WO2009150284A2 - Conjugados de apo-a para la administración de compuestos biológicamente activos - Google Patents

Conjugados de apo-a para la administración de compuestos biológicamente activos Download PDF

Info

Publication number
WO2009150284A2
WO2009150284A2 PCT/ES2009/070224 ES2009070224W WO2009150284A2 WO 2009150284 A2 WO2009150284 A2 WO 2009150284A2 ES 2009070224 W ES2009070224 W ES 2009070224W WO 2009150284 A2 WO2009150284 A2 WO 2009150284A2
Authority
WO
WIPO (PCT)
Prior art keywords
apo
ifn
conjugate
peptide
component
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/ES2009/070224
Other languages
English (en)
Spanish (es)
French (fr)
Other versions
WO2009150284A3 (es
WO2009150284A9 (es
Inventor
Jesús María PRIETO VALTUEÑA
Pedro BERRAONDO LÓPEZ
Jessica Fioravanti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Proyecto de Biomedicina CIMA SL
Original Assignee
Proyecto de Biomedicina CIMA SL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP09761841A priority Critical patent/EP2305309A2/en
Priority to US12/997,829 priority patent/US20110293557A1/en
Priority to AU2009256547A priority patent/AU2009256547B2/en
Priority to BRPI0915093A priority patent/BRPI0915093A2/pt
Priority to CN200980131382.9A priority patent/CN102123737B/zh
Priority to JP2011513010A priority patent/JP5685529B2/ja
Priority to MX2010013759A priority patent/MX2010013759A/es
Priority to RU2011100801/10A priority patent/RU2567667C2/ru
Application filed by Proyecto de Biomedicina CIMA SL filed Critical Proyecto de Biomedicina CIMA SL
Priority to CA2727811A priority patent/CA2727811A1/en
Publication of WO2009150284A2 publication Critical patent/WO2009150284A2/es
Publication of WO2009150284A3 publication Critical patent/WO2009150284A3/es
Anticipated expiration legal-status Critical
Publication of WO2009150284A9 publication Critical patent/WO2009150284A9/es
Priority to US14/947,164 priority patent/US20160074475A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5434IL-12
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775Apolipopeptides

