (en) | 1997-08-07 | 1999-03-02 | Childrens Hospital Research Foundation | Heparin-binding growth factor (HBGF) polypeptides |
| WO1999014226A2 (en) | 1997-09-12 | 1999-03-25 | Exiqon A/S | Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues |
| WO2000013706A1 (en) | 1998-09-08 | 2000-03-16 | Henry Ford Health System | Methods for detecting, preventing, and treating renal disorders by modulating, regulating, and inhibiting connective tissue growth factor |
| WO2000027868A2 (en) | 1998-11-06 | 2000-05-18 | Fibrogen, Inc. | Connective tissue growth factor (ctgf) and methods of use |
| WO2000035936A1 (en) | 1998-12-14 | 2000-06-22 | University Of Miami | Connective tissue growth factor fragments and methods and uses thereof |
| WO2001015729A1 (en) | 1999-08-27 | 2001-03-08 | Fibrogen, Inc. | Connective tissue growth factor receptor, its agonists and antagonists, and their therapeutic and diagnostic uses |
| WO2001029217A2 (en) | 1999-10-15 | 2001-04-26 | Curagen Corporation | Novel polypeptides and polynucleotides encoding same |
| US6965025B2 (en) | 2001-12-10 | 2005-11-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of connective tissue growth factor expression |
| WO2005049582A1 (en) | 2003-11-14 | 2005-06-02 | Auspex Pharmaceuticals, Inc. | Method of preparation of novel nucleoside analogs and uses |
| WO2006069037A1 (en) | 2004-12-23 | 2006-06-29 | Alcon, Inc. | Rnai inhibition of ctgf for treatment of ocular disorders |
| US20080108583A1 (en) | 2006-01-20 | 2008-05-08 | Elena Feinstein | Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes |
| US7399845B2 (en) | 2006-01-27 | 2008-07-15 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| WO2007146511A2 (en) | 2006-05-05 | 2007-12-21 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating gene expression |
| US8262498B2 (en) | 2008-05-16 | 2012-09-11 | Taylor Made Golf Company, Inc. | Golf club |
| US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
| US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
Non-Patent Citations (107)
| Title |
|---|
| ALLEN ET AL., AM. J. RESPIR. CELL MOLL. BIOL., vol. 21, 1999, pages 693 - 700 |
| ALLEN ET AL., FEBS LETTERS, vol. 223, 1987, pages 42 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 410 |
| BERGE ET AL.: "Pharmaceutical Salts", J. OF PHARMA SCI., vol. 66, 1977, pages 1 - 19 |
| BERKOW ET AL.,: "The Merck Manual of Diagnosis and Therapy, 15th Ed.", 1987, pages: 1206 - 1228 |
| BERKOW ET AL.: "The Merck Manual of Diagnosis and Therapy, 15th Ed.,", 1987, pages: 2499 - 2506,46- |
| BLOCK: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 335 |
| BLOCK: "Pharmaceutical Dosage Forms", vol. 2, 1988, MARCEL DEKKER, INC., pages: 335 |
| BLUME ET AL., BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1029, 1990, pages 91 |
| BRADHAM ET AL., J. CELL BIOL., vol. 114, 1991, pages 1285 - 1294 |
| BRAZMA; VILO, FEDS LETT., vol. 480, 2000, pages 17 - 24 |
| BRUNTON ET AL.: "Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed.,", 1996, MCGRAW-HILL, pages: 934 - 935 |
| BUUR ET AL., J. CONTROL REL., vol. 14, 1990, pages 43 - 51 |
| CARULLI ET AL., J. CELL BIOCHEM. SUPPL., vol. 31, 1998, pages 286 - 96 |
| CBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538 |
| CELIS ET AL., FEBS LETT., vol. 480, 2000, pages 2 - 16 |
| CHINTALAPUDI M.R. ET AL., CARCINOGENESIS, vol. 29, no. 4, 22 January 2008 (2008-01-22), pages 696 - 703 |
| CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385 |
| CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385 - 1390 |
| CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937 |
| DU PLESSIS ET AL., ANTIVIRAL RESEARCH, vol. 18, 1992, pages 259 - 265 |
| DUNCAN ET AL., FASEB J, vol. 13, 1999, pages 1774 - 1786 |
| EL HARIRI ET AL., J. PHARM. PHARMACOL., vol. 44, 1992, pages 651 - 654 |
| ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613 |
| FUCHS ET AL., ANAL. BIOCHEM., vol. 286, 2000, pages 91 - 98 |
| GABIZON ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 6949 |
| GAUTSCHI ET AL., J. NATL. CANCER INST., vol. 93, March 2001 (2001-03-01), pages 463 - 471 |
| GENNARO,: "Remington's Pharmaceutical Sciences, 18th Ed.,", 1990, MACK PUBLISHING CO., article SWINYARD: "Chapter 39", pages: 782 - 783 |
| GOING; GUSTERSON, EUR. J. CANCER, vol. 35, 1999, pages 1895 - 904 |
| HIGUCHI ET AL.: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 301 |
| HISHIKAWA ET AL., EUR. J. PHARMACOL., vol. 385, 1999, pages 287 - 290 |
| HISHIKAWA ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 37461 - 37466 |
| HISHIKAWA ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 16797 - 16803 |
| HO ET AL., J. PHARM. SCI., vol. 85, 1996, pages 138 - 143 |
| HU ET AL., S.T.P.PHARMA. SCI., vol. 4, 1994, pages 6,466 |
| IDSON: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199 |
| ILIUM ET AL., FEBS LETT., vol. 167, 1984, pages 79 |
| ITO ET AL., J. AM. SOC. NEPHROL., vol. 12, 2001, pages 472 - 484 |
| JARRETT, J. CHROMATOGR., vol. 618, 1993, pages 315 - 339 |
| JONES, L.J. ET AL., ANALYTICAL BIOCHEMISTRY, vol. 265, 1998, pages 368 - 374 |
| JUNGBLUT ET AL., ELECTROPHORESIS, vol. 20, 1999, pages 2100 - 10 |
| JURECIC; BELMONT, CURR. OPIN. MICROBIOL., vol. 3, 2000, pages 316 - 21 |
| KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330 |
| KASARAGOD ET AL., PEDIATR. DEV. PATHOL., vol. 4, 2001, pages 37 - 45 |
| KLIBANOV ET AL., FEBS LETT., vol. 268, 1990, pages 235 |
| KONDO ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 278, 2000, pages 119 - 124 |
| KOTHAPALLI ET AL., CELL GROWTH. DIFFER., vol. 8, 1997, pages 61 - 68 |
| KROSCHWITZ, J. I.,: "The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859 |
| KUBOTA ET AL., FEBS LETT., vol. 450, 1999, pages 84 - 88 |
| LARSON ET AL., CYTOMETRY, vol. 41, 2000, pages 203 - 208 |
| LARSSON ET AL., J. BIOTECHNOL., vol. 80, 2000, pages 143 - 57 |
| LASKY ET AL., AM. J. PHYSIOL., vol. 275, 1998, pages L365 - 371 |
| LAU; LAM, EXP. CELL RES., vol. 248, 1999, pages 44 - 57 |
| LEE ET AL., CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1991, pages 92 |
| LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 6556 |
| LEUNG; SHAH: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215 |
| LIU L.Y. ET AL., WORLD J GASTROENTEROL., vol. 14, no. 13, 7 April 2008 (2008-04-07), pages 2110 - 4 |
| MADDEN ET AL., DRUG DISCOV. TODAY, vol. 5, 2000, pages 415 - 425 |
| MAHER; DOLNICK, NUC. ACID. RES., vol. 16, 1988, pages 3341 - 3358 |
| MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309 |
| MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770 |
| MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060 |
| MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973 |
| MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654 |
| MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