Definitions

  • the invention falls within the field of methods for stabilization and targeting of compounds of therapeutic interest specifically to target tissues.
  • the invention is based on the ability of apolipoprotein A to direct compounds of therapeutic interest to all those tissues that exhibit high affinity binding sites for said protein.
  • WO07130873 describes methods for targeting microvesicles to liver cells by incorporating on the surface of said capsules a compound that is specifically recognized by the receptors of asialoglycoproteins, hyaluronan, N-acetyl-galactosamine or mannose present in liver cells.
  • WO02086091 describes methods for directing nanovesicles to liver cells by incorporating into said nanovesicles the hepatitis B virus envelope protein.
  • WO200473684 describes a method for addressing partially hydrophobic compounds to liver cells based on phospholipid discoid vesicles comprising ApoA-I in its surface Lou et al (World J.
  • Gastroenterol., 2005, 1 1: 954-959) have described a method for targeting a lipophilic antitumor compound to hepatocellular carcinoma cells using high density lipoprotein (HDL) as a specific carrier based on HDL's ability to accommodate hydrophobic compounds such as cholesterol.
  • HDL high density lipoprotein
  • the vehiculization of hydrophilic compounds to the liver is possible by using conjugates of said compounds to agents that are specifically captured by the liver.
  • conjugates of said compounds to agents that are specifically captured by the liver.
  • Kramer et al J. Biol. Chem., 1992,
  • WO04082720 describes methods for addressing compounds with therapeutic activity to liver cells by incorporating said compounds into pseudoviral particles formed by the hepatitis B virus coat protein.
  • these vehicles have the problem that they show a reduced plasma half-life which requires continued or high dose administration to achieve therapeutic plasma levels in a sustained way.
  • the viral proteins that form pseudoviral particles generate a humoral immune response.
  • WO8702061A describes methods for addressing compounds to tissues that express the LDL receptor by using fusion proteins formed by the apoliprotein B or E receptor binding region and an active component.
  • the invention relates to a conjugate comprising (i) a molecule of Apo A or a functionally equivalent variant thereof and
  • the invention relates to a polynucleotide or a gene construct comprising a polynucleotide that encodes a conjugate according to the invention wherein the compound of therapeutic interest (ii) is a polypeptide that forms a single chain with the component. (i).
  • the invention relates to a vector comprising a polynucleotide or a gene construct according to the invention and to a host cell comprising a polynucleotide, a gene construct or a vector of according to the invention or a nanolipopaticle comprising the conjugate of the invention.
  • the invention relates to a conjugate, a polynucleotide, a gene construct, a vector, a host cell or a nanolipoparticle according to the invention for use in medicine.
  • the invention relates to a conjugate, a polynucleotide, a gene construct, a vector, a host cell or a nanolipoparticle according to the invention for the treatment of liver diseases or diseases associated with the immune system.
  • the invention relates to a composition
  • a composition comprising
  • component (a) A first component selected from a conjugate, a polynucleotide, a gene construct, a vector, a host cell according to claim, a nanolipoparticle and a pharmaceutical preparation according to the invention wherein component (ii) is an inhibitory peptide of TGF- ⁇ l, and
  • the invention in another aspect, relates to a combination of the invention for use in medicine and, in particular, for the treatment of cancer.
  • FIG. 1 Kinetics of IFN ⁇ expression.
  • BALB / c mice received a hydrodynamic injection with the plasmids expressing ApoAI (Apo), IFN ⁇ (IFN), Apo-IFN (AF) or IFN-Apo (IA).
  • ApoAI ApoAI
  • IFN IFN ⁇
  • AF Apo-IFN
  • IA IFN-Apo
  • FIG. 1 Quantitative RT-PCR of IFN ⁇ l hepatic mRNA.
  • a hydrodynamic injection was made in three BALB / c mice for each plasmid and study day. On day 1, 3 and 6 the animals were sacrificed and the liver was extracted. Hepatic mRNA was purified and quantitative RT-PCR was performed for the IFN ⁇ l gene. The mean and standard error of the mean of a representative experiment is shown. The results were analyzed by repeated measures ANOVA, followed by a Bonferroni test. No significant differences were observed between mRNA levels induced by plasmids IFN ⁇ l, AF and IA.
  • FIG. 3 Serum neopterin levels and body temperature.
  • FIG. 5 Increase in the number and activation of splenocytes.
  • BALB / c mice received the distinct IFN ⁇ constructs hydrodynamically and six days later, the spleens were sacrificed and isolated.
  • the number of splenocytes was analyzed (A) and expression of the CD69 early activation marker in CD4 + T cells (B), in CD8 + T cells (C), in B (D) cells and in NK (E) cells.
  • the mean and standard error of the mean of a representative experiment with 7 animals per group are shown. Data were analyzed by ANOVA followed by Dunnett's test comparing the groups with IFN ⁇ with the control group with ApoAI. * p ⁇ 0.05; ** p ⁇ 0.001; *** p ⁇ 0.0001.
  • FIG. 6 Increased specific lysis induced by gene vaccination in the presence of IFN ⁇ -expressing constructs.
  • BALB / c mice were immunized by hydrodynamic injection of a plasmid expressing ⁇ -galactosidase and as an adjuvant plasmids expressing the different constructs with IFN ⁇ were co-administered. Seven days later, target cells loaded with a cytotoxic peptide and high concentration of CFSE and control cells with low concentration of CFSE were injected intravenously. At 24 hours, the animals were sacrificed, and the proportion of target cells and control cells was analyzed to calculate the specific lysis percentage.
  • FIG. 7 Expression of SR-BI in different populations of immune system cells.
  • Splenocytes were isolated from the spleen of BALB / c mice and labeled with anti-SR-BI antibodies and with antibodies to distinguish CD4 + (anti-CD4) T lymphocytes (A), CD8 + (anti-CD8) lymphocytes (B), c é lu the NK (anti-CD49b) (C), monocytes / macrophage phages (anti-CDl Ib) (D) or dendritic cells (anti-CDl Ic) (E).
  • Figure 8 Effect of adjuvant effect in a model of antitumor vaccination. 11-17 BALB / c mice for each treatment group received a hydrodynamic injection with the plasmids expressing ApoAI (Apo), IFN ⁇ (IFN), or IFN-Apo (IA). 24 hours later they were vaccinated with the cytotoxic peptide AHl in incomplete Freund's adjuvant. Nine days later, 5x10 6 CT26 cells were inoculated subcutaneously and tumors were observed over time. The percentage of tumor-free mice over time is represented. The experimental groups were compared with the control group using the Log-rank test. ** p ⁇ 0.01. Figure 9. Leukocyte and circulating platelet kinetics.
  • FIG. 10 Quantitative RT-PCR of brain mRNA of IFN ⁇ inducible genes.
  • FIG. 11 Incorporation of fusion proteins into circulating high density lipoproteins (HDLs).
  • the plasmids encoding the IFN ⁇ constructs were administered to BALB / c mice. At 24 hours, blood was drawn and from the serum obtained, the HDLs were extracted by differential centrifugation in NaBr gradients. The presence of IFN ⁇ in the HDLs of the different groups was analyzed by an interferon bioassay, the cytopathic effect protection assay (A). With the serum samples free of HDLs (HDLs -) and the fraction containing the HDLs (HDLs +), a western blot was performed to determine the presence of apolipoprotein AI (B).
  • FIG. 12 Hematological effects of the administration of HDLs containing IFN-Apo.
  • BALB / c mice were given the equivalent of 10,000 IU of IFN of HDLs containing IFN-Apo, 10,000 IU of recombinant IFN or PBS.
  • A leukocytes
  • B platelets
  • Data were analyzed by ANOVA followed by Dunnett's test comparing the groups with IFN-Apo and with the group with IFN. ** p ⁇ 0.01; *** p ⁇ 0.001.
  • FIG 13. Increase in induction of IFN ⁇ induced by IL12.
  • a plasmid expressing IL 12 under the control of a doxycycline inducible promoter and another plasmid expressing a control construct or one of the constructs with a TGF ⁇ pl7 (A) inhibitor or TGF ⁇ pl44 (B inhibitor) was administered by hydrodynamic injection.
  • the serum IFN ⁇ concentration was analyzed by ELISA. The mean and standard error of the mean of a representative experiment with three animals per group are shown. Data were analyzed by ANOVA followed by Dunnett's test comparing the experimental groups with the control group. ** p ⁇ 0.001.
  • FIG. 14 Protection against the development of CT26 tumors.
  • BALB / c mice were vaccinated with the cytotoxic peptide AHl in incomplete Freund's adjuvant. Seven days later they received a hydrodynamic injection with the constructs expressing inhibitors of TGF ⁇ or ApoA-I as a control. After seven more days, 5x10 5 CT26 cells were inoculated subcutaneously and the appearance of tumors was observed over time. The percentage of tumor-free mice over time is represented. The experimental groups were compared with the control group using the Log-rank test. * p ⁇ 0.05; ** p ⁇ 0.001.
  • FIG 15. Incorporation of Apo-linker-P144 fusion proteins into circulating high density lipoproteins (HDLs).
  • the plasmids encoding the constructs with Apo or Apo-linker-P144 were administered to BALB / c mice. At 24 hours, blood was drawn and from the serum obtained, the HDLs were extracted by differential centrifugation in NaBr gradients. With the fractions containing the HDLs, a western blot was performed to determine the presence of apolipoprotein AI.
  • Figure 16. Increase in induction of IFN ⁇ induced by IL12 after administration of HDLs containing Apo-linker-P144.
  • a plasmid expressing IL 12 was administered by hydrodynamic injection under the control of a doxycycline inducible promoter and another plasmid expressing a control construct (Apo) or Apo-linker-P144.
  • the latter group was given the plasmid IL12 and an intraperitoneal 14 ⁇ g / mouse injections of HDLs containing Apo-linker-P144.
  • the serum IFN ⁇ concentration was analyzed by ELISA. The mean and standard error of the mean of a representative experiment with three animals per group are shown. Data were analyzed by ANOVA followed by Dunnett's test comparing the experimental groups with the control group. ** p ⁇ 0.01.
  • the authors of the present invention have observed that the conjugates formed by an Apo A protein or a functionally equivalent variant thereof and a molecule of therapeutic interest show, after administration to patients, a serum half-life greater than that observed in patients who have been given the molecule of therapeutic interest without conjugation. Additionally, Apo A conjugates and the molecule of therapeutic interest are specifically vehiculized to the patient's liver, which greatly facilitates the treatment of liver diseases and the reduction of side effects due to the action of the therapeutic molecule in other tissues.
  • the invention relates to a conjugate comprising (i) a molecule of Apo A or a functionally equivalent variant thereof and (ii) a compound of therapeutic interest wherein components (i) and ( ii) are covalently linked.
  • the affinity of the conjugates for liver tissue is due to the fact that said tissue has specific receptors for Apo A proteins whose natural function is to capture the HDLs that have ApoA-I in their surface.
  • the longer half-life of the conjugates seems to be related to the high half-life that Apo A molecules show in the organism (of the order of 35 h in humans or 10 h in mice in the case of Apo AI).
  • ApoA-I the affinity of the conjugates for liver tissue is due to the fact that said tissue has specific receptors for Apo A proteins whose natural function is to capture the HDLs that have ApoA-I in their surface.
  • the longer half-life of the conjugates seems to be related to the high half-life that Apo A molecules show in the organism (of the order of 35 h in humans or 10 h in mice in the case of Apo AI).
  • there are other cells that express on their surface specific receptors for ApoA-I allowing vehiculization to other tissues.
  • a protein means, in the context of the present invention, any member of the Apo A family that is part of the high density lipoproteins
  • HDL HDL
  • the Apo A molecules that can be used in the present invention are selected from the group of ApoA-I, Apo A-II, Apo A-III, ApoA-IV and Apo A-
  • the Apo A protein used in the present invention is the ApoA-I protein.
  • ApoA-I means, in the context of the present invention, the mature form of the pre-proApoA-I protein that is part of the high density lipoproteins (HDL).
  • Apo AI is synthesized as a precursor (preproApoA-I) that contains a secretion signal sequence that is removed to give rise to the precursor.
  • the signal sequence consists of 18 amino acids, the propeptide of 6 and the mature form of the 243 amino acid protein.
  • the mature form of the protein lacking signal and processed peptide is used.
  • the ApoA-I protein is of human origin and its amino acid sequence is that shown in SEQ ID NO: 1 (accession number in UniProt P02647).
  • the ApoA-I protein is of murine origin, in particular mouse, and its amino acid sequence is that shown in SEQ ID NO: 2 (accession number in UniProt Q00623).
  • the ApoA-I protein is of murine origin, in particular of rat, and its amino acid sequence is that shown in SEQ ID NO: 3 (accession number in UniProt P04639).
  • Functionally equivalent variant of ApoA-I means all those polypeptides that result from the insertion, substitution or deletion of one or more amino acids of the human or murine ApoA-I sequence mentioned above and which keep the ability to interact with the so-called "class B type I scavenger receptor" (SR-BI) that forms the HDL receptor present in liver cells.
  • the ability to interact with the HDL receptor is essentially determined as described by Monaco et al (EMBO J., 1987, 6: 3253-3260) either by studies of ApoA-I binding to hepatocyte membranes or either by determining the ability of ApoA-I or its variant to inhibit HDL binding to hepatocyte membrane receptors.
  • the dissociation constant of the binding of the ApoA-I variant to hepatocyte membranes is at least 10 "8 M, 10 " 7 M, 10 "6 M, 10 " 5 M or 10 "4 M.
  • ApoA-I variants contemplated in the context of the present invention include polypeptides showing at least 60%, 65 %%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, or 95% of similarity or identity with ApoA-I polypeptides.
  • the degree of identity between two polypeptides is determined using computer algorithms and methods that are widely known to those skilled in the art.
  • the identity between two amino acid sequences is preferably determined using the BLASTP algorithm (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al, J., 1990, Mol. Biol 215: 403-410).
  • the ApoA-I variants used in the context of the invention have a high serum half-life with respect to native ApoA-I, which allows to reach serum ApoA-I levels higher than those observed with ApoA- I.
  • Methods for determining the average life of a whey protein and, in particular ApoA-I are known in the art and include, among others, using the methods based on metabolic tides with labeled proteins described by Eisenberg, S. et al ( J.Lipid Res., 1973, 14: 446-458), by Blum et al. (J. Clin. Invest., 1977, 60: 795-807) and by Graversen et al (J Cardiovasc Pharmacol., 2008, 51: 170-177).
  • An example of such variants that shows a longer half-life is, for example, the variant called Milano (which contains the Rl 73C mutation).
  • the invention contemplates the use of any therapeutic compound that is susceptible to covalent modification without substantially losing its biological activity so that it can be conjugated to ApoA-I or the functionally equivalent variant thereof.
  • the invention contemplates the use as a therapeutically effective component of small organic molecules, peptides, peptidomimetics, peptoids, proteins, polypeptides, glycoproteins, oligosaccharides, nucleic acids and the like.
  • compounds that can be conjugated to ApoA-I or the functionally equivalent variant thereof include antibiotics, cholinesterase agents, atropine, scopolamine, sympathomimetic drugs, hypnotics, sedatives, antiepileptics, opioids, analgesics, anti-inflammatories, histamines, lipid derivatives , anti-asthmatics, antipyretic analgesics, xanthines, osmotic diuretics, mercurial compounds, thiazides and sulphonamides, carbonic anhydrase inhibitors, organic nitrates, antihypertensives, cardiac glycosides, antiarrhythmics, oxytocin, prostaglandins, alkaloids, tocolytic agents, anthelmintic agents, anthelmintic agents, antihelmotic agents, anthelmintic agents, anthelmintic agents, anthelminthic agents, anthelmintic agents, anthelmin
  • component (ii) of the conjugates of the invention comprises a polypeptide chain.
  • the ApoA-I polypeptide and the polypeptide that forms component (ii) are forming a single polypeptide chain.
  • the present invention contemplates the two relative orientations of both polypeptides.
  • the C-terminal end of component (i) is attached to the N-terminal end of component (ii).
  • the N-terminal end of component (i) is attached to the C-terminal end of component (ii).
  • ApoA-I conjugates, when formed by a single polypeptide chain are not formed by
  • component (ii) is the immunoglobulin heavy chain or a plasminogen fragment.
  • component (ii) is the immunoglobulin heavy chain or a plasminogen fragment.
  • TTSE tetranectin trimerization domain linked through its C-terminal end to the N-terminal end of the ApoA-I protein.
  • Polypeptides that can be vehiculized to the liver using the conjugates of the invention include erythropoietin (EPO), leptins, adrenocorticotropic hormone releasing hormone (CRH), somatotropic hormone releasing hormone (GHRH), gonadotro releasing hormone (GnRH), releasing hormone thyrotropin (TRH), prolactin-releasing hormone (PRH), melatonin-releasing hormone (MRH), prolactin-inhibiting hormone (PIH), somato statine, adrenocorticotropic hormone (ACTH), somatotropic or growth hormone (GH), luteinizing hormone (LH), follicle stimulating hormone (FSH), thyrotropin (TSH or thyroid stimulating hormone), prolactin, oxytocin, antidiuretic hormone (ADH or vasopressin), melatonin, Müllerian inhibitory factor, calcitonin, paratyphoid hormone, gastrin, qui
  • component (ii) of the conjugate of the invention is an interferon (IFN).
  • Interferons are classified as interferon type I, type II and type III.
  • Type I interferons are a family of cytokine activity polypeptides that were originally discovered by virtue of their inhibitory activity on viral infection of cell lines in vitro (Pestka, S., Krause, CD. And Walter, MR 2004. Immunol Rev 202: 8-32) and which are characterized by binding to the so-called IFN- ⁇ receptor (IFNAR).
  • IFN- ⁇ receptor IFN- ⁇ receptor
  • type I interferons are classified into interferon- ⁇ (IFN- ⁇ ), interferon- ⁇ (IFN- ⁇ ) and interferon- ⁇ (IFN- ⁇ ).
  • IFN- ⁇ and IFN- ⁇ share a single dimeric receptor that is expressed on the surface of most nucleated cells.
  • the function of these cytokines is of great importance in the immune response against multiple types of viral infections, since they put in place mechanisms that promote death by apoptosis of infected cells and inhibition of viral replication while promoting presentation antigenic Recently it has been experimentally documented that it also exercises its functions by directly activating the activities of T, B and NK lymphocytes as well as dendritic cells in the immune response (Le Bon A. et al, 2003. Nat. Immunol. 4: 1009-1015; Le Bon A. et al, 2006. J. Immunol. 176: 4682-4689; Le Bon A. et al., 2006. J Immunol.