| MARTINERIE ET AL., ONCOGENE, vol. 7, 1992, pages 2529 - 2534 |
| MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237 |
| MIYAO ET AL., ANTISENSE RES. DEV., vol. 5, 1995, pages 115 - 121 |
| MOUSSAD; BRIGSTOCK, MOL. GENET. METAB., vol. 71, 2000, pages 276 - 292 |
| MULLIS T.C.; TANG X.; CHONG K.T., J CLIN PATHOL., vol. 61, no. 5, May 2008 (2008-05-01), pages 606 - 10 |
| MUNEMASA S. ET AL., BR J HAEMATOL., vol. 139, no. 1, October 2007 (2007-10-01), pages 50 |
| MURANISHI, CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 7, 1990, pages 1 - 33 |
| NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500 |
| PAPAHADJOPOULOS ET AL., ANN. N.Y. ACAD. SCI., vol. 507, 1987, pages 64 |
| PICKLES M; LEASK A, J CELL COMMUN SIGNAL., vol. 1, no. 2, 17 July 2007 (2007-07-17), pages 85 - 90 |
| PRASHAR; WEISSMAN, METHODS ENZYMOL., vol. 303, 1999, pages 258 - 72 |
| RIEGER: "Pharmaceutical Dosage Forms", 1988, MARCEL DEKKER, INC., pages: 285 |
| RIEGER: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 285 |
| RITSCHEL, METH. FIND. EXP. CLIN. PHARMACOL., vol. 13, 1993, pages 205 |
| ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 245 |
| SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 1111 - 1118 |
| SANGHVI, Y. S.: "Antisense Research and Applications", 1993, CRC PRESS, article "Chapter 15,", pages: 289 - 302 |
| SANGHVI, Y.S., CROOKE, S.T. AND LEBLEU, B.,: "Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278 |
| SCHOTT: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 271 |
| SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783 |
| SHIMO ET AL., J. BIOCHEM., vol. 124, 1998, pages 130 - 140 |
| SHIMO T. ET AL., J BONE MINER RES., vol. 21, no. 7, July 2006 (2006-07-01), pages 45 - 5 |
| SINGH ET AL., CHEM. COMMUN., vol. 4, 1998, pages 455 - 456 |
| SMITH; WATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482 489 |
| SUNAMOTO ET AL., BULL. CHEM. SOC. JPN., vol. 53, 1980, pages 2778 |
| SUTCLIFFE ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 1976 - 81 |
| SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54 |
| TAKAKURA ET AL., ANTISENSE & NUCL. ACID DRUG DEV., vol. 6, 1996, pages 177 - 183 |
| TO, COMB. CHEM. HIGH THROUGHPUT SCREEN, vol. 3, 2000, pages 235 - 41 |
| TSUBAKI ET AL., J. ENDOCRINOL., vol. 169, 2001, pages 97 - 110 |
| VORWERK ET AL., BR. J. CANCER, vol. 83, 2000, pages 756 - 760 |
| WANG ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 147, 1987, pages 980 - 985 |
| WEINER ET AL., JOURNAL OF DRUG TARGETING, vol. 2, 1992, pages 405 - 410 |
| WOOLF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7305 - 7309 |
| WU ET AL., CANCER RESEARCH, vol. 53, 1993, pages 3765 |
| YAMAMOTO ET AL., J. PHARM. EXP. THER., vol. 263, 1992, pages 25 |
| YAMASHITA ET AL., J. PHARM. PHARMACOL., vol. 39, 1987, pages 621 - 626 |
| YAMASHITA ET AL., J. PHARM. SCI., vol. 79, 1990, pages 579 - 583 |
| YANG ET AL., J. CLIN. ENDOCRINOL. METAB., vol. 83, 1998, pages 2593 - 2596 |
| YANG F. ET AL., CANCER RES., vol. 65, no. 19, 1 October 2005 (2005-10-01), pages 8887 - 95 |
| ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 656 |
| ZHOU ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 19, 1992, pages 269 - 274 |
Cited By (62)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10131904B2 (en) | 2008-02-11 | 2018-11-20 | Rxi Pharmaceuticals Corporation | Modified RNAi polynucleotides and uses thereof |
| US10633654B2 (en) | 2008-02-11 | 2020-04-28 | Phio Pharmaceuticals Corp. | Modified RNAi polynucleotides and uses thereof |
| US8815818B2 (en) | 2008-07-18 | 2014-08-26 | Rxi Pharmaceuticals Corporation | Phagocytic cell delivery of RNAI |
| US9096851B2 (en) | 2008-08-25 | 2015-08-04 | Excaliard Pharmaceuticals, Inc. | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| US8252762B2 (en) | 2008-08-25 | 2012-08-28 | Excaliard Pharmaceuticals, Inc. | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| US9688987B2 (en) | 2008-08-25 | 2017-06-27 | Excaliard Pharmaceuticals, Inc. | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
| US8946172B2 (en) | 2008-08-25 | 2015-02-03 | Excaliard Pharmaceuticals, Inc. | Method for reducing scarring during wound healing using antisense compounds directed to CTGF |
| US8772260B2 (en) | 2008-08-25 | 2014-07-08 | Isis Pharmaceuticals, Inc | Methods for inhibiting expression of connective tissue growth factor |
| US10138485B2 (en) | 2008-09-22 | 2018-11-27 | Rxi Pharmaceuticals Corporation | Neutral nanotransporters |
| US8664189B2 (en) | 2008-09-22 | 2014-03-04 | Rxi Pharmaceuticals Corporation | RNA interference in skin indications |
| US10774330B2 (en) | 2008-09-22 | 2020-09-15 | Phio Pharmaceuticals Corp. | Reduced size self-delivering RNAI compounds |
| US8796443B2 (en) | 2008-09-22 | 2014-08-05 | Rxi Pharmaceuticals Corporation | Reduced size self-delivering RNAi compounds |
| US10041073B2 (en) | 2008-09-22 | 2018-08-07 | Rxi Pharmaceuticals Corporation | Reduced size self-delivering RNAi compounds |
| US10815485B2 (en) | 2008-09-22 | 2020-10-27 | Phio Pharmaceuticals Corp. | RNA interference in skin indications |
| US9938530B2 (en) | 2008-09-22 | 2018-04-10 | Rxi Pharmaceuticals Corporation | RNA interference in skin indications |
| US10876119B2 (en) | 2008-09-22 | 2020-12-29 | Phio Pharmaceuticals Corp. | Reduced size self-delivering RNAI compounds |
| US11396654B2 (en) | 2008-09-22 | 2022-07-26 | Phio Pharmaceuticals Corp. | Neutral nanotransporters |
| US9303259B2 (en) | 2008-09-22 | 2016-04-05 | Rxi Pharmaceuticals Corporation | RNA interference in skin indications |
| US9175289B2 (en) | 2008-09-22 | 2015-11-03 | Rxi Pharmaceuticals Corporation | Reduced size self-delivering RNAi compounds |
| US9074211B2 (en) | 2008-11-19 | 2015-07-07 | Rxi Pharmaceuticals Corporation | Inhibition of MAP4K4 through RNAI |
| US11254940B2 (en) | 2008-11-19 | 2022-02-22 | Phio Pharmaceuticals Corp. | Inhibition of MAP4K4 through RNAi |
| US10167471B2 (en) | 2009-01-05 | 2019-01-01 | Rxi Pharmaceuticals Corporation | Inhibition of PCSK9 through RNAI |
| US9493774B2 (en) | 2009-01-05 | 2016-11-15 | Rxi Pharmaceuticals Corporation | Inhibition of PCSK9 through RNAi |
| US9745574B2 (en) | 2009-02-04 | 2017-08-29 | Rxi Pharmaceuticals Corporation | RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality |
| US11667915B2 (en) | 2009-02-04 | 2023-06-06 | Phio Pharmaceuticals Corp. | RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality |
| US10479992B2 (en) | 2009-02-04 | 2019-11-19 | Phio Pharmaceuticals Corp. | RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality |
| US10240149B2 (en) | 2010-03-24 | 2019-03-26 | Phio Pharmaceuticals Corp. | Reduced size self-delivering RNAi compounds |
| US10184124B2 (en) | 2010-03-24 | 2019-01-22 | Phio Pharmaceuticals Corp. | RNA interference in ocular indications |