  • Type II interferons are characterized in that they bind to the interferon gamma receptor (IFNGR) and include IFN- ⁇ as the sole member.
  • Type III interferons transduce their signal through a complex formed by IL-10 receptor 2 (IL10R2) and IFN lambda 1 receptor (IFNLRl) and consists of three lambda interferons called IFN- ⁇ l, IFN- ⁇ 2 and IFN- ⁇ 3.
  • component (ii) is a type I interferon, such as IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN-K, IFN- ⁇ and IFN- ⁇ .
  • at least one type I interferon comprised in the composition of the invention is selected from the group comprising interferon-alpha (IFN- ⁇ ) and interferon-beta (IFN- ⁇ ).
  • IFN- ⁇ interferon-alpha
  • IFN- ⁇ interferon-beta
  • At least one type I interferon is an IFN- ⁇ selected from the group of IFN- ⁇ 2a, IFN- ⁇ 2b, IFN- ⁇ 4, IFN- ⁇ 5, IFN- ⁇ 8 and combinations thereof, including its combination with other substances in pharmaceutical formulations.
  • the interferon is IFN- ⁇ , preferably of human origin.
  • the interferon is IFN- ⁇ 5.
  • IFN- ⁇ and IFN- ⁇ A list of type I interferon species, particularly IFN- ⁇ and IFN- ⁇ , which can be used in accordance with the invention, can be found in Bekisz et al. (Growth Factors, 2004; 22: 243-251) and in Petska et al. (Immunological Reviews, 2004; 202: 8-32). Additionally, the invention contemplates the use of conjugate combinations comprising more than one type of interferon, such as IFN- ⁇ nl (lymphoblast derivative) or IFN- ⁇ 3 (combination of interferons produced by human leukocytes stimulated with Sendai virus (or other virus) or viral particles).
  • IFN- ⁇ nl lymphoblast derivative
  • IFN- ⁇ 3 Combination of interferons produced by human leukocytes stimulated with Sendai virus (or other virus) or viral particles.
  • the origin of the type I interferon employed does not constitute a critical aspect of the invention.
  • This can be of natural origin, extracted and purified from biological fluids or tissues, or produced by conventional methods of genetic and recombinant engineering, such as those described in Sambrook and Russel ("Molecular Cloning: a Laboratory manual” by J. Sambrook, DW Russel Eds. 2001, third edition, CoId Spring Harbor, New York), by synthetic procedures or by any other conventional technique described in the prior art.
  • At least one type I interferon comprised in the composition of the invention is in a pegylated form.
  • pegylated forms of interferon can be found in US5762923 and US5766582.
  • ROFERON-A recombinant human IFN- ⁇ 2a
  • PEGASYS pegylated IFN- ⁇
  • INTRON-A recombinant human IFN- ⁇ 2b
  • PEG-INTRON Pegylated IFN- ⁇ 2b
  • ALFERON-N IFN- ⁇ 3n, combination of naturally occurring interferons
  • IFNERGEN IFN- ⁇ conl
  • IFN- ⁇ formulations are also included, such as for example AVONEX (IFN- ⁇ la) from Biogen pout, REBIF (IFN- ⁇ la) from EMD Serano, Inc, and BETASERON (IFN- ⁇ lb) from Bayer Health Care.
  • AVONEX IFN- ⁇ la
  • REBIF IFN- ⁇ la
  • BETASERON IFN- ⁇ lb
  • the conjugate of the invention is formed by ApoA-I fused through its C-terminal end and by a flexible linker with the N-terminal end of an ⁇ 1 interferon molecule.
  • the conjugate of the invention is formed by an ⁇ 1 interferon molecule fused through its C-terminal end and by a flexible linker with the N-terminal end of an ApoA-I molecule.
  • component (ii) is a TGF-beta inhibitor.
  • TGF-beta inhibitors that may be part of the conjugates according to the invention include peptide inhibitors selected from TGF-beta 1 receptor sequences that bind to the receptor binding site in TGF- ⁇ 1 thereby blocking the binding. to the receiver These types of peptides have been described in WO200031135, the content of which is incorporated by reference in its entirety.
  • the TGF- ⁇ 1 inhibitor peptide is derived from the TGF- ⁇ 1 type III receptor.
  • the inhibitor peptide is the pl44 peptide which has the sequence TSLDASIIWAMMQN (SEQ ID NO: 4).
  • the invention also contemplates the use of peptides that inhibit the interaction between TGF ⁇ 1 and the TGF ⁇ 1 receptor and the signaling that occurs in response to said interaction identified from phage libraries as described in WO200519244, the content of which is incorporated by reference in its entirety.
  • the inhibitor peptide is the pl7 peptide characterized by the sequence KRIWFIPRS SWYERA (SEQ ID NO: 5), as well as truncated variants thereof and that substantially retain the ability to inhibit the interaction between TGF ⁇ 1 and its receptor such and as described in WO2007048857, the content of which is incorporated in the present invention in its entirety.
  • the conjugates object of the invention comprising the Apo A protein and a second component of a peptide nature may contain a link that directly connects the Apo A protein and said second component or, alternatively, may contain an additional amino acid sequence that acts as linker between the Apo A protein and said second component of a peptide nature.
  • said unnatural intermediate amino acid sequence acts as a hinge region between said domains, allowing them to move independently of each other while maintaining the three-dimensional shape of the individual domains.
  • a preferred non-natural intermediate amino acid sequence according to the invention would be a hinge region characterized by a structural ductility that allows this movement.
  • said non-natural intermediate amino acid sequence is a non-natural flexible linker.
  • said flexible linker is a flexible linker peptide with a length of 20 amino acids or less.
  • the linker peptide comprises 2 or more amino acids selected from the group consisting of glycine, serine, alanine and threonine.
  • said flexible linker is a polyglycine linker. Possible examples of linker / spacer sequences include SGGTSGSTSGTGST (SEQ ID NO: 6), AGSSTGSSTGPGSTT (SEQ ID NO: 7) or GGSGGAP (SEQ ID NO: 8).
  • said linker comprises or consists of the amino acid sequence GGGVEGGG (SEQ ID NO: 9).
  • the linker region is to provide space between the Apo A protein and component (ii). This ensures that the secondary structure of Apo A is not affected by the presence of component (ii) and vice versa.
  • the spacer is polypeptide in nature.
  • the linker peptide preferably comprises at least two amino acids at least three amino acids, at least five amino acids, at least ten amino acids, at least 15 amino acids, at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids or about 100 amino acids.
  • the linker may be attached to the components flanking the two components of the conjugates of the invention by means of covalent bonds and preferably the spacer is essentially non-immunogenic and / or does not comprise any cysteine residues. Similarly, the three-dimensional structure of the spacer is preferably linear or substantially linear.
  • spacer or linker peptides include those that have been used to bind proteins without substantially impairing the function of the bound proteins or at least without substantially impairing the function of one of the bound proteins. More preferably the spacers or linkers have been used to bind proteins comprising structures with rolled helices.
  • the linker may include residues 53-56 of tetranectin, which forms a ⁇ sheet in tetranectin, and residues 57-59 that form a spin in tetranectin (Nielsen, BB et al, FEBS Lett. 412: 388-396 , 1997).
  • the sequence of the segment is GTKVHMK (SEQ ID NO: 10).
  • This linker has the advantage that when it is present in the native tetranectin, it is linking the trimerization domain with the CRD domain, and is therefore suitable for connecting the trimerization domain to another domain in general.
  • the resulting construction is not expected to be more immunogenic than the construction without a linker.
  • connection sheet 3 of human fibronectin corresponding to amino acids 1992-2102 (SWISSPROT numbering, entry P02751) can be chosen as linker.
  • PGTSGQQPSVGQQ SEQ ID NO: 11
  • GTSGQ fragment SEQ ID NO: 52
  • a suitable linker peptide may be based on the sequence of 10 amino acid residues of the upper hinge region of the murine IgG3.
  • This peptide (PKPSTPPGSS, SEQ ID NO: 12) has been used for the production of dimerized antibodies by means of a rolled helix (Pack P. and Pluckthun, A., 1992, Biochemistry 31: 1579-1584) and can be useful as a peptide spacer according to the present invention.
  • Even more preferable may be a corresponding sequence of the upper hinge region of human IgG3. Human IgG3 sequences are not expected to be immunogenic in humans.
  • the linker peptide is selected from the AETKAEPMT AP sequence peptide group (SEQ ID NO: 13) and the GAP sequence peptide.
  • the two components of the conjugates of the invention may be connected by a peptide whose sequence contains a cut-off target for a protease, thus allowing separation of ApoA-I from component (ii).
  • Suitable protease cutting sites. for incorporation into the polypeptides of the invention include enterokinase (DDDDK cutoff site SEQ ID NO: 14), factor Xa (IEDGR cutoff site, SEQ ID NO: 15), thrombin (LVPRGS cutoff site, SEQ ID NO: 16 ), TEV protease (ENLYFQG cutting site, SEQ ID NO: 17), PreScission protease (LEVLFQGP cutting site, SEQ ID NO: 18), internal and the like.
  • the cutting site is that of a protease that is expressed in tumor tissues, in inflamed tissues or in liver so that separation of Apo A and component (ii) takes place once the conjugate It has reached the liver.
  • the linker contains a matrix 9 metalloprotease recognition site (LFPTS cutoff site, SEQ ID NO: 19).
  • the conjugates of the invention can be obtained using any method known to a person skilled in the art.
  • ApoA-I protein can be purify from serum samples from individuals or laboratory animals (WO9807751, WO9811140, Jackson et al, 1976, Biochim Biophys Acta. 420: 342-349, Borresen, AL and Kindt, TJ, 1978, J. Immunogenet. 5 : 5-12 and Forgez, P, and Chapman, MJ, 1982, J. Biochem. Biophys. Methods, 6: 283-96).
  • ApoA-I protein can be obtained from cDNA by expression in a heterologous organism such as, for example, E.coli, S.cerevisiae, P.pastoris, insect cells using methods known in the art such as those described in WO07023476, WO9525786, WO8702062, Feng et al, (Protein. Expr. Purif., 2006, 46: 337-42), PyIe et al, 1996 Biochemistry. 35: 12046-52), Brissette et al, (Protein Expr. Purif. 1991, 2: 296-303) and Bonen, DK (J. Biol. Chem., 1997, 272: 5659-67).
  • a heterologous organism such as, for example, E.coli, S.cerevisiae, P.pastoris, insect cells using methods known in the art such as those described in WO07023476, WO9525786, WO8702062, Feng et al, (
  • the conjugation of the therapeutically active component (ii) to the Apo A molecule can be carried out in different ways.
  • One possibility is the direct conjugation of a functional group to the therapeutically active component in a position that does not interfere with the activity of said component.
  • Functional groups as understood in the present invention, refer to a group of specific atoms in a molecule that are responsible for a characteristic chemical reaction of said molecule.
  • Examples of functional groups include, without limitation, hydroxy, aldehyde, alkyl, alkenyl, alkynyl, amide, carboxamide, primary, secondary, tertiary and quaternary amines, aminoxy, azide, azo (diimide), benzyl, carbonate, ester, ether, glyoxyl.
  • haloalkyl haloformyl, imine, imide, ketone, maleimide, isocyanide, isocyanate, carbonyl, nitrate, nitrite, nitro, nitrous, peroxide, phenyl, phenyl, phosphine, phosphate, phosphono, pyridyl, sulfide, sulfonyl, sulfinyl, thioester, thiol and oxidized 3,4-dihydroxy phenylalanine (DOPA) groups.
  • DOPA 3,4-dihydroxy phenylalanine
  • Examples of such groups are maleimide or glyoxylyl groups that react specifically with thiol groups in the Apo A molecule and oxidized 3,4-dihydroxyphenylalanine (DOPA) groups that react with primary amino groups in the Apo A molecule.
  • DOPA 3,4-dihydroxyphenylalanine
  • the bifunctional group may be first conjugated to the therapeutically active compound and then conjugated to the Apo A protein or, alternatively, it is possible to conjugate the bifunctional group to Apo A protein and then conjugate this to the therapeutically active compound.
  • Illustrative examples of such conjugates include the conjugates known as ketone-oxime (described in US20050255042) in which the first component of the conjugate comprises an aminoxy group that binds to a ketone group present in a heterobifunctional group which, in turn, binds to an amino group in the second component of the conjugate.
  • the agent that is used to conjugate components (i) and (ii) of the conjugates of the invention can be processed photolytically, chemically, thermally or enzymatically.
  • the use of binding agents that can be hydrolyzed by enzymes found in the target cell is of interest, so that the therapeutically active compound is released only inside the cell. Examples of binding agent types that can be processed intracellularly have been described in WO04054622, WO06107617, WO07046893 and WO07112193.
  • component (ii) of the conjugate of the invention is a compound of a peptide nature, including both oligopeptides and peptides.
  • Methods for chemically modifying a polypeptide chain are widely known to those skilled in the art and include methods based on conjugation through thiol groups present in cistern moieties, methods based on conjugation through primary amino groups present in the lysine residues (US6809186), methods based on conjugation through the N- and C-terminal residues.
  • Suitable reagents for the modification of polypeptides to allow coupling to other compounds include: glutaraldehyde (allows compounds to be attached to the N-terminal end of polypeptides), carbodiimide (allows the compound to be attached to the C-terminal end of a polypeptide), succinimide esters (for example MBS, SMCC) which allows activating the N-terminal end and cistern residues, benzidine (BDB), which allows activating tyrosine residues, periodate, which allows activating carbohydrate residues in those proteins that are glycosylated.
  • glutaraldehyde allows compounds to be attached to the N-terminal end of polypeptides
  • carbodiimide allows the compound to be attached to the C-terminal end of a polypeptide
  • succinimide esters for example MBS, SMCC
  • BDB benzidine
  • the ApoA component and the therapeutic compound of interest form a single peptide chain
  • expression of the conjugate is possible in a single step using a gene construct of the invention encoding said conjugate, for which said construct is introduced into a vector suitable for expression in a heterologous organism together with transcription control elements and, optionally, translation.
  • the transcription and, optionally, translation control elements, present in the expression cassette of the invention include promoters, which direct transcription of the nucleotide sequence to which they are operatively linked and other sequences necessary or appropriate for transcription and its adequate regulation in time and place, for example, start and end signals, cut-off sites, polyadenylation signal, origin of replication, transcriptional activators (enhancers), transcriptional silencers (silencers), etc.
  • promoters which direct transcription of the nucleotide sequence to which they are operatively linked and other sequences necessary or appropriate for transcription and its adequate regulation in time and place, for example, start and end signals, cut-off sites, polyadenylation signal, origin of replication, transcriptional activators (enhancers), transcriptional silencers (silencers), etc.
  • said elements, as well as the vectors used to construct the expression cassettes and the recombinant vectors according to the invention are chosen according to the host cells that are intended to be used.
  • the invention relates to a polynucleotide encoding a polypeptide of the invention.
  • the person skilled in the art will appreciate that the polynucleotides of the invention will encode only those conjugates in which component (ii) is of a peptide nature and in which the Apo A polypeptide forms a single peptide chain, regardless of relative orientation and independently of that both components are directly connected or separated by a spacer region.
  • the invention relates to a gene construct comprising a polynucleotide of the invention.
  • the construction comprises the polynucleotide of the invention placed under the operational control of sequences that regulate the expression of the polynucleotide of the invention.
  • the polynucleotides of the invention must access the nucleus of a target tissue and there be transcribed and translated to give rise to the biologically active fusion protein.
  • the active principle that is administered is a polynucleotide, it should preferably encode the precursor precursor form. proApoAl or the precursor form of the ApoAl variant, so that after its expression it is secreted thanks to the signal sequence and processed to give rise to the mature ApoAl.
  • the polynucleotide encoding it is preceded by a sequence encoding the ApoAl signal sequence.
  • the polynucleotide encoding it is preceded by a sequence encoding the interferon signal sequence ⁇ 1.
  • any promoter can be used for the gene constructs of the present invention as long as said promoter is compatible with the cells in which it is desired to express the polynucleotide.
  • suitable promoters for the realization of the present invention include, without necessarily being limited, constitutive promoters such as those derived from eukaryotic virus genomes such as polyomavirus, adenovirus, SV40, CMV, avian sarcoma virus, virus hepatitis B, the promoter of the metallothionein gene, the promoter of the thymidine kinase gene of herpes simplex virus, LTR regions of retroviruses, the promoter of the immuno globuin gene, the promoter of the actin gene, the EF-lalpha gene promoter as well as inducible promoters in which protein expression depends on the addition of a molecule or an exogenous signal, such as the tetracycline system, the NF ⁇ B / UV light system, the Cre /
  • the gene constructs of the invention contain the expression enhancing regions present in the promoter regions of predominantly hepatic expression genes such as the human serum albumin, prothrombin, alpha-1 genes. -microglobulin or aldolase, either in a single copy in the form of several copies thereof and either in isolation or in combination with other specific expression elements in the liver such as cytomegalovirus, alpha-1-antitrypsin or albumin promoters .
  • tissue-specific promoters include the albumin gene promoter (Miyatake et al., 1997, J.
  • Virol, 71: 5124-32 the central hepatitis virus promoter (Sandig et al, 1996 , Gene Ther., 3: 1002-9); the promoter of the gene of fetoprotein alfa (Arbuthnot et al., 1996, Hum.GeneTher., 7: 1503-14), and the promoter of the globulin binding protein gene that binds thyroxine (Wang, L., et al, 1997, Proc. Natl.Acad.Sci.USA 94: 11563-11566).
  • the polynucleotides of the invention or the gene constructs that constitute them may be part of a vector.
  • the invention relates to a vector comprising a polynucleotide or a gene construct of the invention.
  • the person skilled in the art will appreciate that there is no limitation as to the type of vector that can be used since said vector can be a cloning vector suitable for propagation and to obtain suitable polynucleotides or gene constructs or expression vectors in different organisms. suitable heterologists for the purification of the conjugates.
  • suitable vectors include prokaryotic expression vectors such as pUC18, pUC19, Bluescript and their derivatives, mpl8, mpl9, pBR322, pMB9, CoIEl, pCRl, RP4, phage and shuttle vectors such as pSA3 and pAT28, yeast expression vectors such as 2 micron plasmid type vectors, integration plasmids, YEP vectors, centromeric plasmids and the like, insect cell expression vectors such as pAC series and series vectors pVL, plant expression vectors such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE and the like series and expression vectors in upper eukaryotic cells well based on viral vectors (adenovirus, associated viruses to adenoviruses as well as retroviruses and lentiviruses