| US9095504B2 (en) | 2010-03-24 | 2015-08-04 | Rxi Pharmaceuticals Corporation | RNA interference in ocular indications |
| US11584933B2 (en) | 2010-03-24 | 2023-02-21 | Phio Pharmaceuticals Corp. | RNA interference in ocular indications |
| US11118178B2 (en) | 2010-03-24 | 2021-09-14 | Phio Pharmaceuticals Corp. | Reduced size self-delivering RNAI compounds |
| US9963702B2 (en) | 2010-03-24 | 2018-05-08 | Rxi Pharmaceuticals Corporation | RNA interference in dermal and fibrotic indications |
| US10913948B2 (en) | 2010-03-24 | 2021-02-09 | Phio Pharmaceuticals Corp. | RNA interference in dermal and fibrotic indications |
| US10662430B2 (en) | 2010-03-24 | 2020-05-26 | Phio Pharmaceuticals Corp. | RNA interference in ocular indications |
| US9080171B2 (en) | 2010-03-24 | 2015-07-14 | RXi Parmaceuticals Corporation | Reduced size self-delivering RNAi compounds |
| US9340786B2 (en) | 2010-03-24 | 2016-05-17 | Rxi Pharmaceuticals Corporation | RNA interference in dermal and fibrotic indications |
| JP2013530934A (ja) * | 2010-04-28 | 2013-08-01 | ポステック アカデミー−インダストリー ファンデーション | 結合組織成長因子を用いた薬学的組成物 |
| US8859496B2 (en) | 2010-04-28 | 2014-10-14 | Postech Academy-Industry Foundation | Pharmaceutical composition using connective-tissue growth factor |
| EP2564866A4 (en) * | 2010-04-28 | 2013-11-27 | Postech Acad Ind Found | PHARMACEUTICAL COMPOSITION USING A BIND WEAVE GROWTH FACTOR |
| JP2018150351A (ja) * | 2011-02-02 | 2018-09-27 | エクスカリアード・ファーマシューティカルズ,インク | 結合組織増殖因子(ctgf)をターゲティングするアンチセンス化合物を用いた、ケロイドまたは肥厚性瘢痕の治療法 |
| WO2012106508A1 (en) | 2011-02-02 | 2012-08-09 | Pfizer Inc. | Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf) |
| CN103635197A (zh) * | 2011-02-02 | 2014-03-12 | 埃克斯利尔德生物制药公司 | 使用靶向结缔组织生长因子(ctgf)的反义化合物治疗疤痕疙瘩或肥大性疤痕的方法 |
| JP2014505704A (ja) * | 2011-02-02 | 2014-03-06 | エクスカリアード・ファーマシューティカルズ,インク | 結合組織増殖因子(ctgf)をターゲティングするアンチセンス化合物を用いた、ケロイドまたは肥厚性瘢痕の治療法 |
| EP2670411A4 (en) * | 2011-02-02 | 2014-07-16 | Excaliard Pharmaceuticals Inc | METHOD OF TREATING KELOIDS OR HYPERTROPHIC SCARES USING ANTISENSE COMPOUNDS TO AIM AT THE TIE OF THE BIND WEIGHT GROWTH FACTOR (CTGF) |
| EP2670411A1 (en) * | 2011-02-02 | 2013-12-11 | Excaliard Pharmaceuticals, Inc. | Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf) |
| TWI593416B (zh) * | 2011-02-02 | 2017-08-01 | 艾克厘德製藥公司 | 利用針對結締組織生長因子(ctgf)目標之反義化合物治療瘢痕或肥厚性疤痕之方法 |
| US9173894B2 (en) | 2011-02-02 | 2015-11-03 | Excaliard Pharamaceuticals, Inc. | Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (CTGF) |
| KR20130120537A (ko) * | 2011-02-02 | 2013-11-04 | 엑스칼리아드 파마슈티컬즈, 인코포레이티드 | 결합 조직 성장 인자(ctgf)를 표적으로 하는 안티센스 화합물을 사용하여 켈로이드 또는 비후성 흉터를 치료하는 방법 |
| JP2017137325A (ja) * | 2011-02-02 | 2017-08-10 | エクスカリアード・ファーマシューティカルズ,インク | 結合組織増殖因子(ctgf)をターゲティングするアンチセンス化合物を用いた、ケロイドまたは肥厚性瘢痕の治療法 |
| KR101697396B1 (ko) | 2011-02-02 | 2017-01-17 | 엑스칼리아드 파마슈티컬즈, 인코포레이티드 | 결합 조직 성장 인자(ctgf)를 표적으로 하는 안티센스 화합물을 사용하여 켈로이드 또는 비후성 흉터를 치료하는 방법 |
| US8802839B2 (en) | 2011-07-15 | 2014-08-12 | Fibrogen, Inc. | Connective tissue growth factor antisense oligonucleotides |
| US9115356B2 (en) | 2011-07-15 | 2015-08-25 | Fibrogen, Inc. | Connective tissue growth factor antisense oligonucleotides |
| US10934550B2 (en) | 2013-12-02 | 2021-03-02 | Phio Pharmaceuticals Corp. | Immunotherapy of cancer |
| EP3077050A4 (en) * | 2013-12-04 | 2017-11-01 | RXi Pharmaceuticals Corporation | Methods for treatment of wound healing utilizing chemically modified oligonucleotides |