  • the vector of the invention can be used to transform, transfect or infect cells capable of being transformed, transfected or infected by said vector.
  • Said cells can be prokaryotic or eukaryotic.
  • the vector where said DNA sequence is introduced can be a plasmid or a vector that, when introduced into a host cell, is integrated into the genome of said cell and replicated together with the chromosome (or chromosomes) in which (or in which) it has been integrated.
  • the obtaining of said vector can be carried out by conventional methods known to those skilled in the art (Sambrok et al., 2001, cited supra).
  • the invention relates to a cell comprising a polynucleotide, a gene construct or a vector of the invention, for which said cell has been able to be transformed, transfected or infected with a construct or vector provided by it.
  • Transformed, transfected or infected cells can be obtained by conventional methods known to those skilled in the art (Sambrok et al., 2001, cited supra).
  • said host cell is an animal cell transfected or infected with an appropriate vector.
  • Suitable host cells for the expression of the conjugates of the invention include, but are not limited to, mammalian, plant, insect, fungal and bacterial cells.
  • Bacterial cells include, but are not limited to, Gram positive bacteria cells such as species of the genus Bacillus, Streptomyces and Staphylococcus and Gram negative bacteria cells such as cells of the genus Escherichia and Pseudomonas.
  • Fungal cells preferably include yeast cells such as Saccharomyces, Pichia pastoris and Hansenula polymorpha.
  • Insect cells include, without limitation, Drosophila cells and Sf9 cells.
  • Plant cells include, among others, crop plant cells such as cereals, medicinal, ornamental or bulb plants.
  • Mammalian cells suitable for the present invention include epithelial cell lines (pigs, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.). , sex cells (murine, etc.), liver cell lines (mono, etc.).
  • CHO cells (Ch ⁇ nese Hamster Ovary), COS cells, BHK cells, HeLa cells, 911, AT1080, A549, 293 or PER.C6, human ECCs NTERA-2 cells, D3 cells of the mESCs line, human embryonic stem cells such as HS293 and BGVOl, SHEFl, SHEF2 and HS181, NIH3T3, 293T, REH and MCF-7 cells and hMSCs cells.
  • human embryonic stem cells such as HS293 and BGVOl, SHEFl, SHEF2 and HS181, NIH3T3, 293T, REH and MCF-7 cells and hMSCs cells.
  • the invention relates to a nanoparticle comprising a conjugate of the invention.
  • nanoparticle is equivalent to the terms “lipoprotein” or “lipoprotein particle” and can be used interchangeably.
  • lipoprotein or lipoprotein particle
  • nanoparticle is meant any water-soluble particle, formed by a core of apolar lipids (such as esterified cholesterol and triglycerides) covered with a polar outer layer formed by apoproteins, phospholipids and free cholesterol.
  • Nanolipoparticles or lipoproteins are classified according to their density in chylomicrons, very low density lipoproteins (VLDs), intermediate density lipoproteins (IDLs), low density lipoproteins (LDLs) and high density lipoproteins (HDLs). The different characteristics of lipoproteins are shown in Table 1.
  • the nanolipoparticle is an HDL-type lipoprotein characterized by presenting a composition as indicated in the table above and because, the apo lipoproteins that form the protein fraction are Apo A, Apo C, Apo D and Apo E
  • the nanolipoparticles of the invention can be obtained by conventional methods known to those skilled in the art.
  • the nanolipoparticles of the invention can be obtained in vitro by adding cholesterol and phosphatidylcholine to the conjugate of the invention as described in Lerch et al.
  • the conjugates of the invention are useful for vehiculization to the liver and stabilization of compounds of therapeutic interest. Therefore, in another aspect, the invention relates to a pharmaceutical preparation comprising a therapeutically effective amount of a conjugate, a polynucleotide, a gene construct, a vector, a host cell or a nanoparticle according to the invention and a pharmaceutically acceptable carrier or excipient.
  • the invention relates to a polypeptide of the invention, a polynucleotide of the invention, a gene construct of the invention, a vector of the invention, a nanolipoparticle of the invention or a pharmaceutical composition for use in medicine.
  • the conjugates of the invention may be in the form of prodrug, salt, solvate or clathrate, either in isolation or in combination with additional active agents.
  • the combinations of compounds according to the present invention can be formulated together with an excipient that is pharmaceutically acceptable.
  • Preferred excipients for use in the present invention include sugars, starches, celluloses, gums and proteins.
  • the pharmaceutical composition of the invention will be formulated in a solid dosage pharmaceutical form (for example tablets, capsules, dragees, granules, suppositories, sterile crystalline or amorphous solids that can be reconstituted to provide liquid forms etc.), liquid (for example solutions, suspensions, emulsions, elixirs, lotions, ointments etc.) or semi-solid (gels, ointments, creams and the like).
  • a solid dosage pharmaceutical form for example tablets, capsules, dragees, granules, suppositories, sterile crystalline or amorphous solids that can be reconstituted to provide liquid forms etc.
  • liquid for example solutions, suspensions, emulsions, elixirs, lotions, ointments etc.
  • semi-solid gels, ointments, creams and the like.
  • compositions of the invention can be administered by any route, including, but not limited to, oral, intravenous, intramuscular, intrarterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteric, topical, sublingual or rectal.
  • oral, intravenous, intramuscular, intrarterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteric, topical, sublingual or rectal A review of the different forms of administration of active ingredients, of the excipients to be used and their manufacturing procedures can be found in the Treaty of Farmacia Galenica, C.
  • compositions comprising said vehicles can be formulated by conventional procedures known in the state of the art.
  • nucleic acids the polynucleotides of the invention, vectors or gene constructs
  • the invention contemplates pharmaceutical compositions specially prepared for the administration of said nucleic acids.
  • the pharmaceutical compositions can comprise said nucleic acids in a naked form, that is, in the absence of compounds that protect nucleic acids from their degradation by the body's nucleases, which entails the advantage that the toxicity associated with the reagents used is eliminated for transfection.
  • Suitable routes of administration for naked compounds include intravascular, intratumoral, intracranial, intraperitoneal, intrasplenic, intramuscular, subretinal, subcutaneous, mucosa, topical and oral (Templeton, 2002, DNA CeIl Biol., 21: 857-867).
  • nucleic acids can be administered as part of liposomes, cholesterol-conjugated or conjugated to compounds capable of promoting translocation through cell membranes such as the Tat peptide derived from the HIV-I TAT protein, the third helix of the homeodomain of Antennapedia protein from D.melanogaster, VP22 protein from herpes simplex virus, arginine oligomers and peptides such as those described in WO07069090 (Lindgren, A. et al, 2000, Trends Pharmacol. Sci, 21: 99-103, Schwarze , SR et al., 2000, Trends Pharmacol. Sci., 21: 45-48, Lundberg, M et al, 2003, Mol.
  • compounds capable of promoting translocation through cell membranes such as the Tat peptide derived from the HIV-I TAT protein, the third helix of the homeodomain of Antennapedia protein from D.melanogaster, VP22 protein from herpes simplex virus,
  • the polynucleotide can be administered as part of a plasmid vector or a viral vector, preferably adenovirus-based vectors, adeno-associated viruses or retroviruses, such as murine leukemia virus (MLV) or lentivirus (HIV) based viruses. , IVF, EIAV).
  • adenovirus-based vectors preferably adenovirus-based vectors, adeno-associated viruses or retroviruses, such as murine leukemia virus (MLV) or lentivirus (HIV) based viruses. , IVF, EIAV).
  • compositions and polynucleotides of the invention are administered by the so-called “hydrodynamic administration” as described by Liu, F., et al, (Gene Ther, 1999, 6: 1258-66).
  • the compounds are introduced into the body intravascularly at high speed and volume, resulting in high levels of transfection with a more diffuse distribution. It has been shown that the effectiveness of intracellular access depends directly on the volume of fluid administered and the speed of injection (Liu et al, 1999, Science, 305: 1437-1441).
  • mice In mice, administration has been optimized in lml / 10 g body weight values over a period of 3-5 seconds (Hodges et al, 2003, Exp.Opin.Biol.Ther, 3: 91-918).
  • the exact mechanism that allows cell transfection in vivo with polynucleotides after hydrodynamic administration is not fully known.
  • administration by the tail vein takes place at a rate that exceeds the heart rate, which causes the administered fluid to accumulate in the superior vena cava. This fluid subsequently accesses the vessels in the organs and, subsequently, through fenestrations in said vessels, accesses the extravascular space.
  • the polynucleotide comes into contact with the cells of the target organ before it mixes with the blood thus reducing the chances of degradation by nucleases.
  • compositions of the invention can be administered in doses of less than 10 mg per kilogram of body weight, preferably less than 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of body weight and less than 200 nmol of RNA agent, that is, around 4.4 x 10 16 copies per kg of body weight or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15 or 0.075 nmol per kg of body weight.
  • the unit dose can be administered by injection, by inhalation or by topical administration.
  • compositions and polynucleotides of the invention can be administered directly to the organ in the that the target mRNA be expressed in which case doses of between 0.00001 mg to 3 mg per organ are administered, or preferably between 0.0001 and 0.001 mg per organ, around 0.03 and 3.0 mg per organ, around 0.1 and 3.0 mg per organ or between 0.3 and 3.0 mg per organ.
  • the dose depends on the severity and response of the condition to be treated and may vary between several days and several months or until it is observed that the condition remits.
  • the optimal dosage can be determined by periodic measurements of the agent concentrations in the patient's organism.
  • the optimal dose can be determined from the EC50 values obtained by previous tests in vitro or in vivo in animal models.
  • the unit dose can be administered once a day or less than once a day, preferably, less than once every 2, 4, 8 or 30 days. Alternatively, it is possible to administer an initial dose followed by one or several maintenance doses, generally of less quantity than the initial dose.
  • the maintenance regimen may involve treating the patient with doses ranging from 0.01 ⁇ g to 1.4 mg / kg body weight per day, for example 10, 1, 0.1, 0.01, 0.001, or 0, 00001 mg per kg body weight per day. Maintenance doses are preferably administered at most once every 5, 10 or 30 days.
  • the treatment should be continued for a time that will vary according to the type of alteration suffered by the patient, its severity and the patient's condition. After treatment, the evolution of the patient should be monitored to determine if the dose should be increased in case the disease does not respond to the treatment or the dose is decreased if an improvement in the disease is observed or if unwanted side effects are observed.
  • the daily dose can be administered in a single dose or in two or more doses depending on the particular circumstances. If repeated administration or frequent administrations is desired, it is advisable to implant an administration device such as a pump, a semi-permanent catheter (intravenous, intraperitoneal, intracisternal or intracapsular) or a reservoir.
  • an administration device such as a pump, a semi-permanent catheter (intravenous, intraperitoneal, intracisternal or intracapsular) or a reservoir.
  • the conjugates of the invention can be used in therapeutic treatment methods given the ability of said conjugates to vehiculate a compound of therapeutic interest to a target tissue.
  • the person skilled in the art will appreciate that the diseases that can be treated with the compounds of the invention will depend (i) on the active component that is associated with Apo A and (ii) on the tissue to which said conjugates are transported. Table 2 describes in a non-limiting way possible diseases that can be treated with said conjugates and the active ingredient that would be necessary to incorporate into the conjugate:
  • the conjugates of the invention have the ability to target those organs or tissues in which there is expression of surface molecules with sufficient affinity for ApoA and capable of internalizing after binding with said polypeptide.
  • surface molecules include SR-B l (scavenger receptor B type 1), SR-Al (scavenger receptor A type 1), SR-A2 (scavenger receptor A type 1) and SR-C (scavenger receptor C).
  • SR-B l scavenger receptor B type 1
  • SR-Al scavenger receptor A type 1
  • SR-A2 scavenger receptor A type 1
  • SR-C scavenger receptor C
  • example 7 of the present invention illustrates the presence of the SR-BI receptor in different populations of the immune system and, in particular, in CD4 + T lymphocytes, in CD8 + T lymphocytes, in NK lymphocytes; in dendritic cells and monocytes / macrophages.
  • the invention also contemplates the use of the conjugates of the invention for the treatment of diseases associated with the immune system.
  • expression of the SR-BI receptor in osteoclasts is known (Brodeur et al, 2008, J. Bone Miner Res.
  • the conjugates of the present invention are suitable for the vehiculization of compounds of therapeutic interest to the compartments noted above.
  • the conjugates of the invention can be used for the treatment of liver diseases such as intrahepatic cholestasis, fatty liver (alcoholic fatty liver, reye syndrome), hepatic vein thrombosis, hepatoventricular degeneration, hepatomegaly, syndrome hepatopulmonary, hepatorenal syndrome, portal hypertension, liver abscesses, cirrhosis (alcoholic, biliary, experimental), alcoholic liver diseases (fatty liver, hepatitis, cirrhosis), parasitic diseases (echinococcosis, fasciolasis, amebic abscesses), jaundice (hemolytic, hepatocellular and cholestatic), hepatitis (alcoholic hepatitis, chronic hepatitis, autoimmune, hepatitis B, hepatitis C, hepatitis D, drug-induced
  • liver diseases such as intra
  • the conjugates of the invention can be used for the treatment of diseases of the immune system such as: • autoimmune diseases: Addison's disease, autoimmune hemolytic anemia, glomerular basal anti-membrane antibody disease, antiphospholipid syndrome, rheumatoid arthritis, autoimmune diseases of the nervous system, herpetiform dermatitis, type 1 diabetes mellitus, familial meditraneous fever, IGA glomerulonephritis, membranous glomerulonephritis , Goodpasture's syndrome, Graves' disease, autoimmune hepatitis, Lambert-Eaton myasthenic syndrome, Systemic lupus Erythematosus, sympathetic ophthalmia, penfigo, autoimmune polyocrinopathies, idiopathic thrombocytopenic purpura, Reiter's disease and autoimmune thyroiditis),
  • • autoimmune diseases Addison's disease, autoimmune hemolytic anemia, glomerular basal anti-membran
  • hypersensitivity drug hypersensitivity, environmental diseases, delayed hypersensitivity (inhibition of cell migration, disseminated acute encephalomyelitis), immediate hypersensitivity (anaphylaxis, allergic conjunctivitis, atopic dermatitis), immune complex diseases (hypersensitivity vasculitis , Arthus reaction, serum sickness), latex hypersensitivity, Wissler syndrome.
  • Immune deficiency syndromes such as dysgammaglobulinemia, HIV-I infections, HTLV-I or HTL V-2 infections, enzootic bovine leukosis, lymphopenia, phage dysfunctions such as Chediak-Higashi syndrome, chronic granulomatous disease, syndrome of Job, agammaglobulinemia, ataxia telangiectasia, common variable immunodeficiency, DiGeorge syndrome, leukocyte adhesion deficiency syndrome, Wiskott-Aldrich syndrome,
  • immunoproliferative disorders hyperglobulinemia (Schnitzler syndrome), lymphoproliferative disorders (granuloma, heavy chain disease, hair cell leukemia, lymphocytic leukemia, myeloid leukemia, lymphangiomyoma, lymphoma, sarcoidosis, agammaglobulinemia, lymphoblastic lymphoblastic lymphoblastic lymphoblastic disease mononucleosis infectious, lymphomatoid granulomatosis, Marek's disease, Sézary's syndrome, tumor lysis syndrome, Waldenstrom macroglobulinemia, immunoproliferative disease of the small intestine, plasmacytic leukemia, paraproteinemias and thrombocytopenic purpura), paraproteinemias.
  • hyperglobulinemia Schonitzler syndrome
  • lymphoproliferative disorders granuloma, heavy chain disease, hair cell leukemia, lymphocytic leukemia, myeloid leukemia, lymphangiomyoma
  • the conjugates of the invention can be used for the treatment of diseases of the capillary endothelium such as arteriosclerosis, obliterative arteriopathy, Raynaud's disease secondary to connectivitis, primitive hypertension and secondary pulmonary hypertension, diabetic microangiopathy, Buerger's disease, systemic sclerosis, vasculitis and all diseases characterized by endothelial damage with subsequent ischemia.
  • diseases of the capillary endothelium such as arteriosclerosis, obliterative arteriopathy, Raynaud's disease secondary to connectivitis, primitive hypertension and secondary pulmonary hypertension, diabetic microangiopathy, Buerger's disease, systemic sclerosis, vasculitis and all diseases characterized by endothelial damage with subsequent ischemia.
  • the conjugates of the invention can be used for the treatment of bone diseases such as dysplasias characterized by abnormal bone growth.
  • bone diseases such as dysplasias characterized by abnormal bone growth.
  • Representative examples of such conditions are achondroplasia, cleidocranial dysostosis, enchondromatosis, fibrous dysplasia, Gaucher's disease, hypophosphatemic rickets, Marfan syndrome, multiple hereditary exotoses, neurofibromatosis, osteogenesis imperfecta, osteopetrosis, osteopoikilosis, periodio sclerosis, sclerosis, sclerosis, sclerosis pyogenic osteomyelitis, conditions that result in osteopenia such as anemic states, osteopenia caused by steoriodes and heparin, bone marrow disorders, scurvy, malnutrition, calcium deficiency, idiopathic osteoporosis, congenital osteopenia, alcoholism, Cushing's disease, acrom
  • the conjugates of the invention can be used for the treatment of diseases of the intestinal epithelium such as malabsorption syndromes, Crohn's disease, diverticular bowel disease, paralytic ileus and intestinal obstruction.
  • the conjugates of the invention can be used for the treatment of respiratory diseases such as nasal vestibulitus, non-allergic rhinitis (for example, acute rhinitis, chronic rhinitis, atrial rhinitis, vasomotor rhinitis), nasal polyps, sinusitis, juvenile fibroid angiography, cancer of juvenile nose and papillomas, vocal cord polyps, nodules, touch ulcers, cord paralysis vowels, laryngceles, pharyngitis, tonsillitis, tonsillar cellulitis, parapharyngeal abscesses, laryngitis, laryngcele, throat cancer (e.g., nasopharyngeal cancer, tonsillar cancer, laryngeal cancer), lung cancer (squamous cell carcinoma, small cell carcinoma, carcinoma macrocytic, adenocarcinoma), allergic disorders (eosinophilic pneumonia, allergic alveolites, allergic interstitial pneumonia, allergic bronchopulmonary as
  • the invention contemplates that the therapeutically active component is an interferon.
  • the conjugates or the polynucleotides that encode them will be useful for the treatment of liver diseases that respond to interferon, such as chronic hepatitis C, chronic hepatitis B, hepatocarcinoma, cirrhosis, fibrosis.
  • the conjugates of the invention can be used to direct therapeutically active compounds to said cells.
  • the conjugates of the invention containing interferon as a therapeutically active compound can be used as an adjuvant to enhance the immune response of a vaccine.
  • the vaccine can be a vaccine directed against an organism capable of triggering an infectious disease, a vaccine directed against a tumor or a vaccine directed against an allergen.
  • the vaccines may contain a component of an infectious agent, a tumor or an allergen (peptide, polypeptide, glycopeptide, multiepitope peptide, fragment, etc.) or they may be a gene vaccine formed by a nucleic acid encoding a polypeptide of said organism, tumor or allergen
  • the conjugates of the invention comprise a TGF- ⁇ 1 inhibitor peptide.
  • TGF- ⁇ 1 inhibitor peptide can be used in the treatment of diseases or pathological alterations associated with an excess or deregulated expression of TGF- ⁇ 1, such as (i) fibrosis associated with the loss of function of an organ or tissue, for example, fibrosis pulmonary, hepatic fibrosis (cirrhosis), cardiac fibrosis, renal fibrosis, corneal fibrosis, etc., as well as (ii) surgical and aesthetic complications, for example, fibrosis associated with cutaneous and peritoneal surgery, fibrosis associated with burns, osteoarthritis fibrosis -articular, keloids, etc.
  • the authors of the present invention have shown that the administration of the conjugates of the invention comprising a TGF- ⁇ 1 inhibitor peptide in conjunction with IL-12 results in a stimulation of the induction of IFN-gamma mediated by IL- 12. Since IFN- ⁇ is a known antitumor agent, the inventors' finding opens the door to a new antitumor treatment based on the combination of an immuno stimulatory cytokine and a conjugate according to the invention comprising a TGF- ⁇ 1 inhibitor peptide.
  • the invention relates to a composition
  • a composition comprising (a) a first component selected from a conjugate, a polynucleotide, a gene construct, a vector, a host cell, a nanolipoparticle and a pharmaceutical preparation according to the invention, wherein component (ii) is a TGF- ⁇ 1 inhibitor peptide, and
  • a second component selected from an immuno stimulatory cytokine, a polynucleotide encoding said cytokine, a vector comprising said polynucleotide, a TGF- ⁇ 1 inhibiting peptide, a cytotoxic agent and combinations thereof.
  • Immuno-stimulatory cytokines that can be co-administered with Apo A conjugates which comprise a TGF- ⁇ 1 inhibitor peptide include, without limitation, IL-12, IL-2, IL-15, IL-18, IL-24, GM-CSF , TNF- ⁇ , CD40 ligand, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ .
  • the stimulating cytokine is IL-12.
  • TGF- ⁇ 1 inhibitor peptides that may be part of component (b) of the composition of the invention include essentially those that are part of the conjugate of the invention as described above.
  • TGF- ⁇ 1 inhibitor peptides can be, without limitation, the peptide pl44 (SEQ ID NO: 4) or the peptide pl7 (SEQ ID NO: 5).
  • the peptides that are part of the conjugaco (component (a) and the second component of the invention may be the same or different.
  • Cytotoxic agents is a compound capable of killing a cell selectively- or non-selectively or inhibiting the growth of a cell.
  • cytotoxic agents include paclitaxel, cytochalasin B, garmicidin D, ethidium bromide, emetine, mitomycin, ethoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinine dione, mitoxantronein, mitraminothyrotin, actin-throtinone, mitraminethyrotin, actin-throtinin, mitramin-throtinone, actin-throtinone, mitramin-throtinone, actinic acid throtinone, actinic acid throtinone , glucocorticoids, lidocaine, propranolol, puromycin, epiubicin, cyclopho
  • the invention relates to the use of a composition of the invention for the treatment of cancer, for example, the treatment of different types of tumors that include, without limitation hematological cancers (leukemia or lymphomas, for example) , neurological tumors (astrocytomas or glioblastomas, for example), melanoma, breast cancer, lung cancer, head and neck cancer, gastrointestinal tumors (stomach, pancreas or colon cancer, for example), liver cancer (for example, hepatocellular carcinoma), renal cell cancer, genitourinary tumors (ovarian cancer, vaginal cancer, cervical cancer, bladder cancer, testicular cancer, prostate cancer, for example) bone tumors and vascular tumors.
  • hematological cancers leukemia or lymphomas, for example
  • neurological tumors astrocytomas or glioblastomas, for example
  • melanoma breast cancer
  • lung cancer head and neck cancer
  • gastrointestinal tumors stomach, pancreas or colon cancer, for example
  • liver cancer for
  • the invention relates to a composition of the invention for the treatment of cancer.
  • the invention relates to a method for the treatment of cancer which comprises administering to a subject a composition of the invention.
  • the invention relates to the use of a composition of the invention for the preparation of a medicament for the treatment of cancer.
  • the therapeutically effective amounts of the components of the composition of the invention as described in the present invention will depend, for example, on the therapeutic objectives, the route of administration and the condition of the patient. Thus, it is preferable for the doctor to adjust the dose titre and modify the route of administration as needed to obtain the maximum therapeutic effect.
  • a typical dose can range from 0 mg / kg to 250 mg / kg or more daily, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days or weekly.
  • Administration of the composition of the invention can take place in different ways.
  • components (a) and (b) of the composition can be administered sequentially, separately and / or simultaneously. In one embodiment, components (a) and (b) can be administered simultaneously (optionally repeatedly). In another embodiment, the components are administered sequentially (optionally repeatedly).
  • the components will be administered separately (optionally repeatedly).
  • the person skilled in the art will appreciate that when the components (a) and (b) are to be administered sequentially or seriously, it is possible to administer the component (a) followed by the component (b) or the component (b) followed by the component (to).
  • separate formulations of components (a) and (b) can be administered using alternating dosage patterns If administration of components (a) and (b) is carried out sequentially or separately, The interval between the administration of the second component should not be so high that the effect of combination therapy is lost.
  • RNA from mouse liver or brain from treated mice was isolated from individual samples using TRI reagent (Sigma, Madrid, Spain). The concentration and purity of the samples was determined by absorbance at 260 and 280 nm with background correction at 320 nm in spectrophotometer (Biophotometer, Eppendorf).
  • RNA 3 ⁇ g was treated with DNase I and re-transcribed to cDNA with M-MLV RT in the presence of RNase OUT (all reagents from Invitrogen, Carlsbed, CA). 25 ⁇ l of total liver cDNA were obtained. The reaction was incubated 1 h at 37 ° C, denatured 1 min at 95 ° C and brought to 4 ° C. Samples were used immediately for PCR or stored at -20 0 C.
  • the mApoAl cDNA (795 total nucleotides, 72 nucleotides encoding the signal peptide and 723 nucleotides encoding the native protein) was amplified by PCR on the total liver cDNA, using BioTaq DNA polymerase (Bioline, London, UK): 5 min 94 ° C, 30 cycles of 40 sec at 94 ° C, 40 sec at 55 ° C and 40 sec at 72 ° C, followed by 7 min at 72 ° C in 2720 Thermal cycler thermal cycler (Applied Biosystems, Foster City, USA .UU.).
  • the PCR product was migrated in 1% agarose gel Agarose D-I low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA).
  • the purified mApoAl cDNA was cloned, following the instructions provided by the manufacturer, into the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-mApoAl. Finally, the sequence obtained by sequencing was confirmed.
  • mlFN ⁇ l Sense primer 5'-ATGGCTAGGCTCTGTGCTTT-3 '(FwATGmIFNaI) (SEQ ID NO: 22) and antisense primer 5' -TCATTTCTCTTCTCAGTC-CTAGTC-CTAG-1 ) (SEQ ID NO: 23).
  • the mlFN ⁇ cDNA (570 total nucleotides, 69 nucleotides encoding the signal peptide and 501 nucleotides encoding the native protein) was amplified by PCR on the total liver cDNA, using BioTaq DNA polymerase (Bioline, London, United Kingdom).
  • the amplification conditions were: 5 min 94 ° C, 30 cycles of 40 sec at 94 ° C, 40 sec at 55 ° C and 40 sec at 72 ° C, followed by 7 min at 72 ° C in 2720 Thermal cycler thermal cycler ( Applied Biosystems Foster City, USA).
  • the PCR product was migrated in agarose gel 1% Agarose DI low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA).
  • the purified mlFN ⁇ cDNA was cloned, following the instructions provided, into the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-mIFNal. Finally, the sequence obtained by sequencing was confirmed.
  • the 5 '-GGCGCGCCCTGGGCAGTCAGAGTCTCGC-S' (RvAscImApoAl) (SEQ ID NO: 24) antisense primer was designed, which introduces the 9 nucleotide sequence (GGCGCCC) that constitutes a restriction site for the 3 'AscI enzyme of the ApoAl gene and Remove the termination codon. This added restriction sequence will result in a short-binding GAP peptide, which will give some mobility to the constituent proteins.
  • Sense primer 5 'GGCGCGCCCTGTGACCTGCC TCAGACTCA-3' (FwAscImIFN ⁇ ) (SEQ ID NO: 25) that introduces the restriction sequence of AscI into 5 'of the coding sequence for the mature mlFN ⁇ l protein (i.e. elimination of the signal peptide sequence).
  • the PCR product (804 nucleotides) was migrated in 1% agarose gel Agarose D-I low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA). He
  • the PCR product (510 nucleotides) was migrated on 1% Agarose DI low EEO agarose gel (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA).
  • the purified AscI-mIFN ⁇ l DNA was cloned, following the instructions provided, into the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-AscI-mIFNal. Finally, the sequence obtained by sequencing was confirmed.
  • plasmids pCMV-mApoAl-Asc ⁇ and pCMV-Asd-mlFNal were digested independently 1.5 h at 37 ° C with the enzymes Ascl / Pmel, IxBSA and Buffer 4 (New England Biolabs), taking advantage of the restriction site Pmel present in the skeleton of pcDNA 3.1 V5-His TOPO® TA. Both digestions were migrated on 1% agarose gel and the bands corresponding to the open vector pCMV-mApoAl-Asc ⁇ and the insert of the pCMV-AscI-mIFNal were purified.
  • the product was ligated in a 1: 3 ratio (vector: insert) using the T4 DNA ligase High Concentration ligase and as a buffer solution the 2X Rapid Ligation Buffer (Promega Madison, Wl, US A), incubating the mixture 10 min at room temperature .
  • ToplO bacteria Invitrogen, Carlsbed, C A
  • the transformed bacteria were selected for their growth in Petri dishes with LB medium with ampicillin, since the vector contains a gene for resistance to this antibiotic.
  • Plasmid DNA was extracted from the positive bacteria using the MiniPrep technique (Qiagen, Germany) to subsequently digest 2 ⁇ g of said plasmid with the Ascl / Pmel enzymes (New England Biolabs) and electrophoresis to separate the result of said digestion in 1% agarose gel to check the presence of the insert.
  • the resulting plasmid of 6825 nts will be referred to hereafter as pCMV-Apo-IFN (pCMV-AF).
  • the 5 '-GGGCGCGCCTTTCTCTTCTCTCAGTCTTC-S' (RvAscImIFN ⁇ l) (SEQ ID NO: 26) antisense primer was designed, which introduces the 9 nucleotide sequence (GGCGCCC) that constitutes a restriction site for the 3 'AscI enzyme. mlFN ⁇ l gene and eliminates the termination codon.
  • This primer includes 3 nucleotides in 5 'to allow cutting with AscI.
  • PCR was amplified using as a template the pCMV-mApoAl, and the primers FwAscImApoAl and RvTGAmApoAl, with the enzyme BioTaq DNA polymerase (Bioline, London, United Kingdom), using the following amplification conditions: 5 min 94 ° C, 30 cycles of 40 sec at 94 ° C, 40 sec at 57 ° C and 40 sec at 72 ° C, followed by 7 min at 72 ° C in 2720 Thermal cycler thermal cycler (Applied Biosystems Foster City, USA).
  • the PCR product (732 nucleotides) was migrated in 1% agarose gel Agarose D-I low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction Kit (Qiagen, Valencia, CA).
  • the purified AscI-mApoAl DNA was cloned, following the instructions provided, in the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen. Carlsbed, CA), which we will call pCMV-AscI-mApoAl. Finally, the sequence obtained by sequencing was confirmed.
  • the PCR product (576 nucleotides) was migrated on 1% Agarose DI low EEO agarose gel (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction Kit (Qiagen, Valencia, CA).
  • the purified mlFN ⁇ -Asc ⁇ DNA was cloned, following the instructions provided, in the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-mIFNal-AscI. Finally, the sequence obtained by sequencing was confirmed.
  • plasmids pCMV-Asd-mApoAl and pCMV-mlFNal-Ascl were digested independently 1.5 h at 37 ° C with the enzymes Ascl / Pmel, IxBSA and Buffer 4 (New England Biolabs), taking advantage of the site of Pmel restriction present in the skeleton of pcDNA 3.1 V5-His TOPO® TA. Both digestions were migrated on 1% agarose gel and the bands corresponding to the open vector pCMV-mIFNal-Asc ⁇ and the insert of the pCMV-Asd-mApoAl were purified.
  • the product was ligated in a 1: 3 ratio (vector: insert) using the T4 DNA ligase High Concentration ligase and as a buffer solution the 2X Rapid Ligation Buffer (Promega Madison, Wl, USA), incubating the mixture 10 min at room temperature.
  • ToplO bacteria Invitrogen, Carlsbed, CA
  • the transformed bacteria were selected for their growth in Petri dishes with LB medium with ampicillin, since the vector contains a gene for resistance to this antibiotic.
  • Plasmid DNA was extracted from the positive bacteria by means of the MiniPrep technique (Qiagen, Germany) to subsequently digest 2 ⁇ g of said plasmid with the Ascl / Pmel enzymes (New England Biolabs) and electronically separate the result of said digestion in a 1% agarose gel to check the presence of the insert.
  • the resulting plasmid of 6822 nucleotides will be referred to below as pCMV-IFN-Apo (pCMV-IA).
  • the 5'- primer was designed
  • TCACGCACGCTCATACCAAGAACTCCTAGGAATAAACCAAATACGCTTGG GCGCGCCCTGGGC-3 '(RvmApoAlpl7) (SEQ ID NO: 28). It was amplified by PCR, with the Easy-A High Fidelity PCR cloning enzyme (Stratagene, La Jolla, CA) using as a template the pCMV-mApoAl-Asc ⁇ , and the primers FwATGmApoAl and RvmApoAlpl7.
  • the conditions were used: 1 min 95 ° C, 30 cycles of 40 sec at 95 ° C, 40 sec at 60 0 C and lmin at 72 ° C, followed by 7 min at 72 ° C in 2720 Thermal cycler thermal cycler (Applied Biosystems Foster City, USA).
  • the PCR product was migrated in 1% Agarose DI low EEO agarose gel (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA).
  • the purified mApoAl-AscI-pl7 DNA was cloned, following the instructions provided, into the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-mApoAl-Asd-pl7. Finally, the sequence obtained by sequencing was confirmed.
  • TCAATTCTGCATCATGGCCCAGATTATCGAGGCGTCCAGCGAGGTGG GCGCGCCCTGGGC-3 '(RvmApoAlpl44) (SEQ ID NO: 29). It was amplified by PCR, with the Easy-A High Fidelity PCR cloning enzyme (Stratagene, La Jolla, CA) using as template the pCMV-mApoAl-Asc ⁇ , and the primers FwATGmApoAl and RvmApoAlpl44.
  • the conditions used were: 1 min 95 ° C, 30 cycles of 40 sec at 95 ° C, 40 sec at 65 ° C and 1 min at 72 ° C, followed by 7 min at 72 ° C in 2720 Thermal cycler thermal cycler (Applied Biosystems Foster City, USA).
  • the PCR product was migrated in 1% agarose gel Agarose D-I low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick GeI Extraction KH (Qiagen, Valencia, CA).
  • the purified DNA of mApoAl-AscI-pl44 was cloned, following the instructions provided, in the pcDNA TM 3.1 / V5-His TOPO® TA expression vector (Invitrogen, Carlsbed, CA), which we will call pCMV-mApoAl-AscI-pl44. Finally, the sequence obtained by sequencing was confirmed.
  • the 5 '-TTGCTGCC ATACGTGCCAAG-3' primer (SEQ ID NO: 30) was designed, which together with the FwATGmApoAl primer is used to amplify the SPmApoAl, using the pCMV-mApoAl as a template.
  • the PCR product 72 nucleotides was migrated on 1% Agarose DI low EEO agarose gel (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick Gel Extraction KH (Qiagen, Valencia, CA).
  • the PCR product (120 nucleotides) was migrated in 1% Agarose D-I low EEO agarose gel (Pronadisa, Madrid, Spain), and purified the gel fragment by QIAquick GeI Extraction KH (Qiagen, Valencia, CA).
  • the purified SPmApoAl-pl7 DNA was cloned, following the instructions provided, into the pcDNA TM 3.1 / V5-His TOPO® TA (Invita) gene expression vector. Carlsbed, CA), which we will call pCMV-SPmApoAl-pl7. Finally, the sequence obtained by sequencing was confirmed.
  • the 5'- primer was designed
  • the purified DNA of SPmApoAl-p l44 was cloned, following the instructions provided, in the pcDNA TM 3.1 / V5-His TOPO® TA (Invita) gene expression vector, Carlsbed, CA), which we will call pCMV-SPmApoAl-pl44. Finally, the sequence obtained by sequencing was confirmed.
  • the MEROPS database http://merops.sanger.ac.uk/) proteases was studied able to cut the amino acid sequence of the fusion protein, releasing the complete p 144.
  • the search result gave as a candidate the metalloprotease 9 (MMP9), which made the cut leaving an amino acid S in the sequence of pl44.
  • MMP9 metalloprotease 9
  • CTTTTCCCGACGTCT DNA sequence [SEQ ID NO: 51] (amino acids: LFPTS [SEQ ID NO: 19]) will be translated into said cutting sequence: LFPT-S TSLDASIIWAMMQN [SEQ ID NO: 4].
  • the PCR was performed with the following conditions: 2 min at 94 ° C, 30 cycles of 40 sec at 94 ° C, 45 sec at 54 ° C and 40 sec at 72 ° C, followed by 7 min at 72 ° C in thermal cycler 2720 Thermal cycler (Applied Biosystems Foster City, USA).
  • the PCR product was migrated on 1% agarose gel Agarose D-I low EEO (Pronadisa, Madrid, Spain), and purified the gel fragment (70 nucleotides) PerfectPrep DNA Cleanup (Eppendorf, Germany).
  • plasmids pCMV-mApoAl-Asd-pl44 and pCMV-Asd-MMp9-pl44 were digested independently with the restriction enzymes Ascl / Pmel, the latter present in the skeleton of pcDNA 3.1 V5-His TOPO® TA . Digestion was performed 1.5 h at 37 ° C with the enzymes Ascl / Pmel, IxBSA and Buffer 4 (New England Biolabs, Beverly, USA).
  • Plasmid DNA was extracted from the positive bacteria using the MiniPrep technique (Qiagen, Germany) to subsequently digest 2 ⁇ g of said plasmid with the AccI / Pmel enzymes (New England Biolabs) and electrode the result of said digestion in a 1% agarose gel to check the presence of the insert.
  • the resulting plasmid of 6324 nucleotides will be referred to below as pCMV-m, ApoAl-Asd-MMP9-p 144.
  • the DNA sequence was introduced (GCACCAGCAGAAACAAAAGCAGAACCAATGAC, SEQ ID NO: 53) coding for a flexible extended linker whose sequence Translated to amino acids is APAETKAEPMT (SEQ ID NO: 13), which adopts a CCCCCCCCC (coil) structure, and exists as a binding peptide in the native pyrevate ferredoxin oxidoreductase (lb0pA_2).