| US11279934B2 (en) | 2014-04-28 | 2022-03-22 | Phio Pharmaceuticals Corp. | Methods for treating cancer using nucleic acids targeting MDM2 or MYCN |
| US10900039B2 (en) | 2014-09-05 | 2021-01-26 | Phio Pharmaceuticals Corp. | Methods for treating aging and skin disorders using nucleic acids targeting Tyr or MMP1 |
| US11926828B2 (en) | 2014-09-05 | 2024-03-12 | Phio Pharmaceuticals Corp. | Methods for treating aging and skin disorders using nucleic acids targeting TYR or MMP1 |
| US11001845B2 (en) | 2015-07-06 | 2021-05-11 | Phio Pharmaceuticals Corp. | Nucleic acid molecules targeting superoxide dismutase 1 (SOD1) |
| US10808247B2 (en) | 2015-07-06 | 2020-10-20 | Phio Pharmaceuticals Corp. | Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach |
| US11021707B2 (en) | 2015-10-19 | 2021-06-01 | Phio Pharmaceuticals Corp. | Reduced size self-delivering nucleic acid compounds targeting long non-coding RNA |
| US12544344B2 (en) | 2017-04-19 | 2026-02-10 | Phio Pharmaceuticals Corp. | Topical delivery of nucleic acid compounds |
| US12234458B2 (en) | 2018-07-31 | 2025-02-25 | Lemonex Inc. | Composition for inhibiting CTGF expression |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2010224447B2 (en) | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof | |
| WO2010027830A2 (en) | Methods for modulation of connective tissue growth factor expression by administering antisense oligonucleotides through a delivery system so as to reduce scarring from wound healing and threat fibrotic diseases | |
| EP2670411B1 (en) | Antisense compounds targeting connective tissue growth factor (ctgf) for use in a method of treating keloids or hypertrophic scars | |
| US20050059629A1 (en) | Antisense modulation of connective tissue growth factor expression | |
| HK1158965B (en) | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof | |
| HK1245319A1 (en) | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof | |
| HK1192718A (en) | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof | |
| HK1192718B (en) | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009275387 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 1002626 Country of ref document: GB Kind code of ref document: A Free format text: PCT FILING DATE = 20090825 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1002626.8 Country of ref document: GB |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09819622 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2733262 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12011500299 Country of ref document: PH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 211230 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2011525160 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2011/002143 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 591416 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201170345 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1950/CHENP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20117006585 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13132840 Country of ref document: CO Ref document number: 11034740 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009819622 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI0912923 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI0912923 Country of ref document: BR Kind code of ref document: A2 Effective date: 20110223 |