  • 5'- primers were designed
  • Plasmid pCMV-mApoAl-Asd-pl44 was digested with AscI (Buffer 4, New England Biolabs), the PerfectPrep DNA Cleanup DNA (Eppendorf, Germany) was purified, and later digested with Notl (Buffer 3 and BSA, New England Biolabs), due to incompatibility of digestion buffers. A 1% agarose gel was migrated, the open vector was purified with PerfectPrep DNA Cleanup (Eppendorf, Germany).
  • the product was ligated in a 1: 3 ratio (vector: insert) using the T4 DNA ligase High Concentration ligase and as a buffer solution the 2X Rapid Ligation Buffer (Promega Madison, Wl, USA), incubating the mixture 10 min at room temperature.
  • ToplO bacteria Invitrogen, Carlsbed, CA
  • the transformed bacteria were selected for their growth in Petri dishes with LB medium with ampicillin, since the vector contains a gene for resistance to this antibiotic.
  • the resulting plasmid of 6373 nucleotides will be referred to hereafter as pCMV-mApoAl-AscI-LINKER-pl44. Finally, the sequence obtained by sequencing was confirmed.
  • Each DNA plasmid (20 ⁇ g) was resuspended in 1.8 ml of 0.9% saline (Braun) introduced by the tail vein by hydrodynamic injection (Liu et al., 1999, Gene Ther., 6: 1258 -1266), using 27.5G needles and 2.5ml syringes (Becton-Dickinson, Spain). Blood samples were obtained retroorbitally, after inhalation anesthesia with isofluorane (Forane, Abbott). The serum was recovered by two consecutive centrifugations at 9, lxg for 5 minutes and stored at -20 0 C.
  • the CT26 cell line derived from a BALB / c mouse colorectal carcinoma adeno was induced by the N-nitroso-N-methyl-urethane carcinogen, grown in complete RPMI-1640 medium (Gibco-BRL, Paisley, UK), supplemented with 10% fetal calf serum (FCS) inactivated at 56 ° C, 2 mM glutamine, 100 U / ml streptomycin, 100 mg / ml penicillin, 1% ⁇ -mercaptoethanol 5.10-3.
  • FCS fetal calf serum
  • the MC38 cell lines (murine adenocarcinoma cells), L929 (mouse fibroblast derived cells) and 293 (human kidney embryonic cells stably transfected with the El region belonging to human adenovirus type 5, ECACC No. 85120602) cultured in Complete DMEM (supplemented with 10% fetal calf serum (FCS) inactivated at 56 ° C, 2 mM glutamine, 100 U / ml streptomycin, 100 mg / ml penicillin).
  • FCS fetal calf serum
  • the cells described were cultured in humidified incubator chambers at 37 ° C and in a 5% CO2 atmosphere.
  • the plates and culture bottles are from Greiner Bio-one (Essen, Germany).
  • the levels of mlFN ⁇ l were measured by ELISA in 96-well flat plates NUNC maxisorp.
  • the anti-mIFN ⁇ l neutralizing Ab antibody (RMMA-I, PBL) was diluted 1/1000 in PBS Ix, plated 10 ⁇ L / well and incubated O / N at 4 ° C in a humid environment. After five washes in PBS lx-0.1% Tween-20 (pH 12-1 A) the plate was blocked with 300 ⁇ l / well of the PBS Ix 1% BSA solution for 1 h at room temperature. Serum samples were diluted 1/100 in PBS solution Ix 1% BSA and incubated 1 h at room temperature.
  • mRNA values were represented by the formula 2 ⁇ Ct , where ⁇ C t indicates the difference in the threshold cycle between mActin and the target genes.
  • spleen spleen cells were isolated from unimmunized BALB / c mice and the red blood cells were used with ACK solution (Cambrex, Walkersville, MD).
  • the splenocytes obtained were divided into two groups and one of them was incubated 30 min at 37 ° C with RPMI 1640 medium and 9 ⁇ M of TPHPARIGL peptide (cytotoxic epitope derived from ⁇ -galactosidase, Proimmune Ltd., Oxford, United Kingdom).
  • the second group received the same treatment without the peptide.
  • Splenocytes loaded with the peptide were labeled with 2.5 ⁇ M CFSE (CFSE alt0 ) (Molecular Probes, Eugene, OR). Control splenocytes were labeled with 0.25 ⁇ M CFSE (CFSE low ).
  • both populations were mixed in a 1: 1 ratio and 1 0 7 cells were injected intravenously into naval mice or immunized mice. After 24 hours, the animals were sacrificed. The extracted spleens were disintegrated and the ration of high CFSE and low CFSE cells was analyzed by flow cytometry using FACSalibur (Becton Dickinson, Mountain View, Calif, USA). The percentage of specific lysis was calculated according to the following formula:
  • APC-Conjugated Mouse Anti-Mouse NK-1.1 (NKR-PlB and NKR-PlC) Monoclonal Antibody to define the NK cell population.
  • APC-Rat Anti-Mouse CDl Ib to define the cell population of monocytes
  • APC-CDl Ic to define the population of dendritic cells. The other four groups were used as control, incubating 10 min with the respective antibodies, without anti-SRBl. The labeled splenocytes were washed in PBS and 5% fetal bovine serum and incubated 10 min FITC-Conjugated Donkey Anti- Rabbit IgG Antibody (Jackson Immuno Research, West Grove, PA). The samples so stained were studied by flow cytometry using the FACSalibur (Becton Dickinson, Mountain View, Calif, USA).
  • mice were taken from tubes in tubes with 0.5% heparin (Mayne) final concentration, and the plasma was immediately extracted by centrifugation (500Og, 20min.). Solutions of sodium bromide (NaBr) at different densities were prepared in a final volume of 25mL in distilled water. EDTA was added at a final concentration of 0.05% (w / v).
  • V NaBri.4 Vbf (d-dbf) / 1 '4 - d
  • V NaBri.4 Solution Vol 1' 4 to be added
  • the samples were centrifuged 3.5h, 4 0 C, 33600Og, and a fraction of the supernatant of approximately 400ul corresponding to HDL was collected, and the sediment fraction corresponding to the lipoprotein free plasma (LDP) and stored at -2O 0 C.
  • LDP lipoprotein free plasma
  • the IFN activity units of the isolated mouse plasma HDL fractions containing Apo-IFN and IFN-Apo were calculated by activity bioassay, measuring IFN's ability to protect cells against cytopathic activity of lytic encephalon myocarditis virus (EMCV) over a wide range of concentrations of plated IFN by successive dilution of the samples. This dilution were plated 3.10 5 L929 cells / well in 96 - well plate cell culture Cellstar (Greiner bio-one) and incubated O / N at 37 0 C 5% CO 2 to reach the monolayer of adherent cells.
  • EMCV lytic encephalon myocarditis virus
  • mice of mouse rIFN alpha (CHO derived mouse, Hycult Biotechnol) or 10000UI of IFL-Apo HDL measured by activity bioassay were injected retroorbitally.
  • plasmids expressing plasmids were given to groups of four mice by hydrodynamic injection.
  • apolipoprotein AI (ApoAI)
  • murine interferon alpha 1 IFN ⁇ l
  • Apo-IFN fusion of ApoAI and IFN ⁇ l
  • IFN-Apo fusion of IFN ⁇ l and ApoAI
  • Serums obtained at 6 hours and at day 1, 3, 6 and 9 were analyzed by ELISA sandwich.
  • the sera of the mice that received the control plasmid expressing ApoAI did not show detectable levels of IFN ⁇ , indicating that hydrodynamic administration per se or ApoAI expression does not induce endogenous IFN ⁇ expression (Figure 1).
  • mice that were injected with the IFN ⁇ l plasmid expressed high levels of IFN ⁇ at 6 hours and rapidly decreased (Figure 1).
  • the mice that received the plasmids encoding Apo-IFN or IFN-Apo had higher levels of serum interferon at day 1.
  • high levels of IFN ⁇ could be detected, unlike mice injected with the IFN ⁇ l plasmid ( Figure 1). Therefore, the constructs expressing ApoAI and IFN ⁇ fusion proteins have higher and more sustained levels of serum IFN ⁇ .
  • the difference in serum IFN ⁇ levels can be explained by the increase in the plasma half-life of fusion proteins with respect to IFN ⁇ or by the increase in the expression of these proteins.
  • mRNA messenger RNA
  • the livers were collected from the mice that had received a hydrodynamic injection with the plasmids expressing ApoAI, IFN ⁇ l, Apo-IFN and IFN-Apo on day 0, 1, 3 and 6.
  • RNA was extracted from these samples and performed a quantitative RT-PCR.
  • levels of IFN ⁇ 1 mRNA at day 1 were detected in the IFN ⁇ , Apo-IFN and IFN-Apo samples but not in ApoAI samples.
  • mice injected with the ApoAI-IFN ⁇ chimeric constructs have higher levels of serum neopterin and body temperature
  • ApoAI-IFN ⁇ chimeric constructs increase liver expression levels of interferon-inducible genes
  • the activity of type I interferons is mediated by proteins encoded by interferon-inducible genes (ISGs). After the binding of IFN ⁇ to its membrane receptor, a signaling cascade is activated that leads to the activation of the transcription of the ISGs.
  • ISGs interferon-inducible genes
  • the mRNA levels of four of these genes were analyzed at day 3 after hydrodynamic administration.
  • the genes that were analyzed are IRFl, 2'-5 'OAS, USP18, ISG15, MxI.
  • the chimeric constructs increase the mRNA levels of the ISGs studied. An increase induced by the plasmid that expresses IFN ⁇ can also be detected even though at day 3 serum levels of IFN ⁇ were no longer detected.
  • IFN ⁇ constructs increase the number and activation of splenocytes.
  • the increase in the number and activity of spleen cells was analyzed first.
  • the plasmids were injected by hydrodynamic injection and six days later, the spleens were disintegrated, the total cells were counted and, after marking the splenocytes with antibodies to identify the main lymphocyte populations and with an activation marker (CD69), analyzed by flow cytometry.
  • Injection of constructions with IFN ⁇ increased the number of splenocytes significantly.
  • the construction coding for IFN-Apo stands out remarkably in this test ( Figure 5 A).
  • anti-CD4 antibodies were used, as a marker for CD4 + T lymphocytes; anti-CD8, as a marker for CD8 + T cells; anti-CD 19, as a B cell marker; and anti-CD49b, as a marker of NK lymphocytes.
  • CD4 + T lymphocytes the chimeric constructs increased the percentage of activated CD4 + cells, unlike IFN ⁇ ( Figure 5B).
  • IFN ⁇ did increase the percentage of CD8 + cells, although not significantly. The increase was greater, and significant, with Apo-IFN and especially high with IFN-Apo ( Figure 5 C). The percentage of activated B cells follows the same profile as that of CD8 + .
  • IFN-Apo increases the specific lysis induced by cytotoxic lymphocytes.
  • the increase in cytotoxic activity induced by a DNA vaccine in the presence of the different constructs was analyzed.
  • the LacZ gene coding for the ⁇ -galactosidase immunogenic protein was chosen. The plasmid encoding this protein was injected together with the plasmids encoding ApoAl, IFN ⁇ , Apo-IFN or IFN-Apo.
  • splenocytes Seven days after gene vaccination, marked splenocytes were injected intravenously with 2.5 ⁇ M CFSE and loaded with the cytotoxic epitope H2Kd TPHPARIGL, derived from the ⁇ -galactosidase protein. As an internal control, splenocytes with 0.25 ⁇ M CFSE without peptide were injected. Twenty-four hours later the specific lysis of splenocytes loaded with the cytotoxic epitope was quantified by flow cytometry. In Figure 6, a higher lysis with respect to ApoAI with IFN ⁇ is observed, followed by Apo-IFN and by IFN-Apo, construction with which the highest values of specific lysis are obtained. These results correlate with the results of the percentage of activation of CD8 + T cells and allow us to conclude that IFN-Apo is the construction with the highest adjuvant effect in a gene vaccination model.
  • the increase in adjuvant activity may be due to the increase in stability of IFN ⁇ or because the ApoAI fraction of IFN-Apo allows greater interaction of IFN ⁇ with cells of the immune system.
  • SR-BI the main receptor for ApoAI
  • the SRB-I receptor was detected in all the populations analyzed. In the effector cells of the immune system (T CD4 + , T CD8 + and NK) the percentage of cells expressing this receptor ranges between 15% and 28%. This percentage rises to more than 50% in cells with antigenic presentation capacity such as monocytes and dendritic cells (Figure 7). This result suggests that one of the possible mechanisms for increasing adjuvant capacity may be greater maturation of antigen presenting cells.
  • IFN-Apo improves the chain of an anti-tumor vaccination protocol.
  • mice received a hydrodynamic injection with the Apo, IFN or IFN-Apo plasmids and the next day they were vaccinated with the cytotoxic peptide AH-I in incomplete Freunds adjuvant. This peptide is presented by the CT26 tumor line, which was inoculated into the different experimental groups 9 days after vaccination. The majority of the mice in the control group, which received the hydrodynamic plus vaccination with the Apo plasmid, developed a subcutaneous tumor at the site of the inoculation of CT26 tumor cells.
  • mice that received IFN in addition to vaccination exhibit behavior that does not differ significantly from that of the control group.
  • about 60% of the mice that received the vaccination and the IFN-Apo plasmid were able to reject the tumor cells and had no tumor during the 30 days of the experiment ( Figure 8). Therefore, the greater adjuvant effect of IFN-Apo causes an increase in the efficacy of a vaccination protocol.
  • IFN-Apo has lower hematological toxicity than IFN.
  • IFN important hematological toxicity, which can lead to the suspension of treatment in certain patients who develop deep leukopenia and / or thrombocytopenia.
  • the evolution, after the hydrodynamic administration of the different constructions, of the leukocytes and platelets in blood was analyzed. It is observed in Figure 10A that all the constructions that carry interferon showed lower blood levels of leukocytes at day 1 after the hydrodynamic administration of the plasmids. This early effect can be mediated by a blockage of the leukocyte output of the secondary lymphoid organs described for IFN (Shiow LR et al. Nature. 440 (7083): 540-4 (2006)).
  • IFN-Apo increases less than IFN interferon-induced genes in the brain.
  • IFN interferon-induced genes
  • the IFN-Apo fusion protein circulates incorporated into high density lipoproteins (HDLs).
  • HDLs high density lipoproteins
  • the apolipoprotein AI present in the blood circulates in the form of a macromolecular lipoprotein complex called high density lipoproteins.
  • the fusion protein was capable of incorporating into the HDLs, 24 h after injecting the plasmids encoding the IFN and the IFN-Apo molecules hydrodynamically, the HDLs were isolated from the serum by differential centrifugation in NaBr gradient. With these fractions an IFN bioassay was performed, that is, a protection test of the cytopathic effect of a virus, in which cells previously incubated with IFN samples are confronted in successive dilutions, with a cytopathic virus.
  • the virus will not be able to lyse pretreated cells.
  • the HDLs obtained from mice that received the plasmid encoding IFN were not able to protect the cells from the cytopathic effect of the encephalomyelitis virus, indicating that the IFN does not circulate bound to the HDLs.
  • the two IFN-Apo molecules could be detected by this technique in the HDLs ( Figure 13 A).
  • a western blot was performed to detect apolipoprotein AI in the serum fractions free of HDLs (HDLs -) and the fraction of HDLs (HDLs +) of each experimental group.
  • Apolipoprotein AI was not detected in any depleted fraction of HDLs, indicating the correct isolation of the HDLs. Both in the group that received the Apo plasmid, and in the group that received the IFN plasmid, a single band was detected in the HDL fraction, which corresponds to the height of the endogenous apolipoprotein AI. In contrast, a higher band was detected in the group with the Apo-IFN molecule, which corresponds to the fusion molecule. In the case of the IFN-Apo molecule, two bands were detected in addition to the endogenous ApoAI, indicating the formation of dimers in part of the chimeric protein (Figure 13 B).
  • HDLs containing IFN-Apo maintains the properties observed after hydrodynamic administration.
  • This phenomenon may be due to the fact that IFN-Apo stimulates the proliferation of sleeping hematopoietic cells more effectively than IFN (Essers MA, et al. Nature. Feb 11 (2009)). On day 1, the state of IFN-induced depression was determined in these mice. Again, there is a significant difference between mice that received IFN-recombinate and those that received an equivalent dose of IFL-Apo HDLs, reproducing the data obtained after hydrodynamic administration.
  • the ApoAI-linker-P144 construct increases the induction of IFN ⁇ mediated by IL12
  • Inter leukin 12 is an immuno-stimulating cytokine with a potent antitumor activity. Its activity is mainly mediated by IFN ⁇ . The production of this mediator is regulated by TGF ⁇ , so its blockage by means of the inhibitor peptides pl7 or pl44 can increase the induction of IFN ⁇ and, therefore, the antitumor activity of IL 12.
  • TGF ⁇ Inter leukin 12
  • ApoAI was used as a control.
  • pl7 Two pl constructs were generated with pl7: i) spP17, which contains the coding sequence of the pl7 peptide preceded by the ApoAI signal peptide, achieving release to the extracellular medium of the pl7 peptide. ii) ApoAI-P17, which contains the gene that codes for ApoAI followed by three binding amino acids (GAP), and the coding sequence of pl7. With pl44, the spP144 and ApoAI-P144 constructs were generated, replacing the coding sequence of pl7 with that of pl44. In addition, two other constructs were generated: i) ApoAI-MMP9-P144, which contains as a binding peptide a target sequence for metalloproteinase 9 (MMP9). ii) ApoAI-linker-P144, which contains an extended conformation sequence as a binding peptide.
  • the ApoAI-MMP9-P 144 construct is an example of a latent inhibitor that would only be active in the presence of MMP9, which upon cutting the ApoAI binding sequence will release the active p 144 peptide at the place where MMP9 is expressed.
  • This protease is expressed by many types of tumors, including hepatocarcinomas, and by the myeloid suppressor cells, which invade the tumor stroma. So this construction will allow the release of p 144 in the place where it has to act mainly, limiting the adverse effects of the systemic inhibition of TGF ⁇ .
  • the constructs expressing pl7 and ApoAI-linker-P144 increase the percentage of tumor-free vaccinated mice.
  • BALB / c mice were vaccinated with the epitope Cytotoxic H2Kd AHl (SPSYVYHQF, SEQ ID NO: 54) with incomplete Freunds adjuvant. Seven days later, the different constructions were administered by hydrodynamic injection. After another seven days, 5xlO 5 CT26 cells were inoculated subcutaneously. The percentage of tumor-free animals was analyzed over time.
  • apolipoprotein AI that carries fused therapeutic peptides is able to incorporate and circulate in the form of a physiological nanolipoparticle.
  • HDLs containing ApoAI-linker-P144 allows obtaining physiological nanolipoparticles with the ability to inhibit the activity of TGF ⁇ .
  • HDLs purified from an animal expressing ApoAI-linker-P144, were inoculated into mice that are simultaneously administered hydrodynamic injections with a plasmid expressing interleukin 12 in response to doxycycline administration.
  • the ApoAI-linker-P144 plasmid was coadministered.
  • the IFN ⁇ levels obtained after administration of the HDLs are similar to those obtained after hydrodynamic injection (Figure 16).
  • the P144 peptide present in the HDLs is capable of blocking TGF ⁇ in vivo, allowing greater induction of IFN ⁇ . Therefore, the incorporation of peptides to HDLs through their Fusion with apoliprotein AI represents an attractive strategy to formulate new therapeutic peptides.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Rheumatology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Dermatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biotechnology (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Psychology (AREA)
PCT/ES2009/070224 2008-06-13 2009-06-12 Conjugados de apo-a para la administración de compuestos biológicamente activos Ceased WO2009150284A2 (es)

Priority Applications (10)

Application Number Priority Date Filing Date Title
MX2010013759A MX2010013759A (es) 2008-06-13 2009-06-12 Conjugados para la administracion de compuestos biologicamente activos.
AU2009256547A AU2009256547B2 (en) 2008-06-13 2009-06-12 Apo-A conjugates for the administration of biologically active compounds
BRPI0915093A BRPI0915093A2 (pt) 2008-06-13 2009-06-12 conjugados para a administração de compostos biologicamente ativos
CN200980131382.9A CN102123737B (zh) 2008-06-13 2009-06-12 用于生物活性化合物施用的轭合物
JP2011513010A JP5685529B2 (ja) 2008-06-13 2009-06-12 生物学的活性を有する化合物の投与のための複合体
RU2011100801/10A RU2567667C2 (ru) 2008-06-13 2009-06-12 Конъюгаты для введения биологически активных соединений
CA2727811A CA2727811A1 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
EP09761841A EP2305309A2 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
US12/997,829 US20110293557A1 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
US14/947,164 US20160074475A1 (en) 2008-06-13 2015-11-20 Conjugates for the administration of biologically active compounds

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200801796 2008-06-13
ESP200801796 2008-06-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/997,829 A-371-Of-International US20110293557A1 (en) 2008-06-13 2009-06-12 Conjugates for the administration of biologically active compounds
US14/947,164 Division US20160074475A1 (en) 2008-06-13 2015-11-20 Conjugates for the administration of biologically active compounds

Publications (3)

Publication Number Publication Date
WO2009150284A2 true WO2009150284A2 (es) 2009-12-17
WO2009150284A3 WO2009150284A3 (es) 2010-12-09
WO2009150284A9 WO2009150284A9 (es) 2011-02-03

Family

ID=41338617

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2009/070224 Ceased WO2009150284A2 (es) 2008-06-13 2009-06-12 Conjugados de apo-a para la administración de compuestos biológicamente activos

Country Status (10)

Country Link
US (2) US20110293557A1 (https=)
EP (1) EP2305309A2 (https=)
JP (2) JP5685529B2 (https=)
CN (1) CN102123737B (https=)
AU (1) AU2009256547B2 (https=)
BR (1) BRPI0915093A2 (https=)
CA (1) CA2727811A1 (https=)
MX (1) MX2010013759A (https=)
RU (1) RU2567667C2 (https=)
WO (1) WO2009150284A2 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011070214A2 (es) 2009-12-11 2011-06-16 Proyecto De Biomedicina Cima S.L. Conjugados y composiciones para inmunoterapia y tratamiento anti-tumoral
WO2011098644A2 (es) 2010-02-09 2011-08-18 Proyecto De Biomedicina Cima, S.L. Composiciones para el tratamiento de enfermedades infecciosas y tumorales
EP2404611A4 (en) * 2009-03-06 2012-11-21 Digna Biotech Sl Peptide for the prophylactic or therapeutic treatment of skin tumors, in the initial stages
EP2735874A1 (en) 2012-11-21 2014-05-28 Fundación Para La Investigación Biomédica Del Hospital Universitario Puerta De Hierro Methods of diagnosing and therapeutic agents for use in the treatment of prostate cancer
KR20150139142A (ko) * 2014-06-02 2015-12-11 씨제이제일제당 (주) 반추동물의 메탄 생성 저감용 사료 첨가제 조성물
US11390854B2 (en) 2017-05-09 2022-07-19 Fundacion Para La Investigacion Medica Aplicada Human porphobilinogen deaminase derived proteins and polynucleotides and uses thereof
US20220332763A1 (en) * 2019-08-27 2022-10-20 Nanjing Anji Biological Technology Co., Ltd. Fused polypeptide and use thereof

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110305707A1 (en) * 2010-06-15 2011-12-15 The Cleveland Clinic Foundation Compositions and methods for treating cancer
HUE042314T2 (hu) 2011-02-07 2019-06-28 Cerenis Therapeutics Holding Sa Lipoprotein komplexek és azok gyártása és alkalmazásai
JP2014132832A (ja) * 2011-05-10 2014-07-24 Sekisui Chem Co Ltd 医薬、機能性食品、目的蛋白質の安定化方法、融合蛋白質、核酸、並びに、組換え体
EP2748191A1 (en) * 2011-08-25 2014-07-02 F.Hoffmann-La Roche Ag Shortened tetranectin-apolipoprotein a-i fusion protein, a lipid particle containing it, and uses thereof
CN103073646A (zh) * 2012-03-13 2013-05-01 华中科技大学 一种运载蜂毒肽的多肽、运载蜂毒肽的纳米颗粒及其应用
ES2427854B1 (es) * 2012-03-29 2014-09-15 Universidad De Valladolid Sensores de calcio y métodos para la detección de calcio libre intracelular
HK1220210A1 (zh) * 2013-06-05 2017-04-28 Csl Limited 制备载脂蛋白a-i (apo a-i)的方法
GB201410507D0 (en) * 2014-06-12 2014-07-30 Univ Bath Drug delivery enhancement agents
KR102440820B1 (ko) * 2015-09-08 2022-09-05 테리피온, 인크. ApoA-1 융합 폴리펩티드 및 관련 조성물 및 방법
JP7791715B2 (ja) * 2019-04-05 2025-12-24 韓國セラミック技術院 Csq-タグを用いたタンパク質の発現及び精製方法
FR3100715B1 (fr) * 2019-09-12 2023-09-29 Francais Du Sang Ets Utilisation de HDL dans la prophylaxie de la maladie du greffon contre l’hôte

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987002062A1 (en) 1985-10-04 1987-04-09 Biotechnology Research Partners, Ltd. Recombinant apolipoproteins and methods
WO1987002061A1 (en) 1985-10-03 1987-04-09 Biotechnology Research Partners, Ltd. Novel lipoprotein-based drug-delivery systems
WO1995025786A1 (en) 1994-03-21 1995-09-28 American Cyanamid Company Production of human apolipoprotein a1 in a bacterial expression system
WO1998007751A1 (en) 1996-08-23 1998-02-26 Pharmacia & Upjohn Ab A process for purifying apolipoprotein a or apolipoprotein e from human plasma
WO1998011140A1 (en) 1996-09-11 1998-03-19 Pharmacia & Upjohn Ab A process for purifying apolipoproteins and a composition for use in the process
US5762923A (en) 1995-04-06 1998-06-09 Hoffmann-La Roche Inc. Stabilized interferon alpha solutions
US5766582A (en) 1994-10-11 1998-06-16 Schering Corporation Stable, aqueous alfa interferon solution formulations
WO2000031135A1 (es) 1998-11-24 2000-06-02 Instituto Cientifico Y Tecnologico De Navarra, S.A. PEPTIDOS INHIBIDORES DE TGFβ1
WO2002086091A2 (en) 2001-04-25 2002-10-31 The Regents Of The University Of California Method to treat hemophilia by hepatic gene transfer of factor viii/ix with vesicle vector
WO2004054622A1 (en) 2002-12-13 2004-07-01 Immunomedics, Inc. Immunoconjugates with an intracellularly-cleavable linkage
WO2004073684A2 (en) 2003-02-14 2004-09-02 Children's Hospital & Research Center At Oakland Lipophilic drug delivery vehicle and methods of use thereof
WO2004082720A1 (ja) 2003-03-17 2004-09-30 Beacle Inc. 血友病治療用薬剤及びそれを用いた血友病治療方法
US6809186B1 (en) 1999-01-22 2004-10-26 Martek Biosciences Corporation Simple method for labeled conjugate production
WO2005019244A1 (es) 2003-08-22 2005-03-03 Proyecto De Biomedicina Cima S.L. Péptidos con capacidad de unirse al factor transformante de crecimiento beta 1 (tgf-beta1)
US20050255042A1 (en) 2003-11-24 2005-11-17 The Regents Of The University Of California Office Of Technology Transfer, University Of California On-demand cleavable linkers for radioconjugates for cancer imaging and therapy
WO2006107617A2 (en) 2005-04-06 2006-10-12 Ibc Pharmaceuticals, Inc. Methods for generating stably linked complexes composed of homodimers, homotetramers or dimers of dimers and uses
WO2006135436A2 (en) 2004-10-22 2006-12-21 University Of Florida Research Foundation, Inc. Inhibition of gene expression and therapeutic uses thereof
WO2007021494A2 (en) 2005-08-12 2007-02-22 Human Genome Sciences, Inc. Albumin fusion proteins
WO2007023476A2 (en) 2005-08-26 2007-03-01 Cerenis Therapeutics Holding Sa Compositions and methods for producing apolipoprotein gene products in lactic acid bacteria
WO2007046893A2 (en) 2005-10-19 2007-04-26 Ibc Pharmaceuticals, Inc. Methods for generating bioactive assemblies and uses thereof
WO2007048857A1 (es) 2005-10-24 2007-05-03 Proyecto De Biomedicina Cima, S.L. USO DE PÉPTIDOS INHIBIDORES DE TGF- βl EN LA PREPARACIÓN DE UN AGENTE MODULADOR DE LA RESPUESTA INMUNE
WO2007069090A2 (en) 2005-12-06 2007-06-21 Centre National De La Recherche Scientifique Cell penetrating peptides for intracellular delivery of molecules
WO2007112193A2 (en) 2006-03-23 2007-10-04 Immunomedics, Inc. Camptothecin-binding moiety conjugates
WO2007130873A2 (en) 2006-04-28 2007-11-15 Regents Of The University Of Minnesota Liver-specific nanocapsules and methods of using

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6046166A (en) * 1997-09-29 2000-04-04 Jean-Louis Dasseux Apolipoprotein A-I agonists and their use to treat dyslipidemic disorders
EP1276754A4 (en) * 2000-04-14 2005-04-06 Nuvelo Inc Materials and methods relating to lipid metabolism
AU2008201887B2 (en) * 2000-11-10 2011-06-30 F. Hoffmann-La Roche Ltd. Apolipoprotein analogues
EP1558275A4 (en) * 2002-10-30 2009-06-24 Us Health TARGETING OF B1 (CLA-1) BUTARY RECEPTOR FOR THE TREATMENT OF INFECTION, SEPSIS AND INFLAMMATION
US7431915B2 (en) * 2003-10-31 2008-10-07 The Regents Of The University Of California Peptides whose uptake by cells is controllable
US8097283B2 (en) * 2004-01-15 2012-01-17 Mount Sinai School Of Medicine Methods and compositions for imaging
CA2553955C (en) * 2004-02-10 2012-08-28 Zystor Therapeutics, Inc. Acid alpha-glucosidase and fragments thereof
US20060051859A1 (en) * 2004-09-09 2006-03-09 Yan Fu Long acting human interferon analogs
US20080206142A1 (en) * 2006-06-16 2008-08-28 Lipid Sciences, Inc. Novel Peptides That Promote Lipid Efflux
EP2049560B1 (en) * 2006-07-13 2013-05-15 Novozymes Biopharma DK A/S Process for preparing particles of proteinaceous material
KR100817024B1 (ko) * 2006-11-09 2008-03-26 재단법인 목암생명공학연구소 핵산 또는 약물을 간에 특이적으로 전달하는 복합체 및이를 포함하는 약학적 조성물
US20090110739A1 (en) * 2007-05-15 2009-04-30 University Of North Texas Health Science Center At Forth Worth Targeted cancer chemotherapy using synthetic nanoparticles
WO2009036460A2 (en) * 2007-09-14 2009-03-19 Ambrx, Inc. Modified human apolipoprotein a-i polypeptides and their uses

Patent Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987002061A1 (en) 1985-10-03 1987-04-09 Biotechnology Research Partners, Ltd. Novel lipoprotein-based drug-delivery systems
WO1987002062A1 (en) 1985-10-04 1987-04-09 Biotechnology Research Partners, Ltd. Recombinant apolipoproteins and methods
WO1995025786A1 (en) 1994-03-21 1995-09-28 American Cyanamid Company Production of human apolipoprotein a1 in a bacterial expression system
US5766582A (en) 1994-10-11 1998-06-16 Schering Corporation Stable, aqueous alfa interferon solution formulations
US5762923A (en) 1995-04-06 1998-06-09 Hoffmann-La Roche Inc. Stabilized interferon alpha solutions
WO1998007751A1 (en) 1996-08-23 1998-02-26 Pharmacia & Upjohn Ab A process for purifying apolipoprotein a or apolipoprotein e from human plasma
WO1998011140A1 (en) 1996-09-11 1998-03-19 Pharmacia & Upjohn Ab A process for purifying apolipoproteins and a composition for use in the process
WO2000031135A1 (es) 1998-11-24 2000-06-02 Instituto Cientifico Y Tecnologico De Navarra, S.A. PEPTIDOS INHIBIDORES DE TGFβ1
US6809186B1 (en) 1999-01-22 2004-10-26 Martek Biosciences Corporation Simple method for labeled conjugate production
WO2002086091A2 (en) 2001-04-25 2002-10-31 The Regents Of The University Of California Method to treat hemophilia by hepatic gene transfer of factor viii/ix with vesicle vector
WO2004054622A1 (en) 2002-12-13 2004-07-01 Immunomedics, Inc. Immunoconjugates with an intracellularly-cleavable linkage
WO2004073684A2 (en) 2003-02-14 2004-09-02 Children's Hospital & Research Center At Oakland Lipophilic drug delivery vehicle and methods of use thereof
WO2004082720A1 (ja) 2003-03-17 2004-09-30 Beacle Inc. 血友病治療用薬剤及びそれを用いた血友病治療方法
WO2005019244A1 (es) 2003-08-22 2005-03-03 Proyecto De Biomedicina Cima S.L. Péptidos con capacidad de unirse al factor transformante de crecimiento beta 1 (tgf-beta1)
US20050255042A1 (en) 2003-11-24 2005-11-17 The Regents Of The University Of California Office Of Technology Transfer, University Of California On-demand cleavable linkers for radioconjugates for cancer imaging and therapy
WO2006135436A2 (en) 2004-10-22 2006-12-21 University Of Florida Research Foundation, Inc. Inhibition of gene expression and therapeutic uses thereof
WO2006107617A2 (en) 2005-04-06 2006-10-12 Ibc Pharmaceuticals, Inc. Methods for generating stably linked complexes composed of homodimers, homotetramers or dimers of dimers and uses
WO2007021494A2 (en) 2005-08-12 2007-02-22 Human Genome Sciences, Inc. Albumin fusion proteins
WO2007023476A2 (en) 2005-08-26 2007-03-01 Cerenis Therapeutics Holding Sa Compositions and methods for producing apolipoprotein gene products in lactic acid bacteria
WO2007046893A2 (en) 2005-10-19 2007-04-26 Ibc Pharmaceuticals, Inc. Methods for generating bioactive assemblies and uses thereof
WO2007048857A1 (es) 2005-10-24 2007-05-03 Proyecto De Biomedicina Cima, S.L. USO DE PÉPTIDOS INHIBIDORES DE TGF- βl EN LA PREPARACIÓN DE UN AGENTE MODULADOR DE LA RESPUESTA INMUNE
WO2007069090A2 (en) 2005-12-06 2007-06-21 Centre National De La Recherche Scientifique Cell penetrating peptides for intracellular delivery of molecules
WO2007112193A2 (en) 2006-03-23 2007-10-04 Immunomedics, Inc. Camptothecin-binding moiety conjugates
WO2007130873A2 (en) 2006-04-28 2007-11-15 Regents Of The University Of Minnesota Liver-specific nanocapsules and methods of using

Non-Patent Citations (54)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 2000, WILLIAMS & WILKINS PA
ACTON ET AL., J.BIOL.CHEM., vol. 269, 1994, pages 21003 - 21009
ALTSCHUL, S. ET AL., MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL, S. ET AL.: "BLAST Manual", NCBI NLM NIH
ARBUTHNOT ET AL., HUM.GENETHER., vol. 7, 1996, pages 1503 - 14
BEKISZ ET AL., GROWTH FACTORS, vol. 22, 2004, pages 243 - 251
BLUM ET AL., J. CLIN. INVEST., vol. 60, 1977, pages 795 - 807
BON A. ET AL., NAT. IMMUNOL, vol. 4, 2003, pages 1009 - 1015
BONEN, D.K., J. BIOL. CHEM., vol. 272, 1997, pages 5659 - 67
BORRESEN, A.L.; KINDT, T.J., J. IMMUNOGENET., vol. 5, 1978, pages 5 - 12
BRISSETTE ET AL., PROTEIN EXPR. PURIF., vol. 2, 1991, pages 296 - 303
BRODEUR ET AL., J. BONE MINER RES., vol. 23, 2008, pages 326 - 37
C. FAULI I TRILLO: "Tratado de Farmacia Galenica", 1993, LUZAN 5, S.A. DE EDICIONES
CAI, S. F. ET AL., J. LIPID RES., vol. 42, 2001, pages 902 - 909
EISENBERG, S. ET AL., J.LIPID RES., vol. 14, 1973, pages 446 - 458
ESSERS MA ET AL., NATURE, 11 February 2009 (2009-02-11)
FENG ET AL., PROTEIN. EXPR. PURIF, vol. 46, 2006, pages 337 - 42
FORGEZ, P; CHAPMAN, M.J., J. BIOCHEM. BIOPHYS. METHODS, vol. 6, 1982, pages 283 - 96
GRAVERSEN ET AL., J CARDIOVASC PHARMACOL., vol. 51, 2008, pages 170 - 177
GREIG, N.H. ET AL., J PHARMACOL EXP THER, vol. 245, no. 2, 1988, pages 574 - 80
GREISCHEL, A. ET AL., ARZNEIMITTELFORSCHUNG, vol. 38, no. 10, 1988, pages 1539 - 43
HODGES ET AL., EXP.OPIN.BIOL.THER, vol. 3, 2003, pages 91 - 918
JACKSON ET AL., BIOCHIM BIOPHYS ACTA, vol. 420, 1976, pages 342 - 349
KARASINSKA, J.M. ET AL., J NEUROSCI., vol. 29, no. 11, 2009, pages 3579 - 89
KIM ET AL., MOLECULAR THERAPY, vol. 15, 2007, pages 1145 - 1152
KRAMER ET AL., J.BIOL.CHEM., vol. 267, 1992, pages 18598 - 18604
LE BON A. ET AL., J IMMUNOL., vol. 176, 2006, pages 2074 - 8
LE BON A. ET AL., J. IMMUNOL., vol. 176, 2006, pages 4682 - 4689
LERCH ET AL., VOX SANG, vol. 71, 1996, pages 155 - 164
LINDGREN, A. ET AL., TRENDS PHARMACOL. SCI, vol. 21, 2000, pages 99 - 103
LIU ET AL., GENE THER., vol. 6, 1999, pages 1258 - 1266
LIU ET AL., SCIENCE, vol. 305, 1999, pages 1437 - 1441
LIU, F. ET AL., GENE THER, vol. 6, 1999, pages 1258 - 66
LOU ET AL., WORLD J. GASTROENTEROL., vol. 11, 2005, pages 954 - 959
LUNDBERG, M ET AL., MOL. THERAPY, vol. 8, 2003, pages 143 - 150
MIQUEL ET AL., GUT., vol. 52, 2003, pages 1017 - 1024
MIYATAKE ET AL., J. VIROL, vol. 71, 1997, pages 5124 - 32
MONACO ET AL., EMBO J., vol. 6, 1987, pages 3253 - 3260
MULLER, K.M.; ARNDT, K.M.; ALBER, T., METH. ENZYMOLOGY, vol. 328, 2000, pages 261 - 281
NIELSEN, B.B. ET AL., FEBS LETT., vol. 412, 1997, pages 388 - 396
PACK P.; PLUCKTHUN, A., BIOCHEMISTRY, vol. 31, 1992, pages 1579 - 1584
PESTKA, S.; KRAUSE, C.D.; WALTER, M.R., IMMUNOL REV., vol. 202, 2004, pages 8 - 32
PETSKA ET AL., IMMUNOLOGICAL REVIEWS, vol. 202, 2004, pages 8 - 32
PYLE ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 12046 - 52
RODRIGUEZ-SUREDA ET AL., ANALYTICAL BIOCHEMISTRY, vol. 303, 2002, pages 73 - 77
SAMBROOK; RUSSEL: "Molecular Cloning: to Laboratory manual", COLD SPRING HARBOR
SANDIG ET AL., GENE THER., vol. 3, 1996, pages 1002 - 9
SCHWARZE, S.R. ET AL., TRENDS PHARMACOL. SCI., vol. 21, 2000, pages 45 - 48
SHIOW LR ET AL., NATURE, vol. 440, no. 7083, 2006, pages 540 - 4
SMITH, R.A. ET AL., CLIN PHARMACOL THER., vol. 37, no. 1, 1985, pages 85 - 8
SNYDER, E.L.; DOWDY, S.F., PHARM. RES., vol. 21, 2004, pages 389 - 393
TEMPLETON, DNA CELL BIOL., vol. 21, 2002, pages 857 - 867
WANG, L. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 11563 - 11566
YEH ET AL., ATHEROSCLEROSIS, vol. 161, 2002, pages 95 - 103

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2404611A4 (en) * 2009-03-06 2012-11-21 Digna Biotech Sl Peptide for the prophylactic or therapeutic treatment of skin tumors, in the initial stages
US8658599B2 (en) 2009-03-06 2014-02-25 Digna Biotech, S.L. Peptide for the prophylactic or therapeutic treatment of skin tumors in initial stages
WO2011070214A2 (es) 2009-12-11 2011-06-16 Proyecto De Biomedicina Cima S.L. Conjugados y composiciones para inmunoterapia y tratamiento anti-tumoral
WO2011098644A2 (es) 2010-02-09 2011-08-18 Proyecto De Biomedicina Cima, S.L. Composiciones para el tratamiento de enfermedades infecciosas y tumorales
EP2735874A1 (en) 2012-11-21 2014-05-28 Fundación Para La Investigación Biomédica Del Hospital Universitario Puerta De Hierro Methods of diagnosing and therapeutic agents for use in the treatment of prostate cancer
KR20150139142A (ko) * 2014-06-02 2015-12-11 씨제이제일제당 (주) 반추동물의 메탄 생성 저감용 사료 첨가제 조성물
KR101656929B1 (ko) 2014-06-02 2016-09-13 씨제이제일제당 (주) 반추동물의 메탄 생성 저감용 사료 첨가제 조성물
US11390854B2 (en) 2017-05-09 2022-07-19 Fundacion Para La Investigacion Medica Aplicada Human porphobilinogen deaminase derived proteins and polynucleotides and uses thereof
US20220332763A1 (en) * 2019-08-27 2022-10-20 Nanjing Anji Biological Technology Co., Ltd. Fused polypeptide and use thereof

Also Published As

Publication number Publication date
US20160074475A1 (en) 2016-03-17
CN102123737B (zh) 2014-01-01
JP2015038124A (ja) 2015-02-26
AU2009256547B2 (en) 2014-07-10
BRPI0915093A2 (pt) 2015-10-27
RU2011100801A (ru) 2012-07-20
WO2009150284A3 (es) 2010-12-09
JP2011523857A (ja) 2011-08-25
CA2727811A1 (en) 2009-12-17
MX2010013759A (es) 2011-05-25
EP2305309A2 (en) 2011-04-06
WO2009150284A9 (es) 2011-02-03
AU2009256547A1 (en) 2009-12-17
RU2567667C2 (ru) 2015-11-10
US20110293557A1 (en) 2011-12-01
JP5685529B2 (ja) 2015-03-18
CN102123737A (zh) 2011-07-13

Similar Documents

Publication Publication Date Title
WO2009150284A2 (es) Conjugados de apo-a para la administración de compuestos biológicamente activos
ES2588436T3 (es) Análogos de interferón
ES2463016T3 (es) Conjugados y composiciones para inmunoterapia y tratamiento anti-tumoral
ES2986097T3 (es) Proteínas de fusión de interleucina-2/receptor alfa de interleucina-2 y métodos de uso
ES2883158T3 (es) Composiciones y procedimientos de uso para el tratamiento de trastornos metabólicos
ES2906615T3 (es) Tratamiento derivado de citocinas con síndrome de fuga vascular reducido
JP5734865B2 (ja) 選択性に優れた抗がんキメラペプチド
ES2374166T3 (es) Dominios sushi de il-15ralfa como potenciadores selectivos y eficaces de la acción de il-15 a través de il-15rbeta/gamma, en las prote�?nas de fusión hiperagonistas il15ralfa sushi-il 15.
CN110835376B (zh) 涉及具有强烈降低的受体结合亲和力的细胞因子的融合因子
ES2993464T3 (en) Antibody compositions
EP3473261A1 (en) Biosynthetic proline/alanine random coil polypeptides and their uses
Bansal et al. Interferon gamma peptidomimetic targeted to hepatic stellate cells ameliorates acute and chronic liver fibrosis in vivo
US12577323B2 (en) Compositions and conjugates comprising an interleukin and polypeptides that specifically bind TGF-beta
ES2658309T3 (es) Uso de interleuquina-22 en el tratamiento de la hepatitis viral
ES2690147T3 (es) Apelina pegilada y usos de la misma
ES2938890T3 (es) Proteínas de fusión de VWF glucosiladas con farmacocinética mejorada
ES2844232T3 (es) Factor de Von Willebrand modificado
KR20180089516A (ko) 인터류킨-15 조성물 및 이의 용도
WO2015042521A1 (en) Compositions and methods for treatment of autoimmune and inflammatory diseases and disorders
WO2014057436A2 (en) Anticancer conjugate
BR112013013548B1 (pt) Proteína de fusão anticancerígena
JP2010503680A (ja) ヒトil−18による調節t細胞のモジュレーション
JP2024517518A (ja) マクロファージを標的とするペプチド、ならびにそのコンジュゲート、組成物、および使用
WO2008152508A2 (en) Cytokine conjugate
WO2006073446A9 (en) Peptide-mediated protein transduction into cells the hematopoietic lineage

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980131382.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09761841

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2011513010

Country of ref document: JP

Ref document number: 12997829

Country of ref document: US

Ref document number: 2727811

Country of ref document: CA

Ref document number: MX/A/2010/013759

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 4868/KOLNP/2010

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2009761841

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011100801

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2009256547

Country of ref document: AU

Date of ref document: 20090612

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: PI0915093

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20101213